Genes, Genomes and Genetic Analysis

CHAPTER 1 © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Genes,© Jones & BartlettGenomes Learning, LLC © Jones & Bartlett Learning, LLC and NOTGenetic FOR SALE OR DISTRIBUTION AnalysisNOT FOR SALE OR DISTRIBUTION

1.1 DNA: The Genetic Material DNA Structure and Replication 1.2 © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 1.3 Genes and Proteins NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 1.4 Genetic Analysis 1.5 Gene Expression: The Central Dogma 1.6 Mutation 1.7 Genes and Environment 1.8 The Molecular© Jones Unity & of BartlettLife Learning, LLC © Jones & Bartlett Learning, LLC CONNECTIONNOT The FORBlack Urine SALE Disease OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Archibald E. Garrod 1908 Inborn Errors of Metabolism CONNECTION One Gene, One Enzyme George W. Beadle and Edward L. Tatum © JonesGenetic &Control Bartlett of Biochemical Learning, Reactions LLC in Neurospora © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

26105_CH01_001_038.indd 1 4/18/11 2:24 PM © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

LEARNING OBJECTIVES & SCIENCE COMPETENCIES

Once you have understood© and Jones can apply& Bartlett the principles Learning, of genes, LLC genomes, and genetic analysis© Jones discussed & Bartlett in this Learning, LLC chapter, you will have acquiredNOT the FOR following SALE science OR DISTRIBUTION competencies: NOT FOR SALE OR DISTRIBUTION ■ Given the base sequence of a transcribed strand of protein-coding DNA, you will be able to specify the sequence of bases in the corresponding region of messenger RNA and the corresponding sequence of amino acids in the protein. For a mutation in the DNA in which one base is replaced with another, you will be able to deduce how the mRNA and protein will be altered. ■ Given a© linear Jones metabolic & Bartlett pathway Learning, for an essential LLC nutrient, you will be able© Jones to deduce & Bartlett which intermediates Learning, will LLC restore theNOT ability FOR to SALEgrow to ORmutant DISTRIBUTION strains that are defective for any of theNOT enzymes FOR in SALE the pathway. OR DISTRIBUTION Conversely, given data specifying which intermediates in a linear metabolic pathway restore the ability of mutants to grow, you will be able to infer the order in which the enzymes and the intermediates appear in the pathway. ■ Given data on the complementation or lack of complementation among all pairs of a set of mutations affecting © Jonesa biological& Bartlett process, Learning, you will LLC be able to sort the mutations© Jonesinto groups, & Bartlett each corresponding Learning, to LLC a different gene. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

ach species of living organism has a influenced jointly by biological inheritance and unique set of inherited characteristics environmental factors. For example, weight is E©that Jones makes & it Bartlett different fromLearning, every other LLC determined in part© by Jones inheritance & Bartlett but also Learning, in LLC species. Each species has its own developmental part by environment: how much food we eat, plan—oftenNOT describedFOR SALE as a sort OR of DISTRIBUTION “blueprint” for its nutritional content,NOT our FOR exercise SALE regimen, OR DISTRIBUTION building the organism—which is encoded in the and so forth. DNA molecules present in its cells. This develop- Genetics is the study of biologically inher- mental plan determines the characteristics that ited traits, including traits that are influenced in © Jonesare & Bartlettinherited. Learning,Because organisms LLC in the same part© by Jones the environment. & Bartlett Genomics Learning, is the LLC study species share the same developmental plan, of all the genes in an organism to understand NOT FORorganisms SALE thatOR areDISTRIBUTION members of the same species theirNOT molecular FOR SALEorganization, OR DISTRIBUTION function, interac- usually resemble one another. For example, it is tion, and evolutionary history. The fundamental easy to distinguish a human being from a chim- concept of genetics and genomics is that: panzee or a gorilla. A human being habitually stands upright and has long legs, relatively little Inherited traits are determined by the elements of heredity that are transmitted from © Jones & Bartlett Learning,body hair, LLCa large brain, and a flat face© with Jones a & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALEparents OR to DISTRIBUTION offspring in reproduction; these ele- prominent nose, jutting chin, distinct lips, and ments of heredity are called genes. small teeth. All of these traits are inherited—part of our developmental plan—and help set us The existence of genes and the rules govern- apart as Homo sapiens. ing their transmission from gen eration to gen- But human beings are by no means identi- eration were first articulated by Gregor Mendel cal. Many© Jones traits, or& observableBartlett Learning, characteristics, LLC in 1866 (Chapter 3).© JonesMendel’s & formulation Bartlett Learning, of LLC differ fromNOT one FOR person SALE to another. OR DISTRIBUTION In addition inheritance was in termsNOT of FOR the abstract SALE rules OR byDISTRIBUTION to notable differences between males and which hereditary elements (he called them “fac- females, there is a great deal of variation in hair tors”) are transmitted from parents to offspring. color, eye color, skin color, height, weight, per- His objects of study were garden peas, with vari- sonality traits, and other characteristics. Some able traits like pea color and plant height. At one © Joneshuman & Bartlett traits (suchLearning, as sex) LLCare transmitted bio- time© geneticsJones could& Bartlett be studied Learning, only through LLC the NOT FORlogically, SALE others OR DISTRIBUTIONculturally. The color of our eyes progenyNOT producedFOR SALE from ORmatings. DISTRIBUTION Genetic differ- results from biological inheritance, but the ences between species were impossible to native language we learned as a child results define, because organisms of different species from cultural inheritance. Many traits are usually do not mate, or they produce hybrid © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

