Modeling Genetic Diseases of Myelin Using Patient-Derived

Home , Soma (biology)

MODELING GENETIC DISEASES OF MYELIN USING PATIENT-DERIVED

INDUCED PLURIPOTENT STEM CELLS

ZACHARY SCOTT NEVIN

Submitted in partial fulfillment of the requirements

for the degree of Doctor of Philosophy

Dissertation Advisor: Paul Joseph Tesar, Ph.D.

Department of Genetics and Genome Sciences

CASE WESTERN RESERVE UNIVERSITY

August 2017

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hearby approve the thesis/dissertation of

ZACHARY SCOTT NEVIN

candidate for the Doctor of Philosophy degree.*

Ronald Conlon, PhD, Committee Chair

Paul Tesar, PhD

Peter Scacheri, PhD

Jerry Silver, PhD

Nancy Bass, MD

June 19, 2017

*We also certify that written approval has been obtained for any proprietary

material contained therein. TABLE OF CONTENTS

LIST OF TABLES 6

LIST OF FIGURES 7

ACKNOWLEDGEMENTS 8

ABSTRACT 9

CHAPTER 1: Introduction to Myelin in Health and Disease 11

The structure and function of myelin in the central nervous system 11

Oligodendrogenesis in mammals 13

Leukodystrophies: genetic diseases of myelin 16

Pelizaeus-Merzbacher Disease 18

Clinical spectrum of PMD 18

Genetics of PMD 20

Myelin proteolipid protein 22

Theories on the pathogenesis of PLP1 mutations 24

Applications of stem cell technologies to myelin disease 28

Applications and limitations of traditional systems for studying PMD 28

Brief history of embryonic and induced pluripotent stem cells 31

Derivation, applications, and challenges of hiPSC-derived

oligodendrocytes 32

CHAPTER 2: Modeling the Mutational and Phenotypic Landscapes of

Pelizaeus-Merzbacher Disease Using Human iPSC-derived

Oligodendrocytes 37

Authors 37

Abstract 37

Introduction 38

Results 42

Assembly, Generation, and Characterization of a Panel of PMD-Derived

hiPSCs 42

Assessment of PLP1 Transcript Dynamics and Defects in hiPSCs 45

Assessment of OPC Production in PMD Cultures 47

Classes of Cellular and Molecular Defects in PMD Oligodendrocytes 48

Mobilization of PLP1 into Oligodendrocyte Processes by Small Molecule

Modulators of Endoplasmic Reticulum Stress Pathways 50

Modulation of ER Stress Phenotypes in Oligodendrocyte-Neuron Co-

Cultures 51

Discussion 53

Methods 60

Generation of hiPSCs 60

DNA Isolation and Analyses 61

RNA Isolation, RNAseq, and Expression and Splicing Analyses 62

OPC and Oligodendrocyte Differentiation 64

Flow Cytometry 66

Small Molecules 68

Oligodendrocyte and Dorsal Root Ganglion Neuron Co-culture 68

Live Cell Imaging 69

Immunocytochemistry 69

Conflicts of Interest 72

Supplemental Data 72

Acknowledgements 72

Author Information 72

CHAPTER 3: Myelinating Oligodendrocytes in 3D Cortical Spheroids

Derived from Human Pluripotent Stem Cells 94

Authors 94

Abstract 94

Results 95

Methods 100

Generation of hiPSCs 100

Cortical Spheroid Differentiation with OPC and Oligodendrocyte

Induction 100

Small Molecules 102

Gene Editing 102

Immunocytochemistry 102

Electron Microscopy

Conflicts of Interest 104

Acknowledgements 104

Author Information 104

CHAPTER 4: Discussion and Future Directions 111

Summary and significance of the current study 111

Studies directly following from results of the current work 112

Applications of new, more efficient protocols for in vitro oligodendrocyte

generation 112

Assessment of PMD oligodendrocyte myelination in vitro using inorganic

microfibers 114

Assessment of PMD oligodendrocyte myelination in vivo using humanized

mice 115

Gene editing strategies for better models of PMD and therapeutics

development 116

Future studies applying iPSC technologies to parse genetic myelin

diseases 118

Combining next generation sequencing with hiPSC platforms for variant

discovery and cellular characterization of clinically undiagnosed

neurogenetic diseases 118

Combining gene editing with hiPSC platforms to probe why disruption of

translation predominantly disrupts myelin development over other

tissues 119

Strategies to model complex tissues through integration of hiPSC-derived

3D cultures 121

In conclusion 122

REFERENCES 124

LIST OF TABLES

Supplemental Table 1. Primers for PLP1 exon sequencing 90

Supplemental Table 2. Prior publications involving PMD samples in this study 91

Supplemental Table 3. Details on control and pluripotent cell lines 92

LIST OF FIGURES

Figure 1.1. Myelin is produced by oligodendrocytes in the central nervous system 12

Figure 1.2. PMD is a heterogeneous disease 19

Figure 1.3. Structure and mutations of PLP1 21

Figure 1.4. Derived oligodendrocytes have defined morphologies in vitro and in vivo 33

Figure 2.1. Genetic Characterization of a Pelizaeus-Merzbacher Disease hiPSC Panel 74

Figure 2.2. RNA Characterization of PMD hiPSCs and PLP1 Transcript Defects 76

Figure 2.3. Differentiation to OPCs Demonstrates PMD Variability 78

Figure 2.4. Classifications of Oligodendrocyte Phenotypes 80

Figure 2.5. Modulation of the ER Stress Response Improves PLP1 perinuclear retention 82

Figure 2.6. Modulation of the ER Stress Response in Oligodendrocytes Co-cultured with DRG Neurons 84

Supplemental Figure 2.1. High Density SNP Microarray Analysis 86

Supplemental Figure 2.2. mRNA Splicing Analysis 88

Figure 3.1. Induction and Proliferation of OPCs 105

Figure 3.2. Maturation of Oligodendrocytes and Expansion by Promyelinating Drugs 107

Figure 3.3. Cortical Organoids Recapitulate Cellular Phenotypes of PMD 109

ACKNOWLEDGEMENTS

Countless people have lent their time, talents, encouragement, and support toward my personal and professional pursuits, which ultimately led to the work presented herein.

First and foremost, I thank my family for their constant love and support.

I thank the many investigators who have sponsored me in their labs as I realized my passion for research.

I thank the MSTP at Case for this amazing opportunity to pursue both research and medicine, to find a niche I love and, hopefully, to have a positive impact on the lives of patients.

I thank my thesis committee for their critical insights and enthusiasm.

I thank the many colleagues who have worked alongside me in lab, shared this great experience, and became friends.

And finally, my heartfelt thanks to my mentor, Dr. Paul Tesar, for helping me develop a tractable set of skills for my future ahead.

Modeling Genetic Diseases of Myelin Using Patient-Derived Induced Pluripotent

Stem Cells

Abstract

ZACHARY SCOTT NEVIN

Myelin is a lipid-rich membrane that wraps, insulates, and provides trophic support to neural axons. Myelin is an essential component of the vertebrate central nervous system, enabling the coordination and propagation of rapid electrical impulses between neurons. Defects of myelin present clinically as a spectrum of motor and cognitive symptoms, and millions of people suffer from severe neurodegenerative diseases caused by myelin impairment, damage, or loss. Acquired myelin disorders of adulthood, such as multiple sclerosis and leukoencephalopathies, are widely recognized and regularly diagnosed. However, there are many lesser known and poorly understood genetic myelin disorders that nonetheless cause devastating disease, predominantly in children. Despite the collective burden of these diseases, basic myelin biology remains poorly understood. Unfortunately, attempts to identify the molecular etiologies of myelin disease, correlate patients’ phenotypes and genotypes, and develop effective therapies have been confounded by the rarity of these diseases, an inaccessibility of primary glial cells, and inadequate animal models. There is a clear need for research into the function and dysfunction of myelin, as well as potential avenues for therapeutic development for genetic myelin diseases.

Pelizaeus-Merzbacher Disease (PMD) is one of these inherited disorders of myelin, collectively known as leukodystrophies. PMD is a devastating disorder of early postnatal onset that occurs when aberrant or insufficient myelin is produced in the brain and spinal cord. Patients present clinically with a range of symptoms and severity, but over 90% of cases of PMD have been linked to mutations in the

X-linked gene proteolipid protein 1 (PLP1). Here, we have generated PMD induced pluripotent stem cells and oligodendrocytes from a panel of 12 patients using a 2D culture system and demonstrate both distinct and convergent cellular phenotypes in patients with various mutations. Moreover, certain defects may be rescued using pharmacologic small molecules. Lastly, we have also generated oligodendrocytes in cortical spheroids, providing a 3D platform for analysis of disease etiology and functional myelin defects. Combining patient-derived iPSCs with directed differentiation of the oligodendrocyte lineage provides a promising new platform with which to interrogate both cell autonomous and system-level deficits of inherited myelin diseases.

CHAPTER 1: Introduction to Myelin in Health and Disease

The structure and function of myelin in the central nervous system

Cells that make up the central nervous system are broadly categorized as either neurons or glia. Neurons have classically be thought of as the primary functional cell of the CNS—synapsing one-to-the-next to form vast, interconnected networks that receive, process, and transmit electrical signals—while glia provide essential, but secondary support. However, glia, which include astrocytes, microglia, and oligodendrocytes, have been shown to constitute up to 90% of the human brain,1 and there is growing appreciation for their multitudinous and nuanced roles.2

Perhaps the most apparent of these roles is the production and maintenance of myelin throughout the brain and spinal cord.

Myelin is a highly-specialized membrane that wrap and insulates neuron axons. In the central nervous system, myelin is produced by glial cells called oligodendrocytes as a contiguous extension from the cell’s own plasma membrane

(Figure 1).3 Concentric layers of myelin compact around axons to form a segmented insulating sheath with a significantly higher lipid to water ratio compared to typical cell plasma membranes.4 Insulation of axons enables rapid, high fidelity propagation of signals via saltatory conduction between gaps, known as nodes of Ranvier, in sequential myelin sheathes, called internodes. Structurally, a single oligodendrocyte may maintain as many as 40 internodes simultaneously, while along a single axon, adjacent internodes may belong to distinct

11 oligodendrocytes.3 Additionally, myelin is not a static structure, but can tune signal propagation by altering the sizes of nodes of Ranvier.5

Figure 1. Myelin is produced by oligodendrocytes in the central nervous system. As oligodendrocytes mature, they extend membrane processes that are rich in lipids and lipoproteins. When these processes contact neural axons, they wrap the axon in concentric layers of membrane called myelin (inset). Compaction of these layers forms a segmental insulating sheath around the axon and allows for saltatory conduction of nerve impulses (squiggles) between nodes of Ranvier. A subpopulation of oligodendrocyte progenitors persists through adult life, suggesting a potential target for regenerative therapies.

In addition to its insulating properties, emerging evidence suggests there is significant crosstalk between myelin sheathes and the axons they wrap.6 This signaling is believed to primarily occur through activity-dependent release of neurotransmitters as the axon is electrically stimulated, and serves to regulate both myelination of exposed axons7; 8 and neural network plasticity and connectivity.9-11

Specifically, axon derived signals have been shown to stimulate exocytosis of metabolites from myelin membranes,12 providing evidence of a direct role of myelin in the local nourishment and maintenance of axons.13-15

Myelin is present throughout the brain, but is particularly dense within specific motor tracts of the cortex, cerebellum, and spinal cord. These structures are

12 collectively termed “white matter” due to the high density of myelin lipids lending them their characteristic color. Structurally, white matter consists of densely- packed myelinated axons, whereas grey matter contains the bulk of neuronal cell bodies interspersed with axons myelinated to a lesser extent. White matter myelin can be as much as two fold thicker than grey matter due to an increased number of wraps per internode.3 Lastly, internode organization and spacing along an axon also varies both by brain region16 and cortical layer.17

Oligodendrogenesis in mammals

Myelin is present in most vertebrates and is structurally similar across all mammals.18 Specification, migration, and maturation of the oligodendrocyte lineage is also highly conserved. As a result, while direct studies in humans are limited, abundant studies in rodents and other mammals provide insight into human oligodendrogenesis.

The oligodendrocyte lineage is generally considered to consist of three functionally and developmentally distinct cell types: precursors, progenitors, and mature oligodendrocytes. Oligodendrocyte precursors are the earliest proliferative cell in the lineage. During patterning of the neural tube during early embryogenesis, competing gradients of sonic hedgehog19 and bone morphogenetic proteins20 are produced by the ventral floor and dorsal roof plates, respectively. These gradients establish neural domains along the neural tube that generate distinct neuron and glial populations. In particular, the pMN domain is believed to generate motor

13 neurons21 and oligodendrocyte precursors,22 based on their shared expression of the transcription factors OLIG2, PAX6, and NKX2.2.23 These precursors proliferate in both the ventral neural tube (ultimately destined for the spinal cord)24; 25 and subventricular zones (destined for the forebrain)22; 26; 27 throughout embryogenesis, eventually maturing to oligodendrocyte progenitors during late fetal and early postnatal development.

Oligodendrocyte progenitors are both proliferative and migratory, populating the entire axis of the central nervous system.28; 29 However, to achieve this, they must balance the contradictory actions of maintaining their potency while simultaneously sensing for cues to differentiate into myelinating oligodendrocytes. Intrinsic

NOTCH signaling and extrinsic neuron signaling are critical to this dichotomy. The ability to differentiate is intrinsic to progenitors, and to some extent stochastic, as demonstrated by culture of purified progenitors in vitro.30 However, the presence of neurons, specifically unmyelinated axons, greatly increases the both the expression of myelin genes and incidence of progenitor differentiation.31; 32 To counteract this, signaling through NOTCH receptors prevents premature maturation as progenitors migrate.33 Presence of the integrin family of extracellular matrix proteins in the cell’s immediate microenvironment also appears to play a role in regulation of this balance. In cultured cells, αvβ1 integrin sustains progenitors’ migratory capacity,34; 35 while αvβ5 integrin increases their propensity to differentiate36 and regulates myelin-axon interactions. 37; 38 Of final note, progenitors are fully capable of migrating throughout all regions of cortical grey

14 matter, however, there is evidence that their intrinsic ability to differentiate is actually limited in more superficial cortical layers.17; 39

Ultimately, mature oligodendrocytes are responsible for generating and maintaining the myelin sheaths characteristic of this cell lineage. However, remarkably little is known about the specific triggers and regulation of process extension and axon contact, and the dynamics of wrapping have only recently been elucidated. Initially, newly differentiated oligodendrocytes may extend hundreds of processes simultaneously in search of unmyelinated axons. Once a process makes contact, it flattens into a paddle-shaped sheet that encircles the axon by growth at the inner tongue, followed by lateral extension of individual layers.40 In addition to supporting the axon, myelination is also essential for oligodendrocyte survival, as oligodendrocytes that fail to make contact will eventually die off through programmed cell death.41

This process of progenitor migration and oligodendrocyte myelination is adaptive and continues throughout childhood and early adult life. A natural history study of myelin turnover in humans by analysis of radioactive carbon half-life determined that a full complement of oligodendrocytes is populated in early childhood, and subsequent cell turnover is 1/300 annually, while myelin membrane itself is continuously exchanged.42 Additionally, a population of progenitors persists throughout adult life, reactivating under certain conditions to reconstitute lost or damaged myelin.

Successful myelination requires tightly regulated timing of cellular migration and maturation, synthesis of large quantities of membrane, localization to specific brain regions, association with specific neural subtypes, and is all conducted in a species-specific manner. This process is so precise that humans can be aged by which neural structures have been myelinated. Moreover, there is mounting evidence that the oligodendrocyte lineage is actually more varied than currently known, with additional subclasses of the three temporal stages,43 adding to the complexity of this system. It is easy to appreciate, then, how even minor disruptions of this process could trigger a cascade of problems developmentally.

Leukodystrophies: genetic diseases of myelin

The leukodystrophies are a class of severe neurodegenerative disorders defined as any primary inherited disease of myelin.44 This includes dysmyelinating (frank failure of myelinogenesis), hypomyelinating (incomplete but stable myelinogensis45), and demyelinating (damage or loss of mature myelin) disorders.

However, the leukodystrophies are distinct from leukoencephalopathies, which are genetic in origin, but where demyelination occurs secondarily to vascular, mitochondrial, or neuronal defects, and other demyelinating diseases that are secondary to immune, viral, toxic, or radiologic insults.46 Individually, the leukodystrophies are rare disorders, but as a class include more than 30 different diseases (reviewed in 47) that collectively have an incidence of 1.3 in 10,000 live births,48 rivaling that of the more common myelin diseases.

Onset of the leukodystrophies is typically during childhood, often in previously healthy children. Patients are phenotypically variable, both between the various leukodystrophies and within individual diagnoses, however, all entail some degree of progressive motor symptoms (particularly spasticity), loss of language skills, and changes in cognition.49 Additionally, patients with mild central deficits are more likely to present with secondary peripheral nervous system involvement, particularly in the hypomyelinating leukodystrophies. Magnetic resonance imaging for changes in or absence of myelin can aid in diagnosis, but clinical findings are not always correlative with observed myelin defects.50 As a result of this ambiguity in symptoms, no specific final diagnosis is determined for 50% of patients.44; 48

The clinical burden of a leukodystrophy is estimated at $59 million annually in the

U.S.51 Yet, medical management is typically the only care option available for most patients.52 In leukodystrophies where an enzyme is mutated, such as metachromatic leukodystrophy (MLD), enzyme replacement therapy may one day be an option. However, to date, replacement of arylsulfatase A enzyme has not shown efficacy in humans.53 Metabolic correction is another avenue to circumvent certain genetic deficiencies. Lorenzo’s oil is one popularly recognized treatment and acts to lower plasma concentration of very-long chain fatty acids in X-linked

ALD (X-ALD). Here however, treatment is dependent on early detection, as efficacy is lost once patients become symptomatic.54 Lastly, bone marrow transplantation has been attempted in X-ALD55 and, anecdotally, Pelizaeus-

Merzbacher disease with a goal of reducing or eliminating the inflammatory

17 sequelae of myelin degeneration. However, transplantation has yet to demonstrate improvement in patient symptoms or arrest of neurodegeneration.

In order to continue to advance care of these patients, it is crucial to develop systems for earlier diagnosis, more robust clinical and cellular phenotyping, and, ultimately, a pipeline for the development of effective therapies.

Pelizaeus-Merzbacher Disease

Clinical spectrum of PMD

Pelizaeus-Merzbacher disease (PMD) is an X-linked leukodystrophy caused by mutations in proteolipid protein 1 (PLP1). First described in 1885,56; 57 PMD is often considered an archetype of the leukodystrophies due to its extreme rarity (between

600 and 1000 patients in the US)48 yet vast clinical heterogeneity (Figure 2).3; 58

Patients with ‘classic’ PMD present with signs of neural degeneration in early childhood, including hypotonia, nystagmus, and/or motor delay progressing to spasticity, ataxia, and/or choreiform movements through adolescence and early adulthood.59-62 Some patients may live into their 7th decade, but complications of hypotonia and spasticity are often fatal in the 3rd decade. In the more severe

‘connatal’ form, symptoms may present as early as 2 weeks postnatally and are often fatal within the first few years of life.59-62 Finally, a small number of male patients, and almost all of the rare female patients, manifest mild, late onset

18 spasticity in the legs or even mild peripheral neuropathies with no CNS presentation, called ‘PLP-null syndrome.63; 64

Figure 2. PMD is a heterogeneous disease. Patients with PMD present across a spectrum of mild to severe disease attributed to hundreds of different mutations in PLP1.

On MRI, patients are universally dysmyelinated, showing either delay in myelination of the major white matter tracks, or frank absence of myelin. Patients’ morbidity, as defined by their functional disability score,65 correlates very closely with the degree of reduction in total white matter. An individual’s clinical outlook is also substantially worse when brainstem involvement is observed.66

Lastly, spastic paraplegia type 2 (SPG2) has many characteristics overlapping with

PMD. Clinically, patients typically present with non-progressive spasticity, without nystagmus, and are more likely to have peripheral axonal neuropathy. With the advent of gene sequencing, it was discovered these patients also possess PLP1 mutations, however typically of a gene silencing variety (i.e. nonsense, partial deletions, etc.).67-70

Genetics of PMD

PLP1 is subject to intriguing genetics. PLP1 is a major component of CNS myelin, constituting 50% of myelin’s protein content and 10% of its total dry weight.3

Despite this, full gene deletions are associated with the mildest disease presentation71-74 and only account for 1% of the patient population.75 Moreover,

PLP1’s amino acid sequence is 100% conserved between humans, mice and rats,74 suggesting it fills an indispensable role in oligodendrocyte biology.

Consistent with this observation, over 200 unique mutations have been identified spanning the full length of PLP1’s coding sequence (Figure 3), and every PLP1 amino acid polymorphism identified in humans to date has been associated with

PMD or SPG2.62; 74; 75 A majority of patients have been identified with duplications of PLP1 (70%). Most present with classic moderate phenotypes, but may present with mild or severe disease due to currently unknown modifiers.69 Point mutations in PLP1 account for 20% of cases and can cause mild, moderate, or severe disease. Mutations in the PLP1-specific region excluded from its splice isoform,

DM20 (discussed below), usually present as mild PMD, but otherwise there are no clear correlations between mutation locus and disease severity.63; 75 Rare triplications,79 partial frameshift deletions, partial in-frame deletions,76 and assorted indels account for an additional 2% of reported PMD cases and are typically on the severe end of the spectrum. The remaining 8% of patients have no identified mutation in either PLP1’s coding or noncoding sequences.74

Figure 3. Structure and mutations of PLP1. PLP1 is the most abundant protein in the myelin membrane. It has one major splice isoform, DM20, created by excision of 35 amino acids in the intracellular loop (purple). A sample of the 200 known point mutations in PLP1 demonstrates little correlation between mutation location and clinical severity.

Myelin proteolipid protein

Mutations of PLP1 have been unequivocally associated with PMD since the late

1980s,77-81 and PLP1 has been recognized as a significant player in myelin biology for significantly longer. Despite this, surprisingly little is known about PLP1’s function in myelin or oligodendrocytes.

As a family, proteolipids (also called ‘lipophilins’) were first identified and named by Folch and Lees in 1951 due to their solubility in organic solvents.82 In addition to myelin proteolipid (the evolutionary homolog of mammalian PLP1), M6a and

M6b proteolipids are expressed in myelinating glia, neurons, heart, kidney, and thymus.83-89 By homology to these proteins, PLP1 is predicted to be a tetraspanin transmembrane protein with four hydrophobic alpha-helices, two extra-cytoplasmic and three cytoplasmic domains (Figure 3).90; 91

In oligodendrocytes, PLP1 has a single splice isoform, DM20, created by a cryptic splice signal in exon 3 and exclusion of the latter 105 nucleotides in that exon

(Figure 3).92 Evolutionarily, DM20 is the ancestral protein, present in bony and cartilaginous fishes, while amphibians generate only PLP, and reptiles, birds, and mammals generate both.93 Splicing of PLP1/DM20 is regulated by alternative recognition of 5’ splice sites due to differential strengths in splice site recognition in oligodendrocyte progenitors versus oligodendrocytes.94-97 Developmentally,

DM20 is the predominant isoform expressed in oligodendrocyte precursors and progenitors. Initial upregulation of PLP1 expression is coincident with OPC migration out of the subventricular zone, but PLP1 has been shown to be dispensable for OPC migration.98 It is not until oligodendrocytes mature and begin

22 producing myelin that PLP1 expression undergoes rapid exponential upregulation.99

Apart from the oligodendrocyte lineage, DM20 mRNA can be found in multiple precursor types embryologically100; 101 and throughout various cell types of the adult peripheral nervous system.102; 103 Ectopic expression of full-length PLP1, however, typically occurs only during fetal and early postnatal periods.104 PLP1 expression in neurons is also typically fetal or early postnatal,88; 89; 105 however, alternatively spliced PLP1 isoforms have been identified in subtypes of adult neurons in the mouse brain.

Functionally, little is known about the roles of PLP1 or DM20. Most theories focus on its presence as tetraspanin protein in the plasma membrane. Shortly after PLP1 was sequenced, it was suggested to have structural similarities to the colonic ion channel A4.106 Although PLP1 is not overwhelmingly homologous to the other proteolipids (56% M6a, 46% M6b), their shared homology also resembles channel- forming domains, but of the glutamate and nicotinic acetylcholine receptors.85; 107;

108 Recently, PLP1 has been shown to complex with αvβ5-integrin to mediate glutamate-sensitive OPC migration.37; 38 This is particularly intriguing as it suggests a mechanism for both targeted migration to unmyelinated axons and differential myelination of white and grey matter. 109 Lastly, it is possible PLP1 is predominantly a myelin-specific structural protein, and any misattributed proliferation or migration effects are simply due to its overabundance and presence in the cell membranes. As mentioned before, deletion of PLP1 results in the mildest symptoms of PMD. However, electron microscopy of PLP1-null myelin

23 ultrastructure reveals super-compaction of the spacing between laminated layers of myelin, potentially suggesting a simple steric role for PLP1 in myelin. In order to parse these hypotheses further, an in vitro method of modelling myelin is necessary to allow observation of the entire process of oligodendrocyte maturation and PLP1 expression.

Theories on the pathogenesis of PLP1 mutations

Over the decades since PLP1 was first linked to PMD, disparate trails of evidence have suggested everything from defects in mRNA splicing to protein folding to protein trafficking may contribute to PLP1 dysfunction, ultimately either destabilizing the myelin membrane or outright killing the oligodendrocyte.

However, without knowing the specific cellular function of PLP1, no unifying model has been established connecting the wide variety of PLP1 mutations with dysmyelination. We hypothesize that there is no all-inclusive cellular pathogenesis that can account for the genetic and clinical heterogeneity observed in PMD.

Rather, subsets of PLP1 mutations likely each disrupt various aspects of PLP1 expression, localization, and function.

