The Genetic Code of Genes and Genomes

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC The GeneticNOT FOR SALE OR DISTRIBUTION Code of GenesNOT FOR SALE OR DISTRIBUTION and© Jones &Genomes Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

LEARNING OBJECTIVES © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE■■ To ORunderstand DISTRIBUTION how genetic information is storedNOT in FOR the base SALE sequence OR DISTRIBUTION of DNA. For a given sequence of bases in a transcribed strand of protein-coding DNA, you will specify the sequence of bases in the corresponding region of messenger RNA and the sequence of amino acids in the protein. For a mutation in which a specified base is replaced with another, you will deduce the resulting mRNA and protein sequence. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC ■■ To realize thatNOT enzymes FOR work SALE in sequence OR DISTRIBUTION in a metabolic pathway. Given a linearNOT metabolic FOR SALE path- OR DISTRIBUTION way for an essential nutrient, you will deduce which intermediates will restore the ability to grow mutant strains that are defective for any of the enzymes in the pathway. Conversely, using data that specify which intermediates in a linear metabolic pathway restore the ability of mutants to grow, you will infer the order of the enzymes and intermediates in the pathway. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC ■■ To learn that genetic complementation is the operational definition of a gene. Given data on the NOTcomplementation FOR SALE OR or lack DISTRIBUTION of complementation among all pairsNOT of aFOR set of SALE mutations OR affectingDISTRIBUTION a biological process, you will sort the mutations into complementation groups, each corresponding to a different gene.

Genetics is worth studying for many reasons, rang- transmitted from parents to offspring. His objects of © Jones ing& Bartlett from applications Learning, in medicine, LLC agriculture, public© Jonesstudy & were Bartlett garden Learning, peas, with LLCvariable traits like pea NOT FORhealth, SALE and OR conservation DISTRIBUTION biology to ongoing researchNOT colorFOR andSALE plant OR height. DISTRIBUTION The foundation of genetics in cell biology, development, neuroscience, and evo- as a molecular science also dates back to the 1860s lution. Genetics also deals with some of the great when Friedrich Miescher discovered a new type of philosophical themes of human life and individual weak acid, abundant in the nuclei of white blood differences: cells, which turned out to be what we now call DNA © Jones & Bartlett Learning, LLC(deoxyribonucleic acid). ©For Jones many years,& Bartlett the biolog Learning,- LLC A spermatozoon plunges headlong into an ovum, and NOT FOR SALE OR DISTRIBUTIONical function of DNA wasNOT unknown, FOR andSALE no ORrole DISTRIBUTIONin immediately a long-term project is set in motion. The heredity was ascribed to it. cells proliferate at a dizzying rate, clustering, diversify- In this book, you will learn a lot about genes ing. Out of that initial, infinitesimal particle will grow a and genomes. You will learn what constitutes a gene beating heart, hands, fingernails, hair, glands, and a and how it works in physiology and development, in brain with the power to think of itself . . . But from time to © Jones & Bartlett Learning, LLC health and© disease. Jones You & Bartlettwill also learnLearning, how genomes LLC time nature, too, gets things wrong, and so you’ll have NOT FOR SALE OR DISTRIBUTION are organizedNOT and FOR the activities SALE ORof different DISTRIBUTION genes coor- six fingers on one hand or one leg shorter than the other, dinated in space and time. If you know nothing about or else she may construct a brain incapable of under- genetics, you will be brought up to speed. And if you standing the simplest things. already know something, you will see it in a different From Death in August by Marco Vichi, translated by Stephen Sartarelli (2011, light. There are lots of details, but try not to get so Pegasus Books, p. 123) © Jones & Bartlett Learning, LLC © Jonestangled & Bartlettup in them Learning, that you lose LLC sight of how genet- NOT FOR SALE OR DISTRIBUTION NOT icsFOR can SALEhelp you OR understand DISTRIBUTION the great themes—birth, There is indeed a developmental plan encoded consciousness, death—that make the details worth in our DNA that makes each of us a member of the knowing. human species. But still we differ from one another. Besides rare anomalies like six fingers, we differ from one another in many© Joneseveryday, & observableBartlett Learning, charac- LLC1.1 DNA is the molecule© Jones & ofBartlett Learning, LLC teristics, or traits, likeNOT hair color,FOR eyeSALE color, OR skin DISTRIBUTION color, NOT FOR SALE OR DISTRIBUTION height, weight, and personality. Some of these traits heredity. differ because of heredity, others because of culture. The importance of the cell nucleus in inheritance The color of your eyes results from biological inheri- became clear in the 1870s, when the nuclei of the tance, but the native language you learned as a child male and female reproductive cells were observed results© Jonesfrom cultural & Bartlett inheritance. Learning, Many LLC traits are to fuse in ©the Jones process & of Bartlett fertilization. Learning, The next LLC major influencedNOT FOR jointly SALE by biological OR DISTRIBUTION inheritance and envi- advance wasNOT the FOR discovery SALE of chromosomes OR DISTRIBUTION, thread- ronmental factors or lifestyle choices. How much you like objects inside the nucleus that become visible in weigh is determined in part by your inheritance but the light microscope when stained with certain dyes. also in part by how much food you eat, its nutritional Chromosomes exhibit a characteristic “splitting” content, and your exercise habits. behavior, in which each daughter cell formed by cell © Jones & BartlettGenetics Learning, is the study LLC of biologically inherited© Jonesdivision & Bartlettreceives an Learning, identical complement LLC of chromo- traits, including traits that are influenced in part by NOT FOR SALE OR DISTRIBUTION NOT somes.FOR SALEMore evidence OR DISTRIBUTION for the importance of chromo- the environment. Genomics is the study of all the somes was provided by the observation that, whereas genes in an organism to understand their molecular the number of chromosomes in each cell differs from organization, function, interaction, and evolution- one biological species to the next, the number of chro- ary history. The fundamental concept of genetics and mosomes is nearly always constant within the cells of genomics is that: © Jones & Bartlett Learning, LLCany particular species. These© featuresJones of& chromosomesBartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONwere well understood by aboutNOT 1900,FOR andSALE they OR made DISTRIBUTION it seem likely that chromosomes were the carriers of KEY CONCEPT the genes. Inherited traits are determined by genes—the By the 1920s, several lines of indirect evidence elements of heredity that are transmitted from suggested a close relationship between chromosomes, parents© Jones to offspring & Bartlett in reproduction. Learning, LLC and DNA.© MicroscopicJones & Bartlett studies Learning,with special LLCstains NOT FOR SALE OR DISTRIBUTION showed thatNOT DNA FOR is present SALE in OR chromosomes. DISTRIBUTION Various types of proteins are present in chromosomes, too. But The existence of genes and the rules governing whereas most of the DNA in cells of higher organisms their transmission from generation to generation were is present in chromosomes, and the amount of DNA first articulated by Gregor Mendel in 1866. Mendel’s per cell is constant, the amount and kinds of proteins © Jones &formulation Bartlett ofLearning, inheritance LLC was in terms of the abstract© Jonesand other & Bartlett large molecules Learning, differ LLC greatly from one type NOT FORrules SALE by whichOR DISTRIBUTION genes (he called them “factors”) areNOT ofFOR cell SALEto another. OR TheDISTRIBUTION indirect evidence for DNA as

the genetic material was unconvincing, because crude lacking the capsule, these bacteria are inactivated © Jones chemical& Bartlett analyses Learning, had suggested LLC (erroneously, as it© Jonesby the & Bartlettimmune systemLearning, of the LLC host. Both types of NOT FORturned SALE out) OR that DISTRIBUTION DNA lacked the chemical diversityNOT bacteriaFOR SALE “breed OR true” DISTRIBUTION in the sense that the progeny needed in a genetic substance. The favored candidate formed by cell division have the capsular type of the for the genetic material was protein, because proteins parent, either S or R. were known to be an exceedingly diverse collection of When mice are injected with living R cells or with molecules. Proteins therefore became widely accepted S cells that have been killed with extreme heat, the as the genetic material,© Jonesand DNA & was Bartlett thought Learning, to pro- LLCanimals remain healthy. However,© Jones in & 1928 Bartlett Frederick Learning, LLC vide only the structuralNOT framework FOR SALE of chromosomes. OR DISTRIBUTION Griffith showed that whenNOT mice FOR are SALEinjected OR with DISTRIBUTION a Any researcher who hoped to demonstrate that DNA mixture of living R cells and heat-killed S cells, they was the genetic material had a double handicap. Such often die of pneumonia (FIGURE 1.2). Bacteria iso- experiments had to demonstrate not only that DNA is lated from blood samples of the dead mice produce S the genetic material but also that proteins are not the cultures with a capsule typical of the injected S cells, genetic© Jonesmaterial. & Some Bartlett of the Learning, experiments LLC regarded even though© Jones the injected & Bartlett S cells Learning,had been killed LLC by as decisiveNOT FORin implicating SALE OR DNA DISTRIBUTION are described in this heat. Evidently,NOT FORthe injected SALE material OR DISTRIBUTION from the dead section. S cells includes a substance that can enter living R bacterial cells and give them the ability to synthesize the S-type capsule. In other words, the R bacteria can Genetic traits can be altered by be changed—or undergo transforma tion—into S © Jones &treatment Bartlett Learning, with pure LLC DNA. © Jonesbacteria, & Bartlett and the newLearning, characteristics LLC are inherited by NOT FOROne SALE type OR of DISTRIBUTIONbacterial pneumonia in mammals isNOT descendantsFOR SALE of ORthe transformedDISTRIBUTION bacteria. caused by strains of Streptococcus pneumoniae able Griffith’s transformation ofStreptococcus was not to synthesize a gelatinous capsule composed of in itself definitive, but in 1944 the chemical substance polysaccharide (complex carbohy- responsible for changing the R cells into S cells was drate). This capsule surrounds the identified as DNA. In a milestone experiment, Oswald bacterium© Jones and protects & Bartlett it from Learning, the LLCAvery, Colin MacLeod, and© MaclynJones McCarty& Bartlett showed Learning, LLC defenseNOT mechanisms FOR SALE of the OR infected DISTRIBUTION that the substance causingNOT the FOR transformation SALE OR DISTRIBUTIONof animal; thus it enables the bacterium R cells into S cells was DNA. In preparation for the to cause disease. When a bacterial cell is grown on experiment, they had to develop chemical procedures solid medium, it undergoes repeated cell divisions for obtaining DNA in almost pure form from bacte- to form a visible clump of cells called a colony. The rial cells, which had not been done before. When © Jones &enveloping Bartlett Learning,capsule makes LLC the size they added© DNAJones isolated & Bartlett from S cellsLearning, to growing LLC cul- NOT FORof SALE each colonyOR DISTRIBUTION large and gives it a tures of RNOT cells, FORthey observed SALE ORthat DISTRIBUTIONa few S-type cells glistening or smooth (S) appearance were produced. Although the DNA preparations con- (FIGURE 1.1). Certain strains of S. tained traces of protein and RNA (ribonucleic acid, an pneumoniae, however, are unable to abundant cellular macromolecule chemically related synthesize the capsular polysaccha- to DNA), the transforming activity was not altered © Jones &ride, Bartlett and they Learning, form small LLC colonies that have a rough© Jonesby treatments & Bartlett that Learning, destroy either LLC protein or RNA. NOT FOR(R) SALE surface. OR The DISTRIBUTION R strains do not cause pneumonia;NOT However,FOR SALE treatments OR DISTRIBUTION that destroy DNA eliminated

R strain S strain

© Jones &FIGURE Bartlett 1.1 Colonies Learning, of Streptococcus LLC pneumoniae. The small colonies© Jones on the &left Bartlettare from a rough Learning, (R) strain, andLLC the large colonies on NOT FORthe SALE right are OR from DISTRIBUTIONa smooth (S) strain. The S colonies are larger becauseNOT of FOR the capsule SALE on theOR S cells. DISTRIBUTION

Living Living Heat-killed Living R cells plus S cells R cells S cells heat-killed S cells © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Mouse contracts Mouse remains Mouse remains Mouse contracts pneumonia healthy healthy pneumonia © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION S colonies isolated R colonies isolated No colonies isolated R and S colonies isolated from tissue of dead mouse from tissue from tissue from tissue of dead mouse

FIGURE 1.2 Griffith’s experiment demonstrating bacterial transformation. A mouse remains healthy if injected with either the nonvirulent R strain of S. pneumoniae or heat-killed cell fragments of the usually virulent S strain. R cells in the presence of heat-killed S cells are transformed into the virulent© strain,Jones causing & Bartlett pneumonia Learning,in the mouse. LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

the transforming activity (FIGURE 1.3). These experiments implied that the substance responsible for genetic© Jonestransformation & Bartlett was theLearning, DNA of the LLC cell—and © Jones & Bartlett Learning, LLC henceNOT that FORDNA is SALE the genetic OR DISTRIBUTIONmaterial. NOT FOR SALE OR DISTRIBUTION

Transmission of DNA is the link between generations. © Jones &A Bartlettsecond pivotal Learning, finding LLC was reported by Alfred© Jones & Bartlett Learning, LLC NOT FORHershey SALE ORand DISTRIBUTIONMartha Chase in 1952. They studiedNOT FOR SALE OR DISTRIBUTION cells of the intestinal bacterium Escherichia coli after infection by the virus T2. A virus that attacks bacterial cells is called a bacteriophage, often shortened to phage. (Bacteriophage means “bacteria eater.”) The T2 particle is exceedingly© Jones & small, Bartlett yet Learning,it has a LLC © Jones & Bartlett Learning, LLC complex structure composedNOT FOR of SALEa head ORcontaining DISTRIBUTION NOT FOR SALE OR DISTRIBUTION the phage DNA, a tail, and tail fibers. (The head of The intricate color patterns on butterfly wings demonstrate the complexity that can evolve in developmental processes. a human sperm is about 30–50 times larger in both length and width than the head of T2.) Hershey and © Ervin Monn/Shutterstock. Chase were already aware that T2 infection proceeds via the© Jones attachment & Bartlett of a phage Learning, particle byLLC the tip of Because© JonesDNA contains & Bartlett phosphorus Learning, but no LLC sulfur, its tailNOT to the FOR bacterial SALE cell OR wall, DISTRIBUTION entry of phage mate- whereas mostNOT proteins FOR SALE contain OR sulfur DISTRIBUTION but no phos- rial into the cell, multiplication of this material to phorus, it is possible to label DNA and proteins differ- form a hundred or more progeny phage, and release entially by the use of radioactive isotopes of the two of the progeny phage by bursting (lysis) of the bac- elements. Hershey and Chase produced particles con- terial host cell. They also knew that T2 particles are taining radioactive DNA by infecting E. coli cells that © Jones &composed Bartlett of Learning, DNA and LLCprotein in approximately© Joneshad been& Bartlett grown for Learning, several generations LLC in a medium NOT FORequal SALE amounts. OR DISTRIBUTION NOT thatFOR included SALE 32 ORP (a DISTRIBUTIONradioactive isotope of phosphorus)

(A) The transforming activity in S cells is not destroyed by heat. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION S cells killed S cell extract by heat (contains mostly DNA with a little protein and RNA) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION (B) The transforming activity is not destroyed by either protease or RNase. (C) The transforming activity is destroyed by DNase.

DNase (destroys DNA) RNase© Jones & BartlettProtease Learning, LLC © Jones & Bartlett Learning, LLC (destroys (destroys RNA)NOT FOR SALEprotein) OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Cultured© Jones with R & cells Bartlett Learning, LLC © JonesCultured with& BartlettR cells Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

In both cases, progeny of R cells produce R colonies and a few S colonies. Progeny of R cells produce R colonies only.