2 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 2 4/18/11 2:24 PM progeny that die or are sterile. The approach to between chromosomes and DNA. Microscopic © Jones the& Bartlett study of genetics Learning, through LLC the analysis of the studies© Jones with &special Bartlett stains Learning, showed that LLC DNA is NOT FORoffspring SALE ORfrom DISTRIBUTION matings is often referred to as presentNOT FORin chromosomes. SALE OR DISTRIBUTIONChromosomes also classical genetics, or organismic or morphological contain various types of proteins, but the genetics. Given the advances of molecular, or amount and kinds of chromosomal proteins dif- modern, genetics, it is possible to study differ- fer greatly from one cell type to another, ences between species through the comparison whereas the amount of DNA per cell is constant. and analysis of the DNA© Jones itself. There & Bartlett is no fun- Learning,Further LLCmore, nearly all of the DNA© Jonespresent in& Bartlett Learning, LLC damental distinctionNOT between FOR classicalSALE ORand DISTRIBUTIONcells of higher organisms is presentNOT in the FOR chro- SALE OR DISTRIBUTION molecular genetics. They are different and com- mosomes. These arguments for DNA as the plementary ways of studying the same thing: genetic material were unconvincing, however, the function of the genetic material. In this book because crude chemical analyses had suggested we include many examples showing how (erroneously, as it turned out) that DNA lacks molecular© Jones and classical & Bartlett genetics Learning, can be used LLC in the chemical diversity© Jones needed & in Bartlett a genetic Learning,sub- LLC combinationNOT FOR to enhance SALE theOR power DISTRIBUTION of genetic stance. The favoredNOT candidate FOR SALE for the OR genetic DISTRIBUTION analysis. material was protein, because proteins were The foundation of genetics as a molecular sci- known to be an exceedingly diverse collection ence dates back to 1869, just three years after of molecules. Proteins therefore became widely Mendel reported his experiments. It was in 1869 accepted as the genetic material, and DNA was © Jones &that Bartlett Friedrich Learning, Miescher discovered LLC a new type of assumed© Jones to function& Bartlett merely Learning, as the structural LLC NOT FORweak SALE acid, OR abundant DISTRIBUTION in the nuclei of white blood frameworkNOT FOR of SALEthe chromosomes. OR DISTRIBUTION The experi- cells. Miescher’s weak acid turned out to be the ments described below finally demonstrated chemical substance we now call DNA (deoxy- that DNA is the genetic material. ribonucleic acid). For many years the biological function of DNA was unknown, and no role in Experimental Proof of the Genetic Function heredity was ascribed to© it. Jones This first & section Bartlett shows Learning, of LLCDNA © Jones & Bartlett Learning, LLC how DNA was eventuallyNOT isolated FOR andSALE identified OR DISTRIBUTIONAn important first step was takenNOT by Freder-FOR SALE OR DISTRIBUTION as the material that genes are made of. ick Griffith in 1928 when he demonstrated that the genetic material can be transferred from one DNA: The Genetic Material bacterial cell to another. He was working with 1.1 two strains of the bacterium Streptococcus pneu- That ©the Jones cell nucleus & Bartlett plays a keyLearning, role in inheri- LLC moniae identified as© S Jonesand R. When & Bartlett a bacterial Learning, cell LLC tanceNOT was recognized FOR SALE in the OR 1870s DISTRIBUTION by the observa- is grown on solid medium,NOT FOR it undergoes SALE repeatedOR DISTRIBUTION tion that the nuclei of male and female cell divisions to form a visible clump of cells reproductive cells undergo fusion in the process called a colony. The S type of S. pneumoniae of fertilization. Soon thereafter, chromosomes synthesizes a gelatinous capsule composed of were first observed inside the nucleus as thread- complex carbohydrate (polysaccharide). The © Jones &like Bartlett objects that Learning, become visible LLC in the light micro- enveloping© Jones capsule & Bartlett makes Learning,each colony largeLLC and NOT FORscope SALE when OR the DISTRIBUTION cell is stained with certain dyes. givesNOT it FORa glistening SALE or OR smooth DISTRIBUTION (S) appearance Chromosomes were found to exhibit a character- (FIGURE 1.1). This capsule also enables the bacte- istic “splitting” behavior in which each daughter rium to cause pneumonia by protecting it from cell formed by cell division receives an identical the defense mechanisms of an infected animal. complement of chromosomes (Chapter 4). Fur- The R strains of S. pneumoniae are unable to syn- ther evidence for the importance© Jones of & chromosomes Bartlett Learning, thesize LLC the capsular polysaccharide;© Jonesthey form & Bartlett Learning, LLC was provided by the observationNOT FOR that, SALE whereas OR DISTRIBUTIONsmall colonies that have a rough (R)NOT surface FOR (Fig- SALE OR DISTRIBUTION the number of chromosomes in each cell may dif- ure 1.1). The R strain of the bacterium does not fer among biological species, the number of chro- cause pneumonia, because without the capsule mosomes is nearly always constant within the the bacteria are inactivated by the immune sys- cells of any particular species. These features of tem of the host. Both types of bacteria “breed chromosomes© Jones were & Bartlett well understood Learning, by about LLC true” in the sense that© Jones the progeny & Bartlett formed by Learning, cell LLC 1900,NOT and they FOR made SALE it seem OR likely DISTRIBUTION that chromo- division have theNOT capsular FOR type SALE of the OR parent, DISTRIBUTION somes were the carriers of the genes. either S or R. By the 1920s, several lines of indirect evi- Mice injected with living S cells get pneumo- dence began to suggest a close relationship nia. Mice injected either with living R cells or with © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.1 DNA: The Genetic Material 3

26105_CH01_001_038.indd 3 4/18/11 2:24 PM © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC R strain S strain NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION FIGURE 1.1 Colonies of rough (R, the small colonies) and smooth (S, the large colonies) strains of Streptococcus pneumoniae. The S colonies are larger because of the gelatinous capsule on the S cells. [Photograph reproduced from Journal of Experimental Medicine by O.T. Avery, et al. Copyright 1994 by Rockefeller University Press. Reproduced with permission of Rockefeller University Press in the format Textbook via Copyright Clearance Center.]

Living© Jones & BartlettLiving Learning, LLC Heat-killed © Jones &Living Bartlett R cells plusLearning, LLC S cells R cells S cells heat-killed S cells NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Mouse contracts Mouse remains Mouse remains Mouse contracts © pneumoniaJones & Bartlett Learning,healthy LLC healthy© Jones & Bartlettpneumonia Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

S colonies isolated R colonies isolated No colonies isolated R and S colonies isolated from tissue of dead mouse from tissue from tissue from tissue of dead mouse FIGURE 1.2 The Griffith’s experiment demonstrating bacterial transformation. A mouse remains healthy if injected with either the nonvirulent R strain of S. pneumoniae or ©heat-killed Jones cell & fragments Bartlett of the Learning, usually virulent SLLC strain. R cells in the presence of heat-killed© Jones S cells & are Bartlett transformed Learning, LLC into the virulent S strain, causingNOT pneumonia FOR SALE in the mouse. OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

heat-killed S cells remain healthy. Here is Griffith’s injected material from the dead S cells includes a critical finding: mice injected with a mixture of liv- substance that can be transferred to living R cells ing R cells and heat-killed S cells contract the dis- that enables them to synthesize the S-type cap- © Jonesease & Bartlett and often Learning, die of pneumonia LLC (FIGURE 1.2). sule.© JonesIn other & words, Bartlett the Learning, R bacteria LLCcan be NOT FORBacteria SALE isolated OR DISTRIBUTION from blood samples of these dead changed—orNOT FOR undergo SALE transformationOR DISTRIBUTION—into mice produce S cultures with a capsule typical of S bacteria. Furthermore, the ability to synthesize the injected S cells, even though the injected the capsule is inherited by descendants of the S cells had been killed by heat. Evidently, the transformed bacteria. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