Given the tight temporal control of PLP1/DM20 expression during oligodendroglial development, a significant class of mutations have been found to disrupt isoform splicing, causing constitutive expression of either isoform.94; 110; 111 Functionally, transgenic mice that express only DM20 cDNA are able to generate compact myelin with no apparent defects in the extent of myelination throughout the brain,

24 number of lamina per sheath, internode dynamics, or overall quality, yet it still degenerates slowly over the adult life of the animal, albeit without the apparent neuropathy common to other mild cases of PMD.112 Conversely, in the peripheral nervous system, basal expression of PLP1 has been shown to be necessary for the development of functional Schwann cells, while DM20 is completely dispensable.113

Despite its abundance in myelin and strong conservation (100% amino acid identity between humans, rats and mice3; 74), PLP1-null patients have the mildest presentations clinically. Null-syndrome of PMD is typically caused by complete deletion of the PLP1 locus, while other mutations associated with SPG2 phenotype have been shown to cause silencing or rapid degradation of the protein.67-70 As mentioned before, PLP1-null oligodendrocytes are still capable of myelinating nerve axons. However, this myelin is ultra-compacted, suggesting PLP1 presence in the membrane has either a steric impact on spacing of opposed lamina or forms stabilizing junction across the extracellular space.73; 114 Interestingly, whether due to changes in the insulation properties of ultra-compacted myelin or loss of some

PLP1-mediated axonal signaling, myelinated axons in PLP1-null mice have been shown to develop defects in both retrograde and anterograde fast axonal transport.115 OPCs are minimally affected, demonstrating no defects in proliferation or migration, but a slight decrease in the proportion of OPCs that differentiate upon reaching the white matter tracts.98

Oligodendrocyte dysfunction has been clearly shown to be dose dependent on

PLP1 copy number. Patients with duplications typically present as ‘classic’ PMD,

25 with moderate to severe disease, while rare triplication patients present

‘connatally’.74 In the case of PLP1, it is not difficult to imagine how overexpression of such a predominant, membrane-destined protein could overwhelm cellular processing. Overexpressed PLP1 has been shown to be aberrantly trafficked to mitochondria, causing reductions in cellular ATP by up to 50%, increased generation of mitochondria to compensate, and altered extracellular pH.116; 117 In other diseases, such as cystic fibrosis, overexpression of an abundant wild type protein has been shown to cause exponential increase in stochastic protein misfolding in the endoplasmic reticulum. Misfolding of PLP1 has been confirmed using the conformation-sensitive antibody O10,118 ultimately causing retention of

PLP1 in the oligodendrocyte soma,119 activation of the unfolded protein response,120-122 and apoptosis,36; 123 the degree of which is directly related to increasing copy number.124 Contrary to the misfolding hypothesis, there are also limited reports that PLP1 oligomerizes upon reaching the myelin sheath, and that overexpression can cause premature oligomerization in the endoplasmic reticulum

(ER), ultimately still causing ER retention and trafficking dysfunction. 125

Point mutations are the most diverse and least understood class of PLP1 defect.

Mis-splicing and misfolding, either of which can lead to ER retention, stress, and apoptosis, have been clearly implicated in a number of mutations.126-129 Mutations occurring in transmembrane domains are particularly associated with a misfolding pathology, as well as those specifically disrupting either of PLP1’s two cysteine- cysteine disulfide bonds.128 However, for the majority of mutations, pathology cannot be predicted apart from direct observation in mutant cells.

PMD severity has also been linked to mutation-specific pathologies in neurons.

Cerebellar neurons appear to be affected by most PLP1 mutations, possibly explaining why ataxia is more prominent in PMD than other leukodystrophies.130

PLP1 expression has also been demonstrated in medulla neurons during the early postnatal period, suggesting a cause for the disruption of central processing and ventilation seen in some severe ‘connatal’ PMD patients.131-133 Meanwhile, PLP1 deletion appears to predominantly affect hippocampal neurons, duplications affect nigral neurons, and thalamic neurons are sensitive to both duplications and deletions.130

Ultimately, PLP1 is a major component of a highly-specialized membrane, and any changes in expression or trafficking could have critical effects on the composition and fluidity of myelin.134-136 Due to patient variability, results of limited drug trials have not proven generalizable. Chloroquine attenuated ER stress in one HeLa cell transgenic model, but has had no impact on primary cells. 137 Umbilical cord blood transplantation has also been performed in an attempt to address the generalized inflammation associated with neurodegeneration, but these results are inconclusive. 138; 139 Given the surprisingly complex genetics of this monogenic disease, it is unlikely any single pharmacologic agent will prove effective for every patient, and a system for properly categorizing patient pathogenesis is desperately needed.

Applications of stem cell technologies to myelin disease

Applications and limitations of traditional systems for studying PMD

One of the greatest hindrances to prior investigations of myelin-related disorders has been a lack of access to primary patient tissues. Brain biopsies are implicitly dangerous and performed infrequently or post mortem. Even when available, the utility of a biopsy is moot in most genetic myelin disorders because the relevant developmental processes have run their course prior to clinical diagnosis.

Due to the inaccessibility of primary human oligodendrocytes, much of the prior body of PMD literature focuses on animal models with a variety of PLP1 mutations.

Jimpy mice possess a mutation in the exon 5 splice acceptor site, resulting in complete deletion of the exon and subsequent frameshift of terminal residues.78;

140-143 Rumpshaker mice,120; 144-147 myelin-deficient rats,148-151 paralytic tremor rabbits,152; 153 and shaking pups154-157 contain missense mutations in the second extracellular loop, second transmembrane domain, second extracellular domain, and first transmembrane domain, respectively. The jimpy mouse is the source of much of our insight into PLP1 misfolding, endoplasmic reticulum stress, and the unfolded protein response’s involvement in PMD pathogenesis. However, these mice are so severely affected that they die within 20 days. Shaking pup presents a complicated natural history of hypomyelination, as opposed to dysmyelination seen in humans. At the cellular level, pups demonstrate profound cell death during the early postnatal period, but progressively acquire myelin as a subpopulation of oligodendrocytes survives differentiation. Ultimately, shaking pup almost completely recovers myelination in the spinal cord, although the brain remains persistently hypomyelinated.158 In addition, all of these models also present

28 features not observed in human disease, including generalized tremors, early- onset seizures, and extreme changes in total number of oligodendrocytes in the

CNS.147 Lastly, compared to these five models, over 200 unique mutations spanning PLP1’s coding sequence have been identified in PMD patients, of which only the rumpshaker mutation has also been identified in humans.74

In addition to limited point mutation models, duplications have been identified as the major cause of PMD in humans, yet only a few strains of mice have been engineered with supernumerary copies of PLP1. Most of these mice were generated using PLP1 cDNA, which lacks any intronic regulatory elements. Of those generated with a wild type exon-intron complement, the lowest copy number was 4n,124; 159 and all integration events occurred autosomally, so they were not subject to regulatory elements of the endogenous PLP1 locus.124; 160 Only within the past 5 years has a tandem duplication of PLP1 been generated at the endogenous locus.161 These mice present with a primary gait abnormality suggestive of spasticity in human patients and may serve as a better model for appreciating disease pathology and testing potential therapeutics.

Apart from limited mutational relevance, there are also intrinsic species differences between rodent and human in as far as developmental timing of cell generation and myelination, myelin structure, and the oligodendrocyte proteome.162; 163 For these reasons, direct studies in human cells would be preferred. However, not just any cell type is sufficient for PLP1 transgene expression. PLP1 is an integral myelin protein, and myelin is a highly-specialized membrane that is not sufficiently replicated by other cell types. Myelin-independent PLP1 expression and trafficking

29 defects have been modeled to an extent in immortalized cells,74; 164 but ultimately human oligodendrocytes are needed to truly recapitulate PLP1 pathology in vitro.

The advent of induced pluripotent stem cell (iPSC) technologies and cell fate reengineering provides us the first robust methods to generate human oligodendrocytes for molecular and cellular studies in disease-relevant patient- specific cells.165; 166 Moreover, the ability to generate oligodendrocytes at scale enables drug screening of patient lines for personalized therapeutic approaches.

This opens the potential to identify specific populations of PMD patients that respond to certain classes of drugs, and in the very short term, could even lead to repurposing drugs that have already passed FDA approval.

Only two prior studies have been performed in PMD-derived iPSCs. In the first, partial duplication of PLP1 was shown to reduce DM20 expression in the iPSCs themselves.164 While this result is not particularly remarkable, the ability to assess

PLP1 dynamics and splicing directly in iPSCs is promising. PLP1 is not expressed in accessible adult tissues, but iPSCs can be generated from a patient biopsy in as little as 30 days, providing an avenue for rapid initial genotype-phenotype correlation. In the second study, oligodendrocytes derived from two patients with missense mutations identified ER stress as a common pathology.127

These initial studies present a glimpse into power of phenotyping using patient- derived iPSCs. However, in order to fully capture the heterogeneity that is a hallmark of PMD, these efforts will have to be conducted at a much larger scale.

Brief history of embryonic and induced pluripotent stem cells

The realization of cells’ ability to reprogram to a pluripotent state began over sixty years ago with the first demonstration of cloning by somatic cell nuclear transfer of isolated nuclei into denucleated frog eggs.167-169 The isolation and in vitro culture of pluripotent cells from mouse embryos, termed “embryonic stem cells” (ESCs), first occurred in the 1980s, 170; 171 followed by isolation of ESCs from human blastocysts in 1998.172 Shortly thereafter, the ability to control and direct differentiation of human ESCs into defined adult cell types was demonstrated by differentiation of ESCs to neural progenitors.173 The generation of induced pluripotent stem cells, or reprogramming, is a reverse of this process. In 2006,

Takahashi and Yamanaka first demonstrated reprogramming of mouse fibroblasts to iPSCs through the forced expression of embryonic transcription factors.174 The following year, they repeated this with human cells.175; 176 Subsequently, human iPSCs have been generated from a host of other cell types, including blood,177 pancreatic beta cells,178 neural progenitors,179 liver and stomach,180 melanocytes,181 adipocyte progenitors,182 and keratinocytes.183 Although reprogrammed cells should theoretically be equivalently potent in each of these cases, the ability to derive iPSCs from multiple adult tissues opens the door to modeling most conceivable genetic diseases, from germline inherited disorders to somatic cancers.

Derivation, applications, and challenges of hiPSC-derived oligodendrocytes

Generation of human iPSC-induced oligodendrocytes mimics in vivo cell development.165; 166; 184 Pluripotent colonies are first patterned to neuroepithelia expressing OLIG2, NKX2.2, and other markers of the pMN domain of the neural tube. Colonies are then then lifted out of 2D culture and allowed to condense into free floating neurospheres. The size and shape of these spheres serves to establish signaling gradients internally as the cultures are exposed to successive rounds of proliferative and patterning growth factors and small molecules. After initial neurogenesis and OPC specification, spheres are replated on a laminin-rich extracellular matrix that allows outgrowth of neuron axons, followed by migration of successive waves of OPCs. Ultimately, these cultures can be maintained as

OPCs to generate increasing cell numbers, or stimulated with thyroid hormone to induce oligodendrocyte differentiation. In sum total, the best current human protocols take between 70 and 150 days to generate OPCs and oligodendrocytes, respectively.

Figure 4. hiPSC-derived oligodendrocytes have defined morphologies in vitro and in vivo. When cultured in vitro, mature oligodendrocytes are

characterized by their complex web of membrane processes. Shown at left is a super resolution confocal microscopy image of a human stem cell- derived oligodendrocyte stained for PLP1. Individual fluorescent speckles mark PLP1 molecules as they are trafficked through the cell. Shown at right is an electron microscopy cross section of human stem cell-derived myelin wrapping a mouse neuron axon after 12 weeks transplantation in vivo.

The first question to be asked is can these cells myelinate? The second question: what can they myelinate? Surprisingly, in current protocols, oligodendrocytes will not myelinate axons in the cultures from which they are derived. Although motor neurons, which are myelinated in vivo, are also derived from the pMN domain, it has not been established whether the axons that grow out of these neurospheres actually belong to motor neurons. It is equally possible that motor neuron precursors are originally derived, but forced patterning through exposure to high concentrations of oligodendrocyte lineage growth factors disrupts intrinsic pathways in the neurons, changing their identity. Surrogate systems for myelination have been derived, including both isolated neurons and inorganic substrates. Rat dorsal root ganglion neurons, though technically belonging to the peripheral nervous system, are readily myelinated by human oligodendrocytes.185

This system provides the dual benefits of modeling myelination and the trophic support provided by myelin-axon crosstalk. In vivo, oligodendrocytes only myelinate axons, despite the abundance of tube-shaped structures like blood vessels, polarized astrocytes, and other oligodendrocytes’ proceses.186 However, in vitro they appear to be willing to myelinate almost any inorganic substrate so long as it is axon-like in shape and coated with a relevant extracellular matrix.

Micropillars, specially-engineered cones uniformly distributed across a plate, were developed to enable high-throughput microscopy for drug screening for

33 remyelination therapies.187 More recently, electrospun microfibers provide a more exact mimic of axon morphology and can be aligned similar to axons in white matter tracts to easily assess the dynamics and characteristics of internode structure.188 Together, these systems provide insight into oligodendrocytes’ intrinsic capacity for myelination.

To model more physiologically relevant environments, multiple in vivo transplantation and in vitro 3D culture systems have been developed. In vivo, when injected in to the Shiverer mouse model of dysmyelination (a mutation of the second most abundant myelin protein, myelin basic protein), human fetal-derived

OPCs were capable of fully reconstituting myelination of the brain and rescue the mouse.189 Interestingly, chimerization of the wild type mouse brain with human

OPCs also results in replacement of mouse myelin by the human cells,190 further highlighting important interspecies variation.

In vitro, three systems have been developed to model more complex neural tissues, cell-cell interactions, and microenvironments: aggregation, matrix implantation, and organoids. The concept of cellular regeneration and tissue self- organization was first conceived in 1907 after a sea sponge was dissociated, reaggregated, and observed to regrow into a complete organism.191 Similar to this, neurospheres are loose aggregates of neurons and astrocytes with minimal higher structure that are typically employed to measure cellular proliferation.192 Such a system is not likely to be amenable to co-culture with derived oligodendrocytes due to a lack of consistent axon organization. However, neuron aggregates modeling

Alzheimer’s disease have also be grown in beads of Matrigel,193 a laminin-rich

34 extracellular matrix secreted by the Engelbreth-Holm-Swarm tumor line.194 In this context, neuron axons are able to migrate throughout the matrix, providing suitable substrate for oligodendrocyte maturation and wrapping.

Lastly, and most promising, is the field of organoids, 3D in vitro tissues derived from progenitor cells, promoting a propensity towards natural tissue organization, as opposed to arbitrary aggregation. The organoid field derives from embryoid body technologies, where aggregates of stem cells were allowed to undergo spontaneous differentiation (similar to teratoma in vivo).195 Organoids are a progression of this, using defined factors to direct patterning of the developing tissue. Mouse gut was the first tissue to be derived from pluripotent stem cells,196 followed closely by retinal tissue from mouse and human pluripotent stem cells.197;

198 More recently, there has been an explosion in the advancement of cortical organoids, which are patterned similar to the neurospheres stage of 2D cultures, but provide the added benefit of sustained 3D contacts and germinal center-like regional specificity.199 These cortical organoids recapitulate discrete brain regions, including prefrontal lobe, dorsal cortex, ventral cortex, hippocampus, forebrain, choroid plexus,200; 201 self-organize into cortical layers,202-204 execute gene expression and epigenetic programs of fetal neocortex development,205; 206 and model developmental neural expansion, brain folding, and defects leading to microcephaly.201; 207; 208 Most importantly, cortical organoids develop functional neural networks that could provide a novel system for exploring activity dependent myelination. 209 The only glaring omission from current protocols however, is the utter absence of oligodendrocytes.

Together, these 2D, co-culture, and 3D iPSC-based platforms provide the opportunity to model all aspects of oligodendrocyte development and function in a readily accessible in vitro system. Here, we demonstrate the application of these techniques across a panel of PMD patients with unique mutations and variable clinical presentations and suggest a similar approach can be adapted to study many other genetic myelin diseases.

CHAPTER 2: Modeling the Mutational and Phenotypic Landscapes of

Pelizaeus-Merzbacher Disease Using Human iPSC-derived

Oligodendrocytes*

Authors

Zachary S. Nevin,1 Daniel C. Factor,1 Robert T. Karl,1 Panagiotis Douvaras,2

Jeremy Laukka,3 Martha Windrem,4 Steven Goldman,4,5 Valentina Fossati,2 Grace

M. Hobson,6,7,8 Paul J. Tesar1

Abstract

Pelizaeus-Merzbacher Disease (PMD) is a pediatric disease of myelin in the central nervous system that presents with a wide spectrum of clinical severities.

Although PMD is a rare monogenic disease, hundreds of mutations in the X•linked myelin gene proteolipid protein 1 (PLP1) have been identified in humans. Attempts to identify a common pathogenic process underlying PMD have been complicated by an incomplete understanding of PLP1 dysfunction and limited access to primary human oligodendrocytes. To address this, we generated panels of human induced pluripotent stem cells (hiPSCs) and hiPSC-derived oligodendrocytes from twelve

* Chapter 2 is modified from: Nevin ZS, Factor DC, Karl RT, Douvaras P, Laukka J, Windrem MS, Goldman SA, Fossati V, Hobson GM, Tesar PJ. Modeling the Mutational and Phenotypic Landscapes of Pelizaeus- Merzbacher Disease with Human iPSC-Derived Oligodendrocytes. Am J Hum Genet. 2017 Apr 6;100(4):617- 634. Reprinted with permission. ZSN performed all genotyping, cell culture, flow, immunostaining, imaging, and analysis of normalized SNP chip and RNAseq data.

37 children with mutations spanning the genetic and clinical diversity of PMD— including point mutations, duplication, triplication, and deletion of PLP1—and developed an in vitro platform for molecular and cellular characterization of all twelve mutations simultaneously. We identified individual and shared defects in

PLP1 mRNA expression and splicing, oligodendrocyte progenitor development, and oligodendrocyte morphology and capacity for myelination. These observations enabled classification of PMD subgroups by cell-intrinsic phenotypes and identified a subset of mutations for targeted testing of small molecule modulators of the endoplasmic reticulum stress response, with improvement of both morphologic and myelination defects. Collectively, these data provide insights into the pathogeneses of a variety of PLP1 mutations and suggest disparate etiologies of

PMD may require specific treatment approaches for subsets of individuals. More broadly, this study demonstrates the versatility of a hiPSC-based panel spanning the mutational heterogeneity within a single disease and establishes a widely- applicable platform for genotype-phenotype correlation and drug screening in any human myelin disorder.

Introduction

The leukodystrophies are a set of rare genetic disorders characterized by developmental delay and motor impairment due to deficits of myelin, also called

“white matter,” in the central nervous system (CNS).44; 210 Myelin is a highly- structured membrane that ensheathes neuron axons to provide ancillary support

38 and promote proper coordination of electric impulses. Most of the leukodystrophies have an onset in early childhood, and many are fatal. Although individuals are routinely diagnosed by symptoms and genetic testing, most of the leukodystrophies are still poorly understood, and treatment options are largely limited to palliative symptom management.52; 211; 212

Pelizaeus-Merzbacher Disease (PMD [MIM 312080]) is an X-linked leukodystrophy that affects approximately 1000 children in the United States.48; 63;

69; 213; 214 First described in 1885,56; 57 PMD was mapped to the gene proteolipid protein 1 (PLP1 [MIM300401]) in the late 1980s.77-80 PLP1 protein and its splice isoform, DM20, are predominantly expressed by oligodendrocytes—the myelin- producing cell of the CNS—and their progenitors (oligodendrocyte progenitor cells,

OPCs), respectively.215 PLP1 is the major protein component of myelin and has been found to comprise as much as 50% of myelin’s total protein content.3 PLP1’s amino acid composition is 100% conserved between humans, rats and mice,3; 74 there is only a single variant in dogs (p.161V>I), and mutations that cause PMD- like symptoms have been identified in each of these species.147; 150; 216-218 PLP1’s strong cell-type specificity, abundance in myelin, and inter-species conservation all suggest that it fills an indispensable role in oligodendrocyte and myelin biology.

However, PLP1’s function in oligodendrocytes and myelin has only recently begun to be elucidated35; 116; 219; 220 and is still very much in question. As a result, there is no current consensus on the pathogenic processes by which PLP1 mutations cause PMD.

Although PMD is a monogenic disease, affected individuals present with a surprising spectrum of onset, disability, and mortality, which has been grouped into three categories. The common ‘classic’ form presents as a constellation of hypotonia, nystagmus, and/or motor delay in early childhood, with the development of progressive spasticity, ataxia, and/or choreiform movements through adolescence and early adulthood.59-62 Some individuals may live into their 7th decade, but many develop fatal complications of hypotonia and spasticity by their late 20s. In the more severe ‘connatal’ form, symptoms arise early in infancy and are typically fatal within the first few years of life. Lastly, a few males and most of the exceedingly rare females who manifest PMD can develop mild, late onset spasticity in the legs or assorted mild peripheral neuropathies, with minimal CNS deficits.63; 64

This significant clinical heterogeneity has been attributed to hundreds of different mutations of PLP1. A majority of PMD cases (70%) are caused by duplications of the PLP1 locus and present with classic PMD of mild to moderate severity.69 Rare triplications (<1%) cause severe connatal disease, while full gene deletions (1-2%) are associated with mild, late onset symptoms, often termed “null syndrome.”63; 71-

74; 98 Additionally, over 200 unique point mutations have been identified in individuals (25%) presenting across the entire range of mild, moderate, and severe

PMD.74 Point mutations and indels have been found throughout PLP1’s coding sequence, splice sites, and introns. PLP1 has one splice isoform, DM20, created by a cryptic splice signal in exon 3 and exclusion of the latter 105 nucleotides in that exon (exon 3b).92 In the oligodendrocyte lineage, DM20 is the first isoform

40 expressed in developing OPCs, while expression and upregulation of full length

PLP1 occurs coincident with the maturation of OPCs to oligodendrocytes. Of note, mutations in the PLP1-specific region of exon 3 often present as mild PMD.

However, apart from this observation, there are no clear correlations between mutation locus and disease severity.63

This surfeit and variety of human mutations suggests multiple pathogenic processes may be responsible for the diverse manifestations of PMD. In prior literature, five possible molecular defects have been ascribed to certain PLP1 mutations: reduced expression, over expression,119 direct disruption of protein functional domains,35 protein mistrafficking,116; 221; 222 and protein misfolding leading to endoplasmic reticulum (ER) stress.119; 122; 127; 223 The occurrence of these defects individually or in combination likely account for much of the clinical heterogeneity observed in PMD. However, because prior studies have largely focused on mutations one at a time, it is difficult to ascribe any findings to a mutation apart from that in which it was originally observed.

Replicating the efforts of the past 30 years of PMD research for each new PLP1 mutation is a daunting proposition if left to traditional cellular approaches. PLP1 trafficking and membrane dynamics can be modeled to an extent using immortalized cells, but the myelin sheath is a highly specialized membrane that cannot truly be recapitulated apart from oligodendrocytes. Access to primary human oligodendrocytes is severely lacking, however, as brain biopsies are implicitly dangerous and, in the case of developmental myelin disorders, the relevant stages of PMD pathogenesis have already occurred by the time a clinical

41 diagnosis is made, let alone autopsy. As a result, animal models have proven indispensable for in vivo studies of myelin development, but would be prohibitively expensive and time consuming on the scale necessary to span the genetic diversity of PMD.

Instead of attempting to adapt surrogate systems to model PMD heterogeneity, the advent of human induced pluripotent stem cell (hiPSC) and cell fate reengineering technologies now provide us the first robust methods to generate oligodendrocytes for large-scale studies directly in disease-relevant human-derived cells.165; 166 In the current study, we developed a hiPSC-based platform to efficiently model and functionally assess point mutations, duplication, triplication, and deletion of PLP1 across twelve individuals with PMD. We utilized these hiPSCs to generate OPCs and oligodendrocytes from all twelve individuals in parallel for comparative molecular and cellular assessments. These studies establish a framework for the classification of PMD subgroups based on defects observed in disease-relevant cells, inform personalized therapeutics testing, and demonstrate the power of using hiPSC panels to model heterogeneity in a monogenic disease.

Results

Assembly, Generation, and Characterization of a Panel of PMD-Derived hiPSCs

The goal of this study was to establish a platform to assess the developmental, cellular, and molecular defects caused by PMD-relevant PLP1 mutations in

42 human-derived oligodendrocytes. In order to capture the genetic and phenotypic heterogeneity found in PMD, we selected samples for inclusion based on three criteria: type of mutation, distribution of point mutations throughout PLP1, and reported clinical severity. Prior to inclusion in this study, all individuals had been diagnosed with PMD clinically and had PLP1 mutations confirmed by genetic testing. We obtained primary fibroblasts de-identified except for their mutation and clinical severity impression (mild, moderate, or severe) or functional disability score

(ranging from 1-32, with a score of 1 being most severe).65 Our panel ultimately consisted of 12 lines with various PLP1 mutations (Figures 1A and 1B and Table

S2) and 7 normal controls (Table S3).

For two individuals, PMD2 and PMD10, axial T2-weighted MRIs were also available, taken when they were ages 4 and 12, respectively (Figures 1C and 1D).

Both children exhibit diffuse increase in signal intensity in the white matter structures with atrophy of the subcortical white matter. The gross reduction in white matter, particularly in PMD2, has resulted in moderate enlargement of the lateral ventricles. These MRIs are highly representative of children with moderate to severe PMD and demonstrate both the ambiguity and convergence of clinical presentations across people with disparate PLP1 mutations.65; 66; 224

To generate a renewable source of PMD-derived cells, fibroblasts from all 12 individuals were reprogrammed to hiPSCs (see methods). Two independently- derived hiPSC lines per individual were ultimately selected for rigorous characterization. These twenty-four PMD lines (PMD1-12, A and B), along with four hiPSC lines from healthy individuals (NC4-7) and three normal human

43 embryonic stem cell (hESC) lines (NC1-3), constitute the “panel” of 31 pluripotent stem cell lines used throughout the following experiments.

Initially, each line in the panel was rigorously characterized to ensure its identity, pluripotency, and genomic integrity. To first validate the PLP1 point mutations reported for each PMD line, and to confirm no additional mutations were present in any PMD or control line, all seven exons of PLP1 were Sanger sequenced for each line in the panel. PMD7 and 8 were found to contain a nonpathogenic synonymous single nucleotide polymorphism (c.609T>C; p.Asp203=) that is common in the general population (rs1126707, C=22.6%).225 All other lines conformed to the consensus human sequence (RefSeq NM_000533.4).226

Because the process of hiPSC reprogramming can occasionally induce chromosomal defects, copy number variation in each cell line was evaluated at fine resolution using a high density SNP microarray. Comparison of the relative copy number of each SNP confirmed the absence of any gross chromosomal duplications or deletions in all lines (Figures 1E and S1). Furthermore, this resolution allowed delineation of the relative sizes and boundaries of the PLP1 locus duplication, triplication, and deletion in PMD10, 11, and 12, respectively

(Figure 1E, right).

In order to confirm that our cell lines had been completely reprogrammed and retained their pluripotent properties throughout subsequent expansion and characterization, one passage prior to oligodendrocyte differentiation, RNA was isolated from each line, sequenced, and compared against the RNA profiles of

44 primary fibroblasts from which control hiPSCs had been derived. Hierarchical clustering demonstrated close association of all pluripotent lines, with no significant distinction between PMD versus control lines, hiPSCs versus hESCs, or out- grouping of both PMD-derived lines from any single individual (Figure 2B). All pluripotent lines also showed robust and consistent expression of canonical pluripotency markers whose expression correlates with complete reprogramming and acquisition of pluripotent identity (Figure 2C).227 Using this rigorous pipeline, we generated and characterized a diverse panel of hiPSCs to provide a new cellular resource for the study of PMD.