Conclusion: Transforming activity Conclusion: Transforming activity © Jones & Bartlett Learning,is not protein LLC or RNA. © Jones & Bartlett Learning,is most likelyLLC DNA. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION FIGURE 1.3 A diagram of the experiment demonstrating that DNA is the active material in bacterial transformation. (A) Purified DNA extracted from heat-killed S cells can convert some living R cells into S cells, but the extract may still contain undetectable traces of protein and/or RNA. (B) The transforming activity is not destroyed by either protease or RNase. (C) The transforming activity is destroyed by DNase and so probably consists of DNA.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION and then collecting the phage progeny. They obtained This treatment was found to have no effect on the other particles containing labeled proteins in the same subsequent course of the infection, which implies that way, using medium that included 35S (a radioactive the genetic material must enter the infected cells very isotope of sulfur). soon after phage attachment. The kitchen blender In© theJones experiments & Bartlett summarized Learning, in FIGURELLC 1.4, turned out© to Jones be the critical& Bartlett piece ofLearning, equipment. LLC Other nonradioactiveNOT FOR E. SALE coli cells OR were DISTRIBUTION infected with phage methods hadNOT been FOR tried SALE to tear OR the DISTRIBUTIONphage heads from labeled with either 32P (part A) or 35S (part B) in order the bacterial cell surface, but nothing had worked to follow the DNA and proteins separately. Infected reliably. Hershey later explained, “We tried various cells were separated from unattached phage parti- grinding arrangements, with results that weren’t cles by centrifugation, resuspended in fresh medium, very encouraging. When Margaret McDonald loaned © Jones &and Bartlett then swirled Learning, violently LLC in a kitchen blender to© Jonesus her & Bartlettkitchen blender,Learning, the LLCexperiment promptly NOT FORshear SALE attached OR DISTRIBUTION phage material from the cell surfaces.NOT succeeded.”FOR SALE OR DISTRIBUTION

(A) Phage containing32 P-labeled (B) Phage containing35 S-labeled © Jones & Bartlett Learning, LLCDNA infects nonradioactive cell.© Jones & Bartlettprotein Learning, infects nonradioactive LLC cell. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Phage heads Phage heads are removed. are removed. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Infected cell Infected cell remains. remains. Infecting Infecting labeled DNA nonlabeled DNA

© Jones & Bartlett Learning, LLCProgeny phages form; © Jones & BartlettProgeny Learning, phages form; LLC NOT FOR SALE OR DISTRIBUTIONcell lyses. NOT FOR SALEcell OR lyses. DISTRIBUTION Progeny phages contain some32 P-labeled DNA. Progeny phages contain almost no35 S-labeled protein. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning,Conclusion: MainlyLLC DNA, not protein, is inherited© from Jones parental & phage. Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION FIGURE 1.4 The Hershey–Chase (“blender”) experiment, which demonstrated that DNA, not protein, is responsible for directing the reproduction of phage T2 in infected E. coli cells. (A) Radioactive DNA is transmitted to progeny phage in substantial amounts. (B) Radioactive protein is transmitted to progeny phage in negligible amounts.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALEAfter ORthe DISTRIBUTIONphage heads were removed by blend-NOT thatFOR genes SALE consist OR ofDISTRIBUTION DNA. At the present time, the ing, the infected bacteria were examined. Most of equivalent of the transformation experiment is carried the radioactivity from 32P-labeled phage was found out daily in many research laboratories throughout to be associated with the bacteria, whereas only the world, usually with bacteria, yeast, or animal or 35 a small fraction of ©the Jones S radioactivity & Bartlett was Learning, pres- LLCplant cells grown in culture.© JonesThese experiments & Bartlett indi Learning,- LLC ent in the infected cells. The retention of most of cate that DNA is the genetic material in these organ- the labeled DNA, contrastedNOT FOR with SALE the loss OR of mostDISTRIBUTION of isms as well as in phage T2.NOT FOR SALE OR DISTRIBUTION the labeled protein, implied that a T2 phage trans- fers most of its DNA, but very little of its protein, to the cell it infects. The critical finding Figure ( 1.4) KEY CONCEPT was ©that Jones about & Bartlett50 percent Learning, of the LLCtransferred There are© no Jones known & exceptions Bartlett Learning,to the generaliza LLC- 32 P-labeled DNA, but less than 1 percent of the trans- NOT FOR SALE OR DISTRIBUTION tion thatNOT DNA isFOR the genetic SALE materialOR DISTRIBUTION in all cellular ferred 35S-labeled protein, was inherited by the progeny organisms. phage particles. Hershey and Chase interpreted this result to mean that the genetic material in T2 phage is DNA. It is worth noting, however, that in a few types of © Jones & BartlettThe transformation Learning, experiment LLC and the Hershey–© Jonesviruses, & Bartlettthe genetic Learning, material consists LLC of the other type Chase experiment are regarded as classic demonstration of nucleic acid called RNA. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones &STOP Bartlett Learning,& THINK LLC 1.1 © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION G In this diagram of the Hershey–Chase experiment, G0 0 represents the original population of bacteriophage with

radioactive DNA. The progeny bacteriophage (G1) showed © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC half the amount of radioactivity in their DNA as the G0 bacteriophage did. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

(a) If the G bacteriophage were used to infect bacteria, what © Jones1 & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC fraction of the original G0 radioactivity would be present in G1 theirNOT progeny FOR (the SALEG2 bacteriophage)? OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION (b) Suppose that after each cycle of infection, the progeny bacteriophage are used to initiate the next cycle of infection.

What fraction of the original G0 radioactivity would be pres-

ent in the G5 bacteriophage? © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 1.2 The structure of DNA is a (A) (B) 3’ 5’ TA double helix composed of GC AT two intertwined© Jones & strands. Bartlett Learning, LLC © Jones & Bartlett Learning, LLC Even after it was shownNOT that FOR genes SALE consist OR of DISTRIBUTION DNA, NOT FOR SALECG OR DISTRIBUTION many questions remained. How is the DNA in a gene CG GC duplicated when a cell divides? How does the DNA T A in a gene control a hereditary trait? What happens Paired nucleotides to the DNA when a mutation (a change in the DNA) GC takes© place Jones in a &gene? Bartlett Important Learning, clues to LLCthe answers © Jones & Bartlett Learning,T A LLC to these questions emerged from the discovery of the GC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTIONTA three-dimensional structure of the DNA molecule itself. This structure is discussed next. TA AT GC A central feature of double-stranded T A © Jones &DNA Bartlett is complementary Learning, LLC base pairing. © Jones & Bartlett Learning, LLC NOT FORIn SALE the early OR 1950s, DISTRIBUTION a number of researchers began to tryNOT FOR SALE OR DISTRIBUTION CG T A to understand the detailed molecular structure of DNA. GC The first essentially correct three-dimensional structure 5’ 3’ of the DNA molecule was proposed in 1953 by James Watson and Francis Crick© Jones at Cambridge & Bartlett University. Learning, The LLCFIGURE 1.5 Molecular structure© of aJones DNA double & Bartlett helix. Learning, LLC structure was dazzling in its elegance and revolution- (A) A “space-filling” model, in which each atom is depicted as a NOT FOR SALE OR DISTRIBUTIONsphere. (B) A diagram highlightingNOT the helical FOR backbones SALE on OR the DISTRIBUTION ary in suggesting how DNA duplicates itself, controls outside of the molecule and the stacked A—T and G—C base hereditary traits, and undergoes mutation. Even while pairs inside. their tin sheet and wire model of the DNA molecule was still incomplete, Crick announced in his favorite looking up into the structure from the bottom: The pub that, “We have discovered the secret of life.” © Jones & Bartlett Learning, LLC smaller spheres© Jones outline & Bartlettthe “backbone” Learning, of each LLC indi- In the Watson–Crick structure, DNA consists vidual strand, and they coil in a clockwise direction. of twoNOT long FOR chains SALE of subunits OR DISTRIBUTION twisted around one NOT FOR SALE OR DISTRIBUTION The subunits of each strand are nucleotides, each of another to form a double-stranded helix. The double which contains any one of four chemical constituents helix is right-handed, which means that as one looks called bases. The four bases in DNA are along the barrel, each chain follows a clockwise path Adenine (A) Guanine (G) © Jones &as Bartlettit progresses. Learning, You can LLC see the right-handed coil-© Jones & Bartlett Learning, LLC ing in part A of FIGURE 1.5 if you imagine yourself Thymine (T) Cytosine (C) NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

The chemical structures of the nucleotides and arrow-like ribbon. The tail of the arrow represents the © Jones bases& Bartlett need not Learning, concern us LLC at this point. A key point© Jones59 end & of Bartlett the DNA Learning, strand, the headLLC the 39 end. NOT FORfor SALE our present OR DISTRIBUTION purposes is that the bases in the doubleNOT FORBeyond SALE the OR most DISTRIBUTION optimistic hopes, knowledge of helix are paired as shown in Figure 1.5, part B. That is, the structure of DNA immediately gave clues to its function: KEY CONCEPT 1. The sequence of bases in DNA could be copied © Jones & Bartlett Learning, LLC by using each of the ©separate Jones “partner” & Bartlett strands as Learning, LLC At any position on the paired strands of a DNA a pattern for the creation of a new partner strand molecule, if one strandNOT has FOR an A, SALE then the OR partner DISTRIBUTION with a complementaryNOT sequence FOR SALE of bases. OR DISTRIBUTION strand has a T; and if one strand has a G, then the partner strand has a C. 2. The DNA could contain genetic information in coded form in the sequence of bases, analogous to letters printed on a strip of paper. The base© Jones pairing & between Bartlett A and Learning, T and between LLC G and © Jones & Bartlett Learning, LLC C is said to be complementary base pairing; the 3. Changes in genetic information (mutations) complementNOT FOR of A SALEis T, and OR the DISTRIBUTION complement of G is C. couldNOT result FOR from SALE errors inOR copying DISTRIBUTION in which the The complementary pairing in the duplex molecule base sequence of the DNA became altered. means that each base along one strand of the DNA is In the remainder of this chapter, we discuss some matched with a base in the opposite position on the of the implications of these clues. © Jones &other Bartlett strand. Learning, Furthermore, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT InFOR replication, SALE OR each DISTRIBUTION parental DNA KEY CONCEPT strand directs the synthesis of a Nothing restricts the sequence of bases in a sin- new partner strand. gle strand, so any sequence could be present “It has not escaped our notice,” wrote Watson and along one strand. © Jones & Bartlett Learning, LLCCrick, “that the specific base© Jones pairing & weBartlett have postu Learning,- LLC lated immediately suggests a copying mechanism for NOT FOR SALE OR DISTRIBUTIONthe genetic material.” The NOTcopying FOR process SALE in which OR DISTRIBUTION a This principle explains how only four bases in DNA single DNA molecule becomes two identical molecules can code for the huge amount of information needed is called replication. The replication mechanism to make an organism. It is the linear order or sequence that Watson and Crick had in mind is illustrated in of bases along the DNA that encodes the genetic infor- FIGURE 1.6. The strands of the original (parent) mation,© Jones and the & sequence Bartlett is completelyLearning, unrestricted. LLC © Jones & Bartlett Learning, LLC duplex separate, and each individual strand serves The complementary pairing is also called Watson– NOT FOR SALE OR DISTRIBUTION as a pattern,NOT or templaFOR SALEte, for ORthe synthesisDISTRIBUTION of a new Crick base pairing. In the three-dimensional structure strand (replica). The replica strands are synthesized by (Figure 1.5, part A), the base pairs are represented the addition of successive nucleotides in such a way by the larger spheres filling the interior of the double that each base in the replica is complementary (in the helix. The base pairs lie almost flat, stacked on top of Watson–Crick pairing sense) to the base across the way © Jones &one Bartlett another perpendicularLearning, LLC to the long axis of the dou-© Jones & Bartlett Learning, LLC in the template strand. Although the mechanism in ble helix, like pennies in a roll. When discussing a DNA NOT FOR SALE OR DISTRIBUTION NOT FigureFOR SALE1.6 is simple OR DISTRIBUTIONin principle, it is a complex process molecule, biologists frequently refer to the individual that is fraught with geometric problems and requires a strands as single-stranded DNA and to the double variety of enzymes and other proteins. The end result helix as double-stranded DNA or duplex DNA. of replication is that a single double-stranded mole- Each DNA strand has a polarity, or directionality, cule becomes replicated into two copies with identical like a chain of circus ©elephants Jones linked & Bartlett trunk toLearning, tail. In LLC © Jones & Bartlett Learning, LLC sequences: this analogy, each elephantNOT FORcorresponds SALE to OR one DISTRIBUTION nucle- NOT FOR SALE OR DISTRIBUTION otide along the DNA strand. The polarity is determined 59-ATGCCGTA-39 by the direction in which the nucleotides are point- 39-TACGGCAT-59 ing. The “trunk” end of the strand is called the 59 end of the strand, and the “tail” end is called the 39 end. 59-ATGCCGTA-39 59-ATGCCGTA-39 In double-stranded© Jones & Bartlett DNA, the Learning, paired strands LLC are ori- 39-TACGGCAT-5© Jones 9& Bartlett3 9Learning,-TACGGCAT-5 LLC9 entedNOT in opposite FOR SALEdirections: OR The DISTRIBUTION 59 end of one strand NOT FOR SALE OR DISTRIBUTION is aligned with the 39 end of the other. The oppositely Here the bases in the newly synthesized strands are oriented strands are said to be antiparallel. In illus- shown in red. In the duplex on the left, the top strand is trating DNA molecules, we use an arrow-like ribbon the template from the parental molecule and the bottom to represent the backbone, and we use tabs jutting off strand is newly synthesized; in the duplex on the right, © Jones &the Bartlett ribbon to Learning, represent the LLC nucleotides. The polarity© Jonesthe bottom & Bartlett strand Learning, is the template LLC from the parental NOT FORof SALE a DNA OR strand DISTRIBUTION is indicated by the direction of theNOT moleculeFOR SALE and the OR top DISTRIBUTION strand is newly synthesized.

processes of cells known as metabolism . Many pro- © Jones & Bartlett Learning, LLCTA © Jonesteins &are Bartlett enzymes Learning,, a term introduced LLC in 1878 to refer NOT FOR SALE OR DISTRIBUTIONCG NOT toFOR the biologicalSALE OR catalysts DISTRIBUTION that accelerate biochemical AT reactions. Enzymes are essential for the breakdown of organic molecules, generating the chemical energy CG needed for cellular activities; they are also essential CG Parent for the synthesis of small molecules and for their GC duplex © Jones & Bartlett Learning, LLCassembly into larger molecules© Jones and complex& Bartlett cellular Learning, LLC T A NOT FOR SALE OR DISTRIBUTIONstructures. NOT FOR SALE OR DISTRIBUTION CG Although the fundamental connection between T A genes and proteins was not widely appreciated until CG the 1940s, the first evidence for a relationship came TA much earlier. The pioneering observations were made © Jones & Bartlett Learning, LLC by Archibald© JonesGarrod, &a BritishBartlett physician, Learning, who studiedLLC NOT FOR SALE TAOR DISTRIBUTION genetic diseasesNOT causedFOR SALE by inherited OR DISTRIBUTION defects in metab- A T olism. He concluded that an inherited defect in metab- A T olism results from an inherited defect in an enzyme. C G The key observations on which Garrod based this con- CG CG clusion are summarized in the following sections. © Jones & Bartlett Learning, LLC GC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONGC T A NOT FOR SALE OR DISTRIBUTION T Enzyme defects result in inborn Daughter A duplex CG errors of metabolism. CG T A In 1908 Garrod gave a series of lectures in which he T A C G CG proposed this fundamental hypothesis about the rela- T A © Jones & BartlettTA Learning, LLCtionship between enzymes© and Jones disease: & Bartlett Learning, LLC T A NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Template TA A T strands AT KEY CONCEPT Any hereditary disease in which cellular metabolism is abnormal results from an inherited © Jones & BartlettReplica Learning, LLC defect in© an Jones enzyme. & Bartlett Learning, LLC NOT FOR SALE ORstrands DISTRIBUTION NOT FOR SALE OR DISTRIBUTION FIGURE 1.6 Replication in a long DNA duplex as originally proposed by Watson and Crick. The parental strands separate, and Such diseases became known as inborn errors of each parental strand serves as a template for the formation of a new daughter strand by means of A—T and G—C base pairing. metabolism, a term still in use today. Garrod studied a number of inborn errors of © Jones & Bartlett Learning, LLC © Jonesmetabolism & Bartlett in which Learning, the patients LLC excreted abnormal NOT FOR SALE OR DISTRIBUTION NOT substancesFOR SALE in theOR urine. DISTRIBUTION One of these was alkapton- STOP & THINK 1.2 uria. In this case, the abnormal substance excreted is homogentisic acid: Shown here is part of the base sequence in one strand OH in a DNA duplex undergoing replication. O © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC   CH C 5 –TAGCAAAAATAGC–3NOT FOR SALE OR DISTRIBUTION NOT2 FOR SALE OR DISTRIBUTION OH What is the base sequence in the daughter strand? HO This is a conventional chemical representation in which each corner of the hexagon represents a carbon 1.3 © JonesGenes & affectBartlett organismsLearning, LLC atom, and© hydrogen Jones &atoms Bartlett attached Learning, to the ring LLC are NOT FOR SALE OR DISTRIBUTION not shown.NOT The FORsix-carbon SALE ring OR is called DISTRIBUTION a phenyl ring. through the action of proteins. An early name for homogentisic acid was alkapton— One of the important principles of molecular genetics hence the name alkaptonuria. Even though alkapton- is that genes exert their effects on organisms indirectly. uria is rare, with an incidence of about one in 200,000 For most genes, the genetic information contained in people, it was well known even before Garrod studied it. © Jones &the Bartlett nucleotide Learning, sequence specifiesLLC a particular type ©of JonesThe disease & Bartlett itself is Learning,relatively mild, LLC but it has one striking NOT FORprotein SALE. Proteins OR DISTRIBUTION control the chemical and physicalNOT symptom:FOR SALE The ORurine DISTRIBUTION of the patient turns black because

Phenyl ring © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE ORCC DISTRIBUTIONNH2 O

C CCCH2 C C C H OH Phenylalanine (a normal amino acid) © Jones & Bartlett Learning, LLC © Jones &Each Bartlett arrow Learning, LLC represents one NOT FOR SALE OR DISTRIBUTION 1 NOT FOR stepSALE in the OR DISTRIBUTION biochemical pathway.