4 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 4 4/18/11 2:24 PM Transformation in Streptococcus was origi- proteins differentially by using radioactive iso- © Jones nally& Bartlett discovered Learning, in 1928, LLCbut it was not until topes© Jones of the two& Bartlett elements. Learning, Hershey and LLC Chase NOT FOR1944 SALE that OR the DISTRIBUTIONchemical substance responsible producedNOT FOR particles SALE containing OR DISTRIBUTION radioactive DNA for changing the R cells into S cells was identi- by infecting E. coli cells that had been grown for fied. In a milestone experiment, Oswald Avery, several generations in a medium that included Colin MacLeod, and Maclyn McCarty showed 32P (a radioactive isotope of phosphorus) and that the substance causing the transformation then collecting the phage progeny. Other parti- of R cells into S cells ©was Jones DNA. In& Bartlettdoing these Learning, cles containing LLC labeled proteins were© Jones obtained & Bartlett Learning, LLC experiments, they firstNOT needed FOR SALE to develop OR DISTRIBUTION in the same way, by using medium NOTthat included FOR SALE OR DISTRIBUTION chemical procedures for isolating almost pure 35S (a radioactive isotope of sulfur). DNA from cells, which had never been done In the experiments summarized in FIGURE 1.5, before. When they added DNA isolated from S nonradioactive E. coli cells were infected with cells to growing cultures of R cells, they observed phage labeled with either 32P (part A) or 35S (part transformation—that© Jones & Bartlett is, a few Learning, cells of type LLC S B) in order to follow© theJones DNA &and Bartlett proteins Learning,indi- LLC were NOTproduced. FOR Although SALE theOR DNA DISTRIBUTION preparations vidually. Infected cellsNOT were FOR separated SALE from OR un-DISTRIBUTION contained traces of protein and RNA (ribonu- attached phage particles by centrifugation, cleic acid, an abundant cellular macromolecule resuspended in fresh medium, and then swirled chemically related to DNA), the transforming violently in a kitchen blender to shear attached activity was not altered by treatments that phage material from the cell surfaces. This treat- © Jones &destroyed Bartlett either Learning, protein LLC or RNA. However, ment© Jones was found & Bartlett to have no Learning, effect on the LLC subse- NOT FORtreatments SALE OR that DISTRIBUTION destroyed DNA eliminated the quentNOT course FOR of SALE the infection, OR DISTRIBUTION which implies that transforming activity (FIGURE 1.3). These experi- the phage genetic material must enter the ments implied that the substance responsible for infected cells very soon after phage attachment. genetic transformation was the DNA of the The kitchen blender turned out to be the critical cell—hence that DNA is the genetic material. piece of equipment. Other methods had been © Jones & Bartlett Learning,tried to LLC tear the phage heads from© the Jones bacterial & Bartlett Learning, LLC Genetic Role of DNANOT in Bacteriophage FOR SALE OR DISTRIBUTIONcell surface, but nothing had workedNOT reliably. FOR SALE OR DISTRIBUTION Another pivotal finding was reported by Hershey later explained, “We tried various grind- Alfred Hershey and Martha Chase in 1952. They ing arrangements, with results that weren’t very studied cells of the intestinal bacterium Esche- encouraging. When Margaret McDonald loaned richia coli after infection by the virus T2. A virus us her kitchen blender, the experiment promptly that attacks© Jones bacterial & Bartlett cells is calledLearning, a bacterio- LLC succeeded.” © Jones & Bartlett Learning, LLC phageNOT, a term FOR often SALE shortened OR DISTRIBUTIONto phage. Bacte- After the phageNOT heads FOR were SALE removed OR by DISTRIBUTIONthe riophage means “bacteria-eater.” The structure blender treatment, the infected bacteria were of a bacteriophage T2 particle is illustrated in examined. Most of the radioactivity from FIGURE 1.4. It is exceedingly small, yet it has a 32P-labeled phage was found to be associated with complex structure composed of head (which the bacteria, whereas only a small fraction of the © Jones &contains Bartlett the Learning,phage DNA), LLC collar, tail, and tail 35©S radioactivityJones & Bartlettwas present Learning, in the infected LLC cells. NOT FORfibers. SALE (The OR head DISTRIBUTION of a human sperm is about TheNOT retention FOR ofSALE most ofOR the DISTRIBUTION labeled DNA, con- 30–50 times larger in both length and width trasted with the loss of most of the labeled protein, than the head of T2.) Hershey and Chase were implied that a T2 phage transfers most of its DNA, already aware that T2 infection proceeds via the but very little of its protein, to the cell it infects. The attachment of a phage particle by the tip of its critical finding (Figure 1.5) was that about 50 per- tail to the bacterial cell© Jones wall, entry & Bartlett of phage Learning, cent of LLC the transferred 32P-labeled DNA,© Jones but less & Bartlett Learning, LLC material into the cell,NOT multiplication FOR SALE of ORthis DISTRIBUTIONthan 1 percent of the transferred 35S-labeledNOT FOR pro- SALE OR DISTRIBUTION material to form a hundred or more progeny tein, was inherited by the progeny phage particles. phage, and release of the progeny phage by Hershey and Chase interpreted this result to mean bursting (lysis) of the bacterial host cell. They that the genetic material in T2 phage is DNA. also knew that T2 particles were composed of The experiments of Avery, MacLeod, and DNA© and Jones protein & Bartlett in approximately Learning, equal LLC McCarty and those© Jonesof Hershey & Bartlett and Chase Learning, are LLC amounts.NOT FOR SALE OR DISTRIBUTION regarded as classicsNOT in theFOR demonstration SALE OR thatDISTRIBUTION Because DNA contains phosphorus but no genes consist of DNA. At the present time, the sulfur, whereas most proteins contain sulfur but equivalent of the transformation experiment is no phosphorus, it is possible to label DNA and carried out daily in many research laboratories © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.1 DNA: The Genetic Material 5

26105_CH01_001_038.indd 5 4/18/11 2:24 PM (A) The transforming activity in S cells is not destroyed by heat. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Cells killed by heat © Jones & Bartlett Learning, LLC Plate on © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION agar mediumNOT FOR SALE OR DISTRIBUTION

S cell extract (contains mostly DNA with a little R colonies and Culture© Jones of S cells & Bartlett Learning,protein LLC and RNA) Culture of© R Jones cells & Bartlett Learning,a few S colonies LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

(B) The transforming activity is not destroyed by either protease or RNase. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Protease or RNase Plate on © Jones &agar Bartlett medium Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION Conclusion: TransformingNOT FOR activity SALE OR DISTRIBUTION not protein or RNA S cell extract

R colonies and © Jones & BartlettCulture of Learning, R cells LLC a few S colonies © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION (C) The transforming activity is destroyed by DNase.

Plate on agar medium Conclusion: Transforming activity © Jones & Bartlett Learning, LLC most likely DNA© Jones & Bartlett Learning, LLC S cell extract NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

R colonies only Culture of R cells FIGURE 1.3 A diagram of the Avery–MacLeod–McCarty experiment demonstrating that DNA is the active material in bacterial transformation. (A) Purified DNA extracted from heat-killed S cells can convert some living R cells into S cells, but the material may still contain undetectable traces© ofJones protein and/or & Bartlett RNA. (B) The Learning, transforming activityLLC is not destroyed by either protease© Jones or RNase. & (C) Bartlett The transforming Learning, activity is destroyed LLC by DNaseNOT and FOR so probably SALE consists OR of DISTRIBUTION DNA. NOT FOR SALE OR DISTRIBUTION