Assessment of PLP1 Transcript Dynamics and Defects in hiPSCs

Endogenous expression of PLP1 and DM20 proteins is restricted to oligodendrocytes and OPCs, respectively. As a result, studies on the effects of specific human mutations on protein structure and expression have previously been limited to post mortem tissue or transgenic overexpression. However, while protein is not translated, DM20 mRNA is robustly transcribed in pluripotent stem cells.164 Serendipitously, this provides an opportunity for rapid assessment of specific transcript defects without the protracted differentiation of oligodendrocytes. To begin to characterize the effects of mutations in our panel, we used our RNAseq dataset to interrogate DM20 mRNA expression and splicing directly in hESCs and hiPSCs (Figure 2A).

Comparison of mRNA transcript levels between control and PMD-derived pluripotent lines provides a glimpse into the effects of copy number variations at the PLP1 locus. Control cultures, both hiPSC and hESC, measured an average

DM20 expression level of 18.1±4.5 FPKM (Figure 2D). Similarly, all point mutations

(PMD1-8) and the partial deletion (PMD9) showed no significant differences in transcript levels, with average FPKMs of 18.1±2.5 and 15.5±1.2, respectively

(Figure 2D). However, PMD10 and 11 expressed DM20 at levels approximately 2- and 3-fold higher than controls (32.7±5.5 and 55.1±1.8, respectively), consistent with their respective duplication and triplication of the PLP1 locus (Figure 2D).

PMD12, the deletion, showed no expression of DM20, as expected (Figure 2D).

In addition to quantification of expression levels, the presence of DM20 mRNA in pluripotent cells also allows for identification of mutation-specific splicing defects.

In all controls, exon 3 terminated at the internal DM20 splice site (exon 3a), indicating only the shorter, OPC-specific isoform is present in pluripotent stem cells

(Figure 2E). This preempts appreciation of any splicing defects in PMD3-5, whose mutations fall in exon 3b and intron 3 (Figure S2). Additionally, PMD1-2, 6, and 10-

12 showed no defects or alternative splicing (Figure S2), but would not particularly be expected to considering the nature of their exon and copy number mutations.

However, splicing analysis in PMD7 and 8, brothers with an intronic mutation outside the canonical splice site, presented complete skipping of the exon preceding their PLP1 mutation (Figure 2E), confirming prior analyses from autopsy tissues.110 Lastly, PMD9, a partial deletion spanning exons 3b, intron 3, and part

46 of exon 4, demonstrated the expected in-frame deletion of the proximal portion of exon 4, and no additional splicing defects were found (Figure 2E).

Assessment of OPC Production in PMD Cultures

We next wanted to determine whether our genetically diverse panel of PMD- derived hiPSCs could be used to garner insights into the clinical variability of PMD in disease-relevant cells (Figure 3A). Our pluripotent stem cell panel was differentiated to OPCs over a 90-day time course using a protocol that recapitulates in vivo neurodevelopmental transitions including patterning of neuroectoderm, ventralization, OPC specification, and OPC proliferation (Figure

3B).184 Differentiation and all subsequent experiments were performed in parallel for all 12 PMD samples (in duplicate using two independently derived hiPSC lines per individual) and 7 controls to enable direct comparison of data and minimize the influence of variables such as reagent lots, ambient conditions, or handling.

Throughout the process of differentiation, cultures were immunostained for markers of key stages in the development of oligodendrocytes. Day 6 immunostaining for the neural lineage transcription factors PAX6 and SOX1 demonstrated efficient induction across both control (95±1.9%) and PMD

(94±1.4%) cultures (Figures 3C and 3D). Day 12 immunostaining for the early glial lineage transcription factors OLIG2 and NKX2.2 also showed strong induction consistent across control (73±9.2%) and PMD (77±2.8%) cultures (Figures 3C and

3E). These data demonstrate that despite the presence of PLP1 mRNA transcripts

47 in hiPSCs, early neurodevelopmental differentiation appears to be unaffected by mutations in PLP1.

Cultures were maintained an additional 11 weeks to allow OPC specification, at which point the cultures were quantified by flow cytometry for the percentage of platelet-derived growth factor receptor alpha (PDGFRA) positive OPCs in each culture.228 The average proportion of PDGFRA+ OPCs was significantly reduced in PMD cultures (24±3.7%) compared to controls (49±3.3%) (Figure 3F). However, while the proportion of OPCs was generally consistent between both hiPSC clones derived from any given individual, there was substantial variability between cultures derived from separate people (Figure 3G). OPC numbers were strikingly reduced in a majority of PMD cultures (PMD2-4,6-8,10-12), while only four cultures

(PMD1, 5, 9, and 11) contained OPCs at proportions comparable to controls.

Intriguingly, PMD3, a mildly affected individual with a synonymous substitution, demonstrated the greatest depletion of OPCs. Similarly, a mildly affected individual with a PLP1 deletion, PMD12, also displayed poor OPC numbers, whereas more severely affected individuals possessing duplication and triplication of PLP1

(PMD10 and PMD11) trended towards normal numbers of OPCs.

Classes of Cellular and Molecular Defects in PMD Oligodendrocytes

We next wanted to determine whether specific defects would manifest as the

OPCs matured into oligodendrocytes (Figure 4A). PMD and control OPCs were induced to mature into pre-myelinating oligodendrocytes, and cell morphology was

48 assessed by immunostaining for O4 antigen (an early oligodendrocyte-specific surface sulfatide) and PLP1 (using a C-terminal antibody that defines a more mature oligodendrocyte stage). A typical wild type oligodendrocyte generated in cell culture has a readily identifiable morphology consisting of a round, central cell body with multiple branching processes extending symmetrically outward that lend the oligodendrocyte a spider-in-a-web-like appearance (Figure 4B, “Controls”).

We made two major observations in these cultures. First, despite OPC deficits, most PMD cultures were still capable of producing oligodendrocytes (except PMD5 and 11). However, all PMD-derived oligodendrocytes were noticeably defective

(Figure 4B). In order to elucidate the defects in these cells, we developed a machine learning-based algorithm using PerkinElmer Harmony High-Content

Imaging and Analysis software to trace and measure oligodendrocyte processes and identify branch points (Figure 4C). In PMD oligodendrocytes, total process length was significantly reduced compared to controls (Figure 4D). Although PMD and control oligodendrocytes extended a similar number of primary processes from the cell body (Figure 4E), the number of distal process branches was severely reduced (Figure 4F). Interestingly, oligodendrocytes of PMD12, the full PLP1 deletion with a mild phenotype, demonstrated both the highest average and widest range of total process length and branches (Figures 4B, 4D, and 4F). Collectively, these data suggest that PMD oligodendrocytes suffer either a PLP1-induced defect of process extension and branching or a non-specific arrest of maturation due to general disruption of cellular homeostasis. Time lapse imaging of maturing PMD2

49 and PMD10 cultures captured oligodendrocytes producing short processes that fail to extend or branch distally, ultimately resulting in cell death (Movies S1A-C).

In addition to these shared cellular defects, two molecular defects were observed in subsets of the PMD hiPSC-derived oligodendrocytes. First, in the majority of the cultures (PMD1, 3-4, 7-9, and 12), O4-positive oligodendrocytes were present, but

PLP1 expression was not detectable (Figure 4B). This was expected for PMD12, a complete PLP1 deletion, but not the additional cultures that fail to mature to a

PLP1+ stage. Interestingly, although the individual with the PLP1 deletion has a mild phenotype, other cultures which fail to express PLP1 were derived from individuals presenting with some of the most severe clinical presentations of the panel (Figure 1B). Second, in PMD2, 6, and 10, cells matured to a PLP1+ stage, however PLP1 signal was completely restricted to the perinuclear region of the cell body, with no signal evident in the processes (Figure 4B).

Mobilization of PLP1 into Oligodendrocyte Processes by Small Molecule

Perinuclear retention of a misfolded protein is a hallmark of endoplasmic reticulum stress. Our comparative hiPSC panel identified that only a subgroup of PMD cultures (PMD2, 6, and 10) exhibit perinuclear retention of PLP1, so we selected

PMD2 and 10, individuals with genetically distinct point and duplication mutations, to explore strategies to modulate the ER stress response (Figure 5A).

We tested two small molecules that specifically inhibit or enhance the ER stress response. GSK2656157 is a recently described inhibitor of protein kinase R-like endoplasmic reticulum kinase (PERK), which senses misfolded proteins and initiates a response to ER stress.229 Guanabenz is an inhibitor of the protein phosphatase 1 regulatory subunit GADD34, which allows normal cellular functions to recommence once the stressor has been resolved.230

We assessed the effects of GSK2656157 and guanabenz on oligodendrocyte cultures from control NC2 and PLP1 mutants PMD2 and 10. PMD10 oligodendrocytes demonstrated remarkable restoration of cell morphology under both conditions (Figures 5B and 5C). PMD2, however, showed modest mobilization of PLP1 into cell processes when treated with GSK2656157, but had no response to guanabenz (Figures 5B and 5C). Neither small molecule caused appreciable changes in the morphology of control NC2 cells.

Modulation of ER Stress Phenotypes in Oligodendrocyte-Neuron Co-Cultures

Oligodendrocytes in vivo do not exist in a state of homogenous, monolayer culture, and phenotyping in this system, while exceptional for identifying cell-intrinsic deficits, does not capture defects of myelination. In order to create a more physiologically-relevant model of the defects caused by PLP1 mutations, we adapted a protocol for co-culturing human oligodendrocytes on rat dorsal root ganglion neurons (Figure 6A)231 to assess oligodendrocyte maturation, axonal tracking, and ensheathment (in vitro “myelination”). In these conditions, control

51 oligodendrocytes extend processes that search out and travel along individual neuron axons (Figure 6B), forming long linear tracts, as opposed to the branching, web-like morphology seen in monoculture. PLP1 signal is present throughout the cell, including the cell body, processes, and tracts. Meanwhile, myelin basic protein

(MBP), a structural protein in the myelin sheath, is restricted to the cell body and tracts, identifying regions in the early stages of myelination.

NC2, PMD2, and PMD10 oligodendrocytes were seeded onto neurons in basal medium supplemented with GSK2656157 or guanabenz. Similar to monocultures, untreated PMD2 oligodendrocytes showed prominent PLP1 perinuclear retention, with no PLP1 immunofluorescence in the processes (Figure 6C, top). Meanwhile,

MBP immunofluorescence delineated the entirety of the oligodendrocytes, including extensive, matted processes, but showed no tracking with neurons

(Figure 6C, bottom). Interestingly, GSK2656157-treated PMD2 oligodendrocytes did not show mobilization of PLP1 into the processes as they had in monoculture

(Figure 6D, top). Despite this, the process matting seen in MBP largely resolved, and short lengths of tracking were clearly visible (Figure 6D, bottom). On the other hand, guanabenz promoted a degree of PLP1 mobilization into oligodendrocyte processes (Figure 6E, top), but did not resolve the MBP matting to the same extent as GSK2656157 (Figure 6E, bottom).

Untreated PMD10 oligodendrocytes recapitulated the PLP1 perinuclear retention observed in monoculture (Figure 6F, top), but MBP immunofluorescence was present throughout the processes instead of being restricted to defined tracts

(Figure 6F, bottom). Where present, tracts were also shorter than controls.

Treatment with GSK2656157 completely restored PLP1 mobilization into processes (Figure 6G, top), but did not improve MBP signal or tracking over untreated conditions (Figure 6G, bottom). Guanabenz, however, drastically increased PLP1 mobilization into processes, rescued MBP fluorescence intensity, and increased the prevalence of tracts, although they were still less prevalent and shorter than controls (Figure 6H).

Discussion

Historically, PMD has been a challenging disease to parse. Affected individuals present across a spectrum of disease severity, with no direct links between an individual’s unique PLP1 mutation and the etiology or course of their disease. The inaccessibility of primary oligodendrocytes severely limits direct studies in humans, while the hundreds of different PLP1 mutations linked to PMD would be prohibitively expensive and time consuming to model in animals. In this study, taking advantage of natural mutational diversity and recent advancements in hiPSC-based disease modeling, we demonstrated the feasibility of generating, differentiating, and assessing a panel of hiPSCs that captures the full spectrum of

PMD’s clinical and genetic heterogeneity. We characterized hiPSCs, OPCs, and oligodendrocytes from twelve individuals with PMD and identified shared and individual defects spanning PLP1 expression, PLP1 splicing, OPC production, oligodendrocyte morphology, and response to small molecule therapeutics.

Although PLP1 protein is restricted to the oligodendrocyte lineage, DM20 mRNA is robustly transcribed in pluripotent cells,164 providing an opportunity for rapid assessment of mutation-specific transcript defects in a scalable, homogenous population of cells. DM20, the OPC-specific isoform of PLP1, the sole isoform expressed in hiPSCs, which limited our ability to interpret the effects of mutations in the PLP1-specific region of exon 3b. However, we were interested to discover that, while neither the point mutations nor the partial deletion showed any effect on

DM20 expression levels, the duplication and triplication showed 2- and 3-fold higher expression than controls. Given the fact that PLP1 in a normal hemizygous individual constitutes as much as 50% of myelin’s total protein, we speculate this linear relationship between copy number and mRNA expression could lead to excess protein abundance in oligodendrocytes of individuals with supernumerary copies of PLP1. This linear trend has not been reported previously in animals.161

However, those studies were performed on whole brain tissue, wherein OPCs are but a small fraction of the total cell population. Alternately, when protein is actually translated in OPCs and oligodendrocytes, it is possible PLP1’s overabundance triggers a degree of feedback regulation that we cannot appreciate in hiPSCs.

The presence of DM20 mRNA also enables analysis of splicing and structural defects in hiPSCs. Importantly, whereas protein levels vary by cell-type and can only be inferred from hiPSC studies, splicing defects have a direct and immutable impact on protein structure across cell types. We confirmed a prior report of PLP1 exon 6 skipping caused by a mutation of the +3 nucleotide of intron 5.110 Skipping of exon 6 causes an in-frame deletion of 22 amino acids, including part of PLP1’s

54 putative fourth transmembrane domain. Next, we demonstrated that our partial deletion causes an in-frame fusion of exon 3a to the distal portion of exon 4, with no additional mis-splicing or decrease in expression. Similarly, we found that a mutation at the +750 nucleotide of intron 3 does not appear to affect splicing or expression in hiPSCs. Collectively, mRNA analysis in hiPSCs provides a rapid and minimally-invasive means to identify convergent structural and expression defects caused by disparate PLP1 mutations. As more mutations are characterized, this approach could eventually allow subgrouping of mutations by mRNA defect and aid in predicting individuals’ prognoses.

Differentiating hiPSCs to OPCs provides the first insights into cell-intrinsic pathologic consequences of disparate PLP1 mutations. While we anticipated certain mutations could lead to an OPC defect, we were surprised that two-thirds of the PMD cultures were severely depleted of OPCs. Based on prior imaging and pathology studies, PMD has traditionally been considered a disease of myelin production and structure, and thus predominantly a defect of oligodendrocytes.3

Our findings contradict this generalization, suggesting that for at least a subset of individuals with PMD, there is a precedent defect at the OPC stage that would limit subsequent oligodendrocyte production, and thus preempt myelination. Of particular note, mutations within the PLP1-specific region of exon 3b (e.g. PMD3 and PMD4) would not be expected to manifest in OPCs, due to the predicted expression of the DM20 splice isoform. Yet here, PMD3 cultures were some of the most severely depleted in the entire panel. This apparent paradox would have been difficult to appreciate without the ability to directly compare against the

55 spectrum of other PMD-derived cultures. It is important to acknowledge that this single time point is not sufficient to discern whether relative reductions in OPCs are due to a block of proliferation, failure of migration out of neurospheres, premature cell maturation and loss of the PDGFRA marker, or outright cell death.

Nonetheless, our collective results suggest prevalent, OPC-intrinsic defects strongly contribute to phenotypic variability. Most importantly, these findings suggest that future therapeutic development may necessitate earlier intervention than previously appreciated.

Based on simultaneous comparative phenotyping of the twelve individuals in our panel, we identified three distinct classes of cellular defects in PMD-derived oligodendrocytes: failure to produce oligodendrocytes, failure to produce PLP1- positive oligodendrocytes, and perinuclear retention of PLP1. A point mutation in intron 3 and a PLP1 triplication were the only cultures that did not generate any

O4+ or PLP1+ oligodendrocytes, despite these cultures having generated robust numbers of OPCs previously. This could be due to either a block in the maturation of OPCs to oligodendrocytes or rapid death of newly formed oligodendrocytes as

PLP1 production is upregulated. Of the remaining cultures, oligodendrocytes were either O4+ /PLP1- or O4+/PLP1+, but the PLP1 signal was completely retained perinuclearly. Perinuclear localization is a hallmark of protein misfolding and endoplasmic reticulum retention and has previously been demonstrated in vitro in two human oligodendrocyte lines with PLP1 point mutations, one of which corresponds with our PMD6 mutation.127 Additionally, across both these categories, all oligodendrocytes presented with severe defects of process

56 extension and branching. The function of PLP1 has not been fully established.

However, PLP1 has been implicated in both OPC migration35 and as a bridge between the membrane and cytoskeleton.232 It is possible that, in the absence of

PLP1, cell processes become insensitive to stimuli that would normally trigger them to extend. Similarly, observed deficits in distal branching may be secondary to failed process extension, or result from loss of PLP1’s structural cytoskeletal support. Identification of a mutation where cells extend processes that are of normal length, but completely unbranched could elucidate this further. Ultimately, the fact that an individual’s mutation and clinical presentation alone were not predictive of their cellular phenotype highlights the power of this platform to categorize disparate PLP1 mutations, enabling the development of PMD subgroup-specific prognoses and therapeutic plans.

The genetic breakdown of our perinuclear retention cohort was intriguing because it contained a mutation of a proline in an extracellular loop, a mutation of a leucine in a transmembrane domain, and a full PLP1 duplication. Prior studies in animal and human models have implicated endoplasmic reticulum stress as a pathogenic result of particular PLP1 mutations,36; 126-129; 233 but the larger PMD community has struggled to leverage these findings to treat the general PMD population. We suspect this is due to intrinsic differences in the types of mutations being targeted.

To address this, we treated our duplication and transmembrane point mutations with two small molecules that modulate ER stress in two completely opposite manners. GSK2656157, a newly described PERK inhibitor, targets the initiation of the pathway, averting the negative downstream effects of a continuous ER stress

57 response, particularly apoptosis. At the other end, guanabenz, a GADD34 inhibitor, deliberately prolongs the stress response, maintaining expression of molecular chaperones to promote clearance of misfolded protein aggregates. The point mutation and duplication responded variably to these two approaches. In the case of the duplication, both inhibiting and enhancing the ER stress pathway had a drastic positive effect, relieving the stress sufficiently for oligodendrocytes to reestablish normal morphologies. The point mutation, however, contains a gain- of-function mutation that shows only partial response to inhibition of ER stress, and no response to enhanced refolding. It is possible that this mutation is simply refractory to refolding. However, since PLP1 can be observed mobilizing into the processes with GSK2656157 treatment, yet the cells do not fully recover morphologically, it is more likely the position of this mutation disrupts either membrane integration or a functional domain of PLP1. Further characterization and titration of GSK2656157 will provide a foundation for assessment of this and other small molecule therapeutics for personalized applications in the future.

The neuron-oligodendrocyte co-culture system provides a model of the endogenous structural environment that influences oligodendrocyte and myelin biology in the brain, providing additional insight into the nuances of PMD pathogenesis. Using this in vitro system, we demonstrated that individual PMD phenotypes can be modulated to restore oligodendrocyte morphology and axonal tracking. As opposed to our initial monoculture system, there were more appreciable differences between PMD oligodendrocytes’ responses to

GSK2656157 and guanabenz in the co-culture system. It was interesting to

58 observe that untreated cells’ morphologies were improved in this system, presumably due to supportive factors released by the neurons that are absent from our media conditions and less frequent passaging and the extrinsic stress that entails. The transmembrane point mutation again demonstrated improvement of cell morphology when the ER stress response was completely shut down by

GSK2656157, but nonetheless could not associate with neurons. This further confirms that ER stress exacerbates the pathogenesis of this mutation, but persistence of the mutation itself prevents true functional restoration by

GSK2656157 alone. On the other hand, the duplication showed a dramatic response when the ER stress response was prolonged by guanabenz.

Presumably, while inhibition of ER stress leaves misfolded protein stuck in the endoplasmic reticulum, the prolonged action of chaperones and other protective molecules triggered by ER stress promotes folding and mobilization of PLP1 to its ultimate destination in the emerging myelin sheath.

Since their first report a decade ago, human induced pluripotent stem cells have been transformed into a multitude of different cell types, providing invaluable insights into human health and disease. hiPSC technologies are a particular boon to the study of PMD and other leukodystrophies, obviating many of the challenges that have previously limited our ability to model and investigate oligodendrocyte dysfunction. Using hiPSC technologies, we can now generate the entire oligodendrocyte lineage in the laboratory, model the full progression of disease pathology, and observe pathogenesis in real time. Importantly, many of the defects we report here could not have been predicted by individuals’ clinical histories or

59 mutations alone. However, characterization of these defects across all samples in parallel enabled identification of distinct subclasses of cellular and molecular pathogeneses that now link disparate PLP1 mutations. We hope this work will serve as a foundation for the assessment of oligodendrocyte dysfunction throughout the greater community of genetic myelin diseases.

Methods

Generation of hiPSCs

Skin fibroblast samples, de-identified except for mutation and clinical severity, were obtained from Coriell (PMD6), James Garbern, and GMH. Prior to receipt, fibroblasts had been isolated from skin biopsies, cultured for 1-7 passages, and frozen. Upon receipt, samples were assigned arbitrary identifications (PMD1 through 12) pursuant to statutes for exempt human subjects research outlined by

Case Western Reserve University’s IRB. In preparation for hiPSC generation, fibroblasts were thawed, expanded for 2 passages, and tested mycoplasma-free. hiPSCs were generated using standard approaches, including either a floxed polycistronic lentivirus (hSTEMCCA) expressing the pluripotency factors OCT3/4,

SOX2, KLF4, and c-MYC (PMD1-4, 6, 8-10)234 or non-integrating episomal vectors expressing OCT3/4, SOX2, KLF4, L-MYC, LIN28, and a p53 shRNA (PMD5, 7,

11-12;).235 At least three independent hiPSC colonies were selected for clonal expansion based on colony morphology and OCT3/4 immunocytochemistry.

Clones were subsequently split 1:6 every four or five days until sufficiently expanded to collect DNA and RNA and freeze down stocks.

Two independent clonal lines derived from each PMD sample were ultimately selected for further characterization and inclusion in these studies. Seven control human pluripotent lines (designated “NC”) were also included: three approved human embryonic stem cell (hESC) lines from the NIH hESC Registry (NC1, “H1”

NIHhESC-10-0043; NC2, “H7” NIHhESC-10-0061; NC3, “H9” NIHhESC-10-

0062)172 and four in-house derived hiPSC lines from healthy donors (NC4-7).

DNA Isolation and Analyses

Genomic DNA was extracted from each pluripotent cell line either one or two passages prior to initiation of the oligodendrocyte differentiation protocol (see below) using the Qiagen DNeasy Blood & Tissue Kit (Qiagen #69504). Isolation was performed following the manufacturer’s protocol for cultured cells (July 2006

Handbook).

For Sanger sequencing of the PLP1 coding sequence, individual PCR primer pairs were designed to encompass each exon of PLP1 using NCBI Primer-BLAST

(Table S1). Each exon was amplified using KAPA HiFi HotStart ReadyMix (Roche

#07958935001) at the manufacturer’s suggested reaction concentrations and cycling conditions, with an annealing temperature of 61°C, extension time of 15 seconds, and 30 cycles. PCR products were purified using the QIAquick PCR

Purification Kit (Qiagen #28104) and sequenced at the Case Western Reserve

University Genomics Core facility. Reported PLP1 mutations were validated in

PMD samples, and all sequences were compared against the consensus human sequence (GRCh37/hg19).

High density whole genome SNP genotyping was performed using the Illumina

Infinium Omni5 DNA Analysis BeadChip. Log R values were adjusted with the genomic.wave.pl program within PennCNV.236 Ordered Log R values of every coordinate were plotted to visualize any large-scale copy number variations present in each line.

For clonal confirmation and future disambiguation, cell line identity was established and confirmed by STR-based DNA fingerprinting in fibroblasts and derived hiPSC lines, as well as control pluripotent lines (Cell Line Genetics).

RNA Isolation, RNAseq, and Expression and Splicing Analyses

Pluripotent cells were collected for RNA isolation concurrent with initial passaging for oligodendrocyte differentiation (see below). 500,000 cells were pelleted at

1200rpm for 4 minutes, resuspended in 1mL TRIzol (ThermoFisher #15596026), and immediately frozen at -80°C. Total RNA was isolated using the Qiagen

RNeasy Mini Kit (Qiagen #74104), with minor modifications to the beginning of the manufacturer’s protocol (“Purification of Total RNA from Animal Cells using Spin

Technology,” 4th Edition, June 2012 Handbook). Briefly, cells in TRIzol were

62 thawed on ice, vortexed until homogenous, and incubated at room temperature for

5 minutes. 200ul chloroform was added and mixed vigorously. The sample was transferred to PhaseLock gel tubes (5 Prime #2302830), incubated at room temperature for 3 minutes, and then centrifuged at 12,000 x g for 15 minutes at

4°C. The aqueous phase was collected and 1.5 volumes of 100% ethanol was added and mixed thoroughly. The sample was then transferred to an RNeasy Mini column and the remainder of the protocol was followed as written, including the recommended DNase digest.

To generate the cDNA library for RNAseq, 1ug of each sample was rRNA depleted

(Ribo-Zero Gold, Illumina #MRZG12324), fragmented, and indexed using the

TruSeq Stranded mRNA Library Preparation Kit (Illumina #RS-122-2103) per the manufacturer’s protocol. One hundred base-pair paired-end reads were generated for each sample using an Illumina HiSeq 2500 at the Case Western Reserve

University Genomics Core facility. Output FASTQ files were aligned to the

GRCh37/hg19 genome using Tophat (Version 2.0.8) with default settings.237 Data was normalized and fragments per kilobase per million reads (FPKM) were calculated for known RefSeq genes using Cufflinks (Version 2.0.2).238 Using the heatmap.2 function of the gplots R package, Pearson’s Correlation Distance was calculated to compare transcriptome similarities between individual cell lines. To analyze PLP1 mRNA splicing, aligned BAM files were loaded into Integrated

Genomics Viewer (Version 2.3.68 (97)) and visualized using the sashimi plot function. Raw RNA-seq datasets are available at the NCBI Gene Expression

Omnibus (GEO) under accession number GSE96049.

OPC and Oligodendrocyte Differentiation

Differentiation of OPCs and oligodendrocytes was performed on two independently-derived hiPSC clones for each of the 12 PMD samples (n=2 biological replicates per mutation) and 3 hESC and 4 hiPSC normal controls (n=7 biological replicates identical in PLP1 sequence). The entire panel of 31 lines was differentiated simultaneously, with two technical replicates per line.