CC NH2 O

© Jones & Bartlett Learning, LLC HO ©C JonesC CH& 2BartlettC C Learning, LLC C C FIGURENOT 1.7 Urine FOR from SALE a person OR with DISTRIBUTION alkaptonuria turns black NOT FOR SALEH OROH DISTRIBUTION because of the oxidation of the homogentisic acid that it contains. Tyrosine (a normal amino acid) Courtesy Daniel De Aguiar. 2 © Jones &of Bartlettthe oxidation Learning, of homogentisic LLC acid (FIGURE 1.7).© Jones & Bartlett Learning, LLC NOT FORThis SALE is why OR alkaptonuria DISTRIBUTION is also called black urine dis-NOT FOR SALE ORCC DISTRIBUTIONO O . The passing of black urine can hardly escape being ease HO C C CH C C noticed. One case was described in the year 1649: 2 C C OH The patient was a boy who passed black urine and who, 4-hydroxyphenylpyruvic acid at the age of fourteen years, was submitted to a drastic course of treatment© that Jones had for & its Bartlett aim the subduing Learning, of LLC 3 © Jones & Bartlett Learning, LLC the fiery heat of his viscera,NOT FOR which wasSALE supposed OR DISTRIBUTION to bring NOT FORIn SALEthe next step,OR DISTRIBUTION about the condition in question by charring and blacken- the phenyl ring ing his bile. Among the measures prescribed were bleed- OH is opened at this position. ings, purgation, baths, a cold and watery diet, and drugs CC O galore. None of these had any obvious effect, and even- C C CH C tually© Jones the patient, & Bartlett who tired ofLearning, the futile and LLC superfluous © Jones & Bartlett2 Learning, LLC C C therapy,NOT FOR resolved SALE to let ORthings DISTRIBUTION take their natural course. NOT FOR SALEOH OR DISTRIBUTION None of the predicted evils ensued. He married, begat a OH large family, and lived a long and healthy life, always Homogentisic acid (formerly known as alkapton) passing urine black as ink. This is the step (Quotation from Garrod, 1908.) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLCthat is blocked 4 in alkaptonuria; NOT FOR SALEGarrod OR was DISTRIBUTION primarily interested in the biochemis-NOT FOR SALE OR DISTRIBUTIONX homogentisic try of alkaptonuria, but he took note of family studies acid accumulates. that indicated that the disease was inherited as though it were due to a defect in a single gene. As to the bio- O O O chemistry, he deduced that the problem in alkaptonuria was the patients’ inability© Jones to break & Bartlett down the Learning, phenyl LLC C CH CH C CH2© CJonesCH2 &C Bartlett Learning, LLC ring of six carbons thatNOT is present FOR in SALE homogentisic OR DISTRIBUTION acid. HO NOTO FOR SALEOH OR DISTRIBUTION Where does this ring come from? Mammals are unable 4-maleylacetoacetic acid to synthesize it and must obtain it from their diet. Garrod proposed that homogentisic acid originates as a breakdown product of two amino acids, phenylalanine and ©tyrosine, Jones which & Bartlett also contain Learning, a phenyl LLC ring. An © JonesFurther breakdown& Bartlett Learning, LLC aminoNOT acid FOR is one SALE of the “buildingOR DISTRIBUTION blocks” from which FIGURE 1.8 NOTMetabolic FOR pathway SALE for the OR breakdown DISTRIBUTION of phenyl proteins are made. Phenylalanine and tyrosine are alanine and tyrosine. Each step in the pathway, represented by an constituents of normal proteins. The scheme that illus- arrow, requires a particular enzyme to catalyze the reaction. The key step in the breakdown of homogentisic acid is the breaking trates the relationship between the molecules is shown open of the phenyl ring. in FIGURE 1.8. Any such sequence of biochemical © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

reactions is called a biochemical pathway or a meta- Phenylalanine © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLCA defect in this bolic pathway. Each arrow in the pathway represents Each step in a 1 enzyme leads to NOT FORmetabolic SALE pathway OR DISTRIBUTIONPhenylalanine NOT FORa SALEsingle step OR depicting DISTRIBUTION the transition from the “input” hydroxylase accumulation of or substrate molecule, shown at the tail of the arrow, requires a different phenylalanine and enzyme. to phenylketonuria. to the “output” or product molecule, shown at the tip. Biochemical pathways are usually oriented either Tyrosine A defect in this vertically with the arrows pointing down, as in Fig- 2 enzyme leads to © Jones & Bartlett Learning, LLC Tyrosine© Jones & Bartlett Learning, LLC ure 1.8, or horizontally, with the arrows pointing from aminotransferase accumulation of left to right. Garrod didNOT not FOR know SALE all of the OR details DISTRIBUTION of NOT FORtyrosine SALE and toOR DISTRIBUTION tyrosinemia type II. the pathway in Figure 1.8, but he did understand that the key step in the breakdown of homogentisic acid 4-hydroxyphenylpyruvic acid is the breaking open of the phenyl ring and that the A defect in this phenyl ring in homogentisic acid comes from dietary 3 enzyme leads to © Jones & Bartlett Learning, LLC Each enzyme© isJones 4-hydroxyphenyl-& Bartlett Learning, LLC phenylalanine and tyrosine. encoded in a pyruvic acid accumulation of different gene. dioxygenase 4-hydroxyphenyl- WhatNOT allows FOR each SALE step OR in a DISTRIBUTIONbiochemical pathway to NOT FOR SALE OR DISTRIBUTIONpyruvic acid and to occur? Garrod’s insight was to see that each step requires tyrosinemia type III. a specific enzyme to catalyze the reaction and allow the Homogentisic acid chemical transformation to take place. Persons with an A defect in this 4 enzyme leads to inborn error of metabolism, such as alkaptonuria, have Homogentisic acid © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning,1,2-dioxygenase LLCaccumulation of a defect in one step of a metabolic pathway because homogentisic acid NOT FORthey SALE lack ORa functional DISTRIBUTION enzyme for that step. When anNOT FOR SALE OR DISTRIBUTIONand to alkaptonuria.

enzyme in a pathway is defective, the pathway is said 4-maleylacetoacetic acid to have a block at that step. One frequent result of a blocked pathway is that the substrate of the defective enzyme accumulates.© Observing Jones & the Bartlett accumulation Learning, of LLC Further breakdown© Jones & Bartlett Learning, LLC homogentisic acid in patients with alkaptonuria, Gar- NOT FOR SALE OR DISTRIBUTIONFIGURE 1.9 Inborn errors of metabolismNOT FOR in the breakdownSALE OR of DISTRIBUTION rod proposed that there must be an enzyme whose phenylalanine and tyrosine. A different inherited disease results function is to open the phenyl ring of homogentisic acid when each of the enzymes is missing or defective. Alkaptonuria and that this enzyme is missing in these patients. Dis- results from a defective homogentisic acid 1,2-dioxygenase, phenylketonuria from a defective phenylalanine hydroxylase. covery of all the enzymes in the pathway in Figure 1.8 took ©a longJones time. & TheBartlett enzyme Learning, that opens LLC the phenyl © Jones & Bartlett Learning, LLC ring of homogentisic acid was not actually isolated until If PKU is diagnosed in children soon enough after 50 yearsNOT after FOR Garrod’s SALE lectures. OR DISTRIBUTION In normal people it is birth, theyNOT can FORbe placed SALE on ORa specially DISTRIBUTION formulated found in cells of the liver. Just as Garrod had predicted, diet low in phenylalanine. The child is allowed only the enzyme is defective in patients with alkaptonuria. as much phenylalanine as can be used in the synthesis The pathway for the breakdown of phenylalanine of proteins, so excess phenylalanine does not accumu- and tyrosine, as it is understood today, is shown in late. The special diet is very strict. It excludes meat, © Jones &FIGURE 1.9 Bartlett. InLearning, this figure theLLC emphasis is on the enzymes© Jonespoultry, & Bartlettfish, eggs, Learning, milk and LLCmilk products, legumes, NOT FORrather SALE than OR on DISTRIBUTION the structures of the metabolites , orNOT nuts,FOR andSALE bakery OR goodsDISTRIBUTION manufactured with regular small molecules, on which the enzymes act. As Garrod flour. These foods are replaced by a synthetic formula would have predicted, each step in the pathway requires that is very expensive. With the special diet, however, the presence of a particular enzyme that catalyzes that the detrimental effects of excess phenylalanine on step. Although Garrod knew only about alkaptonuria, mental development can largely be avoided. In many in which the defective© Jonesenzyme &is Bartletthomogentisic Learning, acid LLCcountries, including the United© Jones States, & Bartlettall newborn Learning, LLC 1,2-dioxygenase, we NOTnow FORknow SALEthe clinical OR DISTRIBUTIONconse- babies have their blood testedNOT forFOR chemical SALE signs OR ofDISTRIBUTION quences of defects in the other enzymes. Unlike alkapto- PKU. Routine screening is cost effective because PKU nuria, which is a relatively benign inherited disease, the is relatively common. In the United States, the inci- others are very serious. The condition known as phenyl- dence is about one in 8000 among Caucasian births. ketonuria (PKU) results from the absence of (or a defect The disease is less common in other ethnic groups. in) the© Jones enzyme & phenylalanineBartlett Learning, hydroxylase LLC (PAH). In the© metabolic Jones &pathway Bartlett in Figure Learning, 1.9, defects LLC in WhenNOT this stepFOR in theSALE pathway OR isDISTRIBUTION blocked, phenylalanine the breakdownNOT of FOR tyrosine SALE or of 4-ORhydroxyphenylpyruvic DISTRIBUTION accumulates. The excess phenylalanine is broken down acid lead to types of tyrosinemia. These are also into harmful metabolites that cause defects in myelin severe diseases. Type II is associated with skin lesions formation that damage a child’s developing nervous sys- and mental retardation, type III with severe liver tem and lead to severe mental retardation. dysfunction. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

A defective enzyme results important, the experimental approach is widely appli- © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC from a mutant gene. cable to understanding any complex biological pro- NOT FOR SALE OR DISTRIBUTION NOT cess,FOR ranging SALE from OR theDISTRIBUTION genetic control of the cell cycle It follows from Garrod’s work that a defective enzyme or cancer to that of development or behavior. For results from a mutant gene. How does a mutant gene this reason the methods of genetic analysis warrant a result in a defective enzyme? Garrod did not spec- closer examination. ulate. For all he knew, genes were enzymes. This N. crassa grows in the form of filaments on a would have been a ©logical Jones hypothesis & Bartlett at theLearning, time. LLCgreat variety of substrates© Jones including & Bartlett laboratory Learning, LLC We now know that NOTthe relationship FOR SALE between OR DISTRIBUTION genes medium containing only inorganicNOT FOR salts, SALE a sugar, OR and DISTRIBUTION and enzymes is somewhat indirect. With a few excep- one vitamin. Such a medium is known as a minimal tions, each enzyme is encoded in a particular sequence medium because it contains only the nutrients that of nucleotides present in a region of DNA. The DNA are essential for growth of the organism. The fila- region that codes for the enzyme, as well as adja- ments consist of a mass of branched threads separated cent ©regions Jones that & regulateBartlett when Learning, and in LLCwhich cells into interconnected,© Jones & multinucleateBartlett Learning, compartments LLC the enzymeNOT FOR is produced, SALE OR make DISTRIBUTION up the “gene” that allowing freeNOT interchange FOR SALE of nucleiOR DISTRIBUTION and cytoplasm. encodes the enzyme. Each nucleus contains a single set of seven chromo- The genes for the enzymes in the biochemical somes. Beadle and Tatum recognized that the ability pathway in Figure 1.9 have all been identified and the of Neurospora to grow in minimal medium implied nucleotide sequence of the DNA determined. In the that the organism must be able to synthesize all of © Jones &following Bartlett list, Learning, and throughout LLC this text, we use the© Jonesthe other & Bartlett small molecules Learning, needed LLC for growth, such NOT FORtypographical SALE OR DISTRIBUTIONconvention that the names of genes areNOT asFOR amino SALE acids. OR If the DISTRIBUTION biosynthetic pathways needed printed in italic type, whereas gene products are printed for growth are controlled by genes, then a mutation in regular type. In Figure 1.9 the numbers 1 through 4 in a gene responsible for synthesizing an essential correspond to the following genes and enzymes: nutrient would be expected to render a strain unable 1. The gene PAH on the long arm of chromosome to grow unless the strain were provided with the 12 encodes phenylalanine© Jones & hydroxylase Bartlett Learning, (PAH). LLCnutrient. © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONThese ideas were testedNOT in FOR the followingSALE OR way. DISTRIBUTION 2. The gene TAT on the long arm of chromosome Spores of nonmutant Neurospora were irradiated with 16 encodes tyrosine aminotransferase (TAT). either x-rays or ultraviolet light to produce mutant 3. The gene HPD on the long arm of chromosome strains with various nutritional requirements. The 12 encodes 4-hydroxyphenylpyruvic acid diox- isolation of a set of mutants affecting any biological © ygenaseJones (HPD).& Bartlett Learning, LLC process, in© this Jones case &metabolism, Bartlett Learning,is called a mutant LLC NOT FOR SALE OR DISTRIBUTION screen. InNOT the initial FOR step SALE for identifying OR DISTRIBUTION mutants, sum- 4. The gene HGD on the long arm of chromosome marized in FIGURE 1.10, the irradiated spores (purple) 3 encodes homogentisic acid 1,2-dioxygenase were used in crosses with an untreated strain (green). (HGD). Ascospores produced by the sexual cycle in fruiting bodies were individually germinated in complet e © Jones & Bartlett Learning, LLC © Jonesmedium & Bartlett, a complex Learning, medium LLCenriched with a vari- NOT FORGenetic SALE OR analysis DISTRIBUTION led to the one NOT etyFOR of SALEamino ORacids, DISTRIBUTION vitamins, and other substances gene–one enzyme hypothesis. expected to be essential metabolites whose synthesis Garrod’s thinking was far ahead of his time, and his could be blocked by a mutation. Even those ascospores conclusions about inborn errors of metabolism were containing a new mutation affecting synthesis of an largely ignored. The influential experiments connect- essential nutrient would be expected to germinate and ing genes with enzymes© Jones were carried & Bartlett out in the Learning, 1940s LLCgrow in complete medium.© Jones & Bartlett Learning, LLC by George W. Beadle NOTand Edward FOR L.SALE Tatum OR using DISTRIBUTION a fil- To identify which of NOTthe irradiatedFOR SALE ascospores OR DISTRIBUTION amentous fungus Neurospora crassa, commonly called contained a new mutation affecting the synthesis red bread mold, an organism they chose because both of an essential nutrient, spores from each culture genetic and biochemical analysis could be done with were transferred to minimal medium (FIGURE 1.11, ease. In these experiments they identified new muta- Part A). The vast majority of cultures yielded spores tions© that Jones each &caused Bartlett a block Learning, in the metabolic LLC path- that could© grow Jones on minimal& Bartlett medium; Learning, these cultures LLC way NOTfor the FOR synthesis SALE of OR some DISTRIBUTION needed nutrient and lacked anyNOT new mutationFOR SALE of the OR desired DISTRIBUTION type and were showed that each of these blocks corresponded to a discarded. The cultures that were kept were the small defective enzyme needed for one step in the path- number producing spores unable to grow on minimal way. The experimental approach, now called genetic medium, because these were mutant cultures that analysis, was important because it solidified the contained a new mutation blocking the synthesis of © Jones &link Bartlett between Learning, genetics and LLC biochemistry. Equally as© Jonessome & essential Bartlett nutrient. Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & BartlettTHE Learning, HUMAN LLC CONNECTION© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION One Gene, One Enzyme George W. Beadle and Edward L. Tatum (1941) Stanford University,© Jones Stanford, & Bartlett California Learning, LLC © Jones & Bartlett Learning, LLC Genetic ControlNOT FOR of SALE Biochemical OR DISTRIBUTION Reactions in NeurosporaNOT FOR SALE OR DISTRIBUTION

How do genes control metabolic processes? The sugges- attempting to determine its genetic basis. First, these tion that genes control enzymes was made very early in analyses are limited to traits in which the variants are the© history Jones of genetics, & Bartlett most Learning, notably by the LLC British phy- nonlethal. Second,© Jones the variants& Bartlett must haveLearning, visible effects. LLC sicianNOT Archibald FOR GarrodSALE in OR his DISTRIBUTION1903 book, Inborn Errors To get aroundNOT these FOR problems, SALE Beadle OR andDISTRIBUTION Tatum turned of Metabolism. Nevertheless, the precise relationship the problem on its head. between genes and enzymes was still uncertain. Perhaps [These limitations] have led us to investigate the each enzyme is controlled by more than one gene, or general problem of the genetic control of devel- perhaps each gene contributes to the control of several © Jones & Bartlett Learning, LLC © Jonesopment & Bartlett and metabolicLearning, reactions LLC by revers- enzymes. The classic experiments of Beadle and Tatum NOT FOR SALE OR DISTRIBUTION NOT FORing SALE the ordinary OR DISTRIBUTIONprocedure . . . [by setting out] showed that the relationship is usually remarkably simple: to determine if and how genes One gene codes for one enzyme. Their These preliminary results control known biochemical reac- pioneering experiments united genet- appear“ to us to indicate that the tions . . . If the organism must be ics and biochemistry,© and Jones for the &“one Bartlett Learning, LLC © Jones & Bartlett Learning, LLC approach may offer considerable able to carry out a certain chem- gene, one enzyme” NOT concept, FOR Beadle SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION promise as a method of learning ical reaction to survive on a given and Tatum were awarded a Nobel Prize more about how genes regulate medium, a mutant unable to do in 1958 (Joshua Lederberg shared the development and function. this will obviously be lethal on this prize for his contributions to microbial ” medium. . . . [It can be] studied, genetics). Because we now know that © Jones & Bartlett Learning, LLC however,© Jonesif it will grow& Bartlett on a medium Learning, to which LLC some enzymes contain polypeptide chains encoded by NOT FOR SALE OR DISTRIBUTION has beenNOT added FOR the SALE essential OR product DISTRIBUTION of the two (or occasionally more) different genes, a more accu- genetically blocked reaction. . . . rate statement of the principle is “one gene, one polypeptide.” Beadle and Tatum’s experiments also demonstrate Thus, rather than starting with observed differences in the importance of choosing the right organism. Neurospor a traits among individuals, Beadle and Tatum started by © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC had been introduced as a genetic organism only a few generating mutations (in their case, mutations resulting NOT FOR SALEyears earlier, OR DISTRIBUTION and Beadle and Tatum realized that theyNOT fromFOR x-irradiation SALE OR of Neurospora DISTRIBUTION cells), then identified the could take advantage of this organism’s ability to grow on mutations that were lethal on minimal medium but not on a simple medium composed of known substances. medium supplemented with the normal product of the Beadle and Tatum’s work was published in 1941 and can mutated gene. This experimental approach ranks among be found at the reference© Jones at the end& Bartlett of this feature. Learning, In it, LLCthe most important experimental© Jones tool of genetic & Bartlett analysis. Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION they point out the limitations of starting with the physio- G. W. Beadle and E. L. Tatum, Genetic control of biochemical reactions logical basis of a trait (such as black urine disease) and in Neurospora. Proc. Natl. Acad. Sci. USA 27 (1941): 499–506.