6 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 6 4/18/11 2:24 PM throughout the world, usually with bacteria, © Jones yeast,& Bartlett or animal Learning, or plant cells LLC grown in culture. © Jones & Bartlett Learning, LLC NOT FORThese SALE experiments OR DISTRIBUTION indicate that DNA is the ProteinNOT FOR SALE OR DISTRIBUTIONHead (protein genetic material in these organisms as well as in DNA and DNA) phage T2. Although there are no known exceptions to the generalization that DNA is the genetic material in all cellular organisms and many viruses, in several© Jones types &of Bartlettviruses the Learning, LLC © Jones & Bartlett Learning, LLC genetic material consistsNOT of FOR RNA. SALEThese RNA- OR DISTRIBUTION Tail NOT FOR SALE OR DISTRIBUTION containing viruses include the human immu- (protein nodeficiency virus HIV-1 that causes AIDS only) (acquired immune deficiency syndrome). 1.2© JonesDNA Structure & Bartlett and Learning,Replication LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION The inference that DNA is the genetic material (A) (B) still left many questions unanswered. How is the FIGURE 1.4 (A) Drawing of E. coli phage T2, showing various components. The DNA is DNA in a gene duplicated when a cell divides? confined to the interior of the head. (B) An electron micro graph of phage T4, a closely How does the DNA in a gene control a hereditary related phage. [Electron micrograph courtesy of Robert Duda, University of Pittsburgh.] © Jones &trait? Bartlett What happens Learning, to the LLC DNA when a muta- © Jones & Bartlett Learning, LLC NOT FORtion SALE (a change OR inDISTRIBUTION the DNA) takes place in a gene? NOT FOR SALE OR DISTRIBUTION In the early 1950s, a number of researchers examined in Chapter 2. A key point for our pres- began to try to understand the detailed molecular ent purposes is that the bases in the double helix structure of DNA in hopes that the structure are paired as shown in Figure 1.6B. That is: alone would suggest answers to these questions. At any position on the paired strands of a In 1953 James Watson© and Jones Francis & Crick Bartlett at Cam- Learning,DNA LLC molecule, if one strand has ©an JonesA, then & Bartlett Learning, LLC bridge University proposedNOT FORthe first SALE essentially OR DISTRIBUTIONthe partner strand has a T; and ifNOT one strand FOR SALE OR DISTRIBUTION correct three-dimensional structure of the DNA has a G, then the partner strand has a C. molecule. The structure was dazzling in its ele- The pairing between A and T and between gance and revolutionary in suggesting how DNA G and C is said to be complementary; the duplicates itself, controls hereditary traits, and complement of A is T, and the complement of G undergoes© Jones mutation. & Bartlett Even while Learning, their tin-and- LLC is C. The complementary© Jones pairing & Bartlett means Learning, that LLC wire NOTmodel FORof the DNASALE molecule OR DISTRIBUTION was still incom- each base alongNOT one strandFOR SALEof the ORDNA DISTRIBUTION is plete, Crick would visit his favorite pub and matched with a base in the opposite position on exclaim “we have discovered the secret of life.” the other strand. Furthermore: In the Watson–Crick structure, DNA consists of two long chains of subunits, each twisted Nothing restricts the sequence of bases in a around the other to form a double-stranded single strand, so any sequence could be pres- © Jones & Bartlett Learning, LLC © Jonesent along &one Bartlett strand. Learning, LLC NOT FORhelix. SALE The OR double DISTRIBUTION helix is right-handed, which NOT FOR SALE OR DISTRIBUTION means that as one looks along the barrel, each This principle explains how only four bases in chain follows a clockwise path as it progresses. DNA can code for the huge amount of informa- You can visualize the right-handed coiling in part tion needed to make an organism. It is the A of FIGURE 1.6 if you imagine yourself looking up sequence of bases along the DNA that encodes into the structure from© Jonesthe bottom. & Bartlett The dark Learning, the genetic LLC information, and the© sequence Jones is& Bartlett Learning, LLC spheres outline the “backbone”NOT FOR of eachSALE individ- OR DISTRIBUTIONcompletely unrestricted. NOT FOR SALE OR DISTRIBUTION ual strand, and they coil in a clockwise direction. The complementary pairing is also called The subunits of each strand are nucleotides , Watson–Crick pairing. In the three- dimensional each of which contains any one of four chemical structure in Figure 1.6A, the base pairs are repre- constituents called bases attached to a phospho- sented by the lighter spheres filling the interior of rylated© Jonesmolecule & of Bartlett the 5-carbon Learning, sugar deoxy- LLC the double helix. ©The Jones base pairs & Bartlett lie almost Learning, flat, LLC riboseNOT. The FOR four basesSALE in DNAOR DISTRIBUTIONare: stacked on top of NOTone another FOR SALEperpendicular OR DISTRIBUTION to the long axis of the double helix, like pennies in a • Adenine (A) • Guanine (G) roll. When discussing a DNA molecule, biologists • Thymine (T) • Cytosine (C) frequently refer to the individual strands as The chemical structures of the nucleotides and single-stranded DNA and to the double helix © Jones &bases Bartlett need not Learning, concern us LLCat this time. They are as© double-stranded Jones & Bartlett DNA Learning, or duplex DNALLC. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.2 DNA Structure and Replication 7

26105_CH01_001_038.indd 7 4/18/11 2:24 PM © Jones & Bartlett(A) Learning, LLC © Jones (B)& Bartlett Learning, LLC Infection with Infection with NOT FOR SALE OR DISTRIBUTION nonradioactive NOT FOR SALE OR DISTRIBUTIONnonradioactive T2 phage T2 phage

© Jones &E. Bartlett coli cells grown Learning, LLC ©E. Jones coli cells grown& Bartlett Learning, LLC NOT FOR SALEin 32P-containing OR DISTRIBUTION NOTin 35S-containing FOR SALE OR DISTRIBUTION medium (labels DNA) medium (labels protein)

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC Phage reproduction; Phage reproduction; NOT FOR SALE OR DISTRIBUTIONcell lysis releases NOT FOR SALEcell lysisOR releases DISTRIBUTION DNA-labeled progeny protein-labeled phage progeny phage

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION DNA-labeled phage NOT FOR SALE OR DISTRIBUTIONProtein-labeled phage used to infect used to infect nonradioactive cells nonradioactive cells

NOT FORAfter infection,SALE partOR of DISTRIBUTION phage After NOTinfection, FOR part ofSALE phage OR DISTRIBUTION remaining attached to cells is remaining attached to cells is removed by violent agitation removed by violent agitation in a kitchen blender in a kitchen blender

Infecting Infected cell Infecting Infected cell labeled DNA nonlabeled DNA

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FORPhage SALE reproduction; OR DISTRIBUTION cell lysis PhageNOT reproduction; FOR SALE cell OR DISTRIBUTION releases progeny phage that lysis releases progeny contain some 32P-labeled DNA phage that contain almost from the parental phage DNA no 35S-labeled protein

© Jones &Conclusion Bartlett: Learning,DNA from an infecting LLC parental phage is inherited© inJones the progeny & Bartlett phage Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION FIGURE 1.5 The Hershey–Chase (“blender”) experiment demonstrating that DNA, not pro tein, is responsible for directing the reproduction of phage T2 in infected E. coli cells. (A) Radio active DNA is transmitted to progeny phage in substantial amounts. (B) Radioactive protein is transmitted to progeny phage in negligible amounts.