OPCs and oligodendrocytes were generated from pluripotent cells using a pre- publication version of the Douvaras et al 2014 protocol.165; 184 Minor variations from the published protocol are noted here.

Immediately prior to differentiation, cells were incubated in 10uM Y-27632, dissociated using collagenase and dispase, and plated at 200,000 cells per

9.5cm^2 Matrigel-coated well in mTeSR1 medium and 10uM Y-27632. Cells were cultured for two days, changing mTeSR1 each day. Differentiation (protocol day 0) was begun the third day after passaging and was conducted as follows:

Day 0-7: Cells underwent daily complete media changes of DMEM/F12 (Gibco

#11320-033), 1x high-insulin N2 supplement (R&D Systems #AR009), 10uM

SB431542 (SB, Stemgent #04-0010), 250nM LDN189193 (LDN, Stemgent #04-

0074), 100nM all-trans retinoic acid (RA, Sigma #R2625), and 5U/ml PenStrep.

Day 8-11: Cells underwent daily complete medium changes of DMEM/F12, 1x low-insulin N2 supplement (N2, LifeTechnologies #17502048), 100nM RA, 1uM smoothened agonist (SAG, EMD Millipore #566660), and 5U/ml PenStrep.

Day 12-19: On day 12, cells were manually lifted with a cell scraper, broken into approximately 10- to 50-cell clusters, and plated into ultra-low attachment plates

(Corning #3471) to promote formation of free-floating neurospheres. Spheres underwent every other day 2/3 medium changes of DMEM/F12, 1x N2, 1x B27 supplement without vitamin A (B27, LifeTechnologies #12587010), 100nM RA,

1uM SAG, and 5U/ml PenStrep.

Day 20-30: Cells underwent every other day 2/3 medium changes of DMEM/F12,

1x N2, 1x B27, 10ng/ml platelet-derived growth factor (PDGF, R&D Systems #221-

AA), 10ng/ml insulin-like growth factor 1 (IGF, R&D Systems #291-G1), 5ng/ml hepatocyte growth factor (HGF, R&D Systems #294-HG), 10ng/ml Neurotrophin-3

(NT3, EMD Millipore #GF031), 60ng/ml 3,3’,5-Triiodothronine (T3, Sigma #T2877),

100ng/ml biotin (Sigma #4639), 1uM cyclic-AMP (cAMP, Sigma #D0260), 25ug/ml insulin (Sigma #I9278), and 5U/ml PenStrep.

Day 30-60: On day 30, neurospheres were plated onto 0.1mg/ml poly-L-ornithine-

(Sigma #P3655) and 10ug/ml laminin-coated (Sigma #L2020) 9.5cm^2 plates and allowed to attach. Cells underwent every other day 2/3 medium changes of

DMEM/F12, 1x N2, 1x B27, 10ng/ml PDGF, 10ng/ml IGF, 5ng/ml HGF, 10ng/ml

NT3, 60ng/ml T3, 100ng/ml biotin, 1uM cAMP, 25ug/ml insulin, and 5U/ml

PenStrep.

After Day 60, cultures could either be maintained in PDGF-containing medium to promote OPC proliferation, or transitioned to growth factor free (PDGF-, IGF-,

HGF-) medium to allow further differentiation of oligodendrocytes.

For oligodendrocyte phenotyping of the entire panel in Figure 4: Day 96, cultures were dissociated with Accutase (Innovative Cell Technologies #AT-104) for 40 minutes and split 1:6 into 96-well poly-D-lysine Visiplates (PerkinElmer #1450-605) pre-incubated for 1 hour with 10ug/ml laminin. Cells underwent every other day 2/3 medium changes of DMEM/F12, 1x N2, 1x B27, 10ng/ml NT3, 60ng/ml T3,

100ng/ml biotin, 1uM cAMP, 25ug/ml insulin, and 5U/ml PenStrep.

For oligodendrocyte differentiation of NC2, PMD2, and PMD10 for time-lapse imaging (Supplemental Movies), small molecule testing (Figure 5), and neuron co- culture (Figure 6), differentiation was repeated as above through Day 60. After Day

60, cultures were transitioned to every third day 2/3 medium changes of

DMEM/F12, 1x N2, 1x B27, 60ng/ml T3, 100ng/ml biotin, 1uM cAMP, 25ug/ml insulin, 10mM HEPES sodium salt (Sigma #H3784), 20ug/ml L-ascorbic acid

(Sigma #A4544), and 5U/ml PenStrep.

Flow Cytometry

OPC differentiation cultures were incubated in pre-warmed Accutase for 40 minutes at 37°C until cells lifted off the plate. Lifted cultures were diluted with

DMEM/F12 supplemented with 1% bovine serum albumin (BSA, Gibco #15260-

037) and gently pipetted with a 1000ul capacity tip to dissociate cells that had grown out from neurospheres without shearing the OPCs. The spheres themselves remained intact and were removed and discarded. Remaining single cells were counted and centrifuged at 200 x g for 5 minutes at room temperature. Cells were resuspended at up to 10x10^6 cells per 100ul in DMEM/F12 supplemented with

5% donkey serum and PE-conjugated anti-PDGFRA (CD140a, 1:50, BD

Biosciences #556002) and incubated on ice for 45 minutes. Cells were washed three times with DMEM/F12 supplemented with 1% BSA, centrifuged at 200 x g for 5 minutes at room temperature, resuspended in 100ul DMEM/F12 supplemented with 5% donkey serum and APC-conjugated anti-A2B5 (1:11,

Miltenyi #130093582), and incubated on ice for 45 minutes. Cells were washed three times with DMEM/F12+ 1%BSA, centrifuged at 200 x g for 5 minutes at room temperature, resuspended in 500ul DMEM/F12, 1x N2, 1x B27, 10ng/ml PDGF,

10ng/ml IGF, 5ng/ml HGF, 10ng/ml NT3, 60ng/ml T3, 100ng/ml biotin, 1uM cAMP,

25ug/ml insulin, and 5U/ml PenStrep, and filtered through a cell strainer. Cells were flowed using a 100um nozzle on a FACS-Aria (BD Biosciences) at 25p.s.i. and 1500-1800 events per second. 10,000 events were recorded. Data were analyzed using WinList 3D (Version 7.0). Initial debris and doublet gates were set using unstained NC2-derived cultures, and validated against unstained NC6- derived cultures. Gates were set based on side scatter (SSC-A) versus forward scatter (FSC-A) to distinguish live cells from dead cells and debris, then side scatter width (SSC-W) versus height (SSC-H) to exclude cell doublets. A bona fide,

CD140a+ OPC population was initially gated based on immunostained NC2-

67 derived cultures, validated against the remaining 6 immunostained control cultures, and only then used to evaluate the number of derived OPCs in each PMD culture.

Small Molecules

GSK2656157 (EMD Millipore #5046510001) 10mM stock solution in DMSO was prepared, aliquoted, and stored at -20°C. Guanabenz (Tocris Bioscience #0885)

20mM stock solution in DMSO was prepared, aliquoted, and stored at -20°C. Small molecules were warmed to 37°C for 20 minutes before adding to pre-warmed medium. Frozen aliquots were thawed no more than twice before being discarded.

During treatments, every three days, cells underwent a 2/3 medium change that included either 100nM GSK2656157, 1uM GSK2656157, or 2.5uM guanabenz.

Oligodendrocyte and Dorsal Root Ganglion Neuron Co-culture

24-well Visiplates (PerkinElmer #1450-605) were pre-incubated with 125ul rat tail collagen and allowed to air dry for 72 hours. 50,000 DRGs231 were plated in 100ul of M1 medium (MEM [Gibco #11095-080], 10% FBS, 2% glucose [Sigma #G7528]) with 100ng/ml NGF (R&D Systems #556-NG) and 5U/ml PenStrep in the center of the well, bubbles were added using a p100 pipette, and DRGs were allowed to attach for 24 hours at 37°C. The next day, wells were flooded with 500ul E2F medium (MEM, 2% glucose, 1x N2 supplement, 245ng/ml FDU [Sigma #F0503],

245ng/ml uridine [Sigma #U3003]) with 100ng/ml NGF and 5U/ml PenStrep.

Medium was changed every second or third day thereafter (M1/NGF/PenStrep on days 3, 7, 11, 14, and 17; E2F/NGF/PenStrep on days 5 and 9). On day 20, one half of a 9.5cm^2 well of differentiating OPC cultures was seeded onto DRGs in

DMEM/F12, 1x N2, 1x B27, and 5U/ml PenStrep. Medium was changed every other day for 20 days then fixed for immunostaining.

Live Cell Imaging

Cultures of NC2, PMD2, and PMD10 OPCs were differentiated to oligodendrocytes over the course of 20 days as specified above. On day 20, cultures were dissociated and plated onto 0.1mg/ml poly-L-ornithine- and 10ug/ml laminin- coated 4cm^2 plates at low density (split 1-to-6 by surface area) to permit observation of individual cells. The next day, cultures were transferred to a humidity, temperature, and CO2-controlled chamber on an inverted microscope

(Leica DMI6000) for phase imaging. Regions of interest were identified manually and marked using Leica Application Suite X software, after which they were automatically imaged every 10 minutes for the next 60 hours. Static image series were stitched into a movie using Windows Movie Maker (Microsoft Corporation,

Version 2012).

Immunocytochemistry

Cultures for immunocytochemistry were initially fixed with 4% ice-cold paraformaldehyde for 15 minutes.

O4 immunostaining was performed on live cells prior to fixation. O4 antibody supernatant was added to cultures and incubated for 30 minutes at 37°C. Wells were washed 3 times with room temperature DMEM/F12, then immediately fixed.

Additional immunostaining was performed as below.

Monolayer cell cultures (e.g. hiPSCs, OPCs) were permeabilized with 0.2%

TritonX for 10 minutes at room temperature, blocked in 10% donkey serum in PBS for 1 hour at room temperature, incubated in primary antibody in blocking buffer for 1 hour at room temperature (typically) or overnight at 4°C (for PLP1 [AA3] antibody only), washed three times with PBS, incubated in secondary antibody in blocking buffer for 45 minutes at room temperature, washed three times (with DAPI in the first wash to visualize nuclei, when used), and imaged using a Operetta High-

Content Imaging System with Harmony Analysis Software (PerkinElmer

#HH12000000) and standard fluorescence settings.

DRG co-cultures to be immunostained for PLP1 were permeabilized with 10%

TritonX for 30 minutes at room temperature, washed three times with PBS, blocked in 5% donkey serum and 0.1% TritonX in PBS for 1 hour at room temperature, incubated in PLP1 antibody in blocking buffer overnight at 4°C, then incubated in neurofilament (NF) and SOX10 antibodies in blocking buffer for 1 hour at room temperature, washed three times with PBS, incubated in secondary antibodies in blocking buffer for 45 minutes at room temperature, washed three times, and

70 imaged using an inverted fluorescence microscope (Leica DM IL LED), 12-bit monochrome camera (QImaging #QIC-F-M-12-C), and QCapture Pro imaging software (QImaging, Version 6.0.0.605).

DRG co-cultures to be immunostained for MBP were washed 3 times in PBS, permeabilized with 100% ice-cold methanol for 30 minutes at -20°C, washed three times with PBS, blocked in 5% donkey serum and 0.1% TritonX in PBS for 1 hour at room temperature, incubated in MBP, NF, and SOX10 antibodies in 2% donkey serum and 0.1% saponin overnight at 4°C, washed three times with PBS, incubated in secondary antibodies in 10% donkey serum and 0.1% TritonX for one hour at room temperature, washed three times, and imaged as above.

Primary antibodies: mouse-anti-O4 (1:10 unconcentrated supernatant, generously provided by Bruce Trapp, Robert Miller, and Wendy Macklin); OCT3/4 (400ng/ml,

Santa Cruz #SC-5279); Pax6 (6.67ug/ml, Covance #PRB-278P); SOX1 (1ug/ml,

R&D Systems #AF3369); OLIG2 (1:1000, Millipore #AB9610); NKX2.2 (1:100,

Developmental Studies Hybridoma Bank #74.5A5); rat-anti-PLP1 (1:100, AA3, generously provided by Bruce Trapp); rat-anti-MBP (1:100, Abcam #AB7349); goat-anti-SOX10 (2ug/ml, R&D Systems #AF2864); mouse-anti-pan-axonal neurofilament (NF, 1:1000, Covance #SMI311); mouse-anti-pan-neuronal neurofilament (NF, 500ng/ml, Covance #SMI312); DAPI (1ug/ml, Sigma #D8417).

All secondary antibodies were LifeTechnologies AlexaFluor conjugated secondary antibodies used at a dilution of 1:500.

Conflicts of Interest

P.J.T. is on the scientific advisory board of Cell Line Genetics.

Supplemental Data

Supplemental Data include 2 figures, 3 tables, and 3 movies.

Acknowledgements

This research was supported by grants from: the Pelizaeus-Merzbacher Disease

Foundation (P.J.T. and G.M.H.); the NIH R01NS093357 (P.J.T. and M.W.); the

New York Stem Cell Foundation (P.J.T. and V.F.); the NIH R01NS058978

(G.M.H.); and NIH predoctoral training grants T32GM007250 (Z.S.N.) and

F30HD084167 (Z.S.N.). P.D. is a NYSCF-Druckenmiller fellow. Additional support was provided by the Cytometry & Imaging Microscopy and Genomics core facilities of the Case Comprehensive Cancer Center (P30CA043703). We are grateful to the late James Garbern for providing PMD samples, Leslie Cooperman, Elizabeth

Shick, and William Qu for technical assistance, and Peter Scacheri, Anthony

Wynshaw-Boris, Nancy Bass, Marius Wernig, and the Tesar Lab for discussion and comments on the manuscript.

Author Information

1Department of Genetics and Genome Sciences, Case Western Reserve

University School of Medicine, Cleveland, Ohio 44106, USA.

2The New York Stem Cell Foundation Research Institute, New York, New York

10032, USA.

3Departments of Neurology and Neuroscience, University of Toledo, College of

Medicine and Life Science, Toledo, Ohio 43614, USA.

4Center for Translational Neuromedicine, University of Rochester Medical Center,

Rochester, New York 14642, USA.

5Center for Translational Neuroscience, University of Copenhagen Faculty of

Health Sciences, 2200 Copenhagen, Denmark.

6Nemours Biomedical Research, Alfred I. duPont Hospital for Children,

Wilmington, Delaware 19803, USA.

7Department of Biological Sciences, University of Delaware, Newark, Delaware

19716, USA.

8Department of Pediatrics, Jefferson Medical College, Thomas Jefferson

University Philadelphia, Pennsylvania, 19107, USA.

Figure 1. Genetic Characterization of a Pelizaeus-Merzbacher Disease hiPSC Panel

(A) A schematic of PLP1 and the twelve mutations included in this study. Full- length PLP1 consists of seven exons (black and grey bars), while its splice isoform, DM20, results from exclusion of the PLP1-specific domain (blue bar). Both isoforms contain four putative transmembrane domains (striped bars). The locations of individual mutations are indicated as lollipop plots (point mutations) or bars (partial deletion and copy number variants). Relative clinical severities are indicated by color (green = mild, yellow = moderate, red = severe).

(B) Individuals were selected for this study with the intent to maximize genetic and phenotypic diversity. Clinical severities had been previously assessed and reported by functional disability score (FDS) and/or clinical impression. Skin fibroblasts were reprogrammed to hiPSCs using either a lentiviral or episomal construct. Two independently-derived clonal hiPSC lines were selected for characterization and inclusion in subsequent studies. PLP1 mutations were confirmed by Sanger sequencing of each hiPSC line.

(C) T2-weighted MRI of PMD2, taken at age 4, demonstrating increased signal intensity throughout white matter structures and enlargement of the lateral ventricles.

(D) T2-weighted MRI of PMD10, taken at age 10, demonstrating increased signal intensity and distinct atrophy of white matter structures.

(E) Plots demonstrating the gross genomic integrity of derived pluripotent lines. Relative copy number was calculated for each SNP in a high density SNP microarray and plotted as a normalized Log R Ratio. (Left) Plots of every 100th SNP, arranged by ranked genomic coordinate and colored by chromosome. NC1 (male) and NC2 (female) demonstrate the relative enrichment of the X chromosome in NC2. (Right Top) Plots of each SNP within a 2 megabase region surrounding the PLP1 locus on the X chromosome, arranged by relative genomic coordinate. For PMD10, 11, and 12, the SNP array delineates the region of chromosome X duplicated, triplicated, and deleted, respectively. (Right Bottom) A Sanger sequencing trace showing the T-to-G substitution found in PMD2.

Figure 2. RNA Characterization of PMD hiPSCs and PLP1 Transcript Defects

(A) A schematic of the major cell types derived in this study, the stereotypic morphologic appearance of each cell type when cultured in vitro, some of the insights these cells can provide, and the figure(s) in which they feature.

(B) Dendrogram depicting hierarchical clustering analysis of stranded RNAseq. RNA was isolated from each pluripotent line one passage prior to initiation of the OPC differentiation protocol and compared against RNA isolated from primary fibroblasts corresponding to NC5-7.

(C) A heat map depicting the FPKM of canonical pluripotency genes and PLP1 across all PMD hiPSCs, normal controls, and primary fibroblasts corresponding to NC5-7.

(D) A bar graph comparing levels of PLP1 mRNA expression in hiPSCs between various PMD cultures and controls. (*, p = 0.0134; **, p = 0.0017; ***, p < 0.0001)

(E) Sashimi plots of RNAseq transcripts aligning to the PLP1 locus (GRCh37/hg19) quantify PLP1/DM20 mRNA splicing events. Numeric labels indicate the number of quality-filtered transcripts (sequencing depth) that span the indicated exon-exon junction. Exclusion of the distal portion of PLP1 exon 3 (dotted vertical line) in control transcripts indicates that DM20 is the solely expressed isoform in pluripotent cells. PMD7 and 8 demonstrate skipping of exon 6 (white arrowheads). The exon 3-4 junction cannot be annotated in PMD9 (black arrowhead) due to its partial deletion, which spans the PLP1-specific region of exon 3 and proximal portion of exon 4.

Figure 3. Differentiation to OPCs Demonstrates PMD Variability

(A) Schematic of the experimental stage, OPC morphology, and insights presented in this figure.

(B) Overview of the timeline, small molecules, and growth factors used to generate OPCs and oligodendrocytes.

(C) Representative immunofluorescence images comparing stage-specific transcription factors in PMD and control cultures at day 6 (immunostained for neural lineage markers PAX6 and SOX1) and day 12 (immunostained for glial lineage markers OLIG2 and NKX2.2) of the differentiation protocol. Scale bars = 25um.

(D) Quantification of the percent of PAX6-positive cells double-positive for SOX1 as of 6 days in culture. Shown here are the averages of all controls (n=7) versus all PMD lines (n=24, including n=2 biologic replicates per PMD line). Two independently-differentiated wells per line were immunostained (n=2 technical replicates). Error bars indicate standard error of the mean. No significant difference was found between control and PMD.

(E) Quantification of the percent of OLIG2-positive cells double-positive for NKX2.2 as of 12 days in culture. Shown here are the averages of all controls (n=7) versus all PMD lines (n=24, including n=2 biologic replicates per PMD line). Two

78 independently-differentiated wells per line were immunostained (n=2 technical replicates). Error bars indicate standard error of the mean. No significant difference was found between control and PMD.

(F) Day 93 cultures were immunostained for the OPC-specific marker PDGFRA and counted by flow cytometry. Shown here are the averages of all controls (n=7) versus all PMD lines (n=24, including n=2 biologic replicates per PMD line). One well per line was counted (n=1 technical replicate). Error bars indicate standard error of the mean. (*, p = 0.0016)

(G) The same results from figure 3F, plotted here as individual controls versus the average of both hiPSC lines derived from a given PMD sample. PMD results are rank ordered by average number of OPCs and colored to indicate clinical severity (green = mild, yellow = moderate, red = severe).

Figure 4. Classifications of Oligodendrocyte Phenotypes

(A) Schematic of the experimental stage, oligodendrocyte morphology, and insights presented in this figure.

(B) OPCs from one line per PMD sample (n=1 biologic replicate) were differentiated to oligodendrocytes (n=2 technical replicates) and immunostained for oligodendrocyte markers O4, SOX10, and PLP1. Shown here are representative images from each culture. PMD5 and 11 failed to produce any O4- positive cells. PMD2, 6, and 10 demonstrated perinuclear retention of PLP1. The remaining lines produced O4-positive cells, but failed to produce a PLP1-signal. Scale bars = 25um.

(C) A representative immunofluorescence image of an O4-positive oligodendrocyte from the NC2 control line (left) and a trace of its processes (right) generated using an oligodendrocyte identification, tracing, and quantification algorithm derived with the PerkinElmer Harmony software. White circles highlight examples of “roots” where processes contact the cell body. White arrows indicate examples of individual “segments” between process branch points.

(D) The processes of O4-positive oligodendrocytes were traced and measured using a machine learning algorithm derived in-house. Total process length was calculated as an average across individually measured oligodendrocytes. Error bars indicate standard error of the mean.

(E) Junctions of the oligodendrocyte cell body and extending processes were identified and counted using the tracing algorithm. The total number of roots was calculated as an average across individually traced oligodendrocytes. No significant difference was found between controls and PMD lines. Error bars indicate standard error of the mean.

(F) Segments, defined as a linear portion of process between any two intersections (branches) in the trace, were identified and counted using the tracing algorithm. The total number of segments was calculated as an averaged across individually traced oligodendrocytes. Error bars indicate standard error of the mean.

Figure 5. Modulation of the ER Stress Response Improves PLP1 perinuclear retention

(A) Schematic of the experimental stage, oligodendrocyte morphology, and insights presented in this figure.

(B) Representative images of oligodendrocytes after 28 days of treatment with 1uM GSK2656157 (n=2 technical replicates) and immunostained for O4, SOX10, and PLP1. Note the rescue of PLP1 distribution in treated PMD2-derived oligodendrocytes and improvement of oligodendrocyte morphology in PMD10. Scale bars = 25um.

(C) Representative images of oligodendrocytes after 35 days of treatment with 2.5uM guanabenz (n=2 technical replicates) and immunostained for O4, SOX10, and PLP1. Note the improvement of cell morphology in PMD10-derived oligodendrocytes, but not PMD2. Note also, untreated PMD10 cells here, compared to Figure 4B, demonstrate PLP1 diffusing throughout the cell body in addition to intense perinuclear signal. This appears to be due to a longer period of culture between passaging and immunostaining, possibly allowing the cells a degree of recovery from the added extrinsic stress of passaging. Scale bars = 25um.

Figure 6. Modulation of the ER Stress Response in Oligodendrocytes Co- cultured with DRG Neurons

(A) Schematic of the experimental stage, oligodendrocyte morphology, and insights presented in this figure.

(B) Representative images of untreated NC2 oligodendrocytes demonstrating the two distinct morphologies appreciable in co-culture by immunostaining with PLP1

84 versus MBP. PLP1 signal marks the oligodendrocyte cell body, processes, and early tracts extending along neurons (white arrowheads). MBP signal is restricted to the tracts, and is indicative of early axonal ensheathement. Scale bars = 50um.

(C-E) Representative PLP1 (top) and MBP (bottom) immunofluorescence images of PMD2 oligodendrocytes co-cultured with neurons and treated with 100nM GSK2656157 or 2.5uM guanabenz (n=2 technical replicates). Note the rescue of MBP-positive cell processes’ morphology when treated with GSK26157. Scale bars = 25um.

(F-H) Representative PLP1 (top) and MBP (bottom) immunofluorescence images of PMD10 oligodendrocytes co-cultured with neurons and treated with 100nM GSK2656157 or 2.5uM guanabenz (n=2 technical replicates). Note the rescue of PLP1 distribution in treated oligodendrocytes. White arrowheads depict tracts of myelin along neuronal axons. Scale bars = 25um.

Supplemental Figure 1. High Density SNP Microarray Analysis

The remainder of the lines not included in Main Figure 1E. Plots demonstrating the gross genomic integrity of derived pluripotent lines. Relative copy number was calculated for each SNP in a high density SNP microarray. Every 100th SNP, arranged by ranked genomic coordinate, was plotted as a Log R Ratio. SNPs are colored by chromosome.

Supplemental Figure 2. mRNA Splicing Analysis

The remainder of the lines not included in Main Figure 2E. PLP1 mRNA splicing was quantified in PMD hiPSCs and controls using Integrated Genome Viewer’s Sashimi plot function. PMD7 and 8 demonstrate skipping of exon 6 (white arrowheads). The exon 3-4 junction cannot be annotated in PMD9 (black arrowhead) due to its partial deletion. For comparison, splicing analysis of day 154 differentiated NC2 mixed OPCs and oligodendrocytes is also provided, demonstrating the presence of both DM20 and PLP1 transcripts.

Supplemental Table 1. Primers for PLP1 exon sequencing.

PLP1 Exon Forward Primer Reverse Primer 1 AAAGCGAAATTCCAGGCAAGC GATAGAGGGAAGTGAGGGGGT 2 AAGGATTCTGGGTCAATCTCACA CACAGAGGGAAGACTCGGGA 3 TGGCGGGAGGGGCATATGTTTC AGACTCGCGCCCAATTTTCCCC 4 GGCTTTGTTCAATGGCTAGGG GTGGGTAGGAGAGCCAAAGC 5 GGCCATTCACATTGGCCTAC TCTATGCTCATTGGCTCAGGC 6 CTGGGCACAACTGTAGGGAAC GCCAATGCAAGTAGAAGTACGG 7 TCCCTGAGGAAAACTCAGTGC GCAGGAACCAGCTATGAAGCA 3-4 Fusion in PMD9 TTCTCCAGGTCCCAGGGTAAG AGTGCTTCCATAGTGGGTAGGA

Supplemental Table 2. Prior publications involving PMD samples in this study.

Sample Citation(s) PMD1 65 PMD2 65 PMD3 PMD4 94 PMD5 239 PMD6 80; 240 65; 110; 122; PMD7/8 (siblings) 241 PMD9 76 PMD10 65 PMD11 PMD12 65; 71

Supplemental Table 3. Details on control and pluripotent cell lines.

Panel ID Cell Type NIH Registry ID Reprogramming Method Gender NC1 hESC H1 -- Male NC2 hESC H7 -- Female NC3 hESC H9 -- Female NC4 hiPSC -- Episomal Male NC5 hiPSC -- Lentiviral Male NC6 hiPSC -- Lentiviral Female NC7 hiPSC -- Lentiviral Male

Supplemental Movie A. Time Lapse of NC2 Oligodendrocytes.

Oligodendrocytes were differentiated from NC2 OPCs over the course of 20 days, then passaged at low density to allow imaging of individual cells every 10 minutes for 60 hours.

Supplemental Movie B. Time Lapse of PMD2 Oligodendrocytes.