Spores© Jones from & each Bartlett mutant Learning, culture were LLC then trans- minimal medium© Jones allows & Bartlett growth. BecauseLearning, the proporLLC - ferredNOT to a FORseries SALEof media OR to DISTRIBUTIONdetermine whether the tion of irradiatedNOT FOR cultures SALE with OR new DISTRIBUTION mutations was mutation results in a requirement for a vitamin, an very small, only a negligible number of cultures would amino acid, or some other substance. In the example contain two or more new mutations that had occurred illustrated in Figure 1.11, Part B, the mutant strain simultaneously. requires one (or possibly more than one) amino acid, For nutritional mutants requiring amino acids, © Jones &because Bartlett a mixture Learning, of all LLC amino acids added to the© Jonesfurther & Bartlettexperiments Learning, testing each LLC of the amino acids NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning, LLC © Jones & BartlettFilamentous Learning, mycelium LLC grows in complete medium NOT FOR SALE OR DISTRIBUTION NOT FOR SALE ORand DISTRIBUTION many gentically identical asexual spores are produced.

Asexual spores (conidia) ©Spore Jones exposed & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC to x-rays or Asexual ultraviolet light NOT FOR SALE OR DISTRIBUTIONcycle NOT FOR SALE OR DISTRIBUTION

An ascospore is placed in complete medium in a test tube. © JonesFruiting & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT bodyFOR SALE ORAscus DISTRIBUTION NOT FORMycelium SALE OR DISTRIBUTION Sexual cycle

Germination © Jones & Bartlett Learning, LLC © Jonesof ascospore & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Each ascus inside the fruiting body contains ascospores. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC FIGURE 1.10 Beadle and Tatum obtained mutants of the filamentous fungus Neurospora crassa by exposing asexual spores to x-rays or ultraviolet light. The treatedNOT spores FOR were usedSALE to start OR the DISTRIBUTIONsexual cycle in fruiting bodies. After any pair of cellsNOT and FOR their nuclei SALE undergo OR DISTRIBUTION fusion, meiosis takes place almost immediately and results in eight sexual spores (ascospores) included in a single ascus. These are removed individually and cultured in complete medium. Ascospores that carry new nutritional mutants are identified later by their inability to grow in minimal medium.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC individuallyNOT FOR usually SALE revealed OR DISTRIBUTION that only one amino NOT FOR SALE OR DISTRIBUTION acid was required to be added to minimal medium KEY CONCEPT to support growth. In Figure 1.11, Part C, the mutant If a strain with a mutant enzyme that blocks a par- strain requires the amino acid arginine. Even in the ticular step in a linear metabolic pathway can 1940s some of the possible intermediates in amino grow when an intermediate is added to the © Jones &acid Bartlett biosynthesis Learning, had been LLC identified. These were rec-© Jonesgrowth & Bartlett medium, Learning, it means that LLC the location of the NOT FORognized SALE by OR their DISTRIBUTION chemical resemblance to the aminoNOT FORintermediate SALE ORin the DISTRIBUTION pathway is downstream of the acid and by being present at low levels in the cells enzymatic step that is blocked. of organisms. In the case of arginine, two candidates were ornithine and citrulline. All mutants requir- This principle makes intuitive sense because, if the ing arginine were, therefore, tested in medium sup- intermediate were upstream of the metabolic block, plemented with either ornithine alone or citrulline © Jones & Bartlett Learning, LLCthen adding the intermediate© Jones to the growth& Bartlett medium Learning, LLC alone (Figure 1.11, Part D). One class of arginine- NOT FOR SALE OR DISTRIBUTIONwould not allow growth, NOTbecause FOR conversion SALE ORof the DISTRIBUTION requiring mutants, designated Class I, was able to intermediate would still be blocked at the point of the grow in minimal medium supplemented with either mutant enzyme. ornithine, citrulline, or arginine. Other mutants, Application of the principle to the linear pathway designated Class II, were able to grow in minimal for arginine biosynthesis is shown in FIGURE 1.12, medium supplemented with either citrulline or argi- © Jones & Bartlett Learning, LLC where arginine© Jones is the & end Bartlett product Learning, starting with LLC some nine but not ornithine. A third class, Class III, was NOT FOR SALE OR DISTRIBUTION precursor NOTmetabolite, FOR andSALE ornithine OR DISTRIBUTION and citrulline are able to grow only in minimal medium supplemented intermediates in the pathway. The mutants imply the with arginine. order of the intermediates shown because The types of arginine-requiring mutants illustrate the principle of genetic analysis as applied to metabolic ■■ Mutants in Class I are able to grow in the presence © Jones &pathways. Bartlett The Learning, basic principle LLC is that © Jones &of Bartlett either ornithine Learning, or citrulline, LLC which means that NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

(B) Test for required nutrient © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE(A) ORTest forDISTRIBUTION nutritional mutants NOT FOR SALE OR DISTRIBUTION

Asexual Asexual spores spores (conidia)© Jones & Bartlett Learning,(conidia) LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

MM + MM + MM + © Jones & Bartlett Learning, LLC © Jonesvitamins & Bartlettamino nucleic Learning, acid LLC Complete Minimal Complete Minimal acids precursors NOT FORmedium SALE ORmedium DISTRIBUTION medium medium NOT FOR SALE OR DISTRIBUTION (MM) (MM) Mutant strains are tested on MM supplemented with mixtures of Most strains grow A few strains fail to nutrients. The mutant strain in MM; these are grow in MM; these here requires amino acids to grow. © Jones & Bartlettnonmutant Learning, and LLC are mutant and are© Jones & Bartlett Learning, LLC are discarded. kept for futher study. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE(D) Test ORof arginine DISTRIBUTION precursors

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC MM + MM + MM + NOT FOR SALE OR DISTRIBUTION NOT FORornithine SALEcitrulline OR arginineDISTRIBUTION MM + MM + MM + MM + MM + MM + MM + leucine valine glycine serine arginine lysine proline Mutant strains requiring arginine are tested on MM supplemented Mutant strains requiring amino acids are tested on MM with possible precursors of arginine. © Jones & Bartlettsupplement Learning,ed with LLC each of the amino acids in tu©rn Jones. & BartlettThis mutant Learning, strain grows LLC on citrulline The mutant strain here requires arginine to grow. or arginine, but not ornithine. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION FIGURE 1.11 (A) Mutant spores can grow in complete medium but not in minimal medium. (B) Each new mutant is tested for growth in minimal medium supplemented with a mixture of nutrients. (C) Mutants that can grow on minimal medium supplemented with amino acid are tested with each amino acid individually. (D) Mutants unable to grow in the absence of arginine are tested with likely precursors of arginine. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION both ornithine and citrulline are downstream of means that these intermediates are upstream of any of the enzymes blocked in Class I mutants. any of the enzymatic steps blocked in Class III mutants. ■■ Mutants in Class II are able to grow in the presence of citrulline but not ornithine, which © Jones & Bartlett Learning, LLC The structure© Jones of &the Bartlett pathway Learning, in Figure 1.12 LLC was means that citrulline is located downstream of further confirmed by the observations that Class III NOTthe enzymaticFOR SALE block OR in ClassDISTRIBUTION II mutants and that NOT FOR SALE OR DISTRIBUTION mutants accumulate citrulline and Class II mutants ornithine is upstream of the metabolic block in accumulate ornithine. Ultimately, direct biochemical Class II mutants. experiments demonstrated that the inferred enzymes ■■ Mutants in Class III are unable to grow in the were actually present in nonmutant strains but defec- © Jones & Bartlettpresence Learning, of either citrullineLLC or ornithine, which© Jonestive in & mutant Bartlett strains. Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & BartlettSTOP Learning, & THINK LLC 1.3 © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Suppose you do a mutant screen for Neurospora mutants unable to grow on minimal medium unless they are supplemented with an amino acid we’ll call “A.” Based on their molecular structures, you surmise that two molecules, X and Y, are intermediates in the biochemical pathway for the synthesis of A, but you are unsure which of the following pathways may be correct: © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION(a) X Y A NOT FOR SALE OR DISTRIBUTION (b) Y X A You find two classes of mutants that require A for growth. Class 1 grows on minimal medium supplemented with A but not with X or Y. © Jones & BartlettClass 2 Learning,grows on minimal LLC medium supplemented with© JonesA or X but & not Bartlett with Y. Learning, LLC WhichNOT of theFOR pathways SALE (a) OR or (b) DISTRIBUTION do these data support? NOT FOR SALE OR DISTRIBUTION

Precursor Each step in the biochemical pathway is catalyzed by the © Jones & Bartlett Learning, LLC © Jonesenzyme & product Bartlett of a different Learning, LLC NOT FOR SALE OR DISTRIBUTION NOTgene. FOR SALE OR DISTRIBUTION Class I mutants (three complementation groups) Some intermediates in the biochemical pathway may not be known. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONNH2 O NOT FOR SALE OR DISTRIBUTION

NH 2 CH2 CH2 CH2 C C Ornithine H OH Class II mutants When the intermediates (one complementation are known, the order of group) steps in the pathway can © Jones & Bartlett Learning, LLC be determined.© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION O NH2 O

NH2 C NH CH2 CH2 CH2 C C Citrulline H OH

© Jones & Bartlett Learning, LLCClass III mutants © JonesThe intermediate & Bartlett at this Learning, LLC (two complementation step was later shown to be NOT FOR SALE OR DISTRIBUTIONgroups) NOT argininosuccinate.FOR SALE OR DISTRIBUTION

NH NH2 O

NH2 C NH CH2 CH2 CH2 C C © Jones & Bartlett Learning,Arginine LLCH OH © Jones & Bartlett Learning, LLC

FIGURE 1.12 Metabolic pathwayNOT forFOR arginine SALE biosynthesis OR DISTRIBUTION inferred from genetic analysis of Neurospora mutants.NOT FOR SALE OR DISTRIBUTION

pathway than merely the order of the intermediates. Mutant screens sometimes isolate By classifying each mutation according to the partic- different© Jones mutations & Bartlett in Learning,the same gene.LLC ular gene© it Jonesis in and & groupingBartlett all Learning, the mutations LLC in BeadleNOT and FOR Tatum SALE were fortunateOR DISTRIBUTION to study metabolic each geneNOT together, FOR each SALE set of OR mutations DISTRIBUTION and, there- pathways in a relatively simple organism in which fore, each individual gene, correspond to one enzy- each gene specifies a single enzyme, a relation often matic step in the metabolic pathway. In Figure 1.12, called the one gene–one enzyme hypothesis. In for example, Class I includes mutations in any of such a situation, genetic analysis of the mutants three different genes, which implies that there are © Jones &reveals Bartlett a great Learning, deal more LLC about the metabolic© Jonesthree & steps Bartlett in the Learning, pathway between LLC the precursor NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

and ornithine. Similarly, Class III comprises muta- heterokaryon, the red nuclei produce mutant forms © Jones tions& Bartlett in either Learning, of two different LLC genes, which implies© Jonesof the & redBartlett protein Learning, and normal LLC forms of the purple NOT FORthat SALE there OR are DISTRIBUTION two steps in the pathway betweenNOT protein,FOR SALE whereas OR the DISTRIBUTION purple nuclei produce mutant the citrulline and arginine. However, Class II con- forms of the purple protein and normal forms of the sists of mutations in only one gene, which implies red protein. The result is that the red/purple hetero- only one step in the pathway between ornithine and karyon has normal forms of both the red and purple citrulline. proteins. It also has mutant forms of both proteins, Mutations that ©have Jones defects & Bartlettin the same Learning, gene LLCbut these do not matter.© What Jones matters & Bartlett is that Learning,the LLC are identified by NOTmeans FOR of a SALEcomplementation OR DISTRIBUTION normal proteins allow theNOT heterokaryon FOR SALE to grow OR onDISTRIBUTION test, in which two mutations are brought together minimal medium because all needed nutrients can into the same cell. In most multicellular organisms be synthesized. In other words, the normal purple (and even some sexual unicellular organisms), the gene in the red nucleus complements the defective usual way to do this is by means of a mating. When purple gene in the purple nucleus, and the other two ©parents, Jones each & Bartlett carrying Learning,one of the LLCtwo muta- way around.© Jones The logic & Bartlettof complementation Learning, isLLC cap- tions,NOT are crossed,FOR SALE fertilization OR DISTRIBUTION brings the reproduc- tured in NOTthe ancient FOR SALEnursery OR rhyme DISTRIBUTION “Jack Sprat tive cells containing the two mutations together, could eat no fat / His wife could eat no lean / And and through ordinary cell division each cell in the so between the two of them / They licked the platter resulting offspring carries one copy of each mutant clean,” because each partner makes up for the defect gene. In Neurospora this procedure does not work in the other. © Jones &because Bartlett nuclear Learning, fusion isLLC followed almost immedi-© JonesPart & Bartlett B in Figure Learning, 1.13 shows LLCa heterokaryon formed NOT FORately SALE by theOR formation DISTRIBUTION of ascospores, each of whichNOT betweenFOR SALE mutants OR with DISTRIBUTION defects in the same gene, in this has only one set of chromosomes. case purple. Both of the purple nuclei encode a nor- Complementation tests are nevertheless possible mal form of the red protein, but each purple nucleus in Neurospora owing to the multinucleate nature of encodes a defective purple protein. When the nuclei the filaments. Certain strains, including those studied are together, two different mutant forms of the purple by Beadle and Tatum,© haveJones the & property Bartlett that Learning, when LLCprotein are produced, and so© theJones biosynthetic & Bartlett pathway Learning, LLC the filaments from twoNOT mutant FOR SALEorganisms OR come DISTRIBUTION into that requires the purple proteinNOT is FOR still blocked, SALE andOR the DISTRIBUTION physical contact, the filaments fuse and the new fil- heterokaryon is unable to grow in minimal medium. ament contains multiple nuclei from both of the In other words, the mutants 2 and 3 in Figure 1.14 fail participating partners. This sort of hybrid filament is to complement, and so they are judged to have muta- called a heterokaryon, and it contains mutant forms tions in the same gene. of both© Jonesgenes. The & Bartlettword roots Learning, of the term LLCheterokaryon The following© Jones principle & Bartlett underlies Learning, the complemen LLC - meanNOT “different FOR nuclei.”SALE (AOR list DISTRIBUTION of the most common tation test.NOT FOR SALE OR DISTRIBUTION word roots used in genetics can be found at the end of the book.) KEY CONCEPT When a heterokaryon formed from two nutritional mutants is inoculated into minimal medium, The Principle of Complementation: A comple- © Jones &it mayBartlett grow Learning,or it may fail LLC to grow. If it grows in min-© Jonesmentation & Bartlett test brings Learning, two mutant LLC genes together NOT FORimal SALE medium, OR DISTRIBUTION the mutant genes are said to undergoNOT FORin the SALE same cell OR or DISTRIBUTION organism. If this cell or organ- complementation, and this result indicates that ism is nonmutant, the mutations are said to com- the mutations are in different genes. On the other plement one another and it means that the hand, if the heterokaryon fails to grow in minimal parental strains have mutations in different genes. medium, the result indicates noncomplementa- If the cell or organism is mutant, the mutations fail tion, and the two mutations© Jones are & inferred Bartlett to beLearning, in the LLCto complement one another,© Jones and it means& Bartlett that Learning, LLC same gene. NOT FOR SALE OR DISTRIBUTIONthe parental mutations areNOT in the FOR same SALE gene. OR DISTRIBUTION The inferences from complementation or non- complementation emerge from the logic illustrated in FIGURE 1.13. Here the multinucleate filament is A complementation test identifies shown, and the mutant nuclei are color coded accord- mutations in the same gene. ing to© whichJones of & two Bartlett different Learning, genes (red LLC or purple) In the mutant© Jones screen & for Bartlett Neurospora Learning, mutants LLCrequir- is mutant.NOT FORThe thick SALE red ORand DISTRIBUTIONpurple horizontal lines ing arginine,NOT Beadle FOR and SALE Tatum OR found DISTRIBUTION that mutants represent the proteins encoded in the mutant nuclei, in different classes (Class I, Class II, and Class III in and the × represents a defect in the protein resulting Figure 1.12) always complemented one another. This from a mutation in the corresponding gene. result makes sense, because the genes in each class Part A depicts the situation in which the mutant encode enzymes that act at different levels between the © Jones &strains Bartlett have Learning, mutations LLCin different genes. In the© Jonesknown & intermediates.Bartlett Learning, However, LLC some of the mutants NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

(A) (B) © Jones & Bartlett Learning,Mutant 1 LLC Mutant© Jones 2 & Bartlett Learning, LLCMutant 3 NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Complementation No complementation (mutations in different genes) (mutations in same gene) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Complementation No complementation Growth on minimal No growth on minimal © Jones &medium Bartlett Learning, LLC © Jones &medium Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

FIGURE 1.13 Molecular interpretation of a complementation test using heterokaryons to determine whether two mutant strains have mutations in different genes (A) or mutations in the same gene (B). In (A) each nucleus contributes a nonmutant form of one or the other polypeptide chain, and so the heterokaryon is able to grow in minimal medium. In (B) both nuclei contribute a mutant form of the same polypeptide chain; hence, no nonmutant form of that polypeptide can be synthesized and the heterokaryon is unable to grow in © Jones &minimal Bartlett medium. Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION in Class I failed to complement others in Class I, the matrix indicate that mutations x1 and x5 fail to and some in Class III failed to complement others in complement one another; hence, x1 and x5 are muta- Class III. These results allow the number of genes in tions in the same gene. Likewise, mutations x2, x3, each class to be identified.© Jones & Bartlett Learning, LLCx4, and x6 fail to complement© Jones one another & Bartlett in all pos Learning,- LLC To illustrate thisNOT aspect FOR of genetic SALE analysis,OR DISTRIBUTION we sible pairs; hence, x2, x3, xNOT4, and FOR x6 are SALE all mutations OR DISTRIBUTION consider six mutant strains in Class III. These strains in the same gene (but a different gene from that rep- were taken in pairs to form heterokaryons and their resented by x1 and x5). growth on minimal medium assessed. The data are Data in a complementation matrix can conve- shown in FIGURE 1.14, Part A. The mutant genes niently be analyzed by arranging the mutant genes in the© Jonessix strains & Bartlettare denoted Learning, x1, x2, and LLC so forth, in the form© Jones of a circle & Bartlett as shown Learning, in Figure LLC 1.14, and NOTthe data FOR are SALE presented OR in DISTRIBUTION the form of a matrix Part B. Then,NOT forFOR each SALE possible OR pairDISTRIBUTION of mutations, in which 1 indicates growth in minimal medium connect the pair by a straight line if the mutations (complementation) and 2 indicates lack of growth fail to complement (2 signs in part A). According to in minimal medium (lack of complementation). The the principle of complementation, these lines con- diagonal entries are all 2, which reflects the fact that nect mutations that are in the same gene. Each of © Jones &two Bartlett copies ofLearning, the identical LLC mutation cannot show© Jonesthe groups & Bartlett of noncomplementing Learning, LLC mutations is called NOT FORcomplementation. SALE OR DISTRIBUTION The pattern of 1 and 2 signs inNOT aFOR complementation SALE OR DISTRIBUTION group. As we have seen, each

A plus sign in the complementation © Jones &This Bartlett connecting Learning, line means LLC © Jones & Bartlett Learning,matrix LLC means that the indicated that x1 and x5 fail to complement NOT FOR SALE OR DISTRIBUTIONmutations do complement one NOT FORone SALE another; OR they DISTRIBUTION are different another. mutant foms of one gene.