8 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 8 4/18/11 2:24 PM Each DNA strand has a polarity, or direc- (A) (B) 3’ 5’ © Jones tionality,& Bartlett like Learning,a chain of circus LLC elephants linked © Jones & Bartlett Learning, LLC TA NOT FORtrunk SALE to tail. OR In DISTRIBUTION this analogy, each elephant cor- NOT FOR SALE OR DISTRIBUTION GC responds to one nucleotide along the DNA AT strand. The polarity is determined by the direction in which the nucleotides are pointing. The “trunk” end of the strand is called the 3 end of CG the strand, and the “tail”© Jones end is called & Bartlett the 5 end. Learning, LLC © Jones & BartlettCG Learning, LLC In double-stranded DNA,NOT the FOR paired SALE strands OR are DISTRIBUTION NOT FOR SALE ORGC DISTRIBUTION oriented in opposite directions, the 5 end of one T A Paired strand aligned with the 3 end of the other. The nucleotides molecular basis of the polarity, and the reason for GC the opposite orientation of the strands in duplex T A DNA,© are Jones explained & Bartlett in Chapter Learning, 2. In illustrating LLC © Jones & Bartlett Learning,GC LLC DNA NOTmolecules FOR in SALE this book, OR we DISTRIBUTION use an arrow- NOT FOR SALE OR DISTRIBUTIONTA like ribbon to represent the backbone, and we use tabs jutting off the ribbon to represent the TA nucleotides. The polarity of a DNA strand is indi- AT cated by the direction of the arrow-like ribbon. GC © Jones &The Bartlett tail of the Learning, arrow represents LLC the 5 end of the © Jones & Bartlett Learning, LLC T A NOT FORDNA SALE strand, OR the DISTRIBUTION head the 3 end. NOT FOR SALE OR DISTRIBUTION Beyond the most optimistic hopes, knowl- CG edge of the structure of DNA immediately gave T A clues to its function: GC 1. The sequence of bases in DNA could be copied by using© Jones each of& theBartlett separate Learning, LLC © Jones & Bartlett5’ 3’ Learning, LLC “partner” strandsNOT as FOR a pattern SALE for OR the DISTRIBUTIONFIGURE 1.6 Molecular structure of the DNANOT double helixFOR in theSALE standard OR “B form.” DISTRIBUTION creation of a new partner strand with a (A) A space-filling model, in which each atom is depicted as a sphere. (B) A diagram high lighting the helical strands around the outside of the molecule and the AҀT and complementary sequence of bases. GҀC base pairs inside. 2. The DNA could contain genetic information in coded form in the sequence © ofJones bases, analo& Bartlett gous to Learning,letters printed LLC on (replica). The replica© Jones strands are& Bartlett synthesized Learning, by LLC NOTa strip FOR of paper. SALE OR DISTRIBUTION the addition of successiveNOT FOR nucleotides SALE inOR such DISTRIBUTION a 3. Changes in genetic information (muta- way that each base in the replica is complemen- tions) could result from errors in copy- tary (in the Watson–Crick pairing sense) to the ing in which the base sequence of the base across the way in the template strand (Fig- DNA became altered. ure 1.7B). Although the mechanism in Fig- © Jones &In Bartlettthe remainder Learning, of this LLCchapter, we discuss ure© Jones1.7 is simple & Bartlett in principle, Learning, it is a complexLLC NOT FORsome SALE of the OR implications DISTRIBUTION of these clues. processNOT FORthat is SALE fraught OR with DISTRIBUTION geometrical prob- lems and requires a variety of enzymes and An Overview of DNA Replication other proteins. The details are examined in Watson and Crick noted that the structure Chapter 6. The end result of replication is that a of DNA itself suggested a mechanism for its rep- single double-stranded molecule becomes replication. “It has not escaped© Jones our & notice,” Bartlett they Learning, licated LLC into two copies with identical© sequences:Jones & Bartlett Learning, LLC wrote, “that the specificNOT base FOR pairing SALE we haveOR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION postulated immediately suggests a copying 5-ACGCTTGC-3 mechanism.” The copying process in which a 3-TGCGAACG-5

single DNA molecule gives rise to two identical 5-ACGCTTGC-3 5-ACGCTTGC-3 molecules is called replication . The replication 3-TGCGAACG-5 3-TGCGAACG-5 mechanism© Jones that & Watson Bartlett and Learning,Crick had in mindLLC © Jones & Bartlett Learning, LLC is illustratedNOT FOR in FIGURE SALE 1.7. OR DISTRIBUTION Here the bases in theNOT newly FOR synthesized SALE OR strands DISTRIBUTION As shown in part A of Figure 1.7, the strands are shown in red. In the duplex on the left, the of the original (parent) duplex separate, and top strand is the template from the parental each individual strand serves as a pattern, or molecule and the bottom strand is newly syn- template, for the synthesis of a new strand thesized; in the duplex on the right, the bottom © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.2 DNA Structure and Replication 9

26105_CH01_001_038.indd 9 4/18/11 2:24 PM (A) (B) Parent molecule of DNA © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 5’ 3’ TA NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTIONACGCTTGC CG TGCGAACG AT 3’ 5’

© JonesCG & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC CG Parent duplex Template strand Complement of A NOT FOR SALEGC OR DISTRIBUTION 5’ NOT3’ FOR “T”SALE adds OR“A” DISTRIBUTION T A ACGCTTGC TGCGAACG Complement of 3’ 5’ CG G “C” adds “G” Template strand © Jones & Bartlett Learning,T A LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONCG NOT FOR SALE OR DISTRIBUTION TA

C Complement of TA “G” adds “C” 5’ 3’ 5’ A T ACGCTTGC A © Jones & Bartlett Learning,A LLC T © Jones & Bartlett Learning,G LLC TGCGAACG Complement of 5’ 3’ 5’ NOT FOR SALE OR DISTRIBUTIONC G NOT FOR SALE“G” adds OR “C” DISTRIBUTION C CG CG GC GC T A And so forth T Daughter A CG duplex © Jones & Bartlett Learning, LLC 5’ ©3’ Jones5’ & Bartlett Learning, LLC CG T A NOT FOR SALE OR DISTRIBUTION ACGCTTGCNOT FORACG SALE OR DISTRIBUTION T A ACG TGCGAACG CG CG T A 5’ 3’ 5’ TA

TA TA Template © Jones AT& Bartlett Learning, LLC AT © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONstrands NOT5’ FOR SALE3’ OR5’ DISTRIBUTION3’ ACGCTTGC ACGCTTGC TGCGAACG TGCGAACG 3’ 5’ 3’ 5’ Replica strands Daughter molecules of DNA © Jones & FIGUREBartlett 1.7 ReplicationLearning, of DNA. LLC (A) Replication of a DNA duplex ©as originallyJones envisioned & Bartlett by Watson Learning, and Crick. As LLC the parental strands separate, each parental strand serves as a template for the formation of a new daughter strand by means of AҀT and GҀC base pairing. NOT FOR SALE(B) Greater OR detail DISTRIBUTION showing how each of the parental strands servesNOT as a template FOR for SALE the production OR DISTRIBUTION of a comple mentary daughter strand, which grows in length by the successive addition of single nucleotides to the 3 end.

strand is the template from the parental mole- the DNA determines the biochemical character- cule and© Jonesthe top &strand Bartlett is newly Learning, synthesized. LLC istics of cells and organisms.© Jones If &the Bartlett sequence Learning, of LLC Note inNOT Figure FOR 1.7B SALEthat in theOR synthesis DISTRIBUTION of each nucleotides along theNOT DNA FOR is thought SALE ORof as DISTRIBUTION a new strand, new nucleotides are added only to string of letters on a sheet of paper, then the the 3 end of the growing chain: genes are made up of distinct words that form sentences and paragraphs that give meaning to The obligatory elongation of a DNA strand only at the 3 end is an essential feature of the pattern of letters. What is created from the © Jones & BartlettDNA replication. Learning, LLC complex© Jones and &diverse Bartlett DNA Learning, codes is protein, LLC a NOT FOR SALE OR DISTRIBUTION classNOT of macromoleculesFOR SALE OR that DISTRIBUTION carries out most Genes and Proteins of the biochemical activities in the cell. Cells are 1.3 largely made up of proteins. These include Now that we have some basic understanding of structural proteins that give the cell rigidity and the structural makeup of the genetic material, mobility, proteins that form pores in the cell © Jones & Bartlett Learning,we can ask LLChow the sequence of nucleotides© Jones in & membraneBartlett Learning, to control LLC the traffic of small NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