Oligodendrocytes were differentiated from PMD2 OPCs over the course of 20 days, then passaged at low density to allow imaging of individual cells every 10 minutes for 60 hours.

Supplemental Movie C. Time Lapse of PMD10 Oligodendrocytes.

Oligodendrocytes were differentiated from PMD10 OPCs over the course of 20 days, then passaged at low density to allow imaging of individual cells every 10 minutes for 60 hours.

CHAPTER 3: Induction of Oligodendrocytes in Human Cortical Spheroids†

Authors

Mayur Madhavan,1* Zachary S. Nevin,1* Elizabeth Shick,1 Kevin Allan,1 Paul J.

Tesar1

*These authors contributed equally to this work.

Abstract

Human cortical spheroids provide a novel system in which to examine the generation, self-organization, and interactions of neurons and astrocytes during early development of the cerebral cortex. However, oligodendrocytes, the myelinating glia of the central nervous system and third major cell type of cortical origin, are conspicuously absent from current protocols. Here we present a simple method to expand endogenous progenitor populations and generate PLP1 and

CC1-positive oligodendrocytes in human stem cell-derived spheroids.

Oligodendrocyte maturation can be enhanced by exposure to the promyelinating drugs ketoconazole and miconazole. Furthermore, spheroids generated from individuals with Pelizaeus-Merzbacher disease due to PLP1 mutations display

† Chapter 3 is currently in preparation for submission. A modified version of this chapter may eventually appear in print. ZSN and MM co-designed experiments and analyzed results ; ZSN performed a majority of the cell culture.

94 nuances in oligodendrocyte-intrinsic defects not previously captured in 2D cultures. This 3D, multi-lineage system provides a versatile platform to observe and perturb the complex cellular interactions that occur during developmental myelination of the brain and offers new opportunities for disease modeling and therapeutics testing in human tissue.

Results

Recent advances in the generation of 3D tissues in vitro are changing how we study human development and disease. Human stem cell-derived 3D cultures— frequently called “organoids” or “spheroids”—generate cell types from multiple cell lineages that recapitulate complex cell-cell interactions, microenvironments, and tissue architectures that are otherwise lost in traditional 2D cultures. Multiple groups have developed protocols to model the coordinated rounds of cell proliferation, migration, and maturation required to properly pattern the cerebral cortex. These stem cell-derived cortical spheroids have been shown to generate multiple cortical cell types—including neural progenitors, multiple neuron subtypes, and astrocytes—self-organize into distinct cortical layers, and establish functional neural synapses.200; 201; 203; 207; 209; 242; 243 Additionally, single cell analyses of cortical spheroids derived using two distinct protocols have identified transcriptional profiles suggesting the presence of limited populations of oligodendrocyte progenitor cells (OPCs).200; 209 However, after as many as 6 months in culture, no protocol has yet demonstrated the production and maturation

95 of oligodendrocytes, the myelinating glia of the central nervous system and final major cell type of cortical origin. Oligodendrocytes play a critical role in motor, sensory, and cognitive function, producing a lipid-rich membrane that ensheathes neural axons to allow for high-fidelity propagation of electric signals while also providing trophic support to neurons.244 Here, we establish a platform to expand the spontaneous OPC populations that arise in current cortical spheroid protocols, stimulate the maturation of OPCs to oligodendrocytes, and model patient-specific oligodendrocyte defects in the genetic myelin disorder Pelizaeus-Merzbacher

Disease (PMD).

Our protocol expands on that of Pasca et al,242 which generates neurons, astrocytes, and small populations of OPCs. Briefly, after the proscribed 50 days of cell proliferation and patterning, we expose cortical spheroids to platelet-derived growth factor (PDGF) and insulin-like growth factor-1 (IGF-1) to stimulate OPC proliferation, followed by thyroid hormone (T3) to induce oligodendrocyte maturation (Figures 1A-E). To control for inter-line variability, we initially replicated spheroid differentiation using two human embryonic cell lines (H7 and H9) and two in-house derived human induced pluripotent cell lines (hiPSC1 and hiPSC2).

At day 45, prior to OPC expansion, multiple distinct germinal centers could be appreciated within patterned spheroids both by light (Figure 1D) and fluorescence microscopy (Figures 1F-G). These regions were characterized by exclusion of βIII- tubulin-positive early neurons (Figure 1F) and the presence of SOX1-positive neural progenitors, some of which were observed actively dividing as demonstrated by positive phospho-Histone3 signal (Figure 1G). These progenitors

96 organized into rosettes, with decreased or absent DAPI-positive nuclei centrally, suggesting formation of early ventricle-like structures. Populations of OLIG2 and

SOX10-positive oligodendrocyte progenitor cells were also observed adjacent to these germinal centers (Figures 1H-J), which coincides with the in vivo origin of

OPCs in the subventricular zone.245 At day 60, after 10 days of exposure to PDGF and IGF-1, the population of SOX10-positive OPCs increased by 34% on average across multiple spheroids derived from each cell line compared to untreated controls (Figures 1K-M).

After expansion of the OPC population, spheroids were exposed to T3 for an additional 10 days to stimulate the maturation of OPCs to oligodendrocytes.

Interestingly, at day 90, untreated spheroids were found to contain rare, isolated oligodendrocytes among the neurons and astrocytes (Figure 2A). However, the scarcity of these oligodendrocytes likely explains the absence of a mature oligodendrocyte profile from previous single cell analyses.200 Using expression of proteolipid protein 1 (PLP1) as an indicator of oligodendrocyte maturation, our

PDGF/IGF-1/T3 regimen increased normalized PLP1 signal density by 16 fold compared to select sections from untreated controls where PLP1-positive cells were observed (Figure 2A-C).

We next wanted to determine whether cortical spheroids could be used as a platform to screen for compounds that enhance oligodendrocyte differentiation.

Our lab previously identified a class of small molecule –azoles that stimulate OPC differentiation to oligodendrocytes in 2D cell culture and in vivo mouse models.246

Treatment with T3 increased normalized PLP1 density nearly 3-fold over

PDGF/IGF-1 treatment alone (Figures 2D-F). Meanwhile, treatment with ketoconazole or miconazole in lieu of T3 increased normalized PLP1 density 4.4- fold and 3.8-fold, respectively (Figures 2G-I). Given the scalability of cortical spheroid differentiation, this system provides a tractable platform for screening and validation of myelin targeted therapeutics in a human tissue.

We next wanted to test the extent to which cortical spheroids could be used to model genetic defects that cause a developmental myelin disease. Pelizaeus-

Merzbacher disease (PMD [MIM 312080]) is a rare X-linked leukodystrophy caused by mutations in PLP1.63; 213 Although PLP1 is the most abundant protein in myelin,3 it’s specific function is currently unknown. Hundreds of mutations have been identified in patients, who in turn range from mild symptoms of motor delay and spasticity to severe hypotonia with mortality in early childhood. We have previously generated PMD hiPSC-derived oligodendrocytes using a 2D culture system and demonstrated both distinct and convergent cellular phenotypes in individuals with various mutations.247 We used three of these lines to generate cortical spheroids: PMD2, a severe point mutation (c.254T>G); PMD10, a duplication of the entire PLP1 locus; PMD12, a deletion of the entire PLP1 locus.

In 3D spheroid cultures, PMD12 produced abundant CC1-positive, newly formed oligodendrocytes despite the expected absence of PLP1 (Figures 3B and K). In

2D cultures previously, both PMD2 and PMD10 showed distinct retention of PLP1 perinuclearly, which resolved upon chemical modulation of the endoplasmic reticulum stress pathway. In 3D spheroid cultures, PMD2 recapitulated this phenotype, demonstrating frank perinuclear retention of PLP1 (Figures 3C and K).

Furthermore, treatment of PMD2 spheroids with GSK2656157, an inhibitor of protein kinase R-like endoplasmic reticulum kinase (PERK),229 simultaneously with

T3 exposure, significantly improved mobilization of PLP1 away from the nucleus and into oligodendrocyte processes (Figures 3D and K). Conversely, in the 3D system PMD10 did not present with perinuclear retention, but rather showed a slight increase in PLP1 signal throughout PMD10 spheroids compared to controls

(Figures 3E and K). Under these circumstances, treatment with GSK2656157 moderately decreased total PLP1 signal (Figure 3K), while MBP signal was significantly increased (Figure 3F-H). This suggests that overexpression of PLP1, the most abundant myelin protein, may actually trigger maturation of oligodendrocytes precociously, but can nonetheless be ameliorated by modulation of the endoplasmic reticulum stress response. Finally, we used CRISPR-Cas9 to introduce a single nucleotide insertion, frameshift, and premature stop codon into one copy of PLP1 in PMD10 hiPSCs (see Methods). When differentiated to cortical spheroids, this “correction” of the duplication returned PLP1 (Figures 3I and K) and

MBP (Figures 3J and H) signal densities to wild type levels.

Human corticogenesis is a complex process that requires the coordinated generation, migration, and maturation of distinct populations of cells. Human stem cell-derived 3D cortical spheroids provide the first opportunity to not only observe and perturb these processes in normal human tissue and various neurogenetic diseases, but also at a scale that enables high-throughput genotype-phenotype correlation and therapeutic testing. With the induction of oligodendrocytes, cortical spheroids now recapitulate the three major cell lineages of CNS origin. Ultimately,

99 it will be important to establish the extent to which these oligodendrocytes recapitulate in vivo architecture and function, namely, do they myelinate neuron axons within the context of the spheroid? As of three months in culture, we have not observed clear ensheathement by confocal or electron microscopy. However, the formation of compact myelin is a drawn out process in vivo.248 We hypothesize that prolongation of time in culture and/or delay of initial OPC expansion may permit further maturation of the oligodendrocytes and tissue as a whole and provide a more favorable microenvironment in which for myelination to occur.

However even with these early stages spheroids, we are able to test the efficacy of myelinating drugs in the combined context of neurons, astrocytes, and oligodendrocytes. Additionally we were able to employ this model to study developmental defects and test drug and gene therapy strategies in a patient specific manner for individuals with PMD.

Methods

Generation of hiPSCs

Generation of normal (NC1, “CWRU191”; NC2, “CWRU198”) and PMD hiPSCs was performed as previously described.247 Two approved human embryonic stem cell (hESC) lines from the NIH hESC Registry (hESC1, “H7” NIHhESC-10-0061; hESC2, “H9” NIHhESC-10-0062)172 were also used in these studies.

100

Cortical Spheroid Differentiation with OPC and Oligodendrocyte Induction

Cortical spheroids were generated from pluripotent cells based on the Pasca et al

2015 protocol.242 Minor variations to the protocol are noted below.

To generate cortical spheroids, pluripotent stem cell colonies cultured on vitronectin (Gibco #A14700) were lifted using dispase (Gibco #17105-041) at 37°C for 10 minutes. Intact colonies were transferred to individual low-adherence V- bottom 96-well plates (S-Bio Prime #MS-9096VZ) in 200ul Starter media.

Spheroids were cultured in 96-well plates through day 25 of the Pasca et al protocol, with daily half-media changes. On day 25, spheroids were transferred to ultra-low attachment 6-well plates (Corning #CLS3471) at a density of 15-20 spheroids per well and cultured thus through the remainder of the protocol.

To induce OPC proliferation, beginning day 50, 10 ng/ml platelet-derived growth factor (PDGF, R&D Systems #221-AA-050) and 10 ng/ml insulin-like growth factor

1 (IGF-1, R&D Systems #291-G1-200) were added to the every-other-day media changes for 10 days.

To induce oligodendrocyte maturation, beginning day 60, 40 ng/ml 3,3’,5- triiodothronine (T3, Sigma #ST2877) was added to the every-other-day media changes for 10 days. When used, small molecules were treated during this same period. Ketoconazole and miconazole were added in lieu of T3. GSK2656157 was added in addition to T3.

101

After day 70, spheroids can be maintained in base NBA media with every-other- day media changes indefinitely.

Small Molecules

Ketoconazole (Sigma #K1003) 10mM stock solution in DMSO was prepared, aliquoted, and stored at -20°C. Miconazole (Sigma #M3512) 10mM stock solution in DMSO was prepared, aliquoted, and stored at -20°C. GSK2656157 (EMD

Millipore #5046510001) 10mM stock solution in DMSO was prepared, aliquoted, and stored at -20°C. Small molecules were warmed to 37°C for 20 minutes before adding to pre-warmed medium. Frozen aliquots were thawed no more than twice before being discarded.

Gene Editing

CRISPR-Cas9 editing of PMD10 iPSCs was performed by the Genome

Engineering and iPSC Center at Washington University in St. Louis. A guide targeting PLP1 exon 3 (sequence: TCTACACCACCGGCGAGTC) resulted in a single nucleotide insertion (g.288_289insA) in a single copy of PLP1. Upon receipt, the mutation was resequenced and the line identity confirmed by short-tandem- repeat based DNA fingerprinting (Cell Line Genetics).

102

Immunocytochemistry

Spheroids for immunohistochemistry were initially fixed with 4% ice-cold paraformaldehyde for 45minutes, washed three times in PBS and equilibrated with

30% sucrose overnight. The spheroids were embedded in OCT and sectioned at

10 m.

Primary antibodies: mouse-anti-βIII-tubulin (1:1000, R&D Systems #MAB1195); goat-anti-SOX1 (1:200, R&D Systems #AF3369); mouse-anti-phospho-Histone3

(1:100, Cell Signaling); rabbit-anti-OLIG2 (1:250, Millipore #AB9610); goat-anti-

SOX10 (1:250, R&D #AF2864); rat-anti-PLP1 (1:500, AA3, generously provided by Wendy Macklin); mouse-anti-pan-axonal neurofilament (NF, 1:1000, Covance

#SMI311); mouse-anti-pan-neuronal neurofilament (NF, 1:1000, Covance

#SMI312); mouse-anti-GFAP (1:1000, Dako #Z0334); mouse-anti-CC1 (1:250

Millipore #MABC200); rat-anti-MBP (1:500, Abcam #AB7349); DAPI (1ug/ml,

Sigma #D8417).

All secondary antibodies were LifeTechnologies AlexaFluor conjugated secondary antibodies used at a dilution of 1:500.

To assess the intensity and area of staining in each section we used Adobe

Photoshop to calculate integrated pixel density. The integrated pixel density is a sum of all the pixel intensity values in a selected region. Comparable areas from spheroids of similar size were selected for all comparisons. Undersized spheroids were excluded from our analysis.

103

Conflicts of Interest

P.J.T. is on the scientific advisory board of Cell Line Genetics.

Acknowledgements

This research was supported by grants from: the Pelizaeus-Merzbacher Disease

Foundation (P.J.T.); the NIH R01NS093357 (P.J.T.); the New York Stem Cell

Foundation (P.J.T.); and NIH predoctoral training grants T32GM007250 (Z.S.N.) and F30HD084167 (Z.S.N.). Additional support was provided by the Cytometry &

Imaging Microscopy core facility of the Case Comprehensive Cancer Center

(P30CA043703). We are grateful to Carney Blake and Baraa Nawash for technical assistance and the Tesar Lab for discussion and comments on the manuscript.

Author Information

1Department of Genetics and Genome Sciences, Case Western Reserve

University School of Medicine, Cleveland, Ohio 44106, USA.

104

Figure 1. Induction and Proliferation of OPCs

(A) A schematic of cortical spheroid differentiation highlighting additions to the protocol. From Day 50-60, PDGF and IGF-1 were added to stimulate OPC proliferation. From Day 60-70, T3, ketoconazole, miconazole, or T3/GSK2656257 were added to modulate oligodendrocyte maturation.

(B) Light microscopy of spheroids on day 2 after passaging. 2.5x magnification.

105

(D) Light microscopy of spheroids on day 45 demonstrating clearly delineated germinal centers. 10x magnification.

(E) Light microscopy of spheroids on day 60. 2.5x magnification.

(F) Immunofluorescence of a day 45 spheroid demonstrating germinal centers (white traces) demarcated by βIII-tubulin neurons.

(G) Immunofluorescence of a day 45 spheroid demonstrating a rosette and SOX1- positive neural progenitor cells within a germinal center. Actively dividing cells are marked by phospho-Histone3.

(H-J) Immunofluorescence of a day 45 spheroid demonstrating populations of OLIG2 and SOX10-positive OPCs found adjacent to germinal centers. I and J are insets of H.

(K) Immunofluorescence of OPCs in a day 60 spheroid following the original protocol.

(L) Immunofluorescence of OPCs in a day 60 spheroid exposed to PDGF and IGF- 1 from day 50-60.

(M) Normalized quantification of SOX10+,PDGFRa+ OPCs with or without exposure to PDGF and IGF-1. Treated spheroids produced 34% more OPCs across all lines (p = 0.011).

106

Figure 2. Maturation of Oligodendrocytes and Expansion by Promyelinating Drugs

(A) Immunofluorescence of cell diversity in day 90 spheroids generated using the original protocol. Neurofilament (NF) marks neurons. Glial fibrillary acidic protein (GFAP) marks astrocytes. PLP1 marks oligodendrocytes.

(B) Immunofluorescence of cell diversity in day 90 spheroids exposed to T3 from day 60-70.

(D) Immunofluorescence of spontaneous oligodendrocyte maturation without exposure to T3. CC1 is a marker of newly formed oligodendrocytes.

107

(E) Immunofluorescence of oligodendrocyte maturation at day 90 with T3 exposure.

(F) Quantification of normalized PLP1 signal density in D-E (p = 0.01).

(G) Immunofluorescence of oligodendrocyte maturation at day 90 with ketoconazole instead of T3.

(H) Immunofluorescence of oligodendrocyte maturation at day 90 with miconazole instead of T3.

(I) Quantification of normalized PLP1 signal density in F-H (p = 0.010).

108

Figure 3. Cortical Organoids Recapitulate Cellular Phenotypes of PMD

(A) Immunofluorescence of H9 control spheroids at day 90 demonstrating prevalent PLP1 signal.

(B) Immunofluorescence of PMD12 spheroids at day 90 demonstrating presence of CC1-positive newly formed oligodendrocytes that cannot produce PLP1.

(D) Immunofluorescence of PMD2 spheroids treated with GSK2656157 at day 90 demonstrating restoration of PLP1 signal.

(E) Immunofluorescence of PMD10 spheroids at day 90 demonstrating overexpression of PLP1 signal.

(F) Immunofluorescence of PMD10 spheroids at day 90 demonstrating reduced expression of MBP signal.

(G) Immunofluorescence of PMD10 spheroids treated with GSK2656157 at day 90 demonstrating restoration of MBP signal.

109

(H) Quantification of normalized MBP signal density in F, G, and J (** p < 0.01, * p < 0.03).

(I) Immunofluorescence of CRISPR-corrected PMD10 spheroids at day 90 demonstrating reduction of PLP1 signal.

(J) Immunofluorescence of CRISPR-corrected PMD10 spheroids at day 90 demonstrating restoration of MBP signal.

(K) Quantification of normalized PLP1 signal density in A-D, E, and I (** p < 0.01, * p < 0.05).

110

CHAPTER 4: Discussion and Future Directions

Summary and significance of the current study

Human pluripotent stem cell technologies are changing the way we approach biomedical questions. Since the first isolation of embryonic stem cells, hundreds of cell subtypes throughout the body have been derived in vitro, from healthy individuals and sick patients, with known genetic mutations and undiagnosed disease. With the development of new protocols for derivation of the oligodendroglial lineage, we can now circumvent many of the technical challenges that have limited modeling of myelin and oligodendrocyte dysfunction and prevented in depth analysis of PMD and other leukodystrophies. Whereas acquisition of primary patient oligodendrocytes is extremely invasive, hiPSCs can now be generated from skin, blood,249 or even urine samples.250 Whereas myelin development begins in utero, patients present ambiguously, and diagnosis occurs well after relevant disease processes have occurred, hiPSC technologies enable us to turn back the clock, generate the full oligodendrocyte lineage in a dish, and observe the development and progression of disease pathology in real time. Prior studies of some of the hundreds of mutations linked to PMD suggest multiple disease etiologies could be contributing to patient heterogeneity, a degree of variability that would be truly impossible to capture using traditional animal models.

However, we have now demonstrated the feasibility of modeling and assessing a panel of patient-derived oligodendrocytes that captures the broad spectrum of clinical and genetic diversity found in this single disease.

111

In this work, we have presented a hiPSC platform to identify patient-specific defects spanning PLP1 expression, PLP1 splicing, OPC production, and oligodendrocyte morphology. Many of the defects we report here could not have been predicted by patients’ clinical histories or mutations alone. Moreover, characterization of these defects across all patients in parallel enabled identification of distinct subclasses of cellular and molecular pathogeneses that now link disparate PLP1 mutations. Subsequently, we developed a protocol for oligodendrocyte generation in 3D cortical spheroids and demonstrated variability in patient phenotypes in 2D versus 3D cultures that further tease apart nuances in mutation pathogeneses. Most importantly, we demonstrated the use of this platform for phenotype-targeted therapeutic testing and showed patient-specific responses to two small molecule modulators of the ER stress response. In the future, we plan to expand this platform to include additional PMD patients with unique mutations, incorporate new assays to refine PMD cellular and molecular phenotyping, and screen compound libraries to identify effective PMD therapeutics. We hope this work will inspire other researchers to take full advantage of the versatility of 2D and 3D hiPSC-derived models to begin to delve into oligodendrocyte dysfunction in myelin diseases broadly.

Studies directly following from results of the current work

Applications of new, more efficient protocols for in vitro oligodendrocyte generation

112

Generation of a large, pure pool of human oligodendrocytes is one of the most significant obstacles we faced in studying human myelinogenesis. A 90+ day protocol is not amenable to gathering the amount of material necessary to perform basic, yet critical assays such as cell sorting, RNAseq, or Western blot, let alone conduct large-scale drug screening. Interestingly, in mice, a robust, expandable population of pure OPCs can be generated from epiblast stem cells in only 10 days.251 However, interspecies variation is well established in regards to timing of the development of the central nervous system.41; 252-254 Nonetheless, there is promising evidence that more rapid human protocols are forthcoming.255

Most intriguing is the success of transdifferentiation of cerebral cell types.

Transdifferentiation refers to the direct conversion of one adult cell type to another, typically through the overexpression of lineage-specific transcription factors. Both neurons256 and Schwann cells257 have successfully been derived from human fibroblasts, with Schwann derived in as little as 20 days. In rodents, transdifferentiation of fibroblasts to OPCs has been achieved using only Sox10,

Olig2 and either Nkx2.2258 or Zfp536.259 Although transdifferentiation itself is less attractive than an iPSC approach due to the absence of a proliferative starting cell population, the identification of transcription factors sufficient for transdifferentiation suggests key pathways that could be modulated in pursuit of accelerated iPSC-based differentiation. Additionally, there has been one report of human transdifferentiation of CD34+ blood-derived stem cells to OPCs using merely thyroid hormone,260 but characterization of these cells needs additional validation. Bioinformatically, new resources parsing the transcriptome of cell types

113 in the brain may also provide insights into pathways or critical cell fate transitions that could be directly stimulated.261; 262 For instance, an initial report demonstrated that oligodendrocyte maturation actually progresses through two sequential stages, each of which requires a distinct complement of transcription factors and myelin proteins,263 whereas current differentiation protocols use constant concentrations of limited growth factors to try and push differentiation.

In the absence of more robust differentiation, single cell analysis is an attractive alternative for interrogating cellular and molecular defects. Single-cell RNA sequencing264 would enable not only high quality analysis of oligodendrocyte transcriptomes, but could provide insight into variability across the population, a characteristic which has long been suspected but not yet proven. Super resolution265 and expansion microscopy266 could also provide a new perspective on molecular dynamics in oligodendrocytes. Both methods enable visualization of individual proteins, which in the case of PMD, would permit higher resolution of

PLP1 trafficking, cellular localization, integration into myelin, and any disruptions thereof.

Ultimately, any advance in the efficiency of oligodendrocyte differentiation will have a direct impact on the throughput of this system for modeling as many unique PMD mutations as possible.

Assessment of PMD oligodendrocyte myelination in vitro using inorganic microfibers

114

Inorganic microfibers are an especially promising advancement for studies of oligodendrocyte maturation and the process of myelination. Due to their inert state, the system truly captures oligodendrocytes’ intrinsic capacity for myelination. This is particularly important to the study of leukodystrophies, providing an easy and guaranteed means of eliminating non-cell intrinsic elements as confounding factors in disease heterogeneity. Conversely, this platform can also be readily adapted to model the more complex cerebral microenvironment through the addition of specific components of the extracellular matrix, co-culture in neuron or astrocyte-conditioned media, or stimulation with neurotransmitters mimicking neuronal activity.267 Grown on coverslips, this system is also accessible for live, real-time microscopy, cytochemistry, and electrophysiology.

Assessment of PMD oligodendrocyte myelination in vivo using humanized mice

Insights into the cell intrinsic aspects of myelination is important to appreciating the cellular etiology of disease, but ultimately, pathophysiology must be established within the context of the central nervous system. Except in rare cases when surgical human tissue is available, human-to-human OPC transplantation is not ethically feasible. However, complete population of the mouse brain by human

OPCs is eminently possible. For reasons that are not yet known, human glia have a competitive advantage over their mouse counterparts and can actually supplant mouse myelin sheaths.190 Alternately, Shiverer is a dysmyelinated mouse model that lacks intact myelin,189 perhaps making it more amenable to transplantation of

115 diseased human cells whose competitive advantage may be impaired. In either case, transplantation of OPCs enables assessment of myelin development, ultrastructure, and, for certain demyelinating leukodystrophies, eventual loss.

Lastly, combining chimerization with new methods for tissue clearing268; 269 could provide fascinating insights into whole-brain dynamics of human oligodendrocyte migration and regional specificity of differentiation.

Gene editing strategies for better models of PMD and therapeutics development

The rapid rise of CRISPR/Cas9270 editing technologies has rendered the generation of targeted mutations practically rote. Multiple studies have now demonstrated the utility of CRISPR/Cas9 editing in patient-derived iPSCs271-273 and hematopoietic stem cells274 for phenotypic correction of a disease-causing mutation in vitro.

There are multiple appealing prospects to editing in PMD iPSC lines. First, the gold standard for any study of a genetic disease, whether at the cell or organism level, is comparison against an isogenic control modified solely at the mutant locus. This becomes especially important in any experiments using iPSCs275 because, by their very nature, an iPSC culture is clonal. Any mutations acquired somatically prior to reprogramming or subsequently in culture risk becoming fixed in the line, and thus insidious confounding factors. This risk can be tempered, to a degree, by using multiple separately-derived clones as biological controls, but ideally this would require separate original tissue samples, which is rarely how samples are

116 collected. Second, isogenic controls provide the best possible comparison for phenotyping a new mutation. Particularly in a disease like PMD—where so little is known about PLP1, yet its defects appear to be diverse—an isogenic control definitively answers whether an observed phenotype is mutation-specific or the result of some other background variation. Third, once a genotype-phenotype correlation is identified for a particular patient mutation, hypothesis-driven editing of additional related loci would allow for rapid validation of new classes of mutations, rather than having to track down, acquire, and reprogram other patient lines.