(A) x1 x2 x3 x4 x5 x6 (B) x1 x1 _ + + + _ + © Jones_ &_ Bartlett_ _Learning, LLC x6 © Jonesx2 & Bartlett Learning, LLC NOTx2 FOR SALE+ OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION _ _ _ x3 + _ _ x4 + x5 x3 A minus sign in the x5 _ + x4 © Jones complementation& Bartlett Learning, LLC © Jones & Bartlett Learning, LLC _ NOT FORmatrix SALE means OR that DISTRIBUTION the x6 These connectingNOT linesFOR mean SALE that x 2,OR DISTRIBUTION indicated mutations x3, x4, and x6 fail to complement one do not complement another in any pairwise combination; one another. they are mutant foms of a different gene.

FIGURE 1.14 (A) Results of complementation tests. (B) To interpret the results, arrange the mutations in a circle. Connect by a straight © Jones &line Bartlett any pair of mutationsLearning, that failLLC to complement—that is, that yield© Jones a mutant heterokaryon.& Bartlett Any Learning, pair of mutations LLC connected by a straight line are mutations in the same gene, and are more than likely mutations at different nucleotide sites in the gene. This example NOT FORshows SALE two complementationOR DISTRIBUTION groups, each of which represents aNOT single FORgene needed SALE for ORarginine DISTRIBUTION biosynthesis.

complementation group© Jones defines & aBartlett gene, so Learning,the com- LLCarginine. On the basis of ©the Jones one gene–one & Bartlett enzyme Learning, LLC plementation test actuallyNOT FOR provides SALE the ORgeneticist’s DISTRIBUTION hypothesis, which is largelyNOT FORtrue SALEfor metabolic OR DISTRIBUTION operational definition: enzymes in Neurospora, the pathway from citrulline to arginine in Figure 1.12 must comprise two steps KEY CONCEPT with an unknown intermediate in between. This intermediate was later found to be argininosuccinate. A gene© Jones is defined & Bartlett experimentally Learning, as a set LLC of muta- Likewise, ©Class Jones I mutants & Bartlett defined Learning, three complemen LLC - tionsNOT that FORmake SALEup a single OR complementation DISTRIBUTION tation groups;NOT hence, FOR thereSALE are OR three DISTRIBUTION enzymatic steps group. Any pair of mutations within a complemen- from the precursor to ornithine. These intermediates tation group fail to complement one another. were also soon identified. Finally, Class II mutations all failed to complement one another, and the finding The mutations in Figure 1.14, therefore, represent of only one complementation group means that there © Jones &two Bartlett genes, mutationLearning, of LLCany one of which results© Jonesis but & a Bartlettsingle enzymatic Learning, step thatLLC converts ornithine NOT FORin SALE the inability OR DISTRIBUTION of the strain to convert citrulline toNOT toFOR citrulline. SALE OR DISTRIBUTION

STOP &© THINKJones & Bartlett 1.4 Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Among mutations affecting a metabolic pathway in Neu- m1 m2 m3 m4 m5 m6 rospora, one class of mutants blocks the conversion of m1 _ + + _ + + W into Z. These mutants can grow on minimal medium m2 _ _ ++ _ when supplemented with Z, but they can’t when sup- © Jones & Bartlett Learning, LLC © Jones & Bartlett_ ++ Learning,_ LLC plementedNOT FOR with W.SALE You carry OR out DISTRIBUTION complementation tests NOT FORm3 SALE OR DISTRIBUTION _ with six such mutants (m1, m2, …, m6) and find the com- m4 ++ plementation matrix shown here. m5 _ +

(a) How many different genes are indicated by these results? m6 _ (b) If each gene codes for a different enzyme in the pathway, how © Jones & manyBartlett enzymatic Learning, steps are there LLC in the conversion of W into Z? © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Genetic analysis can be applied principles for introducing specific gene modifi- © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC to the study of any complex cations in mice by the use of embryonic stem NOT FOR SALE OR DISTRIBUTION NOT FOR cells”SALE OR DISTRIBUTION biological process. The type of genetic analysis pioneered by Beadle ■■ 2009—Elizabeth H. Blackburn, Carol W. Greider, and Tatum is immensely powerful for identifying the and Jack W. Szostak “for the discovery of how genetic control of complex biological processes. Their chromosomes are protected by telomeres and approach lays out a systematic© Jones path—a & Bartlett sort of Learning, recipe— LLC the enzyme telomerase”© Jones & Bartlett Learning, LLC for gene discovery. First,NOT decide FOR what SALE process OR you DISTRIBUTION want ■■ 2013—James E. Rothman,NOT FOR Randy SALE W. Schekman, OR DISTRIBUTION to study. Next figure out what characteristics mutant and Thomas C. Südhof “for their discoveries of organisms with a disruption in that process would dis- machinery regulating vesicle traffic, a major play. Then do a mutant screen for mutants showing transport system in our cells” these characteristics. Carry out complementation tests to find© Jones out how & Bartlettmany different Learning, genes that LLC you have ■■ 2015—Tomas© Jones Lindahl,& Bartlett Paul Learning, Modrich, and LLC Aziz identified.NOT FORAnd finally,SALE ORfind DISTRIBUTION out what the products of SancarNOT “for FOR mechanistic SALE studiesOR DISTRIBUTION of DNA repair” those genes are, what they do, how they interact with ■■ 2017—Jeffrey C. Hall, Michael Rosbash, and each other, and in what order they function. Michael W. Young “for their discoveries of Beadle and Tatum themselves analyzed many molecular mechanisms controlling the circadian metabolic pathways for a wide variety of essen- rhythm” © Jones &tial Bartlett nutrients, Learning, but their experimentsLLC were especially© Jones & Bartlett Learning, LLC NOT FORimportant SALE OR in DISTRIBUTIONdeciphering pathways of amino acidNOT FOR SALE OR DISTRIBUTION biosynthesis. Their findings over just a few years are 1.4 Genes specify proteins by said to have “contributed more knowledge of amino means of a genetic code. acid biosynthetic pathways than had been accumu- The Beadle and Tatum experiments established that a lated during decades of traditional study.” They were gene specifies the structure of an enzyme but left open awarded the 1958 Nobel© Jones Prize in & Physiology Bartlett Learning,or Med- LLC © Jones & Bartlett Learning, LLC the issue of how this happens. We now know that icine for their research,NOT and FOR in the SALE intervening OR DISTRIBUTION years NOT FOR SALE OR DISTRIBUTION the relationship between genes and proteins is indi- at least nine more Nobel Prizes in Physiology or Med- rect. The genetic information that specifies a protein icine were awarded in which genetic analysis carried is actually contained in the sequence of bases in DNA out along the lines of Beadle and Tatum played a sig- in a manner analogous to letters printed on a strip of nificant role. Here is a list, with quotations from the paper. In a region of DNA that directs the synthesis official© Jonescitations & of Bartlett the Nobel Learning, Foundation. LLC © Jones & Bartlett Learning, LLC of a protein, the genetic code for the protein is con- NOT■■ FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 1958—George Beadle and Edward Tatum “for tained in only one strand, and it is decoded in a linear their discovery that genes act by regulating defi- order. The result of protein synthesis is a polypeptide nite chemical events.” (It was in doing literature chain, which consists of a linear sequence of amino research for his Nobel Prize Lecture that Beadle acids connected end to end. Each polypeptide chain discovered Garrod’s earlier work and brought it © Jones & Bartlett Learning, LLC © Jonesfolds &into Bartlett a characteristic Learning, three-dimensional LLC configu- to the world’s attention.) ration that is determined by its particular sequence of NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ■■ 1965—François Jacob, André Lwoff, and Jacques amino acids. A typical protein is made up of one or Monod “for their discoveries concerning genetic more polypeptide chains. Many proteins function as control of enzyme and virus synthesis” enzymes that participate in metabolic processes such as amino acid biosynthesis. ■■ 1995—Edward B. Lewis, Christiane Nüsslein- Volhard, and Eric© JonesF. Wieschaus & Bartlett “for their Learning, discov- LLC © Jones & Bartlett Learning, LLC eries concerningNOT the FOR genetic SALE control OR of DISTRIBUTION early One of the DNA strandsNOT directs FOR SALE the OR DISTRIBUTION embryonic development” synthesis of a molecule of RNA.

■■ 2000—Leland H. Hartwell, Tim Hunt, and Sir The details of how genes code for proteins were not Paul Nurse “for their discoveries of key regula- understood until the 1960s, and an outline of the pro- © torsJones of the & cell Bartlett cycle” Learning, LLC cess is shown© Jones in FIGURE & Bartlett 1.15. The Learning, decoding LLCof the genetic information takes place in two distinct steps NOT■■ 2002—Sydney FOR SALE Brenner, OR DISTRIBUTION H. Robert Horvitz, and known asNOT transcription FOR SALE and translation OR DISTRIBUTION. The indirect John E. Sulston “for their discoveries concerning route of information transfer genetic regulation of organ development and programmed cell death” DNA → RNA → Protein © Jones & Bartlett■■ 2007—Mario Learning, R. Capecchi, LLC Martin J. Evans, and© Jonesis known & Bartlett as the central Learning, dogma LLC of molecular genetics. NOT FOR SALEOliver OR DISTRIBUTIONSmithies “for their discoveries ofNOT TheFOR term SALE dogma OR means DISTRIBUTION “set of beliefs”; it dates from

DNA © Jones &Nucleotide Bartlett sequence Learning,ATGT LLCCCACTGCGGTCCTGGAA © Jones & Bartlett Learning, LLC TACAGGTGACGCCAGGACCTT NOT FOR inSALE DNA molecule OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

TRANSCRIPTION TRANSCRIPTION

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC rRNA mRNA tRNA Two-step decoding NOT FORAn RNA SALE intermediate OR DISTRIBUTION(ribosomal) (messenger)NOT FOR SALE(transfer) OR DISTRIBUTION process synthesizes plays the role of a polypeptide. “messenger.”

Ribosome

© Jones & Bartlett Learning,TRANSLATION LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION TRANSLATION Amino acid sequence in polypeptide chain Met Ser Thr Ala Val Leu Glu ATGTCCACTGCGGTCCTGGAA

© Jones & Bartlett Learning,DNA LLCtriplets encoding each amino acid © Jones & Bartlett Learning,Protein LLC NOT FORFIGURE SALE 1.15 ORDNA DISTRIBUTION sequence coding for the first seven amino NOT FOR SALE OR DISTRIBUTION acids in a polypeptide chain. The DNA sequence specifies the FIGURE 1.16 The “central dogma” of molecular genetics: DNA amino acid sequence through a molecule of RNA that serves as codes for RNA, and RNA codes for proteins. The DNA → RNA step an intermediary “messenger.” Although the decoding process is is transcription, and the RNA → protein step is translation. indirect, the net result is that each amino acid in the polypeptide chain is specified by a group of three adjacent bases in the DNA. In this example, the polypeptide chain is that of phenylalanine © Jones & Bartlett Learning, LLC ■■ © Jones & Bartlett Learning, LLC hydroxylase (PAH). A set of about 45 transfer RNA (tRNA) mole NOT FOR SALE OR DISTRIBUTION cules, each of whichNOT carries FOR a particular SALE ORamino DISTRIBUTION acid as well as a three-base recognition region the time the idea was first put forward as hypothesis. that base-pairs with a group of three adjacent Since then the “dogma” has been confirmed experi- bases in the mRNA. As each tRNA participates in mentally, but the term persists. The main concept in translation, its amino acid becomes the terminal the central© Jones dogma & Bartlettis that DNA Learning, does not code LLC for pro- subunit© Jones of the & growingBartlett polypeptideLearning, LLCchain. tein NOTdirectly FOR but ratherSALE acts OR through DISTRIBUTION an intermediary A tRNANOT thatFOR carries SALE methionine OR DISTRIBUTION is denoted molecule of ribonucleic acid (RNA). The structure of tRNAMet, one that carries serine is denoted RNA is similar to, but not identical with, that of DNA. tRNASer, and so forth. (Because there are more There is a difference in the sugar (RNA contains the than 20 different tRNAs, but only 20 amino sugar ribose instead of deoxyribose), RNA is usually acids, some amino acids can be attached to any © Jones &single Bartlett stranded Learning, (not a duplex), LLC and RNA contains the© Jones &of Bartlett several tRNAs.) Learning, LLC base uracil (U) instead of thymine (T), which is pres- NOT FOR SALE OR DISTRIBUTION NOT FORThe SALE central OR dogma DISTRIBUTION illustrated in FIGURE 1.16 ent in DNA. Three types of RNA take part in the syn- is the fundamental principle of molecular genetics thesis of proteins: because it summarizes how the genetic information in ■■ A molecule of messenger RNA (mRNA), which DNA becomes expressed in the amino acid sequence carries the genetic information from DNA and in a polypeptide chain. is used as a template© Jones for polypeptide & Bartlett synthesis. Learning, LLC © Jones & Bartlett Learning, LLC In most mRNANOT molecules, FOR SALE a relatively OR DISTRIBUTION high NOT FOR SALE OR DISTRIBUTION proportion of the nucleotides actually code for KEY CONCEPT amino acids. For example, the mRNA for phe- The sequence of nucleotides in a gene specifies nylalanine hydroxylase is 2400 nucleotides in the sequence of nucleotides in a molecule of length and codes for a polypeptide of 452 © Jones & Bartlett Learning, LLC messenger© Jones RNA; in & turn, Bartlett the sequence Learning, of LLC amino acids; in this case, more than 50 percent nucleotides in the messenger RNA specifies the NOTof the FOR length SALE of the OR mRNA DISTRIBUTION codes for amino sequenceNOT of amino FOR acids SALE in theOR polypeptide DISTRIBUTION acids. chain. ■■ Three types of ribosomal RNA (rRNA), which are major constituents of the cellular particles © Jones & Bartlettcalled Learning,ribosomes on LLC which polypeptide synthe-© JonesThe manner& Bartlett in which Learning, genetic LLC information is trans- NOT FOR SALEsis ORtakes DISTRIBUTION place. NOT ferredFOR SALEfrom DNA OR to DISTRIBUTION RNA is shown in FIGURE 1.17.