10 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 10 4/18/11 2:24 PM molecules into and out of the cell, and receptor © Jones proteins& Bartlett that Learning, regulate cellular LLC activities in © Jones & Bartlett Learning, LLC NOT FORresponse SALE toOR molecular DISTRIBUTION signals from the growth NOT FOR SALE OR DISTRIBUTION medium or from other cells. Proteins are also responsible for most of the metabolic activities of cells. They are essential for the synthesis and breakdown of organic molecules and for gen- erating the chemical energy© Jones needed & Bartlett for cellular Learning, LLC © Jones & Bartlett Learning, LLC activities. In 1878 theNOT term enzymeFOR SALE was intro- OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION duced to refer to the biological catalysts that accelerate biochemical reactions in cells. By 1900, thanks largely to the work of the German biochemist Emil Fischer, enzymes were shown FIGURE 1.8 Urine from a person with alkapto nuria turns to be© proteins. Jones &As Bartlettoften happens Learning, in science, LLC black because of the oxidation© Jones of the homogentisic& Bartlett acid Learning, that LLC it contains. [Courtesy of Daniel De Aguiar.] nature’sNOT “mistakes” FOR SALE provide OR cluesDISTRIBUTION as to how NOT FOR SALE OR DISTRIBUTION things work. Such was the case in establishing a relationship between genes and disease, striking symptom: The urine of the patient turns because a “mistake” in a gene (a mutation) can black because of the oxidation of homogentisic result in a “mistake” (lack of function) in the © Jones & Bartlett Learning, LLC acid© Jones(FIGURE 1.8 &). BartlettThis is why Learning, alkaptonuria LLC is also corresponding protein. This provided a fruitful called black urine disease. An early case was NOT FORavenue SALE of OR research DISTRIBUTION for the study of genetics. describedNOT FOR in the SALE year 1649: OR DISTRIBUTION

Inborn Errors of Metabolism as a Cause The patient was a boy who passed black urine of Hereditary Disease and who, at the age of fourteen years, was sub- About a century ago, the British physician mitted to a drastic course of treatment that had Archibald Garrod realized© Jones that certain & Bartlett heritable Learning, for LLC its aim the subduing of the fiery© heatJones of his & Bartlett Learning, LLC viscera, which was supposed to bring about the diseases followed the NOTrules ofFOR transmission SALE OR that DISTRIBUTION NOT FOR SALE OR DISTRIBUTION condition in question by charring and blacken- Mendel had described for his garden peas. In ing his bile. Among the measures prescribed 1908 Garrod gave a series of lectures in which were bleedings, purgation, baths, a cold and he proposed a fundamental hypothesis about watery diet, and drugs galore. None of these the relationship between heredity, enzymes, had any obvious effect, and eventually the and disease:© Jones & Bartlett Learning, LLC patient, who tired© Jonesof the futile & Bartlettand superfluous Learning, LLC NOT FOR SALE OR DISTRIBUTION therapy, resolvedNOT to let FOR things SALE take their OR natural DISTRIBUTION Any hereditary disease in which cellular course. None of the predicted evils ensued. He metabolism is abnormal results from an inher- married, begat a large family, and lived a long ited defect in an enzyme. and healthy life, always passing urine black as Such diseases became known as inborn errors ink. (Recounted by Garrod, 1908.) © Jones &of Bartlettmetabolism Learning,, a term still LLC in use today. © Jones & Bartlett Learning, LLC Garrod was primarily interested in the bio- NOT FOR SALEGarrod OR studied DISTRIBUTION a number of inborn errors of NOT FOR SALE OR DISTRIBUTION metabolism in which the patients excreted chemistry of alkaptonuria, but he took note of abnormal substances in the urine. One of these family studies that indicated that the disease was was alkaptonuria. In this case, the abnormal inherited as though it were due to a defect in a substance excreted is homogentisic acid: single gene. As to the biochemistry, he deduced © Jones & Bartlett Learning,that the LLC problem in alkaptonuria© Jones was the & Bartlett Learning, LLC patients’ inability to break down the phenyl ring OHNOT FORO SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION of six carbons that is present in homogentisic

CH2 C acid. Where does this ring come from? Most ani- OH mals obtain it from foods in their diet. Garrod HO proposed that homogentisic acid originates as a © Jones & Bartlett Learning, LLC breakdown product© ofJones two amino & Bartlett acids, phenyl- Learning, LLC An earlyNOT name FOR for SALE homogentisic OR DISTRIBUTION acid was alkap- alanine and tyrosine,NOT which FOR also SALE contain OR a phe- DISTRIBUTION ton, hence the name alkaptonuria for this dis- nyl ring. An amino acid is one of the “building ease. Even though alkaptonuria is rare, with an blocks” from which proteins are made. Phenyl- incidence of about one in 200,000 people, it alanine and tyrosine are constituents of normal was well known even before Garrod studied it. proteins. The scheme that illustrates the rela- © Jones &The Bartlett disease itself Learning, is relatively LLC mild, but it has one tionship© Jones between & Bartlett the molecules Learning, is shown LLC in NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.3 Genes and Proteins 11

26105_CH01_001_038.indd 11 4/18/11 2:24 PM connection © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FORThe SALE Black OR DISTRIBUTION Urine Disease NOT FOR SALE OR DISTRIBUTION

Although he was a distinguished phy- mode of incidence of alkaptonuria urine originally called alkapton] is sician, Garrod’s lectures on the relationship finds a ready explanation if the homo gentisic acid, the excretion of ©between Jones hered- & Bartlettanomaly Learning, be regarded LLC as a rare reces- which is© the Jones essential & Bartlettfeature of Learning,the LLC Archibald E. Garrod 1908 ity and congeni- sive character in the Mendelian alkaptonuric. . . . Homogentisic acid St. Bartholomew’s Hospital, NOTtal defects FOR SALEin sense. OR . DISTRIBUTION. . Of the cases of alkapton- is a productNOT of FOR normal SALE metabolism OR DISTRIBUTION London, England metabolism had uria a very large proportion have . . . . The most likely sources of the Inborn Errors of Metabolism no impact when been in the children of first cousin phenyl ring in homo gentisic acid they were deliv- marriages. . . . It is also noteworthy are phenyl alanine and tyrosine, ered. The© Jones important & concept Bartlett that oneLearning, gene that, LLC if one takes families with five© Jonesor [because & Bartlett when Learning,these amino LLC acids corresponds to one enzyme (the “one gene– more children [with both parents are administered to an alkaptonuric] one enzymeNOT hypothesis”)FOR SALE was OR developed DISTRIBUTION normal and at least one NOT FOR SALE ORthey DISTRIBUTIONcause a very con- independently in the 1940s by George W. child affected with al- We may further spicuous increase in Beadle and Edward L. Tatum, who used kap tonuria], the totals conceive that the the output of homo- the bread mold Neurospora crassa as work out in strict con- splitting of the phenyl gentisic acid. . . . Where © Jones &their Bartlett experimental Learning, organism. LLCWhen Bea- formity to Mendel’s© Jones law, & Bartlettring in normal Learning, LLCthe al kap tonuric differs dle finally became aware of Inborn i.e. 57 [normal chil- metabolism is the work from the normal indi- NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Errors of Metabolism, he was generous dren] : 19 [affected chil- of a special enzyme vidual is in having no in praising it. This excerpt shows Garrod dren] in the proportions and that in congenital power of destroying

at his best, interweaving history, clinical 3:1. . . . Of inborn errors alkaptonuria this homogentisic acid medicine, heredity, and biochemistry in his of metabolism, alkap- enzyme is wanting. when formed—in other account of alkaptonuria.© The Jones excerpt &also Bartlett tonuria Learning, is that of which LLC © Joneswords &of Bartlett breaking Learning, up LLC illustrates how the severity of a genetic dis- we know most. In itself the phenyl ring of that ease depends on its socialNOT context. FOR Garrod SALE it is OR a trifling DISTRIBUTION matter, inconvenient compound.NOT . . .FOR We may SALE further OR con- DISTRIBUTION writes as though alkaptonuria were a rather than harmful. . . . Indications ceive that the splitting of the phenyl harmless curiosity. This is indeed largely of the anomaly may be detected in ring in normal metabolism is the true when the life expectancy is short. With early medical writings, such as that in work of a special enzyme and that in today’s© Joneslonger life & span, Bartlett alkaptonuria Learning, 1584 LLC of a schoolboy who, although© Jones congenital & Bartlett alkap Learning, tonuria this enzyme LLC patients accumulate the dark pigment in he enjoyed good health, continu- is wanting. their NOTcartilage FOR and joints SALE and ORcan eventu- DISTRIBUTIONously excreted black urine; andNOT that FOR SALE OR DISTRIBUTION ally develop arthritis. in 1609 of a monk who exhibited a Source: H. Harris. Garrod’s Inborn Errors of Metabolism, Second edition. Oxford University To students of heredity the similar peculiarity and stated that he Press (1963). Originally published in inborn errors of metabolism offer a had done so all his life. . . . There are London, England by the Oxford University Press. © Jones &promising Bartlett field Learning, of investi gation. LLC . . . It no sufficient grounds© Jones [for & doubting Bartlett Learning, LLC was pointed out [by others] that the that the blackening substance in the NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