Looking towards therapeutic applications, there are multiple avenues for gene editing-based therapeutics in PMD. Since duplications comprise 70% of the patient population, theoretically a single guide-RNA used to knockout a single copy of

PLP1 could be therapeutic for a majority of the patient population. Moreover, given that PLP1-null patients have some of the mildest clinical phenotypes, there is a case to be made for knockout as a therapeutic strategy for almost any mutation.

While null patients still present with some symptoms, morbidity and mortality are vastly improved in null-syndrome compared to classic or connatal patients.

Logistically, the oligodendrocyte lineage is also quite amenable to direct editing in patients. First, as discussed above, PLP1 knockout is preferable to most other mutations, so any attempt at homologous recombination that instead results in introduction of an indel is unlikely to have a more severe effect on the cell. Second,

PLP1’s oligodendrocyte specificity in adult tissues reduces the chance that editing in other cell types could trigger deleterious effects. Lastly, a population of OPCs

117 persists through adult life, so it is possible that editing and reactivation of a limited number of these proliferative progenitors could be sufficient to reconstitute myelin throughout the brain. In vitro editing and transplantation of autologous iPSC- derived OPCs, while theoretically feasible, is not truly viable on a patient-by-patient basis within the constraints of Good Clinical Practice. However, for the reasons above, direct delivery of an editing construct—for example by virus276—has the potential to have a targeted and substantial impact on the oligodendrocyte lineage.

Future studies applying iPSC technologies to parse genetic myelin diseases

Combining next generation sequencing with hiPSC platforms for variant discovery and cellular characterization of clinically undiagnosed neurogenetic diseases

The fact that over 50% of patients with an inherited leukodystrophy remain undiagnosed48 is a profound statement to the degree of our ignorance regarding the molecular genetics underlying these diseases. New sequencing modalities, including whole exome, whole genome, and single-cell RNAseq, provide the opportunity to identify novel variants, genes, and pathways involved in not only myelin disease, but normal function as well. In one recent report, whole exome sequencing in patients with persistently undiagnosed white matter abnormalities yielded a positive diagnosis in 42% of cases.277 However, diagnosis is only the first step. Combining sequencing with iPSC-based phenotyping and isogenic gene editing not only provides validation that the identified mutation is truly causative, but expands our repertoire of cellular resources for subsequent studies.

118

Application of this approach in a concerted manner across all leukodystrophy patients seen within an institution or consortium has the potential to capture extremely rare or novel variants that could reorient our approach to studying and treating myelin diseases.

Combining gene editing with hiPSC platforms to probe why disruption of translation predominantly disrupts myelin development over other tissues

Such reorientation is now occurring in regards to the role of ER stress in myelin diseases. Induction of endoplasmic reticulum stress is a common theme across the leukodystrophies121; 278; 279 and neurodegenerative disease at large.280; 281

While this seems to suggest ER stress is a point of convergence in the pathogeneses of disparate genetic diseases, there is mounting evidence that this is in fact a red herring. Rather, ER stress may only be the sequelae of a primary convergence on disruption of translation.

Consider the situation at hand, not only do oligodendrocytes produce more membrane (and its associated proteins) than any other cell in the body, each oligodendrocyte does so over a comparatively brief developmental period.3 Fidelity of translation during this period must be profoundly tuned in order to maintain protein production at high enough rates to maintain membrane homeostasis.282

Moreover, during this period, two proteins, PLP1 and MBP, constitute almost 90% of the protein output of the cell,3 both of which must properly fold and insert into membranes bound for the cell surface. Folding and insertion occur co-

119 translationally, suggesting a direct link between dysregulation of PMD expression and disruption of translation. Additionally, vanishing white matter is caused by mutations in EIF2B, part of the translation initiation complex.283 4H syndrome is caused by mutations in RNA polymerase subunits IIIA and B, responsible for synthesizing ribosomal RNA.284 Eukaryotic elongation factor 1A2, responsible for chaperoning tRNAs to the ribosomal A site, causes an as yet unnamed disorder affecting both neurons and myelin.285; 286 And lastly, a growing number of tRNA synthetases have been linked to dysfunction of myelin in both the central 287-289 and peripheral nervous systems.290 All of these diseases are exceedingly rare and have only recently started to come to light as new variants are found through whole genome sequencing.

The two most interesting shared features of these diseases are, 1) these are non- redundant proteins with critical roles in translation, and yet these diseases are not embryonically lethal, and, 2) each of these diseases present with primary myelin defects, with occasional lesser involvement of other tissues. Is it possible, then, that translation is also a red herring? Could mutations in each of these genes ultimately be affecting translation, specifically, of PLP1? Could the as yet unknown function of PLP1 be disrupted not only through direct mutation, but also by any and all disruptions of translation during the critical period of myelin production? Could

PLP1 be the common denominator? Here again, combining iPSCs with gene editing, one could easily knockout PLP1 in each of these other diseases to assess effects on oligodendrocyte phenotype, survival, and myelin production.

120

Strategies to model complex tissues through integration of hiPSC-derived 3D cultures

Cerebral organoids intrinsically model complex cell-cell interactions and are a promising platform for advancing our understanding of myelin in health and disease. However, as a result of the factors used for patterning, various protocols each generate distinct regions of the total brain. Until recently, this limited the ability to model long range interactions that occur in vivo. However, two groups have now shown separate approaches to bridging this divide. In one study, separately derived ventral and dorsal organoids were fused, stimulating the natural migration of specific populations of neurons between the two organoids.200 In another study, inorganic microfibers were added to the culture, stimulating elongation of the sphere and altering endogenous signaling to guide organization in a more controlled manner.291

There are multiple possible applications of these improvements to the study of myelin. The most immediate would be studies of OPC migration. Two major migratory events have been demonstrated in rodents, but not yet in human tissues.

First is the maturation of oligodendrocyte precursors to progenitors as they leave the subventricular zone. The ability to replicate, evaluate, and reverse this maturation could have applications for remyelinating therapies, as precursors are significantly more proliferative than progenitors, at least in rodents.3 Second is the pause in migration as OPCs cross from white matter into grey matter. Although they eventually populate the entire brain, this stutter could also have implications for remyelination of MS, where OPCs seem to be disinclined to enter demyelinated

121 lesions. One eventual application of the microfiber technique would be genesis of a corpus callosum-like structure within or between two organoids. However, significant advances in our control of neural axon orientation will be prerequisite to this achievement. Finally, Brainbow fluorescent constructs have been previously applied to study morphology and interactions between mature oligodendrocytes.292

Applying this to differentially derived and fused ventral and dorsal organoids could be used to model the sequential regional waves of OPC production and migration that occur in early embryos, leading to a greater appreciation of oligodendrocyte subtypes and their preferences for populating and myelinating particular regions of the adult brain.

Truly, organoid technologies are still in their infancy, and their full potential is yet to be realized. Addition of oligodendrocytes to this cellular context is only the first step in recapitulating the true complexity of the human brain. Nonetheless, this is a significant step forward for modeling developmental myelin diseases.

In conclusion

Using iPSCs to model human disease is by no means a novel concept, but it is time to start thinking big. As reprogramming, gene editing, and tissue modeling become common practice, there are fewer and fewer reasons to pursue only the most prevalent mutations in a disease, when so frequently less common variants can provide the greatest insights. Panels capturing the full landscape of a single disease will not always be necessary, but should be given serious consideration in

122 diseases with complex presentations and genetics. There are many questions left to be asked in the realm of PMD and the leukodystrophies. I hope this work will provide some degree of guidance to future projects.

123

References

1. Pfrieger, F.W., and Barres, B.A. (1995). What the fly's glia tell the fly's brain. Cell 83, 671-674. 2. Allen, N.J., and Barres, B.A. (2009). Neuroscience: Glia - more than just brain glue. Nature 457, 675-677. 3. Baumann, N., and Pham-Dinh, D. (2001). Biology of oligodendrocyte and myelin in the mammalian central nervous system. Physiol Rev 81, 871-927. 4. Schmitt, S., Castelvetri, L.C., and Simons, M. (2015). Metabolism and functions of lipids in myelin. Biochim Biophys Acta 1851, 999-1005. 5. Waxman, S.G., Pappas, G.D., and Bennett, M.V. (1972). Morphological correlates of functional differentiation of nodes of Ranvier along single fibers in the neurogenic electric organ of the knife fish Stern archus. J Cell Biol 53, 210-224. 6. Nave, K.A., and Trapp, B.D. (2008). Axon-glial signaling and the glial support of axon function. Annu Rev Neurosci 31, 535-561. 7. Gibson, E.M., Purger, D., Mount, C.W., Goldstein, A.K., Lin, G.L., Wood, L.S., Inema, I., Miller, S.E., Bieri, G., Zuchero, J.B., et al. (2014). Neuronal activity promotes oligodendrogenesis and adaptive myelination in the mammalian brain. Science 344, 1252304. 8. Emery, B. (2010). Regulation of oligodendrocyte differentiation and myelination. Science 330, 779-782. 9. Ahrendsen, J.T., and Macklin, W. (2013). Signaling mechanisms regulating myelination in the central nervous system. Neurosci Bull 29, 199-215. 10. Eroglu, C., and Barres, B.A. (2010). Regulation of synaptic connectivity by glia. Nature 468, 223-231. 11. Schwab, M.E., and Strittmatter, S.M. (2014). Nogo limits neural plasticity and recovery from injury. Curr Opin Neurobiol 27, 53-60. 12. Trajkovic, K., Dhaunchak, A.S., Goncalves, J.T., Wenzel, D., Schneider, A., Bunt, G., Nave, K.A., and Simons, M. (2006). Neuron to glia signaling triggers myelin membrane exocytosis from endosomal storage sites. J Cell Biol 172, 937-948. 13. Lee, Y., Morrison, B.M., Li, Y., Lengacher, S., Farah, M.H., Hoffman, P.N., Liu, Y., Tsingalia, A., Jin, L., Zhang, P.W., et al. (2012). Oligodendroglia metabolically support axons and contribute to neurodegeneration. Nature 487, 443-448. 14. Nave, K.A. (2010). Myelination and the trophic support of long axons. Nat Rev Neurosci 11, 275-283. 15. Kramer-Albers, E.M., Bretz, N., Tenzer, S., Winterstein, C., Mobius, W., Berger, H., Nave, K.A., Schild, H., and Trotter, J. (2007). Oligodendrocytes secrete exosomes containing major myelin and stress-protective proteins: Trophic support for axons? Proteomics Clin Appl 1, 1446-1461. 16. Bakiri, Y., Karadottir, R., Cossell, L., and Attwell, D. (2011). Morphological and electrical properties of oligodendrocytes in the white matter of the corpus callosum and cerebellum. J Physiol 589, 559-573. 17. Tomassy, G.S., Berger, D.R., Chen, H.H., Kasthuri, N., Hayworth, K.J., Vercelli, A., Seung, H.S., Lichtman, J.W., and Arlotta, P. (2014). Distinct profiles of myelin distribution along single axons of pyramidal neurons in the neocortex. Science 344, 319-324. 18. Waehneldt, T.V. (1990). Phylogeny of myelin proteins. Ann N Y Acad Sci 605, 15-28. 19. Roelink, H., Augsburger, A., Heemskerk, J., Korzh, V., Norlin, S., Ruiz i Altaba, A., Tanabe, Y., Placzek, M., Edlund, T., Jessell, T.M., et al. (1994). Floor plate and motor neuron

124

induction by vhh-1, a vertebrate homolog of hedgehog expressed by the notochord. Cell 76, 761-775. 20. Miller, R.H., Dinsio, K., Wang, R., Geertman, R., Maier, C.E., and Hall, A.K. (2004). Patterning of spinal cord oligodendrocyte development by dorsally derived BMP4. J Neurosci Res 76, 9-19. 21. Orentas, D.M., Hayes, J.E., Dyer, K.L., and Miller, R.H. (1999). Sonic hedgehog signaling is required during the appearance of spinal cord oligodendrocyte precursors. Development 126, 2419-2429. 22. Pringle, N.P., and Richardson, W.D. (1993). A singularity of PDGF alpha-receptor expression in the dorsoventral axis of the neural tube may define the origin of the oligodendrocyte lineage. Development 117, 525-533. 23. Rowitch, D.H., and Kriegstein, A.R. (2010). Developmental genetics of vertebrate glial-cell specification. Nature 468, 214-222. 24. Timsit, S., Martinez, S., Allinquant, B., Peyron, F., Puelles, L., and Zalc, B. (1995). Oligodendrocytes originate in a restricted zone of the embryonic ventral neural tube defined by DM-20 mRNA expression. J Neurosci 15, 1012-1024. 25. Warf, B.C., Fok-Seang, J., and Miller, R.H. (1991). Evidence for the ventral origin of oligodendrocyte precursors in the rat spinal cord. J Neurosci 11, 2477-2488. 26. Doetsch, F., Garcia-Verdugo, J.M., and Alvarez-Buylla, A. (1997). Cellular composition and three-dimensional organization of the subventricular germinal zone in the adult mammalian brain. J Neurosci 17, 5046-5061. 27. Levison, S.W., and Goldman, J.E. (1993). Both oligodendrocytes and astrocytes develop from progenitors in the subventricular zone of postnatal rat forebrain. Neuron 10, 201-212. 28. Small, R.K., Riddle, P., and Noble, M. (1987). Evidence for migration of oligodendrocyte-- type-2 astrocyte progenitor cells into the developing rat optic nerve. Nature 328, 155- 157. 29. Lachapelle, F., Duhamel-Clerin, E., Gansmuller, A., Baron-Van Evercooren, A., Villarroya, H., and Gumpel, M. (1994). Transplanted transgenically marked oligodendrocytes survive, migrate and myelinate in the normal mouse brain as they do in the shiverer mouse brain. Eur J Neurosci 6, 814-824. 30. Temple, S., and Raff, M.C. (1986). Clonal analysis of oligodendrocyte development in culture: evidence for a developmental clock that counts cell divisions. Cell 44, 773-779. 31. Macklin, W.B., Weill, C.L., and Deininger, P.L. (1986). Expression of myelin proteolipid and basic protein mRNAs in cultured cells. J Neurosci Res 16, 203-217. 32. Matsuda, Y., Koito, H., and Yamamoto, H. (1997). Induction of myelin-associated glycoprotein expression through neuron-oligodendrocyte contact. Brain Res Dev Brain Res 100, 110-116. 33. Wang, S., Sdrulla, A.D., diSibio, G., Bush, G., Nofziger, D., Hicks, C., Weinmaster, G., and Barres, B.A. (1998). Notch receptor activation inhibits oligodendrocyte differentiation. Neuron 21, 63-75. 34. Milner, R., Edwards, G., Streuli, C., and Ffrench-Constant, C. (1996). A role in migration for the alpha V beta 1 integrin expressed on oligodendrocyte precursors. J Neurosci 16, 7240-7252. 35. Harlow, D.E., Saul, K.E., Komuro, H., and Macklin, W.B. (2015). Myelin Proteolipid Protein Complexes with alphav Integrin and AMPA Receptors In Vivo and Regulates AMPA- Dependent Oligodendrocyte Progenitor Cell Migration through the Modulation of Cell- Surface GluR2 Expression. J Neurosci 35, 12018-12032.

125

36. Gow, A., Southwood, C.M., and Lazzarini, R.A. (1998). Disrupted proteolipid protein trafficking results in oligodendrocyte apoptosis in an animal model of Pelizaeus- Merzbacher disease. J Cell Biol 140, 925-934. 37. Gudz, T.I., Komuro, H., and Macklin, W.B. (2006). Glutamate stimulates oligodendrocyte progenitor migration mediated via an alphav integrin/myelin proteolipid protein complex. J Neurosci 26, 2458-2466. 38. Gudz, T.I., Schneider, T.E., Haas, T.A., and Macklin, W.B. (2002). Myelin proteolipid protein forms a complex with integrins and may participate in integrin receptor signaling in oligodendrocytes. J Neurosci 22, 7398-7407. 39. Vigano, F., Mobius, W., Gotz, M., and Dimou, L. (2013). Transplantation reveals regional differences in oligodendrocyte differentiation in the adult brain. Nat Neurosci 16, 1370- 1372. 40. Snaidero, N., Mobius, W., Czopka, T., Hekking, L.H., Mathisen, C., Verkleij, D., Goebbels, S., Edgar, J., Merkler, D., Lyons, D.A., et al. (2014). Myelin membrane wrapping of CNS axons by PI(3,4,5)P3-dependent polarized growth at the inner tongue. Cell 156, 277-290. 41. Barres, B.A., Lazar, M.A., and Raff, M.C. (1994). A novel role for thyroid hormone, glucocorticoids and retinoic acid in timing oligodendrocyte development. Development 120, 1097-1108. 42. Yeung, M.S., Zdunek, S., Bergmann, O., Bernard, S., Salehpour, M., Alkass, K., Perl, S., Tisdale, J., Possnert, G., Brundin, L., et al. (2014). Dynamics of oligodendrocyte generation and myelination in the human brain. Cell 159, 766-774. 43. Tomassy, G.S., and Fossati, V. (2014). How big is the myelinating orchestra? Cellular diversity within the oligodendrocyte lineage: facts and hypotheses. Front Cell Neurosci 8, 201. 44. Parikh, S., Bernard, G., Leventer, R.J., van der Knaap, M.S., van Hove, J., Pizzino, A., McNeill, N.H., Helman, G., Simons, C., Schmidt, J.L., et al. (2015). A clinical approach to the diagnosis of patients with leukodystrophies and genetic leukoencephelopathies. Mol Genet Metab 114, 501-515. 45. Pouwels, P.J., Vanderver, A., Bernard, G., Wolf, N.I., Dreha-Kulczewksi, S.F., Deoni, S.C., Bertini, E., Kohlschutter, A., Richardson, W., Ffrench-Constant, C., et al. (2014). Hypomyelinating leukodystrophies: translational research progress and prospects. Ann Neurol 76, 5-19. 46. Ludwin, S.K. (1997). The pathobiology of the oligodendrocyte. J Neuropathol Exp Neurol 56, 111-124. 47. Kohlschutter, A., and Eichler, F. (2011). Childhood leukodystrophies: a clinical perspective. Expert Rev Neurother 11, 1485-1496. 48. Bonkowsky, J.L., Nelson, C., Kingston, J.L., Filloux, F.M., Mundorff, M.B., and Srivastava, R. (2010). The burden of inherited leukodystrophies in children. Neurology 75, 718-725. 49. Kevelam, S.H., Steenweg, M.E., Srivastava, S., Helman, G., Naidu, S., Schiffmann, R., Blaser, S., Vanderver, A., Wolf, N.I., and van der Knaap, M.S. (2016). Update on Leukodystrophies: A Historical Perspective and Adapted Definition. Neuropediatrics 47, 349-354. 50. Schiffmann, R., and van der Knaap, M.S. (2009). Invited article: an MRI-based approach to the diagnosis of white matter disorders. Neurology 72, 750-759. 51. Brimley, C.J., Lopez, J., van Haren, K., Wilkes, J., Sheng, X., Nelson, C., Korgenski, E.K., Srivastava, R., and Bonkowsky, J.L. (2013). National variation in costs and mortality for leukodystrophy patients in US children's hospitals. Pediatr Neurol 49, 156-162 e151. 52. Van Haren, K., Bonkowsky, J.L., Bernard, G., Murphy, J.L., Pizzino, A., Helman, G., Suhr, D., Waggoner, J., Hobson, D., Vanderver, A., et al. (2015). Consensus statement on

126

preventive and symptomatic care of leukodystrophy patients. Mol Genet Metab 114, 516-526. 53. Kondo, Y., Wenger, D.A., Gallo, V., and Duncan, I.D. (2005). Galactocerebrosidase-deficient oligodendrocytes maintain stable central myelin by exogenous replacement of the missing enzyme in mice. Proc Natl Acad Sci U S A 102, 18670-18675. 54. Moser, H.W., Raymond, G.V., Lu, S.E., Muenz, L.R., Moser, A.B., Xu, J., Jones, R.O., Loes, D.J., Melhem, E.R., Dubey, P., et al. (2005). Follow-up of 89 asymptomatic patients with adrenoleukodystrophy treated with Lorenzo's oil. Arch Neurol 62, 1073-1080. 55. Aubourg, P., Blanche, S., Jambaque, I., Rocchiccioli, F., Kalifa, G., Naud-Saudreau, C., Rolland, M.O., Debre, M., Chaussain, J.L., Griscelli, C., et al. (1990). Reversal of early neurologic and neuroradiologic manifestations of X-linked adrenoleukodystrophy by bone marrow transplantation. N Engl J Med 322, 1860-1866. 56. Pelizaeus, F. (1885). Uber eine eigenthümliche Form Spastischer Lähmung mit Cerebralerschinungen auf hereditärer Grundlage (Multiple Sklerose). Arch Psychiatr Nervenkr, 16698-16710. 57. Merzbacher, L. (1910). Eine eigenarige familiär-hereditare Erkrankungsform (Aplasia axialis extra-corticalis congenita). Z Neurol Psychiatr, 31-138. 58. Hobson GM, K.J. (1999 [Updated 2013]). PLP1-Related Disorders. In GeneReviews. (Seattle (WA), University of Washington. 59. Boulloche, J., and Aicardi, J. (1986). Pelizaeus-Merzbacher disease: clinical and nosological study. J Child Neurol 1, 233-239. 60. Hodes, M.E., Pratt, V.M., and Dlouhy, S.R. (1993). Genetics of Pelizaeus-Merzbacher disease. Dev Neurosci 15, 383-394. 61. Cailloux, F., Gauthier-Barichard, F., Mimault, C., Isabelle, V., Courtois, V., Giraud, G., Dastugue, B., and Boespflug-Tanguy, O. (2000). Genotype-phenotype correlation in inherited brain myelination defects due to proteolipid protein gene mutations. Clinical European Network on Brain Dysmyelinating Disease. Eur J Hum Genet 8, 837-845. 62. Hudson, L.D. (2003). Pelizaeus-Merzbacher disease and spastic paraplegia type 2: two faces of myelin loss from mutations in the same gene. J Child Neurol 18, 616-624. 63. Hobson, G.M., and Kamholz, J. (1993). PLP1-Related Disorders. In GeneReviews(R), R.A. Pagon, M.P. Adam, H.H. Ardinger, S.E. Wallace, A. Amemiya, L.J.H. Bean, T.D. Bird, C.T. Fong, H.C. Mefford, R.J.H. Smith, et al., eds. (Seattle (WA). 64. Hurst, S., Garbern, J., Trepanier, A., and Gow, A. (2006). Quantifying the carrier female phenotype in Pelizaeus-Merzbacher disease. Genet Med 8, 371-378. 65. Laukka, J.J., Stanley, J.A., Garbern, J.Y., Trepanier, A., Hobson, G., Lafleur, T., Gow, A., and Kamholz, J. (2013). Neuroradiologic correlates of clinical disability and progression in the X-linked leukodystrophy Pelizaeus-Merzbacher disease. J Neurol Sci 335, 75-81. 66. Sumida, K., Inoue, K., Takanashi, J., Sasaki, M., Watanabe, K., Suzuki, M., Kurahashi, H., Omata, T., Tanaka, M., Yokochi, K., et al. (2016). The magnetic resonance imaging spectrum of Pelizaeus-Merzbacher disease: A multicenter study of 19 patients. Brain Dev 38, 571-580. 67. Matsufuji, M., Osaka, H., Gotoh, L., Shimbo, H., Takashima, S., and Inoue, K. (2013). Partial PLP1 deletion causing X-linked dominant spastic paraplegia type 2. Pediatr Neurol 49, 477-481. 68. Lee, J.A., Madrid, R.E., Sperle, K., Ritterson, C.M., Hobson, G.M., Garbern, J., Lupski, J.R., and Inoue, K. (2006). Spastic paraplegia type 2 associated with axonal neuropathy and apparent PLP1 position effect. Ann Neurol 59, 398-403.