3’ 5’ Like DNA, an RNA strand also exhibits polarity; © Jones & Bartlett Learning, LLCTA © Jonesits 59 &and Bartlett 39 ends Learning, are determined LLC by the orientation NOT FOR SALE OR DISTRIBUTIONCG NOT ofFOR the nucleotides.SALE OR TheDISTRIBUTION 59 end of the RNA transcript is AT synthesized first, and in the RNA–DNA duplex formed in transcription, the polarity of the RNA strand is CG opposite to that of the DNA strand. Each gene includes CG particular nucleotide sequences that initiate and ter- © JonesGC & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC T A minate transcription. The RNA transcript made from NOT FOR SALE OR DISTRIBUTIONany gene begins at an initiationNOT FOR site in SALE the template OR DISTRIBUTION CG strand, which is located “upstream” from the amino T A acid coding region, and ends at a termination site, CG which is located “downstream” from the amino acid TA coding region. For any gene, the length of the RNA DNA© strand Jones & BartlettTA Learning, LLCDirection of transcript ©is veryJones much & smallerBartlett than Learning, the length LLC of the growth of NOTbeing FOR SALE AOR TDISTRIBUTION DNA in theNOT entire FOR chromosome. SALE OR ForDISTRIBUTION example, the transcribed RNA strand A T transcript of the PAH gene for phenylalanine hydrox- C 3’ G ylase is 90,000 nucleotides in length, but the DNA in C G G C all of chromosome 12 is about 130,000,000 nucleo- G C A tide pairs. In this case, the length of the PAH transcript © Jones & Bartlett Learning,T LLC © Jones & Bartlett Learning, LLC RNA transcript A is less than 0.1 percent of the length of the DNA in NOT FOR SALE OR DISTRIBUTION C NOT theFOR chromosome. SALE OR A DISTRIBUTION different gene in chromosome 12 C G T * U A would be transcribed from a different region of the C G C DNA molecule in chromosome 12, but the transcribed * U A T region would again be small in comparison with the G T A A total length of the DNA in the chromosome. A U © Jones & BartlettT Learning,5’ LLC © Jones & Bartlett Learning, LLC * 3’ NOT FOR SALE OR DISTRIBUTIONA molecule of RNA directsNOT FOR the SALEsynthesis OR DISTRIBUTION 5’ U in RNA pairs of a polypeptide chain. with A in DNA The synthesis of a polypeptide under the direction FIGURE 1.17 Transcription is the production of an RNA strand that of an mRNA molecule is known as translation. is complementary© Jones in& base Bartlett sequence Learning, to a DNA strand. LLC In this Although ©the Jones sequence & Bartlett of bases inLearning, the mRNA LLC codes example,NOT a DNA FOR strand SALE is being OR transcribed DISTRIBUTION into an RNA strand at for the sequenceNOT FOR of amino SALE acids OR in DISTRIBUTIONa polypeptide, the the bottom left. Note that in an RNA molecule, the base U (uracil) molecules that actually do the “translating” are the plays the role of T (thymine) in that it pairs with A (adenine). Each A–U pair is marked with an asterisk. tRNA molecules. The mRNA molecule is translated in nonoverlapping groups of three bases called codons. For each codon in the mRNA that specifies an amino © Jones &The Bartlett DNA opens Learning, up, and one LLC of the strands is used as a© Jonesacid, &there Bartlett is one Learning,tRNA molecule LLC containing a com- NOT FORtemplate SALE forOR the DISTRIBUTION synthesis of a complementary strandNOT plementaryFOR SALE group OR of DISTRIBUTION three adjacent bases that can pair of RNA. The process of making an RNA strand from with the bases in the codon. The correct amino acid a DNA template is transcription, and the RNA mole- is attached to the other end of the tRNA, and when cule that is made is the transcript. The base sequence this tRNA comes into line, the amino acid attached in the RNA is complementary (in the Watson–Crick to it becomes the new terminal end of the growing pairing sense) to that ©in Jonesthe DNA & template, Bartlett except Learning, that LLCpolypeptide chain. © Jones & Bartlett Learning, LLC U (which pairs with A)NOT is present FOR SALEin the RNA OR inDISTRIBUTION place The role of tRNA in translationNOT FOR is SALE illustrated OR inDISTRIBUTION of T. The rules of base pairing between DNA and RNA FIGURE 1.18 and can be described as follows: are summarized below. KEY CONCEPT Base in DNA template ©Adenine Jones & ThymineBartlett Learning,Guanine CytosineLLC The mRNA© Jones is read codon& Bartlett by codon. Learning, Each codon LLC NOT FOR SALE OR DISTRIBUTION that specifiesNOT anFOR amino SALE acid matchesOR DISTRIBUTION with a com- A T G C plementary group of three adjacent bases in a U A C G single tRNA molecule. One end of the tRNA is attached to the correct amino acid, so the correct Uracil Adenine Cytosine Guanine amino acid is brought into line. Base in RNA transcript © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

The tRNA molecules used in translation do not line moves along it in steps, three nucleotides at a time © Jones up& Bartlettalong the Learning, mRNA simultaneously LLC as shown in© Jones(codon & byBartlett codon). Learning,As each new codonLLC comes into place, NOT FORFigure SALE 1.18. OR The DISTRIBUTION process of translation takes place onNOT theFOR next SALE tRNA ORbinds DISTRIBUTION with the ribosome, and the grow- a ribosome, which combines with a single mRNA and ing end of the polypeptide chain becomes attached to the amino acid on the tRNA. In this way, each tRNA in turn serves temporarily to hold the polypeptide chain The coding sequence of bases in mRNA specifies as it is being synthesized. As the polypeptide chain is Messenger the amino acid sequence RNA (mRNA) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC of a polypeptide chain. transferred from each tRNA to the next in line, the NOT FOR SALE OR DISTRIBUTIONtRNA that previously heldNOT the polypeptide FOR SALE is released OR DISTRIBUTION Bases A UGU CCACUGCGGUCCUGGAA Each group of three from the ribosome. The polypeptide chain elongates in the U AC [ A GG adjacent bases is a codon. mRNA UGA one amino acid at a step until any one of three particular CGC CAG The mRNA is translated codons specifying “stop” is encountered. At this point, Transfer GAC codon by codon by means CUU RNA of tRNA molecules. synthesis of the chain of amino acids is finished, and Met (tRNA) © JonesSer & Bartlett Learning, LLC the polypeptide© Jones chain &is releasedBartlett from Learning, the ribosome. LLC Thr NOT FOR AlaSALE OR DISTRIBUTIONEach tRNA has a NOT FOR SALE OR DISTRIBUTION Val different base sequence Leu but about the same Glu The genetic code is a triplet code. Each tRNA carries an amino acid to be added Figure 1.18 indicates that the mRNA codon AUG spec- to the polypeptide chain. ifies methionine (Met) in the polypeptide chain, UCC © Jones & Bartlett Learning, LLC © Jonesspecifies & Bartlett Ser (serine), Learning, ACU specifies LLC Thr (threonine), FIGURE 1.18 The role of messenger RNA in translation is to carry NOT FORthe SALE information OR contained DISTRIBUTION in a sequence of DNA bases to a NOT andFOR so SALEon. The OR complete DISTRIBUTION decoding table is called the ribosome, where it is translated into a polypeptide chain. Translation genetic code, and it is shown in TABLE 1.1 . For any is mediated by transfer RNA (tRNA) molecules, each of which can codon, the column on the left corresponds to the first base-pair with a group of three adjacent bases in the mRNA. Each nucleotide in the codon (reading from the 59 end), tRNA also carries an amino acid; when it is brought to the ribosome by base pairing, its amino acid becomes the growing end of the the row across the top corresponds to the second polypeptide chain. © Jones & Bartlett Learning, LLCnucleotide, and the column© onJones the right & Bartlett corresponds Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

TABLE 1.1 The Standard Genetic Code

Second Nucleotide in Codon © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALEU OR DISTRIBUTIONC ANOT FOR SALE ORG DISTRIBUTION

UUU Phe F Phenylalanine UCU Ser S Serine UAU Tyr Y Tyrosine UGU Cys C Cysteine U UUC Phe F Phenylalanine UCC Ser S Serine UAC Tyr Y Tyrosine UGC Cys C Cysteine C U UUA Leu L Leucine UCA Ser S Serine UAA Termination UGA Termination A © Jones & BartlettUUG Learning, Leu L Leucine LLC UCG Ser S Serine © JonesUAG & TerminationBartlett Learning,UGG Trp LLC W Tryptophan G Third nucleotide in codon (3 9 end) NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION CUU Leu L Leucine CCU Pro P Proline CAU His H Histidine CGU Arg R Arginine U CUC Leu L Leucine CCC Pro P Proline CAC His H Histidine CGC Arg R Arginine C C CUA Leu L Leucine CCA Pro P Proline CAA Gln Q Glutamine CGA Arg R Arginine A CUG Leu L Leucine CCG Pro P Proline CAG Gln Q Glutamine CGG Arg R Arginine G © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC AUU Ile I NOTIsoleucine FOR SALEACU Thr OR T DISTRIBUTIONThreonine AAU Asn N Asparagine AGUNOT Ser SFOR Serine SALE UOR DISTRIBUTION AUC Ile I Isoleucine ACC Thr T Threonine AAC Asn N Asparagine AGC Ser S Serine C A AUA Ile I Isoleucine ACA Thr T Threonine AAA Lys K Lysine AGA Arg R Arginine A AUG Met M Methionine ACG Thr T Threonine AAG Lys K Lysine AGG Arg R Arginine G First nucleotide in codon (5 9 end) in codon First nucleotide © JonesGUU Val & BartlettV Valine Learning,GCU Ala LLC A Alanine GAU Asp D ©Aspartic Jones acid & GGUBartlett Gly G Learning, Glycine LLCU GUC Val V Valine GCC Ala A Alanine GAC Asp D Aspartic acid GGC Gly G Glycine C NOTG FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION GUA Val V Valine GCA Ala A Alanine GAA Glu E Glutamic acid GGA Gly G Glycine A GUG Val V Valine GCG Ala A Alanine GAG Glu E Glutamic acid GGG Gly G Glycine G

Codon Three-letter and single-letter abbreviations © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

to the third nucleotide. The complete codon is given Codon number © Jones in& Bartlettthe body ofLearning, the table, LLCalong with the amino acid© Jones &in Bartlett PAH gene Learning, LLC NOT FOR(or SALE “stop”) OR that DISTRIBUTION the codon specifies. Each amino acidNOT FOR SALE OR DISTRIBUTION is designated by its full name as well as by a three- 1234567 letter abbreviation and a single-letter abbreviation. ATG TCCACTGCGGTCCTGGAA Both types of abbreviations are used in molecu- DNA TAC AGGTGACGCCAGGACCTT lar genetics. The code in Table 1.1 is the “standard” genetic code used in ©translation Jones & in Bartlett the cells ofLearning, nearly LLCTRANSCRIPTION © Jones & Bartlett Learning, LLC all organisms. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION mRNA A UGU CCACUGCGGUCCUGGAA In addition to the 61 codons that code only for U AC A GG amino acids, there are 4 codons that have specialized UGA functions: CGC TRANSLATION CAG GAC ©■■ The Jones codon & AUG,Bartlett which Learning, specifies MetLLC (methi- © Jones & Bartlett Learning, LLCCUU Met onine), is also the “start” codon for polypeptide Ser NOT FOR SALE OR DISTRIBUTIONMet NOT FOR SALE ORThr DISTRIBUTION synthesis. The positioning of a tRNA bound to Polypeptide Ala AUG is one of the first steps in the initiation of Val Leu polypeptide synthesis, so all polypeptide chains Amino acid number Glu begin with Met. In most organisms, the tRNAMet in PAH polypeptide 1234567 © Jones & Bartlettused forLearning, initiation LLC of translation is the same© Jones & Bartlett Learning, LLC tRNAMet used to specify methionine at internal FIGURE 1.19 The central dogma in action. The DNA that encodes NOT FOR SALE OR DISTRIBUTION NOT PAHFOR serves SALE as a template OR DISTRIBUTION for the production of a messenger RNA, positions in a polypeptide chain. and the mRNA, in turn, serves to specify the sequence of amino acids in the PAH polypeptide chain through interactions with the ■■ The codons UAA, UAG, and UGA, each of which tRNA molecules. is a “stop,” specify the termination of translation and result in release of the completed polypeptide chain from© the Jones ribosome. & Bartlett These codons Learning, do LLC © Jones & Bartlett Learning, LLC or, in terms of the single-letter abbreviations, not have tRNANOT molecules FOR thatSALE recognize OR DISTRIBUTION them NOT FOR SALE OR DISTRIBUTION but are instead recognized by protein factors that 59-AUGUCCACUGCGGUCCUGGAA-39 terminate translation. M S T A V L E How the genetic code table is used to infer the The full decoding operation for this region of the amino© acidJones sequence & Bartlett of a polypeptide Learning, chain LLC may be PAH gene ©is shownJones in & FIGURE Bartlett 1.19 Learning,. In this figure, LLC the illustrated using phenylalanine hydroxylase again, in NOT FOR SALE OR DISTRIBUTION initiation NOTcodon FOR AUG SALEis highlighted OR DISTRIBUTION because some particular the DNA sequence coding for amino acid patients with PKU have a mutation in this particular numbers 1 through 7. The DNA sequence is codon. As might be expected from the fact that AUG is the initiation codon for polypeptide synthesis, cells in 9 9 5 -ATGTCCACTGCGGTCCTGGAA-3 patients with this particular mutation fail to produce 39-TACAGGTGACGCCAGGACCTT-59 © Jones & Bartlett Learning, LLC © Jonesany of& theBartlett PAH polypeptide. Learning, Mutation LLC and its conse- quences are considered next. NOT FORThis SALE region OR is DISTRIBUTIONtranscribed into RNA in a left-to-rightNOT FOR SALE OR DISTRIBUTION direction, and because RNA grows by the addition of successive nucleotides to the 39 end (Figure 1.17), it is 1.5 Genes change by mutation. the bottom strand that is transcribed. The nucleotide The term mutation refers to any heritable change in a sequence of the RNA is that of the top strand of the gene (or, more generally, in the genetic material); the DNA, except that U replaces T, so the mRNA for amino © Jones & Bartlett Learning, LLCterm also refers to the process© Jones by which & suchBartlett a change Learning, LLC acids 1 through 7 is NOT FOR SALE OR DISTRIBUTIONtakes place. One type of mutationNOT FOR results SALE in a changeOR DISTRIBUTION in the sequence of bases in DNA. The change may be 59-AUGUCCACUGCGGUCCUGGAA-39 simple, such as the substitution of one pair of bases in a The codons are read from left to right according to the duplex molecule for a different pair of bases. For exam- genetic© Jonescode shown & Bartlett in Table 1.1.Learning, Codon AUG LLC codes for ple, a C—G© pairJones in a &duplex Bartlett molecule Learning, may mutate LLC to T—A, A—T, or G—C. The change in base sequence may Met NOT(methionine), FOR SALE UCC codesOR DISTRIBUTION for Ser (serine), and so NOT FOR SALE OR DISTRIBUTION on. Altogether, the amino acid sequence of this region also be more complex, such as the deletion or addition of the polypeptide is of base pairs. Geneticists also use the term mutant, which refers to the result of a mutation. A muta- 59-AUGUCCACUGCGGUCCUGGAA-39 tion yields a mutant gene, which in turn produces a © Jones & Bartlett MetSerThrAlaValLeuGluLearning, LLC © Jonesmutant & BartlettmRNA, a mutantLearning, protein, LLC and finally a mutant NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

A G C T Codon 408 in Mutation of Codon 1 in Mutation of G A © Jones & Bartlett Learning,T C PAH LLC gene © Jones & Bartlett Learning, LLCPAH gene NOT FOR SALE OR DISTRIBUTION408 NOT FOR SALE OR DISTRIBUTION1234567

G CCACAATACC T GT G CCCT TCTCAGTT CGC DNA G TGTCCACTGCGGTCCTGGAA CGGTGTTATG G A A CCGGGA AGAGTCAAGCG DNA C ACAGGTGACGCCAGGACCTT TRANSCRIPTION

© JonesMutant initiation & Bartlett codon Learning, LLC mRNA G CCACAAU©ACC JonesU UGG CCC &UU BartlettCUCAGU UCGC Learning, LLC TRANSCRIPTION C GG in PAH mRNA U GU NOT FOR SALE OR DISTRIBUTION UANOTU FOR SALEMutant ORcodon DISTRIBUTION GGA in PAH mRNA TRANSLATION ACC mRNA GGG GUGUCCACUGCGGUCCUGGAA AAG CAC Ala AGU Thr CAA Ile GCG Polypeptide Pro TRANSLATION tRNAVal Trp © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning,Pro LLC Mutant amino acid Phe X No PAH polypeptide is produced in PAH polypeptide Ser NOT FOR SALE OR DISTRIBUTIONVal Val NOT FOR SALE OR DISTRIBUTIONVal because tRNA cannot be used Arg to initiate polypeptide synthesis. FIGURE 1.21 The R408W mutant in the PAH gene. Codon 408 for FIGURE 1.20 The M1V mutant in the PAH gene. The methionine arginine (R) is mutated into a codon for tryptophan (W). The result is codon needed for initiation mutates to a codon for valine. Translation that position 408 in the mutant PAH polypeptide is occupied by © Jones &cannot Bartlett be initiated, Learning, and no PAH polypeptideLLC is produced. © Jonestryptophan & Bartlett rather than Learning,by arginine. The LLCmutant protein has no PAH enzyme activity. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION organism that exhibits the effects of the mutation—for example, an inborn error of metabolism. codon 408 is changed from a C—G base pair into a DNA from patients from all over the world who T—A base pair. The result is that the PAH mRNA has a mutant codon at position 408; specifically, it has have phenylketonuria© hasJones been &studied Bartlett to determine Learning, LLC © Jones & Bartlett Learning, LLC what types of mutations are responsible for the inborn UGG instead of CGG. Translation does occur in this error. There are a largeNOT variety FOR of SALEmutant ORtypes. DISTRIBUTION More mutant because everythingNOT else FOR about SALE the mRNA OR DISTRIBUTIONis than 400 different mutations have been described. In normal, but the result is that the mutant PAH car- some cases part of the gene is missing, so the genetic ries a tryptophan (Trp) instead of an arginine (Arg) information to make a complete PAH enzyme is absent. at position 408 in the polypeptide chain. The conse- quence of the seemingly minor change of one amino In other© Jones cases the & genetic Bartlett defect Learning, is more subtle, LLC but the © Jones & Bartlett Learning, LLC result is still either the failure to produce a PAH pro- acid is very drastic, because the mutant PAH has no tein orNOT the productionFOR SALE of a OR PAH DISTRIBUTION protein that is inactive. enzyme activityNOT FORand so SALE is unable OR to DISTRIBUTION catalyze its met- In the mutation shown in FIGURE 1.20 , substitution abolic reaction. In other words, the mutant PAH pro- of a G—C base pair for the normal A—T base pair at tein is complete but inactive. With PAH, as with other the very first position in the coding sequence changes proteins, some amino acid replacements result in a the normal codon AUG (Met) used for the initiation of polypeptide chain that is unable to fold properly. The © Jones &translation Bartlett into Learning, the codon LLC GUG, which normally spec-© Jonesincorrectly & Bartlett folded Learning, polypeptides LLC are digested by pro- NOT FORifies SALE valine OR (Val) DISTRIBUTION and cannot be used as a “start” codon.NOT teasesFOR inSALE the cell, OR which DISTRIBUTION recycles the amino acids for The result is that translation of the PAH mRNA cannot use in the synthesis of other proteins. occur, so no PAH polypeptide is made. This mutant is designated M1V because the codon for M (methionine) at amino acid position 1 in the PAH polypeptide has been changed to ©a codon Jones for & V Bartlett(valine). Although Learning, LLC STOP & THINK© Jones 1.5 & Bartlett Learning, LLC the M1V mutant is quiteNOT rareFOR worldwide, SALE OR it isDISTRIBUTION com- NOT FOR SALE OR DISTRIBUTION mon in some localities, such as in Québec province in Suppose you discover a novel mutant form of the Canada. enzyme phenylalanine hydroxylase (PAH) with the One PAH mutant that is quite common is des- amino acid replacement R408Q—that is, the amino ignated R408W, which means that codon 408 in the PAH© Jones polypeptide & Bartlett chain Learning,has been changed LLC from acid arginine© Jones (R) normally & Bartlett found at Learning, position 408 inLLC the one NOTcoding FOR for arginine SALE OR(R) toDISTRIBUTION one coding for tryp- protein isNOT replaced FOR in SALEthe mutant OR by DISTRIBUTION the amino acid tophan (W). This mutant is one of the four most glutamine (G). What single nucleotide substitution in common in cases of PKU among European Cauca- the DNA coding for arginine at position 408 would sians. The molecular basis of the mutation is shown result in R408Q? in FIGURE 1.21. In this case, the first base pair in © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