FIGURE 1.9. Any such sequence of biochemical in homogentisic acid comes from dietary phe- reactions is called a biochemical pathway or nylalanine and tyrosine. a metabolic© Jones pathway & Bartlett. Each arrow Learning, in the path- LLC What allows each© stepJones in a biochemical & Bartlett path- Learning, LLC way representsNOT FOR a single SALE step depictingOR DISTRIBUTION the transi- way to occur? GarrodNOT correctly FOR SALE surmised OR that DISTRIBUTION tion from the “input” or substrate molecule, each step requires a specific enzyme to catalyze shown at the head of the arrow, to the “output” the reaction for the chemical transformation. or product molecule, shown at the tip. Persons with an inborn error of metabolism, such Biochemical pathways are usually oriented as alkaptonuria, have a defect in a single step of © Joneseither & Bartlett vertically Learning, with the arrows LLC pointing down, a metabolic© Jones pathway & Bartlett because Learning, they lack LLCa func- NOT FORas inSALE Figure OR 1.9, DISTRIBUTION or horizontally, with the arrows tionalNOT enzyme FOR for SALE that step. OR When DISTRIBUTION an enzyme in pointing from left to right. Garrod did not know a pathway is defective, the pathway is said to all of the details of the pathway in Figure 1.9, have a block at that step. One frequent result of but he did understand that the key step in the a blocked pathway is that the substrate of the breakdown of homogentisic acid is the breaking defective enzyme accumulates. Observing the © Jones & Bartlett Learning,open of the LLC phenyl ring and that the phenyl© Jones ring & accumulationBartlett Learning, of homogentisic LLC acid in patients NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

12 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 12 4/18/11 2:25 PM Phenyl ring Phenylalanine © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC A defect in this Each step in a NH 1 enzyme leads to NOT FOR SALE ORCC DISTRIBUTION2 O NOTmetabolic FOR pathway SALE OR DISTRIBUTIONPhenylalanine hydroxylase accumulation of C CCCH2 C requires a different phenylalanine and enzyme. C C H OH to phenylketonuria. Phenylalanine (a normal amino acid) Tyrosine © Jones & BartlettEach arrow Learning, LLC © Jones A& defect Bartlett in this Learning, LLC represents one 2 enzyme leads to 1 NOT FOR SALEstep in ORthe DISTRIBUTION TyrosineNOT FOR SALE OR DISTRIBUTION aminotransferase accumulation of biochemical tyrosine and to pathway. tyrosinemia type II.

CC NH2 O 4-Hydroxyphenyl- HO© JonesC C &CH Bartlett2 C C Learning, LLC © Jones pyruvic& Bartlett acid Learning, LLC NOTC FORC SALEH OROH DISTRIBUTION NOT FOR SALE OR DISTRIBUTIONA defect in this 3 enzyme leads to Tyrosine (a normal amino acid) Each enzyme is 4-Hydroxyphenyl- encoded in a pyruvic acid accumulation of different gene. dioxygenase 4-hydroxyphenyl- 2 pyruvic acid and to tyrosinemia type III. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC CC O O Homogentisic acid NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTIONA defect in this HO C C CH2 C C 4 enzyme leads to Homogentisic acid C C OH 1,2-dioxygenase accumulation of 4-Hydroxyphenylpyruvic acid homogentisic acid and to alkaptonuria.

3 © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 4-Maleylacetoacetic acid NOT FOR InSALE the next OR step DISTRIBUTION NOT FOR SALE OR DISTRIBUTION the phenyl ring OH is opened at this position. Further breakdown CC O FIGURE 1.10 Inborn errors of metabolism that affect the breakdown of phenyl- © JonesC C & CHBartlett2 C Learning, LLC alanine and tyrosine.© An Jones inherited disease& Bartlett results when Learning, any of the enzymes LLC is C C OH missing or defective. Alkapto nuria results from a mutant homo gentisic acid 1,2 NOT FOR SALE OR DISTRIBUTION dioxygenase; phenylketonuriaNOT FOR results SALEfrom a mutant OR phenylalanine DISTRIBUTION hydroxylase. OH Homogentisic acid (formerly known as alkapton) with alkaptonuria, Garrod proposed that there This is the step must be an enzyme whose function is to open © Jones & Bartlett Learning, LLC that is blocked © Jones & Bartlett Learning, LLC 4 in alkaptonuria; the phenyl ring of homogentisic acid and that NOT FOR SALE OR DISTRIBUTIONX homogentisic thisNOT enzyme FOR is missingSALE inOR these DISTRIBUTION patients. Isolation acid accumulates. of the enzyme that opens the phenyl ring of homogentisic acid was not actually achieved until 50 years after Garrod’s lectures. In normal O O O people it is found in cells of the liver, and just as C CH CH C CH©2 JonesC CH 2& CBartlett Learning,Garrod LLC had predicted, the enzyme is© defective Jones in& Bartlett Learning, LLC HO NOTO FOR SALEOH OR DISTRIBUTIONpatients with alkaptonuria. NOT FOR SALE OR DISTRIBUTION 4-Maleylacetoacetic acid The pathway for the breakdown of phenylalanine and tyrosine, as it is understood today, is shown in FIGURE 1.10. In this figure the emphasis is on the enzymes rather than on the structures © JonesFurther & breakdown Bartlett Learning, LLC of the metabolites© Jones, or small & Bartlettmolecules, Learning, on LLC FIGURE 1.9NOT Metabolic FOR pathway SALE for ORthe breakdown DISTRIBUTION of phenylala- which the enzymesNOT act. FOR Each stepSALE in the OR path- DISTRIBUTION nine and tyrosine. Each step in the pathway, represented by an arrow, requires a specific enzyme to catalyze the reaction. The key way requires the presence of a particular step in the breakdown of homogentisic acid is the breaking open of enzyme that catalyzes that step. Although the phenyl ring. Garrod knew only about alkaptonuria, in which the defective enzyme is homogentisic acid © Jones & Bartlett Learning, LLC 1,2© Jonesdioxygenase, & Bartlett we now Learning, know the LLCclinical NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.3 Genes and Proteins 13

26105_CH01_001_038.indd 13 4/18/11 2:25 PM connection © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOROne SALE Gene, OR DISTRIBUTION One Enzyme NOT FOR SALE OR DISTRIBUTION