127

69. Inoue, K. (2005). PLP1-related inherited dysmyelinating disorders: Pelizaeus-Merzbacher disease and spastic paraplegia type 2. Neurogenetics 6, 1-16. 70. Osaka, H., Kawanishi, C., Inoue, K., Uesugi, H., Hiroshi, K., Nishiyama, K., Yamada, Y., Suzuki, K., Kimura, S., and Kosaka, K. (1995). Novel nonsense proteolipid protein gene mutation as a cause of X-linked spastic paraplegia in twin males. Biochem Biophys Res Commun 215, 835-841. 71. Inoue, K., Osaka, H., Thurston, V.C., Clarke, J.T., Yoneyama, A., Rosenbarker, L., Bird, T.D., Hodes, M.E., Shaffer, L.G., and Lupski, J.R. (2002). Genomic rearrangements resulting in PLP1 deletion occur by nonhomologous end joining and cause different dysmyelinating phenotypes in males and females. Am J Hum Genet 71, 838-853. 72. Gao, Q., Thurston, V.C., Vance, G.H., Dlouhy, S.R., and Hodes, M.E. (2005). Genetic diagnosis of PLP gene duplications/deletions in patients with Pelizaeus-Merzbacher disease. Clin Genet 68, 466-467. 73. Klugmann, M., Schwab, M.H., Puhlhofer, A., Schneider, A., Zimmermann, F., Griffiths, I.R., and Nave, K.A. (1997). Assembly of CNS myelin in the absence of proteolipid protein. Neuron 18, 59-70. 74. Garbern, J.Y. (2007). Pelizaeus-Merzbacher disease: Genetic and cellular pathogenesis. Cell Mol Life Sci 64, 50-65. 75. Garbern, J.Y., and Hobson, G.M. (1993). PLP1-Related Disorders. 76. Kleindorfer, D.O., Dlouhy, S.R., Pratt, V.M., Jones, M.C., Trofatter, J.A., and Hodes, M.E. (1995). In-frame deletion in the proteolipid protein gene of a family with Pelizaeus- Merzbacher disease. Am J Med Genet 55, 405-407. 77. Willard, H.F., and Riordan, J.R. (1985). Assignment of the gene for myelin proteolipid protein to the X chromosome: implications for X-linked myelin disorders. Science 230, 940-942. 78. Dautigny, A., Mattei, M.G., Morello, D., Alliel, P.M., Pham-Dinh, D., Amar, L., Arnaud, D., Simon, D., Mattei, J.F., Guenet, J.L., et al. (1986). The structural gene coding for myelin- associated proteolipid protein is mutated in jimpy mice. Nature 321, 867-869. 79. Koeppen, A.H., Ronca, N.A., Greenfield, E.A., and Hans, M.B. (1987). Defective biosynthesis of proteolipid protein in Pelizaeus-Merzbacher disease. Ann Neurol 21, 159-170. 80. Gencic, S., Abuelo, D., Ambler, M., and Hudson, L.D. (1989). Pelizaeus-Merzbacher disease: an X-linked neurologic disorder of myelin metabolism with a novel mutation in the gene encoding proteolipid protein. Am J Hum Genet 45, 435-442. 81. Hudson, L.D., Puckett, C., Berndt, J., Chan, J., and Gencic, S. (1989). Mutation of the proteolipid protein gene PLP in a human X chromosome-linked myelin disorder. Proc Natl Acad Sci U S A 86, 8128-8131. 82. Folch, J., and Lees, M. (1951). Proteolipides, a new type of tissue lipoproteins; their isolation from brain. J Biol Chem 191, 807-817. 83. Baumrind, N.L., Parkinson, D., Wayne, D.B., Heuser, J.E., and Pearlman, A.L. (1992). EMA: a developmentally regulated cell-surface glycoprotein of CNS neurons that is concentrated at the leading edge of growth cones. Dev Dyn 194, 311-325. 84. Campagnoni, C.W., Garbay, B., Micevych, P., Pribyl, T., Kampf, K., Handley, V.W., and Campagnoni, A.T. (1992). DM20 mRNA splice product of the myelin proteolipid protein gene is expressed in the murine heart. J Neurosci Res 33, 148-155. 85. Yan, Y., Narayanan, V., and Lagenaur, C. (1996). Expression of members of the proteolipid protein gene family in the developing murine central nervous system. J Comp Neurol 370, 465-478. 86. Pribyl, T.M., Campagnoni, C.W., Kampf, K., Ellison, J.A., Landry, C.F., Kashima, T., McMahon, J., and Campagnoni, A.T. (1996). Expression of the myelin basic protein gene locus in

128

neurons and oligodendrocytes in the human fetal central nervous system. J Comp Neurol 374, 342-353. 87. Pribyl, T.M., Campagnoni, C., Kampf, K., Handley, V.W., and Campagnoni, A.T. (1996). The major myelin protein genes are expressed in the human thymus. J Neurosci Res 45, 812- 819. 88. Bongarzone, E.R., Campagnoni, C.W., Kampf, K., Jacobs, E.C., Handley, V.W., Schonmann, V., and Campagnoni, A.T. (1999). Identification of a new exon in the myelin proteolipid protein gene encoding novel protein isoforms that are restricted to the somata of oligodendrocytes and neurons. J Neurosci 19, 8349-8357. 89. Sarret, C., Combes, P., Micheau, P., Gelot, A., Boespflug-Tanguy, O., and Vaurs-Barriere, C. (2010). Novel neuronal proteolipid protein isoforms encoded by the human myelin proteolipid protein 1 gene. Neuroscience 166, 522-538. 90. Popot, J.L., Pham Dinh, D., and Dautigny, A. (1991). Major myelin proteolipid: the 4-alpha- helix topology. J Membr Biol 123, 278. 91. Weimbs, T., and Stoffel, W. (1992). Proteolipid protein (PLP) of CNS myelin: positions of free, disulfide-bonded, and fatty acid thioester-linked cysteine residues and implications for the membrane topology of PLP. Biochemistry 31, 12289-12296. 92. Nave, K.A., Lai, C., Bloom, F.E., and Milner, R.J. (1987). Splice site selection in the proteolipid protein (PLP) gene transcript and primary structure of the DM-20 protein of central nervous system myelin. Proc Natl Acad Sci U S A 84, 5665-5669. 93. Venkatesh, B., Erdmann, M.V., and Brenner, S. (2001). Molecular synapomorphies resolve evolutionary relationships of extant jawed vertebrates. Proc Natl Acad Sci U S A 98, 11382-11387. 94. Hobson, G.M., Huang, Z., Sperle, K., Sistermans, E., Rogan, P.K., Garbern, J.Y., Kolodny, E., Naidu, S., and Cambi, F. (2006). Splice-site contribution in alternative splicing of PLP1 and DM20: molecular studies in oligodendrocytes. Hum Mutat 27, 69-77. 95. Wang, E., Huang, Z., Hobson, G.M., Dimova, N., Sperle, K., McCullough, A., and Cambi, F. (2006). PLP1 alternative splicing in differentiating oligodendrocytes: characterization of an exonic splicing enhancer. J Cell Biochem 97, 999-1016. 96. Wang, E., Dimova, N., and Cambi, F. (2007). PLP/DM20 ratio is regulated by hnRNPH and F and a novel G-rich enhancer in oligodendrocytes. Nucleic Acids Res 35, 4164-4178. 97. Wang, E., Mueller, W.F., Hertel, K.J., and Cambi, F. (2011). G Run-mediated recognition of proteolipid protein and DM20 5' splice sites by U1 small nuclear RNA is regulated by context and proximity to the splice site. J Biol Chem 286, 4059-4071. 98. Harlow, D.E., Saul, K.E., Culp, C.M., Vesely, E.M., and Macklin, W.B. (2014). Expression of proteolipid protein gene in spinal cord stem cells and early oligodendrocyte progenitor cells is dispensable for normal cell migration and myelination. J Neurosci 34, 1333-1343. 99. Trapp, B.D., Nishiyama, A., Cheng, D., and Macklin, W. (1997). Differentiation and death of premyelinating oligodendrocytes in developing rodent brain. J Cell Biol 137, 459-468. 100. Ikenaka, K., Kagawa, T., and Mikoshiba, K. (1992). Selective expression of DM-20, an alternatively spliced myelin proteolipid protein gene product, in developing nervous system and in nonglial cells. J Neurochem 58, 2248-2253. 101. Timsit, S.G., Bally-Cuif, L., Colman, D.R., and Zalc, B. (1992). DM-20 mRNA is expressed during the embryonic development of the nervous system of the mouse. J Neurochem 58, 1172-1175. 102. Spassky, N., Goujet-Zalc, C., Parmantier, E., Olivier, C., Martinez, S., Ivanova, A., Ikenaka, K., Macklin, W., Cerruti, I., Zalc, B., et al. (1998). Multiple restricted origin of oligodendrocytes. J Neurosci 18, 8331-8343.

129

103. Wight, P.A., Duchala, C.S., Readhead, C., and Macklin, W.B. (1993). A myelin proteolipid protein-LacZ fusion protein is developmentally regulated and targeted to the myelin membrane in transgenic mice. J Cell Biol 123, 443-454. 104. Michalski, J.P., Anderson, C., Beauvais, A., De Repentigny, Y., and Kothary, R. (2011). The proteolipid protein promoter drives expression outside of the oligodendrocyte lineage during embryonic and early postnatal development. PLoS One 6, e19772. 105. Greenfield, E.A., Reddy, J., Lees, A., Dyer, C.A., Koul, O., Nguyen, K., Bell, S., Kassam, N., Hinojoza, J., Eaton, M.J., et al. (2006). Monoclonal antibodies to distinct regions of human myelin proteolipid protein simultaneously recognize central nervous system myelin and neurons of many vertebrate species. J Neurosci Res 83, 415-431. 106. Breitwieser, G.E., McLenithan, J.C., Cortese, J.F., Shields, J.M., Oliva, M.M., Majewski, J.L., Machamer, C.E., and Yang, V.W. (1997). Colonic epithelium-enriched protein A4 is a proteolipid that exhibits ion channel characteristics. Am J Physiol 272, C957-965. 107. Kitagawa, K., Sinoway, M.P., Yang, C., Gould, R.M., and Colman, D.R. (1993). A proteolipid protein gene family: expression in sharks and rays and possible evolution from an ancestral gene encoding a pore-forming polypeptide. Neuron 11, 433-448. 108. Yan, Y., Lagenaur, C., and Narayanan, V. (1993). Molecular cloning of M6: identification of a PLP/DM20 gene family. Neuron 11, 423-431. 109. Baracskay, K.L., Duchala, C.S., Miller, R.H., Macklin, W.B., and Trapp, B.D. (2002). Oligodendrogenesis is differentially regulated in gray and white matter of jimpy mice. J Neurosci Res 70, 645-654. 110. Hobson, G.M., Davis, A.P., Stowell, N.C., Kolodny, E.H., Sistermans, E.A., de Coo, I.F., Funanage, V.L., and Marks, H.G. (2000). Mutations in noncoding regions of the proteolipid protein gene in Pelizaeus-Merzbacher disease. Neurology 55, 1089-1096. 111. Bonnet-Dupeyron, M.N., Combes, P., Santander, P., Cailloux, F., Boespflug-Tanguy, O., and Vaurs-Barriere, C. (2008). PLP1 splicing abnormalities identified in Pelizaeus-Merzbacher disease and SPG2 fibroblasts are associated with different types of mutations. Hum Mutat 29, 1028-1036. 112. Sporkel, O., Uschkureit, T., Bussow, H., and Stoffel, W. (2002). Oligodendrocytes expressing exclusively the DM20 isoform of the proteolipid protein gene: myelination and development. Glia 37, 19-30. 113. Shy, M.E., Hobson, G., Jain, M., Boespflug-Tanguy, O., Garbern, J., Sperle, K., Li, W., Gow, A., Rodriguez, D., Bertini, E., et al. (2003). Schwann cell expression of PLP1 but not DM20 is necessary to prevent neuropathy. Ann Neurol 53, 354-365. 114. Boison, D., Bussow, H., D'Urso, D., Muller, H.W., and Stoffel, W. (1995). Adhesive properties of proteolipid protein are responsible for the compaction of CNS myelin sheaths. J Neurosci 15, 5502-5513. 115. Edgar, J.M., McLaughlin, M., Yool, D., Zhang, S.C., Fowler, J.H., Montague, P., Barrie, J.A., McCulloch, M.C., Duncan, I.D., Garbern, J., et al. (2004). Oligodendroglial modulation of fast axonal transport in a mouse model of hereditary spastic paraplegia. J Cell Biol 166, 121-131. 116. Huttemann, M., Zhang, Z., Mullins, C., Bessert, D., Lee, I., Nave, K.A., Appikatla, S., and Skoff, R.P. (2009). Different proteolipid protein mutants exhibit unique metabolic defects. ASN Neuro 1. 117. Appikatla, S., Bessert, D., Lee, I., Huttemann, M., Mullins, C., Somayajulu-Nitu, M., Yao, F., and Skoff, R.P. (2014). Insertion of proteolipid protein into oligodendrocyte mitochondria regulates extracellular pH and adenosine triphosphate. Glia 62, 356-373.

130

118. Jung, M., Sommer, I., Schachner, M., and Nave, K.A. (1996). Monoclonal antibody O10 defines a conformationally sensitive cell-surface epitope of proteolipid protein (PLP): evidence that PLP misfolding underlies dysmyelination in mutant mice. J Neurosci 16, 7920-7929. 119. Karim, S.A., Barrie, J.A., McCulloch, M.C., Montague, P., Edgar, J.M., Kirkham, D., Anderson, T.J., Nave, K.A., Griffiths, I.R., and McLaughlin, M. (2007). PLP overexpression perturbs myelin protein composition and myelination in a mouse model of Pelizaeus-Merzbacher disease. Glia 55, 341-351. 120. McLaughlin, M., Karim, S.A., Montague, P., Barrie, J.A., Kirkham, D., Griffiths, I.R., and Edgar, J.M. (2007). Genetic background influences UPR but not PLP processing in the rumpshaker model of PMD/SPG2. Neurochem Res 32, 167-176. 121. Clayton, B.L., and Popko, B. (2016). Endoplasmic reticulum stress and the unfolded protein response in disorders of myelinating glia. Brain Res 1648, 594-602. 122. Southwood, C.M., Garbern, J., Jiang, W., and Gow, A. (2002). The unfolded protein response modulates disease severity in Pelizaeus-Merzbacher disease. Neuron 36, 585- 596. 123. Southwood, C., and Gow, A. (2001). Molecular pathways of oligodendrocyte apoptosis revealed by mutations in the proteolipid protein gene. Microsc Res Tech 52, 700-708. 124. Kagawa, T., Ikenaka, K., Inoue, Y., Kuriyama, S., Tsujii, T., Nakao, J., Nakajima, K., Aruga, J., Okano, H., and Mikoshiba, K. (1994). Glial cell degeneration and hypomyelination caused by overexpression of myelin proteolipid protein gene. Neuron 13, 427-442. 125. Swanton, E., Holland, A., High, S., and Woodman, P. (2005). Disease-associated mutations cause premature oligomerization of myelin proteolipid protein in the endoplasmic reticulum. Proc Natl Acad Sci U S A 102, 4342-4347. 126. Numata, Y., Morimura, T., Nakamura, S., Hirano, E., Kure, S., Goto, Y.I., and Inoue, K. (2013). Depletion of molecular chaperones from the endoplasmic reticulum and fragmentation of the Golgi apparatus associated with pathogenesis in Pelizaeus-Merzbacher disease. J Biol Chem 288, 7451-7466. 127. Numasawa-Kuroiwa, Y., Okada, Y., Shibata, S., Kishi, N., Akamatsu, W., Shoji, M., Nakanishi, A., Oyama, M., Osaka, H., Inoue, K., et al. (2014). Involvement of ER stress in dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 missense mutations shown by iPSC-derived oligodendrocytes. Stem Cell Reports 2, 648-661. 128. Dhaunchak, A.S., and Nave, K.A. (2007). A common mechanism of PLP/DM20 misfolding causes cysteine-mediated endoplasmic reticulum retention in oligodendrocytes and Pelizaeus-Merzbacher disease. Proc Natl Acad Sci U S A 104, 17813-17818. 129. Roboti, P., Swanton, E., and High, S. (2009). Differences in endoplasmic-reticulum quality control determine the cellular response to disease-associated mutants of proteolipid protein. J Cell Sci 122, 3942-3953. 130. Sima, A.A., Pierson, C.R., Woltjer, R.L., Hobson, G.M., Golden, J.A., Kupsky, W.J., Schauer, G.M., Bird, T.D., Skoff, R.P., and Garbern, J.Y. (2009). Neuronal loss in Pelizaeus- Merzbacher disease differs in various mutations of the proteolipid protein 1. Acta Neuropathol 118, 531-539. 131. Mayer, C.A., Macklin, W.B., Avishai, N., Balan, K., Wilson, C.G., and Miller, M.J. (2009). Mutation in the myelin proteolipid protein gene alters BK and SK channel function in the caudal medulla. Respir Physiol Neurobiol 169, 303-314. 132. Miller, M.J., Kangas, C.D., and Macklin, W.B. (2009). Neuronal expression of the proteolipid protein gene in the medulla of the mouse. J Neurosci Res 87, 2842-2853.

131

133. Miller, M.J., Haxhiu, M.A., Georgiadis, P., Gudz, T.I., Kangas, C.D., and Macklin, W.B. (2003). Proteolipid protein gene mutation induces altered ventilatory response to hypoxia in the myelin-deficient rat. J Neurosci 23, 2265-2273. 134. Aggarwal, S., Yurlova, L., Snaidero, N., Reetz, C., Frey, S., Zimmermann, J., Pahler, G., Janshoff, A., Friedrichs, J., Muller, D.J., et al. (2011). A size barrier limits protein diffusion at the cell surface to generate lipid-rich myelin-membrane sheets. Dev Cell 21, 445-456. 135. Nickels, J.D., Chatterjee, S., Stanley, C.B., Qian, S., Cheng, X., Myles, D.A.A., Standaert, R.F., Elkins, J.G., and Katsaras, J. (2017). The in vivo structure of biological membranes and evidence for lipid domains. PLoS Biol 15, e2002214. 136. Regis, S., Grossi, S., Corsolini, F., Biancheri, R., and Filocamo, M. (2009). PLP1 gene duplication causes overexpression and alteration of the PLP/DM20 splicing balance in fibroblasts from Pelizaeus-Merzbacher disease patients. Biochim Biophys Acta 1792, 548-554. 137. Morimura, T., Numata, Y., Nakamura, S., Hirano, E., Gotoh, L., Goto, Y.I., Urushitani, M., and Inoue, K. (2014). Attenuation of endoplasmic reticulum stress in Pelizaeus-Merzbacher disease by an anti-malaria drug, chloroquine. Exp Biol Med (Maywood) 239, 489-501. 138. Tatar, C.L., Appikatla, S., Bessert, D.A., Paintlia, A.S., Singh, I., and Skoff, R.P. (2010). Increased Plp1 gene expression leads to massive microglial cell activation and inflammation throughout the brain. ASN Neuro 2, e00043. 139. Wishnew, J., Page, K., Wood, S., Galvin, L., Provenzale, J., Escolar, M., Gustafson, K., and Kurtzberg, J. (2014). Umbilical cord blood transplantation to treat Pelizaeus-Merzbacher Disease in 2 young boys. Pediatrics 134, e1451-1457. 140. Morello, D., Dautigny, A., Pham-Dinh, D., and Jolles, P. (1986). Myelin proteolipid protein (PLP and DM-20) transcripts are deleted in jimpy mutant mice. EMBO J 5, 3489-3493. 141. Cerghet, M., Bessert, D.A., Nave, K.A., and Skoff, R.P. (2001). Differential expression of apoptotic markers in jimpy and in Plp overexpressors: evidence for different apoptotic pathways. J Neurocytol 30, 841-855. 142. Nave, K.A., Bloom, F.E., and Milner, R.J. (1987). A single nucleotide difference in the gene for myelin proteolipid protein defines the jimpy mutation in mouse. J Neurochem 49, 1873-1877. 143. Nave, K.A., Lai, C., Bloom, F.E., and Milner, R.J. (1986). Jimpy mutant mouse: a 74-base deletion in the mRNA for myelin proteolipid protein and evidence for a primary defect in RNA splicing. Proc Natl Acad Sci U S A 83, 9264-9268. 144. Barrie, J.A., Montague, P., Karim, S., Kirkham, D., Nave, K.A., Anderson, T.J., Griffiths, I.R., and McLaughlin, M. (2010). Modulation of rumpshaker phenotype with wild-type PLP/DM20 suggests several pathogenic mechanisms. J Neurosci Res 88, 2135-2145. 145. Fanarraga, M.L., Sommer, I.U., Griffiths, I.R., Montague, P., Groome, N.P., Nave, K.A., Schneider, A., Brophy, P.J., and Kennedy, P.G. (1993). Oligodendrocyte development and differentiation in the rumpshaker mutation. Glia 9, 146-156. 146. Mitchell, L.S., Gillespie, S.C., McAllister, F., Fanarraga, M.L., Kirkham, D., Kelly, B., Brophy, P.J., Griffiths, I.R., Montague, P., and Kennedy, P.G. (1992). Developmental expression of major myelin protein genes in the CNS of X-linked hypomyelinating mutant rumpshaker. J Neurosci Res 33, 205-217. 147. Griffiths, I.R., Scott, I., McCulloch, M.C., Barrie, J.A., McPhilemy, K., and Cattanach, B.M. (1990). Rumpshaker mouse: a new X-linked mutation affecting myelination: evidence for a defect in PLP expression. J Neurocytol 19, 273-283. 148. Nadon, N.L., and Duncan, I.D. (1995). Gene expression and oligodendrocyte development in the myelin deficient rat. J Neurosci Res 41, 96-104.

132

149. Boison, D., and Stoffel, W. (1989). Myelin-deficient rat: a point mutation in exon III (A----C, Thr75----Pro) of the myelin proteolipid protein causes dysmyelination and oligodendrocyte death. EMBO J 8, 3295-3302. 150. Duncan, I.D., Hammang, J.P., and Trapp, B.D. (1987). Abnormal compact myelin in the myelin-deficient rat: absence of proteolipid protein correlates with a defect in the intraperiod line. Proc Natl Acad Sci U S A 84, 6287-6291. 151. Yanagisawa, K., Duncan, I.D., Hammang, J.P., and Quarles, R.H. (1986). Myelin-deficient rat: analysis of myelin proteins. J Neurochem 47, 1901-1907. 152. Sypecka, J., and Domanska-Janik, K. (2005). Rabbit paralytic tremor phenotype--a plp1 gene mutation as a model of human Pelizaeus-Merzbacher disease. Acta Neurobiol Exp (Wars) 65, 221-229. 153. Tosic, M., Dolivo, M., Amiguet, P., Domanska-Janik, K., and Matthieu, J.M. (1993). Paralytic tremor (pt) rabbit: a sex-linked mutation affecting proteolipid protein-gene expression. Brain Res 625, 307-312. 154. Tosic, M., Matthey, B., Gow, A., Lazzarini, R.A., and Matthieu, J.M. (1997). Intracellular transport of the DM-20 bearing shaking pup (shp) mutation and its possible phenotypic consequences. J Neurosci Res 50, 844-852. 155. Nadon, N.L., and Duncan, I.D. (1996). Molecular analysis of glial cell development in the canine 'shaking pup' mutant. Dev Neurosci 18, 174-184. 156. Nadon, N.L., Duncan, I.D., and Hudson, L.D. (1990). A point mutation in the proteolipid protein gene of the 'shaking pup' interrupts oligodendrocyte development. Development 110, 529-537. 157. Yanagisawa, K., Moller, J.R., Duncan, I.D., and Quarles, R.H. (1987). Disproportional expression of proteolipid protein and DM-20 in the X-linked, dysmyelinating shaking pup mutant. J Neurochem 49, 1912-1917. 158. Mayer, J.A., Griffiths, I.R., Goldman, J.E., Smith, C.M., Cooksey, E., Radcliff, A.B., and Duncan, I.D. (2015). Modeling the natural history of Pelizaeus-Merzbacher disease. Neurobiol Dis 75, 115-130. 159. Inoue, Y., Kagawa, T., Matsumura, Y., Ikenaka, K., and Mikoshiba, K. (1996). Cell death of oligodendrocytes or demyelination induced by overexpression of proteolipid protein depending on expressed gene dosage. Neurosci Res 25, 161-172. 160. Yool, D.A., Edgar, J.M., Montague, P., and Malcolm, S. (2000). The proteolipid protein gene and myelin disorders in man and animal models. Hum Mol Genet 9, 987-992. 161. Clark, K., Sakowski, L., Sperle, K., Banser, L., Landel, C.P., Bessert, D.A., Skoff, R.P., and Hobson, G.M. (2013). Gait abnormalities and progressive myelin degeneration in a new murine model of Pelizaeus-Merzbacher disease with tandem genomic duplication. J Neurosci 33, 11788-11799. 162. Duncan, I.D. (1990). Dissection of the phenotype and genotype of the X-linked myelin mutants. Ann N Y Acad Sci 605, 110-121. 163. Ishii, A., Dutta, R., Wark, G.M., Hwang, S.I., Han, D.K., Trapp, B.D., Pfeiffer, S.E., and Bansal, R. (2009). Human myelin proteome and comparative analysis with mouse myelin. Proc Natl Acad Sci U S A 106, 14605-14610. 164. Shimojima, K., Inoue, T., Imai, Y., Arai, Y., Komoike, Y., Sugawara, M., Fujita, T., Ideguchi, H., Yasumoto, S., Kanno, H., et al. (2012). Reduced PLP1 expression in induced pluripotent stem cells derived from a Pelizaeus-Merzbacher disease patient with a partial PLP1 duplication. J Hum Genet 57, 580-586. 165. Douvaras, P., Wang, J., Zimmer, M., Hanchuk, S., O'Bara, M.A., Sadiq, S., Sim, F.J., Goldman, J., and Fossati, V. (2014). Efficient generation of myelinating oligodendrocytes from

133

primary progressive multiple sclerosis patients by induced pluripotent stem cells. Stem Cell Reports 3, 250-259. 166. Wang, S., Bates, J., Li, X., Schanz, S., Chandler-Militello, D., Levine, C., Maherali, N., Studer, L., Hochedlinger, K., Windrem, M., et al. (2013). Human iPSC-derived oligodendrocyte progenitor cells can myelinate and rescue a mouse model of congenital hypomyelination. Cell Stem Cell 12, 252-264. 167. Briggs, R., and King, T.J. (1952). Transplantation of Living Nuclei From Blastula Cells into Enucleated Frogs' Eggs. Proc Natl Acad Sci U S A 38, 455-463. 168. Gurdon, J.B., Laskey, R.A., and Reeves, O.R. (1975). The developmental capacity of nuclei transplanted from keratinized skin cells of adult frogs. J Embryol Exp Morphol 34, 93- 112. 169. Gurdon, J.B. (1962). Adult frogs derived from the nuclei of single somatic cells. Dev Biol 4, 256-273. 170. Evans, M.J., and Kaufman, M.H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154-156. 171. Martin, G.R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78, 7634-7638. 172. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-1147. 173. Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., and Bongso, A. (2000). Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 18, 399-404. 174. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676. 175. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872. 176. Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., et al. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917-1920. 177. Ye, Z., Zhan, H., Mali, P., Dowey, S., Williams, D.M., Jang, Y.Y., Dang, C.V., Spivak, J.L., Moliterno, A.R., and Cheng, L. (2009). Human-induced pluripotent stem cells from blood cells of healthy donors and patients with acquired blood disorders. Blood 114, 5473- 5480. 178. Stadtfeld, M., Brennand, K., and Hochedlinger, K. (2008). Reprogramming of pancreatic beta cells into induced pluripotent stem cells. Curr Biol 18, 890-894. 179. Eminli, S., Utikal, J., Arnold, K., Jaenisch, R., and Hochedlinger, K. (2008). Reprogramming of neural progenitor cells into induced pluripotent stem cells in the absence of exogenous Sox2 expression. Stem Cells 26, 2467-2474. 180. Aoi, T., Yae, K., Nakagawa, M., Ichisaka, T., Okita, K., Takahashi, K., Chiba, T., and Yamanaka, S. (2008). Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science 321, 699-702. 181. Utikal, J., Maherali, N., Kulalert, W., and Hochedlinger, K. (2009). Sox2 is dispensable for the reprogramming of melanocytes and melanoma cells into induced pluripotent stem cells. J Cell Sci 122, 3502-3510.