factors are diet and exercise, but weight is also affected © Jones 1.6 & BartlettMost Learning, traits are LLC complex traits © Jonesby the & cumulative Bartlett Learning,impact of at least LLC 700 known genetic NOT FOR SALEaffected OR DISTRIBUTION by multiple genetic NOT factors,FOR SALE each of OR small DISTRIBUTION effect. and environmental factors. Inborn errors of metabolism illustrate the general 1.7 Evolution means continuity principle that genes code for proteins and that mutant of life with change. genes code for mutant© Jones proteins & Bartlettthat can resultLearning, in LLCThe pathway for the breakdown© Jones and & Bartlettexcretion Learning, of LLC inherited diseases suchNOT as FORphenylketonuria. SALE OR But DISTRIBUTION few phenylalanine is by no NOTmeans FOR unique SALE to humanOR DISTRIBUTION people have even met anyone with phenylketon- beings. One of the remarkable generalizations to uria because its frequency is only about 1 in 10,000 have emerged from molecular genetics is that organ- individuals. An inherited trait like phenylketonuria, isms that are very distinct—for example, plants and which is due to mutations in a single gene, is called animals—share many features in their genetics and a simple© Jones Mendelian & Bartlett trait because Learning, it occurs LLC in fami- biochemistry.© Jones These similarities& Bartlett indicate Learning, a fundamen LLC - lies accordingNOT FOR to simpleSALE genetic OR DISTRIBUTION ratios first discovered tal “unity ofNOT life”: FOR SALE OR DISTRIBUTION by Gregor Mendel (Chapter 2). Although about 2000 simple Mendelian diseases have been described, each of them is quite rare in the human population as a KEY CONCEPT whole (although some individual diseases are more All creatures on Earth share many features of the © Jones &common Bartlett in particularLearning, subgroups). LLC © Jonesgenetic & Bartlett apparatus, Learning, including LLCgenetic information NOT FOR SALEMost ORtraits DISTRIBUTION that you will encounter in everyday lifeNOT FORencoded SALE in the OR sequence DISTRIBUTION of bases in DNA, tran- are not simple Mendelian traits. The most commonly scription into RNA, and translation into protein on encountered diseases include heart disease, diabetes, ribosomes with the use of transfer RNAs. All crea- kidney disease, autism, and bipolar disorder. Almost tures also share certain characteristics in their everyone knows somebody who is affected with one biochemistry, including many enzymes and other or more of these conditions,© Jones often & Bartlett a family member.Learning, LLCproteins that are similar in© amino Jones acid & sequence,Bartlett Learning, LLC Each of these commonNOT conditions FOR SALE occurs OR in DISTRIBUTION about three-dimensional structure,NOT and FOR function. SALE OR DISTRIBUTION 1/100 individuals—at least 100 times more frequent than a typical simple Mendelian disorder. These common diseases are examples of complex traits because their causation is a complex Groups of related organisms descend interplay© Jones between & Bartlettmultiple geneticLearning, and environmen LLC - from a common© Jones ancestor.& Bartlett Learning, LLC tal factors.NOT FORA disease SALE in whichOR DISTRIBUTION causation is complex OrganismsNOT share FOR a common SALE set OR of DISTRIBUTIONsimilar genes and is affected by genetic factors, but each genetic fac- proteins because they evolved by descent from a tor, acting alone, does not determine presence of common ancestor. The process of evolution takes the disease. Each genetic factor is a risk factor that place when a population of organisms gradually increases the chance that an individual carrying the changes in genetic composition through time. Evo- © Jones &gene Bartlett will manifest Learning, the disease. LLC Each risk factor may© Joneslutionary & Bartlett changes Learning, in genes andLLC proteins result in NOT FORhave SALE a relatively OR DISTRIBUTION small effect, but the risk factors areNOT differencesFOR SALE in metabolism,OR DISTRIBUTION development, and behav- cumulative. ior among organisms, which allows them to become Complex traits are also affected by environmen- progressively better adapted to their environments. tal factors and lifestyle choices. An individual may From an evolutionary perspective, the unity of fun- have multiple genetic risk factors for heart disease, for damental molecular processes in organisms alive example, but still delay© Jonesthe onset & of Bartlett the disease, Learning, min- LLCtoday reflects inheritance© fromJones a &distant Bartlett common Learning, LLC imize its severity, or NOTavoid FORit altogether SALE with OR lifestyleDISTRIBUTION ancestor in which the molecularNOT FOR mechanisms SALE OR were DISTRIBUTION choices like eating a healthy diet, getting regular exer- already in place. cise, and not smoking. Conversely, an individual with Not only the unity of life but also many other few genetic rick factors for heart disease may never- features of living organisms become comprehensible theless come down with the disease owing to poor life- from an evolutionary perspective. For example, the style© choices Jones in diet,& Bartlett exercise, Learning, and tobacco LLC use. interposition© Jones of an RNA & Bartlettintermediate Learning, in the basic LLC flow NotNOT all FOR complex SALE traits OR are DISTRIBUTION diseases. Most com- of geneticNOT information FOR SALE from DNA OR toDISTRIBUTION RNA to protein monly observed differences among individuals are makes sense if the earliest forms of life used RNA for due to variation in complex traits. Height and weight both genetic information and enzyme catalysis. The are two prominent examples. Both traits are affected importance of the evolutionary perspective in under- by multiple genetic and environmental factors acting standing aspects of biology that seem pointless or need- © Jones &together. Bartlett In the Learning, case of weight, LLC obvious environmental© Joneslessly & complex Bartlett is Learning,summed up LLCin a famous aphorism NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

of the evolutionary biologist Theodosius Dobzhansky: known for hundreds of different species of organisms. © Jones “Nothing& Bartlett in biologyLearning, makes LLC sense except in the light of© JonesThese & include Bartlett the genomesLearning, of multiple LLC representatives NOT FORevolution.” SALE OR DISTRIBUTION NOT ofFOR many SALE groups OR of organisms, DISTRIBUTION including extinct human Biologists distinguish three major kingdoms of ancestors sequenced from DNA extracted from fossil organisms: bones. TABLE 1.2 shows a small sample of sequenced 1. Bacteria This group includes most bacteria and genomes. Genome size is given in megabases (Mb), or millions of base pairs. cyanobacteria© (formerlyJones & calledBartlett blue-green Learning, LLC © Jones & Bartlett Learning, LLC algae). Cells of these organisms lack a The organism denoted syn3.0 is very special in membrane-boundedNOT FORnucleus SALE and mitochondria, OR DISTRIBUTION that it is not a naturally occurringNOT FOR organism, SALE andOR we DISTRIBUTION are surrounded by a cell wall, and divide by will discuss it later. Among the naturally occurring binary fission. organisms in Table 1.2 are two bacteria: Mycoplasma mycoides is notable for its small genome and limited 2. Archaea This group was initially discovered number of genes; Escherichia coli is more typical of ©among Jones microorganisms & Bartlett Learning, that produce LLC methane bacteria in© size Jones and gene & Bartlett number. Learning,Both bacteria LLC have NOTgas orFOR that SALElive in extremeOR DISTRIBUTION environments, such NOT FOR SALE OR DISTRIBUTION as hot springs or pools with high salt concentra- tions. They are widely distributed in more normal environments as well. Superficially TABLE 1.2 Comparison of Genomes resembling bacteria, the cells of archaeans show © Jones & Bartlettimportant Learning, differences LLC in the manner in which© Jones & Bartlett Learning, LLC Number of NOT FOR SALEtheir OR membrane DISTRIBUTION lipids are chemically linked.NOT FOR SALE OR DISTRIBUTIONGenome size, Mba genes The machinery for DNA replication and tran- Organism (approximate) (approximate) scription in archaeans resembles that of eukary- ans, whereas their metabolism strongly syn3.0 resembles that of bacteria. DNA sequence anal- (synthetic DNA 0.5 473 ysis indicates that© Jones about half & Bartlettof the genes Learning, found LLCbacterium) © Jones & Bartlett Learning, LLC in the kingdomNOT Archaea FOR SALEare unique OR DISTRIBUTIONto this NOT FOR SALE OR DISTRIBUTION group. Mycoplasma mycoides (causes bovine 1.2 985 3. Eukarya This group includes all organisms pneumonia) whose cells contain an elaborate network of internal membranes, a membrane-bounded © Jones & Bartlett Learning, LLC Escherichia© coli Jones & Bartlett Learning, LLC nucleus, and mitochondria. Their DNA is pres- NOT FOR SALE OR DISTRIBUTION (common colonNOT FOR SALE4.6 OR DISTRIBUTION4000 ent in the form of linear molecules organized bacterium) into true chromosomes, and cell division takes place by means of mitosis. The eukaryotes Saccharomyces include plants and animals as well as fungi and cerevisiae 12 6000 many single-celled organisms, such as amoebae (baker’s yeast) © Jones & Bartlettand ciliated Learning, protozoa. LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION The members of the groups Bacteria and Archaea Caenorhabditis are often grouped together into a larger assemblage elegans 100 20,000 called prokaryotes, which literally means “before [the (soil nematode) evolution of] the nucleus.” This terminology is conve- nient for designating© prokaryotes Jones & asBartlett a group Learning, in con- LLCDrosophila © Jones & Bartlett Learning, LLC 180 16,000 trast with eukaryotesNOT, which FOR literally SALE means OR DISTRIBUTION “good melanogaster NOT FOR SALE OR DISTRIBUTION [well-formed] nucleus.” (fruit fly)

The molecular unity of life is seen in Arabidopsis thaliana 135 28,000 comparisons of genomes. (mouse-ear cress) The ©totality Jones of DNA& Bartlett in a cell, Learning, nucleus, or LLC organelle is © Jones & Bartlett Learning, LLC calledNOT its genome FOR SALE. When ORused DISTRIBUTION with reference to a spe- Mus musculusNOT FOR SALE2500 OR DISTRIBUTION25,000 cies of organism, for example in phrases such as “the (laboratory mouse) human genome,” the term genome is defined as the DNA present in a normal reproductive cell. Homo sapiens 3000 25,000 Modern methods for sequencing DNA are so (human being) © Jones &rapid Bartlett and efficient Learning, that the LLC complete DNA sequence is© JonesaMillions & of Bartlettbase pairs. Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

about the same density of genes—about one gene per Regulatory (2%) © Jones Mb& Bartlett of DNA. Learning, LLC © Jones & BartlettTranscription Learning, (2%) LLC NOT FOR SALEBaker’s OR yeast DISTRIBUTION (Saccharomyces cerevisiae) is aNOT FOR SALECell envelopeOR DISTRIBUTION (2%) single-celled eukaryote. It has a genome size of 12 Energy metabolism (3%) Other identified Mb organized into 16 chromosomes containing about function (4%) 6000 genes. The gene density is about one gene per Nucleoside 2 Mb—twice that of typical bacteria. & nucleotide © Jones & Bartlett Learning, LLC synthesis (4%) © Jones & Bartlett Learning, LLC Caenorhabditis elegans, Drosophila melanogaster, and the Translation diminutive floweringNOT plant ArabidopsisFOR SALE thaliana OR are DISTRIBUTION com- DNA replication NOT FOR SALE(22%) OR DISTRIBUTION plex, multicellular eukaryotes notable for their relatively & repair (6%) small genome size, which is still substantially larger than that of baker’s yeast. Their gene number is also larger RNA synthesis than that of yeast, but only by a factor of 3–4, with an & processing Unknown average© Jonesgene density & Bartlett of one gene Learning, per 5–10 LLCMb. (Not all © Jones(13%) & Bartlett Learning,(17%) LLC insectsNOT have FOR a genome SALE as smallOR DISTRIBUTIONas that of Drosophila; the NOT FOR SALE OR DISTRIBUTION General genome size of the mountain grasshopper, Podisma pedes- metabolism Transport tris, is about 100 times larger than that of Drosophila, but (11%) (15%) it has about the same number of genes. Such paradoxes of genome size are discussed in Chapter 6.) © Jones & BartlettThe genomes Learning, of mouse LLC and human are much© Jones & Bartlett Learning, LLC NOT FORlarger SALE than OR those DISTRIBUTION of the other multicellular eukaryotesNOT FIGUREFOR SALE1.22 Functions OR DISTRIBUTIONof the 473 genes in the synthetic bacterium syn3.0. in Table 1.2, yet they have about the same number Data from C. A. Hutchison III et al. Science 2016 Mar 25;351(6280):aad6253. doi: 10.1126/science.aad6253. of genes. This means that the gene density in mouse and human is much reduced, to roughly one gene per 100 Mb. The reduced gene density is reflected in the fact that only about 1.5© Jonespercent of& theBartlett human Learning, genome LLCThe completed genome was© then Jones tested & forBartlett viability Learning, by LLC sequence codes for protein.NOT FOR (About SALE 27 percent OR DISTRIBUTION of the being introduced into livingNOT Mycoplasma FOR SALE cells in OR which DISTRIBUTION human genome is present in protein-coding genes, but the original DNA had been destroyed. much of the DNA sequence present in such genes does The project was not without its surprises. There not actually code for amino acids.) are, for example, more than a few cases in which each Which brings us back to syn3.0, the world’s first of two genes appears to be nonessential, but eliminat- synthetic© Jones organism. & Bartlett It was created Learning, to identify LLC the min- ing both results© Jones in cells & thatBartlett grow extremelyLearning, slowly LLC or imal NOTset of FORgenes SALEthat would OR enable DISTRIBUTION a bacterial cell to not at all.NOT A good FOR analogy SALE is theOR engines DISTRIBUTION on a twin- multiply in growth medium containing amino acids engine jet like the Boeing 767: It can fly when one and other small-molecule nutrients. Starting with engine is disabled, but not both. cells of Mycoplasma mycoides, researchers at the J. Craig After much work and some trial and error, syn3.0—a Venter Institute in La Jolla, California systematically viable cell with a synthetic minimal genome compris- © Jones &knocked Bartlett out Learning, each of the LLC 985 genes to determine© Jonesing 473 & Bartlett genes—was Learning, created. TheLLC functions of these NOT FORwhich SALE genes OR wereDISTRIBUTION essential for growth. They thenNOT 473FOR genes SALE are ORsummarized DISTRIBUTION in FIGURE 1.22 . As might chemically synthesized a 0.5-Mb DNA molecule that be expected, the largest numbers of genes function in contained only essential genes. Synthesis of such a small-molecule transport, general metabolism, or syn- large piece of DNA is technically extremely difficult, thesis and processing of macromolecules. Remarkably, because long molecules of DNA in solution are frag- 17 percent of the genes in the minimal genome have ile and break easily due© Jones to mechanical & Bartlett shear. Learning,In prac- LLCno identified function (“unknown”),© Jones & whichBartlett means Learning, a LLC tice, large molecules haveNOT to FOR be synthesized SALE OR in smallerDISTRIBUTION great deal of biology remainsNOT to be FOR discovered. SALE It OR is also DISTRIBUTION pieces that must then be assembled in proper order. worth noting that a substantial fraction of the genes In the case of syn3.0, the researchers made clever use in syn3.0 have recognizable counterparts in the other of living yeast cells to combine the synthetic pieces in organisms listed in Table 1.2, attesting to the molecular the right order and to faithfully replicate the molecule. unity of life on Earth. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones &CHAPTER Bartlett Learning, SUMMARY LLC © Jones & Bartlett Learning, LLC NOT FOR SALE■■ Inherited OR DISTRIBUTIONtraits are affected by genes. NOT FOR■■ Different SALE mutations OR DISTRIBUTION in the same gene can be iden- ■■ Genes are composed of the chemical deoxyribo- tified by means of a complementation test, in nucleic acid (DNA). which the mutants are brought together in the same cell or organism. Mutations in the same ■■ DNA replicates to form (usually identical) copies gene fail to complement one another, whereas of itself. © Jones & Bartlett Learning, LLCmutations in different genes© Jones show & Bartlett Learning, LLC ■■ DNA contains a codeNOT specifying FOR SALE what types OR ofDISTRIBUTION complementation. NOT FOR SALE OR DISTRIBUTION enzymes and other proteins are made in cells. ■■ Most traits are complex traits affected by multiple ■■ DNA occasionally mutates, and the mutant forms genes as well as by environmental factors. specify altered proteins. ■■ Organisms change genetically through genera- ■■ A mutant enzyme is an “inborn error of metabo- tions in the process of biological evolution. lism” that blocks one step in a biochemical path- © Jones & Bartlett Learning, LLC ■■ Because© ofJones their common & Bartlett descent, Learning, organisms LLC way for the metabolism of small molecules. NOT FOR SALE OR DISTRIBUTION share manyNOT features FOR SALE of their ORgenetics DISTRIBUTION and ■■ Genetic analysis of mutants of the fungus Neuros- biochemistry. pora unable to synthesize an essential nutrient led to the one gene–one enzyme hypothesis.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC ISSUES AND IDEAS NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ■■ What special feature of the structure of DNA polypeptide chain from a molecule of messenger allows each strand to be replicated without regard RNA? to the other? ■■ What is meant by the term genetic analysis, and ■■ What does it mean to say that a strand of DNA how is genetic analysis exemplified by the work specifies the structure© Jones of a molecule & Bartlett of RNA? Learning, LLCof Beadle and Tatum using© Jones Neurospora & ?Bartlett Learning, LLC ■■ What types of RNANOT participate FOR SALE in protein OR synthe DISTRIBUTION- ■■ What is a complementationNOT test, FOR and SALEwhat is itOR DISTRIBUTION sis, and what is the role of each type of RNA? used for in genetic analysis? ■■ What is meant by the phrase genetic code, and how is the genetic code relevant to the translation of a © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC SOLUTIONS:NOT FOR SALESTEP BYOR STEP DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

PROBLEM 1 In the human gene for the beta chain of direction, which means that the template DNA strand is hemoglobin, the oxygen-carrying protein in the red transcribed in the 39-to-59 direction, which happens to blood cells, the first 30 nucleotides in the protein-coding be the same left-to-right orientation of the strand shown © Jones ®ion Bartlett are as Learning, shown here. LLC © Jonesabove. & TheBartlett base sequence Learning, is deduced LLC from the usual base-pairing rules, except that A in DNA pairs with U in NOT FOR SALE OR DISTRIBUTION  NOT FOR SALE OR DISTRIBUTION 3 -TACCACGTGGACTGAGGACTCCTCTTCAGA-5 RNA. (c) The polypeptide chain is translated in succes- (a) What is the sequence of the partner strand? sive groups of three nucleotides (each group constitut- (b) If the DNA duplex of this gene were transcribed ing a codon), starting at the 59 end of the coding from left to right, what is the base sequence of the sequence in the RNA and moving in the 59-to-39 direction. The amino acid corresponding to each codon can RNA across this part ©of Jonesthe coding & region?Bartlett Learning, LLC © Jones & Bartlett Learning, LLC (c) What is the sequence of amino acids in this part of be found in the genetic code table. (d) The change from the beta-globin polypeptideNOT FOR chain? SALE OR DISTRIBUTIONT to A in the transcribed strandNOT alters FOR a GAG SALE codon OR into DISTRIBUTION (d) In the mutation responsible for sickle-cell anemia, a GUG codon in the RNA transcript, resulting in the the red T indicated is replaced with an A. The mutant replacement of the normal glutamic acid (GAG) with is present at relatively high frequency in some human valine (V). The nonmutant duplex, the RNA transcript, populations because carriers of the gene are more and the amino acid sequence are as shown below. The resistant© Jones to falciparum & Bartlett malaria Learning, than are noncarriers. LLC amino acid© that Jones is replaced & Bartlett in the sickle-cellLearning, mutant LLC is WhatNOT is the FOR amino SALE acid replacement OR DISTRIBUTION associated with indicated inNOT red. FOR SALE OR DISTRIBUTION this mutation?

SOLUTION. (a) The partner strand is deduced from the 3-TACCACGTGGACTGAGGACTCCTCTTCAGA-5 rule that A pairs with T and G pairs with C; however, 5-ATGGTGCACCTGACTCCTGAGGAGAAGTCT-3 keep in mind that the paired DNA strands have opposite © Jones &polarity Bartlett (that Learning, is, their 59-to-3 LLC9 orientations are reversed).© Jones &5-AUGGUGCACCUGACUCCUG Bartlett Learning, LLCAGGAGAAGUCU-3 NOT FOR (b)SALE The ORRNA DISTRIBUTION strand is synthesized in the 59-to-3NOT9 FOR SALEMetValHisLeuThrPro OR DISTRIBUTIONGluGluLysSer

PROBLEM 2 The accompanying diagram shows a linear (a) Prepare a square complementation matrix of data, © Jones &bioynthetic Bartlett pathwayLearning, for an LLC essential nutrient designated© Joneswith the& Bartlett rows and Learning,columns representing LLC the mutants NOT FOR FSALE in an organism, OR DISTRIBUTION such as Neurospora, able to grow in aNOT inFOR alphabetical SALE order.OR DISTRIBUTION Each entry in the matrix should minimal medium. Each red letter indicates one interme- be a plus sign if the row mutant and the column diate in the pathway, and each blue number indicates a mutant do show complementation (that is, if they are mutant that blocks one step in the pathway. mutants of different genes) or a minus sign if they do not show complementation (that is, if they are 1 2 3 4 5 mutants of the same gene). A B© JonesC D & EBartlettF Learning, LLC © Jones & Bartlett Learning, LLC (b) What is special about the principal diagonal of the NOT FOR SALE OR DISTRIBUTIONmatrix? (The principal diagonalNOT is FORthe diagonal SALE that OR DISTRIBUTION Make a table in which the columns correspond to the runs from upper left to lower right.) What does this intermediates, arranged in alphabetical order, and the result mean biologically? rows correspond to the mutants, arranged in numerical (c) What is special about the triangular parts of the order. In the body of the table, insert a plus sign if the matrix above and below the diagonal? What does this mutant© Jones will grow & Bartletton minimal Learning, medium supplemented LLC result mean© biologically? Jones & Bartlett Learning, LLC with the nutrient and a minus sign if the mutant will not NOT FOR SALE OR DISTRIBUTION (d) PrepareNOT a circular FOR diagram SALE of theOR mutants DISTRIBUTION as grow under these conditions. Assume that all intermedi- discussed in the text, showing which of the mutants ates can be transported into the cell from the growth form complementation groups. medium. SOLUTION. (a) The complementation matrix is as SOLUTION. This is a classic type of genetic analysis pio- shown here. (b) The principal diagonal consists exclu- © Jones &neered Bartlett by BeadleLearning, and Tatum. LLC The principle is that a© Jonessively & of Bartlett minus signs; Learning, biologically, LLC this means that a mutant will grow on any intermediate whose position in NOT FOR SALE OR DISTRIBUTION NOT mutantFOR SALE cannot ORundergo DISTRIBUTION complementation with itself, the pathway is downstream of the metabolic block. Hence, because two copies of the identical mutation must be in mutant 1 will grow on any intermediate except A, the same gene. (c) The upper and lower triangular matri- mutant 2 will grow on any intermediate except A or B, ces are symmetrical, mirror images of one another; bio- and so forth. The complete matrix is as shown. It looks logically, this means that the parent of origin of the exceptionally simple because both the rows (mutants) © Jones & Bartlett Learning, LLCmutant makes no difference© toJones whether & Bartlettthe mutants Learning, LLC and columns (intermediates) are arranged in the same undergo complementation. Because of the symmetry of order as their constituentsNOT appearFOR SALEin the pathway. OR DISTRIBUTION Nor- the data matrix, complementationNOT FOR data areSALE often OR pre -DISTRIBUTION mally this will not be the case. sented only in the form of the upper diagonal. (d) The circular type of the complementation test is also shown. It indicates that the complementation groups are {a}, {b, c, ABCDE F h, j}, {d, i}, {e, g}, and {f }. The complementation groups are © Jones &1 Bartlett2 1 1 Learning, 1 1 1 LLC not informative© Jones about &where Bartlett the product Learning, of each LLC gene NOT FOR SALE OR DISTRIBUTION acts in the pathway;NOT FOR this informationSALE OR must DISTRIBUTION come from the 2 2 2 1 1 1 1 type of analysis illustrated in the previous problem. 3 2 2 2 1 1 1 4 2 2 2 2 1 1 (a–c) 5 2 2 2 2 2 1 © Jones & Bartlett Learning, LLC © Jones &a Bartlett b c Learning, d e fLLC g h i j a 2 1 1 1 1 1 1 1 1 1 NOT FOR PROBLEMSALE OR DISTRIBUTIONA complementation test is used to sort a setNOT FOR SALE OR DISTRIBUTION 3 b 1 2 2 1 1 1 1 2 1 2 of mutants into groups, each group corresponding to a subset of the mutants that have defects in the same gene. c 1 2 2 1 1 1 1 2 1 2 Shown here are the genes (1–5) from the previous prob- d 1 1 1 2 1 1 1 1 2 1 lem and 10 mutants (a–j) grouped according to the gene e 1 1 1 1 2 1 2 1 1 1 they affect. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONf 1 1 1 1 1NOT2 FOR1 SALE 1 1 OR 1 DISTRIBUTION 1 2 3 4 5 g 1 1 1 1 2 1 2 1 1 1 a e, g c, b, h, j f d, i h 1 2 2 1 1 1 1 2 1 2

Gene 1 is represented by mutant a only, gene 2 by i 1 1 1 2 1 1 1 1 2 1 mutants© Jones e and g&, and Bartlett so forth. Learning, LLC j 1 ©2 Jones 2 1& Bartlett 1 1 Learning, 1 2 1 LLC2 NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

(d) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC a b NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION j c i

CONCEPTS© Jones &IN Bartlett ACTION: Learning, PROBLEMS LLC FOR SOLUTION © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 1.1 Prior to the Avery, MacLeod, and McCarty exper- translation system). One polypeptide consisted of iment, what features of cells and chromosomes repeating Asp and the other of repeating Met. were already known that could have been inter- How can you explain this result? preted as evidence that DNA is an important con- © Jones & Bartlettstituent Learning, of the genetic LLC material? © Jones1.10 &If Bartlett one strand Learning, of a DNA duplex LLC has the sequence NOT FOR SALE OR DISTRIBUTION NOT FOR 5SALE9-GTCAT-3 OR 9DISTRIBUTION, what is the sequence of the com- 1.2 In the early years of the twentieth century, why plementary strand. (Write the answer with the 5’ did most biologists and biochemists believe that end at the left.) proteins were probably the genetic material? 1.11 Consider a region along one strand of a 1.3 From their examination of the structure of DNA, © Jones & Bartlett Learning, LLC double-stranded DNA© moleculeJones &consists Bartlett of tan Learning,- LLC what were Watson and Crick able to infer about dem repeats of the trinucleotide 59-CTA-39, so the probable NOTmechanisms FOR SALEof DNA OR replication, DISTRIBUTION that the sequenceNOT in FOR this SALE strand OR is DISTRIBUTION coding capability, and mutation? 59-CTACTACTACTA . . .-39. What is the sequence in the other strand? (Write the answer 1.4 What are three principal structural differences with the 59 end at the left.) between RNA and DNA? Part of the protein-coding region in a gene has the 1.5© JonesA region & along Bartlett an RNA Learning, transcript contains LLC no U. 1.12 © Jones & Bartlett Learning, LLC base sequence - 9. What NOTWhat FOR base SALE will be ORmissing DISTRIBUTION in the corresponding NOT FOR3 SALEACAGC ATAAACGTTC-5OR DISTRIBUTION is the sequence of the partner DNA strand? region of the template strand of DNA?

1.6 When the base composition of a DNA sample 1.13 If the DNA sequence in Problem 1.12 is the tem- from the bacterium Salinicoccus roseus was deter- plate strand that is transcribed in the synthesis of messenger RNA, would it be transcribed from left © Jones & Bartlettmined, Learning, 23.6 percent LLC of the bases were found to be© Jones & Bartlett Learning, LLC guanine. The DNA of this organism is known to to right or from right to left? What base sequence NOT FOR SALEbe OR double DISTRIBUTION stranded. What is the percentage ofNOT FOR wouldSALE this OR region DISTRIBUTION of the RNA contain? adenine in its DNA? 1.14 What amino acid sequence would be synthesized 1.7 DNA extracted from a certain virus has the follow- from the messenger RNA region in Problem 1.12? ing base composition: 15 percent adenine, 25 percent thymine,© Jones 20 &percent Bartlett guanine, Learning, and LLC1.15 If a mutation occurs in© the Jones DNA sequence & Bartlett in Prob Learning,- LLC 40 percent cytosine.NOT HowFOR would SALE you ORinterpret DISTRIBUTION this lem 1.12 in which theNOT red FORC is replaced SALE with OR T, DISTRIBUTION result in terms of the structure of the viral DNA? what amino acid sequence would result?

1.8 A duplex DNA molecule contains 532 occurrences 1.16 A polymer is made that has a random sequence of the dinucleotide 59-GT-39 in one or the other of consisting of 25 percent U’s and 75 percent C’s. © Jonesthe paired & strands.Bartlett What Learning, other dinucleotide LLC is also Among© Jones the amino & Bartlettacids in the Learning, polypeptide chainsLLC present exactly 532 times? resulting from in vitro translation, what is the NOT FOR SALE OR DISTRIBUTION expectedNOT frequencyFOR SALE of Pro? OR Of DISTRIBUTIONPhe? 1.9 A repeating polymer with the sequence 1.17 With in vitro translation of an RNA into a polypep- 5-GAUGAUGAUGAU . . .-3 tide chain, the translation can begin anywhere along the RNA molecule. A synthetic RNA mole- © Jones & Bartlettwas f oundLearning, to produce LLC only two types of polypep-© Jones &cule Bartlett has the Learning,sequence LLC NOT FOR SALEtides OR in DISTRIBUTION a translation system that uses cellularNOT FOR SALE OR DISTRIBUTION components but not living cells (called an in vitro 59-CGCUUACCACAUGUCGCGAAC-39

How many reading frames are possible if this mole- © Jones1.20 & Shown Bartlett here Learning, is part of a metabolic LLC pathway in a © Jones & Bartlettcule is Learning, translated in vitroLLC? How many reading frames bacterium in which a substrate metabolite (small NOT FOR SALEare OR possible DISTRIBUTION if this molecule is translated in vivo, inNOT FOR molecule)SALE OR X DISTRIBUTIONis converted into a final product which translation starts with the codon AUG? metabolite W through a sequence of three steps catalyzed by the enzymes A, B, and C. Each of the 1.18 The coding sequence in the messenger RNA for enzymes is the product of a different gene. amino acids 1 through 10 of human phenylalanine hydroxylase© Jones is & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC A B C NOT FOR SALE OR DISTRIBUTION X Y NOTZ FORW SALE OR DISTRIBUTION 5-AUGUCCACUGCGGUCCUGGAAAACCCAGGC-3 (a) What are the first 10 amino acids? Which metabolites would be expected to be missing, and which present in excess, in cells that are (b) What sequence would result from a mutant for: mutant RNA in which the red A was © Joneschanged & Bartlett to G? Learning, LLC (a) © EnzymeJones A? & Bartlett Learning, LLC NOT(c) FORWhat SALE sequence OR would DISTRIBUTION result from a (b) NOTEnzyme FOR B? SALE OR DISTRIBUTION mutant RNA in which the red C was (c) Enzyme C? changed to G? (d) What sequence would result from a 1.21 A mutant is isolated with a defect in one of the mutant RNA in which the red U was enzymes in the metabolic pathway in Problem 20, © Jones & Bartlett Learning,changed to C? LLC © Jones &but Bartlett it is not Learning, known which LLC step (A, B, or C) is blocked. The final product W of the pathway is NOT FOR SALE(e) OR What DISTRIBUTION sequence would result from a NOT FOR SALE OR DISTRIBUTION essential for growth. When mutant cells are placed mutant RNA in which the red G was in cultures lacking W, they cannot grow; but when changed to U? W is added to the medium, they can grow. Exper- 1.19 How is it possible for a gene with a mutation in iments are carried out to determine whether any the coding region© Jones to encode & Bartlett a polypeptide Learning, with LLC of the intermediates ©can Jones substitute & forBartlett W in sup Learning,- LLC the same amino acid sequence as the nonmutant porting growth. The mutant cells are found to gene? NOT FOR SALE OR DISTRIBUTION grow in the presenceNOT of Z but FOR not in SALE the presence OR DISTRIBUTION of X or Y. Deduce from these data what step in the pathway is blocked in the mutant.

(a) Because the G1 bacteriophage have half the (a) The complementation data indicate three radioactivity of the G0 bacteria, the G2 would have complementation groups: One group consists of mutants © Jones &half Bartlett of the G Learning,1 or 1/2  1/2 LLC  1/4 of the G0. (b) With © Jonesm1 and & m4Bartlett, another Learning, of mutants m2 LLC, m3, and m6, and the halving of the radioactivity in each bacteriophage third only of mutant m5. (b) If each complementation NOT FOR SALE OR DISTRIBUTION 5 NOT FOR SALE OR DISTRIBUTION generation, the G5 would have (1/2)  1/32 of the group represents one enzymatic step in the conversion radioactivity of original G0 radioactivity. of W into Z, then three enzymatic steps are involved.

ANSWER TO STOP & THINK 1.2 ANSWER TO STOP & THINK 1.5 © Jones & Bartlett Learning, LLCThe possible codons for arginine© Jones are CGU, & CGC, Bartlett CGA, Learning, LLC   3 –ATCGTTTTTATCG-5NOT FOR SALE OR DISTRIBUTIONCGG, AGA, or AGG; the possibleNOT codons FOR for SALE glutamine OR DISTRIBUTION are CAA or CAG. The actual codon for arginine must be either CGA or CGG because, in either case, a change ANSWER TO STOP & THINK 1.3 in the second position from A to G would result in The data support (b) Y → X → A because a mutation substituting arginine with glutamine. Because a change in the© JonesX → A step& Bartlett would allow Learning, growth on LLC A but not in a codon© (RNA) Jones from & A Bartlettto G corresponds Learning, to a change LLC on X or Y, and a mutation in the Y → X step would in the transcribed strand of DNA from T to C, the single allowNOT growth FOR on SALEA or X butOR not DISTRIBUTION on Y. These are the nucleotide NOTsubstitution FOR in SALE DNA would OR DISTRIBUTIONbe from a T−A observed classes of mutants. nucleotide pair to a C−G nucleotide pair.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR DesignSALE Credits: Stop OR & Think icon DISTRIBUTION made by Darius Dan from www.flaticon.com; The Human Connection icon made by Daniel BruceNOT from www.flaticon.com; FOR ElephantSALE image: © NickBiemans/GettyImages.OR DISTRIBUTION