134

182. Sun, N., Panetta, N.J., Gupta, D.M., Wilson, K.D., Lee, A., Jia, F., Hu, S., Cherry, A.M., Robbins, R.C., Longaker, M.T., et al. (2009). Feeder-free derivation of induced pluripotent stem cells from adult human adipose stem cells. Proc Natl Acad Sci U S A 106, 15720-15725. 183. Maherali, N., Ahfeldt, T., Rigamonti, A., Utikal, J., Cowan, C., and Hochedlinger, K. (2008). A high-efficiency system for the generation and study of human induced pluripotent stem cells. Cell Stem Cell 3, 340-345. 184. Douvaras, P., and Fossati, V. (2015). Generation and isolation of oligodendrocyte progenitor cells from human pluripotent stem cells. Nat Protoc 10, 1143-1154. 185. Wood, P.M., and Bunge, R.P. (1986). Myelination of cultured dorsal root ganglion neurons by oligodendrocytes obtained from adult rats. J Neurol Sci 74, 153-169. 186. Lubetzki, C., Demerens, C., Anglade, P., Villarroya, H., Frankfurter, A., Lee, V.M., and Zalc, B. (1993). Even in culture, oligodendrocytes myelinate solely axons. Proc Natl Acad Sci U S A 90, 6820-6824. 187. Mei, F., Fancy, S.P., Shen, Y.A., Niu, J., Zhao, C., Presley, B., Miao, E., Lee, S., Mayoral, S.R., Redmond, S.A., et al. (2014). Micropillar arrays as a high-throughput screening platform for therapeutics in multiple sclerosis. Nat Med 20, 954-960. 188. Bechler, M.E., Byrne, L., and Ffrench-Constant, C. (2015). CNS Myelin Sheath Lengths Are an Intrinsic Property of Oligodendrocytes. Curr Biol 25, 2411-2416. 189. Windrem, M.S., Schanz, S.J., Guo, M., Tian, G.F., Washco, V., Stanwood, N., Rasband, M., Roy, N.S., Nedergaard, M., Havton, L.A., et al. (2008). Neonatal chimerization with human glial progenitor cells can both remyelinate and rescue the otherwise lethally hypomyelinated shiverer mouse. Cell Stem Cell 2, 553-565. 190. Windrem, M.S., Schanz, S.J., Morrow, C., Munir, J., Chandler-Militello, D., Wang, S., and Goldman, S.A. (2014). A competitive advantage by neonatally engrafted human glial progenitors yields mice whose brains are chimeric for human glia. J Neurosci 34, 16153- 16161. 191. Wilson, H.V. (1907). A New Method by Which Sponges May Be Artificially Reared. Science 25, 912-915. 192. Reynolds, B.A., and Weiss, S. (1992). Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255, 1707-1710. 193. Choi, S.H., Kim, Y.H., Hebisch, M., Sliwinski, C., Lee, S., D'Avanzo, C., Chen, H., Hooli, B., Asselin, C., Muffat, J., et al. (2014). A three-dimensional human neural cell culture model of Alzheimer's disease. Nature 515, 274-278. 194. Li, M.L., Aggeler, J., Farson, D.A., Hatier, C., Hassell, J., and Bissell, M.J. (1987). Influence of a reconstituted basement membrane and its components on casein gene expression and secretion in mouse mammary epithelial cells. Proc Natl Acad Sci U S A 84, 136-140. 195. Evans, M. (2011). Discovering pluripotency: 30 years of mouse embryonic stem cells. Nat Rev Mol Cell Biol 12, 680-686. 196. Spence, J.R., Mayhew, C.N., Rankin, S.A., Kuhar, M.F., Vallance, J.E., Tolle, K., Hoskins, E.E., Kalinichenko, V.V., Wells, S.I., Zorn, A.M., et al. (2011). Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro. Nature 470, 105-109. 197. Eiraku, M., Takata, N., Ishibashi, H., Kawada, M., Sakakura, E., Okuda, S., Sekiguchi, K., Adachi, T., and Sasai, Y. (2011). Self-organizing optic-cup morphogenesis in three- dimensional culture. Nature 472, 51-56. 198. Nakano, T., Ando, S., Takata, N., Kawada, M., Muguruma, K., Sekiguchi, K., Saito, K., Yonemura, S., Eiraku, M., and Sasai, Y. (2012). Self-formation of optic cups and storable stratified neural retina from human ESCs. Cell Stem Cell 10, 771-785.

135

199. Eiraku, M., Watanabe, K., Matsuo-Takasaki, M., Kawada, M., Yonemura, S., Matsumura, M., Wataya, T., Nishiyama, A., Muguruma, K., and Sasai, Y. (2008). Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem Cell 3, 519-532. 200. Birey, F., Andersen, J., Makinson, C.D., Islam, S., Wei, W., Huber, N., Fan, H.C., Metzler, K.R.C., Panagiotakos, G., Thom, N., et al. (2017). Assembly of functionally integrated human forebrain spheroids. Nature 545, 54-59. 201. Lancaster, M.A., Renner, M., Martin, C.A., Wenzel, D., Bicknell, L.S., Hurles, M.E., Homfray, T., Penninger, J.M., Jackson, A.P., and Knoblich, J.A. (2013). Cerebral organoids model human brain development and microcephaly. Nature 501, 373-379. 202. Renner, M., Lancaster, M.A., Bian, S., Choi, H., Ku, T., Peer, A., Chung, K., and Knoblich, J.A. (2017). Self-organized developmental patterning and differentiation in cerebral organoids. EMBO J 36, 1316-1329. 203. Kadoshima, T., Sakaguchi, H., Nakano, T., Soen, M., Ando, S., Eiraku, M., and Sasai, Y. (2013). Self-organization of axial polarity, inside-out layer pattern, and species-specific progenitor dynamics in human ES cell-derived neocortex. Proc Natl Acad Sci U S A 110, 20284-20289. 204. Eiraku, M., and Sasai, Y. (2012). Self-formation of layered neural structures in three- dimensional culture of ES cells. Curr Opin Neurobiol 22, 768-777. 205. Camp, J.G., Badsha, F., Florio, M., Kanton, S., Gerber, T., Wilsch-Brauninger, M., Lewitus, E., Sykes, A., Hevers, W., Lancaster, M., et al. (2015). Human cerebral organoids recapitulate gene expression programs of fetal neocortex development. Proc Natl Acad Sci U S A 112, 15672-15677. 206. Luo, C., Lancaster, M.A., Castanon, R., Nery, J.R., Knoblich, J.A., and Ecker, J.R. (2016). Cerebral Organoids Recapitulate Epigenomic Signatures of the Human Fetal Brain. Cell Rep 17, 3369-3384. 207. Lancaster, M.A., and Knoblich, J.A. (2014). Generation of cerebral organoids from human pluripotent stem cells. Nat Protoc 9, 2329-2340. 208. Li, Y., Muffat, J., Omer, A., Bosch, I., Lancaster, M.A., Sur, M., Gehrke, L., Knoblich, J.A., and Jaenisch, R. (2017). Induction of Expansion and Folding in Human Cerebral Organoids. Cell Stem Cell 20, 385-396 e383. 209. Quadrato, G., Nguyen, T., Macosko, E.Z., Sherwood, J.L., Min Yang, S., Berger, D.R., Maria, N., Scholvin, J., Goldman, M., Kinney, J.P., et al. (2017). Cell diversity and network dynamics in photosensitive human brain organoids. Nature 545, 48-53. 210. Kevelam, S.H., Steenweg, M.E., Srivastava, S., Helman, G., Naidu, S., Schiffmann, R., Blaser, S., Vanderver, A., Wolf, N.I., and van der Knaap, M.S. (2016). Update on Leukodystrophies: A Historical Perspective and Adapted Definition. Neuropediatrics. 211. Helman, G., Van Haren, K., Escolar, M.L., and Vanderver, A. (2015). Emerging treatments for pediatric leukodystrophies. Pediatr Clin North Am 62, 649-666. 212. Helman, G., Van Haren, K., Bonkowsky, J.L., Bernard, G., Pizzino, A., Braverman, N., Suhr, D., Patterson, M.C., Ali Fatemi, S., Leonard, J., et al. (2015). Disease specific therapies in leukodystrophies and leukoencephalopathies. Mol Genet Metab 114, 527-536. 213. Hobson, G.M., and Garbern, J.Y. (2012). Pelizaeus-Merzbacher disease, Pelizaeus- Merzbacher-like disease 1, and related hypomyelinating disorders. Semin Neurol 32, 62- 67. 214. Numata, Y., Gotoh, L., Iwaki, A., Kurosawa, K., Takanashi, J., Deguchi, K., Yamamoto, T., Osaka, H., and Inoue, K. (2014). Epidemiological, clinical, and genetic landscapes of hypomyelinating leukodystrophies. J Neurol 261, 752-758.

136

215. LeVine, S.M., Wong, D., and Macklin, W.B. (1990). Developmental expression of proteolipid protein and DM20 mRNAs and proteins in the rat brain. Dev Neurosci 12, 235-250. 216. Phillips, R.J. (1954). Jimpy, a new totally sexlinked gene in the house mouse. Z Indukt Abstamm Vererbungsl 86, 322-326. 217. Eicher, E.M., and Hoppe, P.C. (1973). Use of chimeras to transmit lethal genes in the mouse and to demonstrate allelism of the two X-linked male lethal genes jp and msd. J Exp Zool 183, 181-184. 218. Griffiths, I.R., Duncan, I.D., McCulloch, M., and Harvey, M.J. (1981). Shaking pups: a disorder of central myelination in the Spaniel dog. Part 1. Clinical, genetic and light- microscopical observations. J Neurol Sci 50, 423-433. 219. Griffiths, I., Klugmann, M., Anderson, T., Thomson, C., Vouyiouklis, D., and Nave, K.A. (1998). Current concepts of PLP and its role in the nervous system. Microsc Res Tech 41, 344-358. 220. Laukka, J.J., Kamholz, J., Bessert, D., and Skoff, R.P. (2016). Novel pathologic findings in patients with Pelizaeus-Merzbacher disease. Neurosci Lett 627, 222-232. 221. Simons, M., Kramer, E.M., Macchi, P., Rathke-Hartlieb, S., Trotter, J., Nave, K.A., and Schulz, J.B. (2002). Overexpression of the myelin proteolipid protein leads to accumulation of cholesterol and proteolipid protein in endosomes/lysosomes: implications for Pelizaeus- Merzbacher disease. J Cell Biol 157, 327-336. 222. Gow, A., Friedrich, V.L., Jr., and Lazzarini, R.A. (1994). Many naturally occurring mutations of myelin proteolipid protein impair its intracellular transport. J Neurosci Res 37, 574- 583. 223. Gow, A., and Sharma, R. (2003). The unfolded protein response in protein aggregating diseases. Neuromolecular Med 4, 73-94. 224. Laukka, J.J., Makki, M.I., Lafleur, T., Stanley, J., Kamholz, J., and Garbern, J.Y. (2014). Diffusion tensor imaging of patients with proteolipid protein 1 gene mutations. J Neurosci Res 92, 1723-1732. 225. Sherry, S.T., Ward, M.H., Kholodov, M., Baker, J., Phan, L., Smigielski, E.M., and Sirotkin, K. (2001). dbSNP: the NCBI database of genetic variation. Nucleic Acids Res 29, 308-311. 226. Pruitt, K.D., Brown, G.R., Hiatt, S.M., Thibaud-Nissen, F., Astashyn, A., Ermolaeva, O., Farrell, C.M., Hart, J., Landrum, M.J., McGarvey, K.M., et al. (2014). RefSeq: an update on mammalian reference sequences. Nucleic Acids Res 42, D756-763. 227. Bock, C., Kiskinis, E., Verstappen, G., Gu, H., Boulting, G., Smith, Z.D., Ziller, M., Croft, G.F., Amoroso, M.W., Oakley, D.H., et al. (2011). Reference Maps of human ES and iPS cell variation enable high-throughput characterization of pluripotent cell lines. Cell 144, 439- 452. 228. Sim, F.J., McClain, C.R., Schanz, S.J., Protack, T.L., Windrem, M.S., and Goldman, S.A. (2011). CD140a identifies a population of highly myelinogenic, migration-competent and efficiently engrafting human oligodendrocyte progenitor cells. Nat Biotechnol 29, 934- 941. 229. Axten, J.M., Romeril, S.P., Shu, A., Ralph, J., Medina, J.R., Feng, Y., Li, W.H., Grant, S.W., Heerding, D.A., Minthorn, E., et al. (2013). Discovery of GSK2656157: An Optimized PERK Inhibitor Selected for Preclinical Development. ACS Med Chem Lett 4, 964-968. 230. Tsaytler, P., Harding, H.P., Ron, D., and Bertolotti, A. (2011). Selective inhibition of a regulatory subunit of protein phosphatase 1 restores proteostasis. Science 332, 91-94. 231. Chan, J.R., Watkins, T.A., Cosgaya, J.M., Zhang, C., Chen, L., Reichardt, L.F., Shooter, E.M., and Barres, B.A. (2004). NGF controls axonal receptivity to myelination by Schwann cells or oligodendrocytes. Neuron 43, 183-191.

137

232. Yamazaki, R., Ishibashi, T., Baba, H., and Yamaguchi, Y. (2016). Knockdown of Unconventional Myosin ID Expression Induced Morphological Change in Oligodendrocytes. ASN Neuro 8. 233. Gow, A., and Lazzarini, R.A. (1996). A cellular mechanism governing the severity of Pelizaeus-Merzbacher disease. Nat Genet 13, 422-428. 234. Somers, A., Jean, J.C., Sommer, C.A., Omari, A., Ford, C.C., Mills, J.A., Ying, L., Sommer, A.G., Jean, J.M., Smith, B.W., et al. (2010). Generation of transgene-free lung disease-specific human induced pluripotent stem cells using a single excisable lentiviral stem cell cassette. Stem Cells 28, 1728-1740. 235. Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S., Hong, H., Nakagawa, M., Tanabe, K., Tezuka, K., et al. (2011). A more efficient method to generate integration-free human iPS cells. Nat Methods 8, 409-412. 236. Diskin, S.J., Li, M., Hou, C., Yang, S., Glessner, J., Hakonarson, H., Bucan, M., Maris, J.M., and Wang, K. (2008). Adjustment of genomic waves in signal intensities from whole-genome SNP genotyping platforms. Nucleic Acids Res 36, e126. 237. Trapnell, C., Pachter, L., and Salzberg, S.L. (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105-1111. 238. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. (2010). Transcript assembly and quantification by RNA- Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28, 511-515. 239. Taube, J.R., Sperle, K., Banser, L., Seeman, P., Cavan, B.C., Garbern, J.Y., and Hobson, G.M. (2014). PMD patient mutations reveal a long-distance intronic interaction that regulates PLP1/DM20 alternative splicing. Hum Mol Genet 23, 5464-5478. 240. Wood, P.L., Smith, T., Pelzer, L., and Goodenowe, D.B. (2011). Targeted metabolomic analyses of cellular models of pelizaeus-merzbacher disease reveal plasmalogen and myo-inositol solute carrier dysfunction. Lipids Health Dis 10, 102. 241. Carango, P., Funanage, V.L., Quiros, R.E., Debruyn, C.S., and Marks, H.G. (1995). Overexpression of DM20 messenger RNA in two brothers with Pelizaeus-Merzbacher disease. Ann Neurol 38, 610-617. 242. Pasca, A.M., Sloan, S.A., Clarke, L.E., Tian, Y., Makinson, C.D., Huber, N., Kim, C.H., Park, J.Y., O'Rourke, N.A., Nguyen, K.D., et al. (2015). Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat Methods 12, 671-678. 243. Renner, M., Lancaster, M.A., Bian, S., Choi, H., Ku, T., Peer, A., Chung, K., and Knoblich, J.A. (2017). Self-organized developmental patterning and differentiation in cerebral organoids. EMBO J. 244. Simons, M., and Nave, K.A. (2015). Oligodendrocytes: Myelination and Axonal Support. Cold Spring Harb Perspect Biol 8, a020479. 245. Rowitch, D.H. (2004). Glial specification in the vertebrate neural tube. Nat Rev Neurosci 5, 409-419. 246. Najm, F.J., Madhavan, M., Zaremba, A., Shick, E., Karl, R.T., Factor, D.C., Miller, T.E., Nevin, Z.S., Kantor, C., Sargent, A., et al. (2015). Drug-based modulation of endogenous stem cells promotes functional remyelination in vivo. Nature 522, 216-220. 247. Nevin, Z.S., Factor, D.C., Karl, R.T., Douvaras, P., Laukka, J., Windrem, M.S., Goldman, S.A., Fossati, V., Hobson, G.M., and Tesar, P.J. (2017). Modeling the Mutational and Phenotypic Landscapes of Pelizaeus-Merzbacher Disease with Human iPSC-Derived Oligodendrocytes. Am J Hum Genet 100, 617-634.

138

248. Bercury, K.K., and Macklin, W.B. (2015). Dynamics and mechanisms of CNS myelination. Dev Cell 32, 447-458. 249. Sommer, A.G., Rozelle, S.S., Sullivan, S., Mills, J.A., Park, S.M., Smith, B.W., Iyer, A.M., French, D.L., Kotton, D.N., Gadue, P., et al. (2012). Generation of human induced pluripotent stem cells from peripheral blood using the STEMCCA lentiviral vector. J Vis Exp. 250. Zhou, T., Benda, C., Dunzinger, S., Huang, Y., Ho, J.C., Yang, J., Wang, Y., Zhang, Y., Zhuang, Q., Li, Y., et al. (2012). Generation of human induced pluripotent stem cells from urine samples. Nat Protoc 7, 2080-2089. 251. Najm, F.J., Zaremba, A., Caprariello, A.V., Nayak, S., Freundt, E.C., Scacheri, P.C., Miller, R.H., and Tesar, P.J. (2011). Rapid and robust generation of functional oligodendrocyte progenitor cells from epiblast stem cells. Nat Methods 8, 957-962. 252. Raff, M.C., Lillien, L.E., Richardson, W.D., Burne, J.F., and Noble, M.D. (1988). Platelet- derived growth factor from astrocytes drives the clock that times oligodendrocyte development in culture. Nature 333, 562-565. 253. Hart, I.K., Richardson, W.D., Bolsover, S.R., and Raff, M.C. (1989). PDGF and intracellular signaling in the timing of oligodendrocyte differentiation. J Cell Biol 109, 3411-3417. 254. Fyffe-Maricich, S.L., Karlo, J.C., Landreth, G.E., and Miller, R.H. (2011). The ERK2 mitogen- activated protein kinase regulates the timing of oligodendrocyte differentiation. J Neurosci 31, 843-850. 255. Piao, J., Major, T., Auyeung, G., Policarpio, E., Menon, J., Droms, L., Gutin, P., Uryu, K., Tchieu, J., Soulet, D., et al. (2015). Human embryonic stem cell-derived oligodendrocyte progenitors remyelinate the brain and rescue behavioral deficits following radiation. Cell Stem Cell 16, 198-210. 256. Vierbuchen, T., Ostermeier, A., Pang, Z.P., Kokubu, Y., Sudhof, T.C., and Wernig, M. (2010). Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463, 1035-1041. 257. Thoma, E.C., Merkl, C., Heckel, T., Haab, R., Knoflach, F., Nowaczyk, C., Flint, N., Jagasia, R., Jensen Zoffmann, S., Truong, H.H., et al. (2014). Chemical conversion of human fibroblasts into functional Schwann cells. Stem Cell Reports 3, 539-547. 258. Najm, F.J., Lager, A.M., Zaremba, A., Wyatt, K., Caprariello, A.V., Factor, D.C., Karl, R.T., Maeda, T., Miller, R.H., and Tesar, P.J. (2013). Transcription factor-mediated reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol 31, 426-433. 259. Yang, N., Zuchero, J.B., Ahlenius, H., Marro, S., Ng, Y.H., Vierbuchen, T., Hawkins, J.S., Geissler, R., Barres, B.A., and Wernig, M. (2013). Generation of oligodendroglial cells by direct lineage conversion. Nat Biotechnol 31, 434-439. 260. Venkatesh, K., Srikanth, L., Vengamma, B., Chandrasekhar, C., Prasad, B.C., and Sarma, P.V. (2015). In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones. Neurosci Lett 588, 36-41. 261. Cahoy, J.D., Emery, B., Kaushal, A., Foo, L.C., Zamanian, J.L., Christopherson, K.S., Xing, Y., Lubischer, J.L., Krieg, P.A., Krupenko, S.A., et al. (2008). A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function. J Neurosci 28, 264-278. 262. Zhang, Y., Chen, K., Sloan, S.A., Bennett, M.L., Scholze, A.R., O'Keeffe, S., Phatnani, H.P., Guarnieri, P., Caneda, C., Ruderisch, N., et al. (2014). An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 34, 11929-11947.

139

263. Dugas, J.C., Tai, Y.C., Speed, T.P., Ngai, J., and Barres, B.A. (2006). Functional genomic analysis of oligodendrocyte differentiation. J Neurosci 26, 10967-10983. 264. Wu, A.R., Neff, N.F., Kalisky, T., Dalerba, P., Treutlein, B., Rothenberg, M.E., Mburu, F.M., Mantalas, G.L., Sim, S., Clarke, M.F., et al. (2014). Quantitative assessment of single-cell RNA-sequencing methods. Nat Methods 11, 41-46. 265. Marx, V. (2013). Is super-resolution microscopy right for you? Nat Methods 10, 1157-1163. 266. Chen, F., Tillberg, P.W., and Boyden, E.S. (2015). Optical imaging. Expansion microscopy. Science 347, 543-548. 267. Fannon, J., Tarmier, W., and Fulton, D. (2015). Neuronal activity and AMPA-type glutamate receptor activation regulates the morphological development of oligodendrocyte precursor cells. Glia 63, 1021-1035. 268. Yang, B., Treweek, J.B., Kulkarni, R.P., Deverman, B.E., Chen, C.K., Lubeck, E., Shah, S., Cai, L., and Gradinaru, V. (2014). Single-cell phenotyping within transparent intact tissue through whole-body clearing. Cell 158, 945-958. 269. Chung, K., Wallace, J., Kim, S.Y., Kalyanasundaram, S., Andalman, A.S., Davidson, T.J., Mirzabekov, J.J., Zalocusky, K.A., Mattis, J., Denisin, A.K., et al. (2013). Structural and molecular interrogation of intact biological systems. Nature 497, 332-337. 270. Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308. 271. Peters, D.T., Cowan, C.A., and Musunuru, K. (2008). Genome editing in human pluripotent stem cells. In StemBook. (Cambridge (MA). 272. Musunuru, K. (2013). Genome editing of human pluripotent stem cells to generate human cellular disease models. Dis Model Mech 6, 896-904. 273. Soldner, F., Laganiere, J., Cheng, A.W., Hockemeyer, D., Gao, Q., Alagappan, R., Khurana, V., Golbe, L.I., Myers, R.H., Lindquist, S., et al. (2011). Generation of isogenic pluripotent stem cells differing exclusively at two early onset Parkinson point mutations. Cell 146, 318-331. 274. Mandal, P.K., Ferreira, L.M., Collins, R., Meissner, T.B., Boutwell, C.L., Friesen, M., Vrbanac, V., Garrison, B.S., Stortchevoi, A., Bryder, D., et al. (2014). Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell Stem Cell 15, 643- 652. 275. Ananiev, G., Williams, E.C., Li, H., and Chang, Q. (2011). Isogenic pairs of wild type and mutant induced pluripotent stem cell (iPSC) lines from Rett syndrome patients as in vitro disease model. PLoS One 6, e25255. 276. Piguet, F., Sondhi, D., Piraud, M., Fouquet, F., Hackett, N.R., Ahouansou, O., Vanier, M.T., Bieche, I., Aubourg, P., Crystal, R.G., et al. (2012). Correction of brain oligodendrocytes by AAVrh.10 intracerebral gene therapy in metachromatic leukodystrophy mice. Hum Gene Ther 23, 903-914. 277. Vanderver, A., Simons, C., Helman, G., Crawford, J., Wolf, N.I., Bernard, G., Pizzino, A., Schmidt, J.L., Takanohashi, A., Miller, D., et al. (2016). Whole exome sequencing in patients with white matter abnormalities. Ann Neurol 79, 1031-1037. 278. Lin, W., and Popko, B. (2009). Endoplasmic reticulum stress in disorders of myelinating cells. Nat Neurosci 12, 379-385. 279. Way, S.W., and Popko, B. (2016). Harnessing the integrated stress response for the treatment of multiple sclerosis. Lancet Neurol 15, 434-443. 280. Roussel, B.D., Kruppa, A.J., Miranda, E., Crowther, D.C., Lomas, D.A., and Marciniak, S.J. (2013). Endoplasmic reticulum dysfunction in neurological disease. Lancet Neurol 12, 105-118.

140

281. Hetz, C., and Mollereau, B. (2014). Disturbance of endoplasmic reticulum proteostasis in neurodegenerative diseases. Nat Rev Neurosci 15, 233-249. 282. Richter, J.D., and Coller, J. (2015). Pausing on Polyribosomes: Make Way for Elongation in Translational Control. Cell 163, 292-300. 283. Lin, Y., Pang, X., Huang, G., Jamison, S., Fang, J., Harding, H.P., Ron, D., and Lin, W. (2014). Impaired eukaryotic translation initiation factor 2B activity specifically in oligodendrocytes reproduces the pathology of vanishing white matter disease in mice. J Neurosci 34, 12182-12191. 284. Wolf, N.I., Vanderver, A., van Spaendonk, R.M., Schiffmann, R., Brais, B., Bugiani, M., Sistermans, E., Catsman-Berrevoets, C., Kros, J.M., Pinto, P.S., et al. (2014). Clinical spectrum of 4H leukodystrophy caused by POLR3A and POLR3B mutations. Neurology 83, 1898-1905. 285. Chambers, D.M., Peters, J., and Abbott, C.M. (1998). The lethal mutation of the mouse wasted (wst) is a deletion that abolishes expression of a tissue-specific isoform of translation elongation factor 1alpha, encoded by the Eef1a2 gene. Proc Natl Acad Sci U S A 95, 4463-4468. 286. Abbott, C.M., Newbery, H.J., Squires, C.E., Brownstein, D., Griffiths, L.A., and Soares, D.C. (2009). eEF1A2 and neuronal degeneration. Biochem Soc Trans 37, 1293-1297. 287. Simons, C., Griffin, L.B., Helman, G., Golas, G., Pizzino, A., Bloom, M., Murphy, J.L., Crawford, J., Evans, S.H., Topper, S., et al. (2015). Loss-of-function alanyl-tRNA synthetase mutations cause an autosomal-recessive early-onset epileptic encephalopathy with persistent myelination defect. Am J Hum Genet 96, 675-681. 288. Park, S.G., Schimmel, P., and Kim, S. (2008). Aminoacyl tRNA synthetases and their connections to disease. Proc Natl Acad Sci U S A 105, 11043-11049. 289. Wolf, N.I., Toro, C., Kister, I., Latif, K.A., Leventer, R., Pizzino, A., Simons, C., Abbink, T.E., Taft, R.J., van der Knaap, M.S., et al. (2015). DARS-associated leukoencephalopathy can mimic a steroid-responsive neuroinflammatory disorder. Neurology 84, 226-230. 290. Latour, P., Thauvin-Robinet, C., Baudelet-Mery, C., Soichot, P., Cusin, V., Faivre, L., Locatelli, M.C., Mayencon, M., Sarcey, A., Broussolle, E., et al. (2010). A major determinant for binding and aminoacylation of tRNA(Ala) in cytoplasmic Alanyl-tRNA synthetase is mutated in dominant axonal Charcot-Marie-Tooth disease. Am J Hum Genet 86, 77-82. 291. Lancaster, M.A., Corsini, N.S., Wolfinger, S., Gustafson, E.H., Phillips, A.W., Burkard, T.R., Otani, T., Livesey, F.J., and Knoblich, J.A. (2017). Guided self-organization and cortical plate formation in human brain organoids. Nat Biotechnol. 292. Dumas, L., Heitz-Marchaland, C., Fouquet, S., Suter, U., Livet, J., Moreau-Fauvarque, C., and Chedotal, A. (2015). Multicolor analysis of oligodendrocyte morphology, interactions, and development with Brainbow. Glia 63, 699-717.

141