How do genes control metabolic pro- the roles of genes, the physiological chemical reactions. If the organism cesses? The suggestion that genes control geneticist usually attempts to deter- must be able to carry out a certain ©enzymes Jones &was Bartlett mine the Learning, physiological LLC and biochemi- chemical© reactionJones &to Bartlettsurvive on Learning, a LLC George W. Beadle and made very early cal bases of already known hereditary given medium, a mutant unable to do Edward L. Tatum 1941 NOTin the FOR history SALE of traits. OR . . DISTRIBUTION. There are, however, a num- this willNOT obviously FOR be SALE lethal ORon this DISTRIBUTION Stanford University, Stanford, genetics, most ber of limitations inherent in this medium. Such a mutant can be main- California notably by the approach. Perhaps the most serious tained and studied, however, if it will Genetic Control of Biochemical British physi- of these is that the investigator must grow on a medium to which has been Reactions in Neurospora © Jones & Bartlettcian Archibald Learning, in LLCgeneral confine himself to© the Jones added & Bartlett the essential Learning, product LLCof the Garrod in his study of non-lethal heritable charac- genetically blocked reaction. . . . 1908 NOTbook Inborn FOR SALEErrors of OR Metabo- DISTRIBUTIONters. Such characters are NOT FOR SALE ORAmong DISTRIBUTION approximately lism. But the precise relationship between likely to involve more These preliminary 2000 strains [derived genes and enzymes was still uncertain. or less non-essential so- results appear to us to from single cells after Perhaps each enzyme is controlled by more called “terminal” reac- indicate that the x-ray treatment], three © Jones &than Bartlett one gene, Learning, or perhaps each LLC gene con- tions. . . . A© second Jones & approachBartlett may Learning, offer LLCmutants have been tributes to the control of several enzymes. difficulty is that the found that grow essen- NOT FOR SALE OR DISTRIBUTION NOT FOR considerableSALE OR DISTRIBUTIONpromise The classic experiments of Beadle and standard approach to as a method of learning tially normally on the Tatum showed that the relationship is usu- the problem implies the more about how genes complete medium and ally remarkably simple: One gene codes for use of characters with regulate development scarcely at all on the one enzyme. The pioneering experiments visible manifestations. and function. minimal medium. One united genetics and biochemistry,© Jones and & for Bartlett Many Learning,such characters LLC © Jonesof these & strainsBartlett proved Learning, LLC the “one gene, one enzyme”NOT concept, FOR Bea- SALEinvolve OR DISTRIBUTIONmorphological NOTto FOR be unable SALE to synthe-OR DISTRIBUTION dle and Tatum were awarded a Nobel variations, and these are likely to be size vitamin B6 (pyridoxine). A sec- Prize in 1958 (Joshua Lederberg shared based on systems of biochemical ond strain turned out to be unable to the prize for his contributions to microbial reactions so complex as to make anal- synthesize vitamin B1 (thiamine). A genetics). Because we now know that some ysis exceedingly difficult. . . . Consid- third strain has been found to be enzymes© Jones contain & polypeptide Bartlett Learning,chains erations LLC such as those just outlined© Jones unable & Bartlett to synthesize Learning, para-aminoben- LLC encodedNOT by two FOR (or occasionally SALE OR more) DISTRIBUTION dif- have led us to investigate the generalNOT FORzoic SALEacid. . OR. . These DISTRIBUTION preliminary ferent genes, a more accurate statement of problem of the genetic control of results appear to us to indicate that the principle is “one gene, one polypep- development and metabolic reactions the approach may offer considerable tide.” Beadle and Tatum’s experiments by reversing the ordinary procedure promise as a method of learning also demonstrate the importance of choos- and, instead of attempting to work more about how genes regulate © Jones &ing Bartlett the right organism. Learning, Neurospora LLC had out the chemical© Jones bases of& Bartlettknown Learning,development LLC and function. For been introduced as a genetic organism only genetic characters, to set out to deter- example, it should be possible, by NOT FORa SALEfew years OR earlier, DISTRIBUTION and Beadle and Tatum mine if and NOThow FORgenes SALEcontrol OR finding DISTRIBUTION a number of mutants unable realized that they could take advantage of known biochemical reactions. The to carry out a particular step in a the ability of this organism to grow on a ascomycete Neurospora offers many given synthesis, to determine simple medium composed of known advantages for such an approach and whether only one gene is ordinarily substances. © Jones & Bartlettis well Learning, suited to geneticLLC studies. concerned© withJones the &immediate Bartlett regu- Learning, LLC From the standpoint of physio- Accordingly, our program has been lation of a given specific chemical logical genetics the developmentNOT FOR and SALE built OR around DISTRIBUTION this organism. The pro- reaction.NOT FOR SALE OR DISTRIBUTION functioning of an organism consist cedure is based on the assumption essentially of an integrated system of that x-ray treatment will induce Source: G. W. Beadle and E. L. Tatum, Proc. Natl. Acad. Sci. USA 27 (1941): 499–506. chemical reactions controlled in some mutations in genes concerned with manner© Jones by genes. & . Bartlett. . In investigating Learning, the LLC control of known specific© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION consequences of defects in the other enzymes. (PAH). When this step in the pathway is Unlike alkaptonuria, which is a relatively benign blocked, phenylalanine accumulates. The excess inherited disease, the others are very serious. phenylalanine is broken down into harmful The condition known as phenylketonuria metabolites that cause defects in myelin forma- © Jones & Bartlett Learning,(PKU) results LLC from the absence of (or ©a defectJones & tionBartlett that damage Learning, a child’s LLC developing nervous NOT FOR SALE OR DISTRIBUTIONin) the enzyme phenylalanine hydroxylaseNOT FOR SALEsystem ORand leadDISTRIBUTION to severe mental retardation.

14 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 14 4/18/11 2:25 PM However, if PKU is diagnosed in children 1.4 Genetic Analysis © Jones soon& Bartlett enough Learning, after birth, they LLC can be placed on © Jones & Bartlett Learning, LLC NOT FORa SALEspecially OR formulated DISTRIBUTION diet low in phenylala- TheNOT genetic FOR implications SALE OR of Garrod’sDISTRIBUTION research on nine. The child is allowed only as much phenyl- inborn errors of metabolism were not widely alanine as can be used in the synthesis of appreciated, most likely because his writings proteins, so excess phenylalanine does not accu- focused primarily on biochemical pathways mulate. The special diet is very strict. It excludes rather than inheritance. The definitive connec- meat, poultry, fish, eggs,© Jones milk and & Bartlett milk prod- Learning,tion between LLC genes and enzymes© came Jones from & Bartlett Learning, LLC ucts, legumes, nuts, andNOT bakery FOR goods SALE manufac- OR DISTRIBUTIONstudies carried out in the 1940s byNOT George FOR W. SALE OR DISTRIBUTION tured with regular flour. These foods are Beadle and Edward L. Tatum using a filamen- replaced by an expensive synthetic formula. tous fungus Neurospora crassa, commonly called With the special diet, however, the detrimental red bread mold, an organism they chose because effects of excess phenylalanine on mental devel- both genetic and biochemical analysis could be opment© Jones can largely & Bartlett be avoided, Learning, although LLC in done with ease. ©In Jonesthese experiments, & Bartlett Learning,they LLC adultNOT women FOR with SALE PKU who OR are DISTRIBUTION pregnant, the identified new mutationsNOT FOR that SALE each causedOR DISTRIBUTION a fetus is at risk. In many countries, including the block in the metabolic pathway for the synthesis United States, all newborn babies have their of some needed nutrient, and showed that each blood tested for chemical signs of PKU. Routine of these blocks corresponded to a defective screening is cost- effective because PKU is rela- enzyme needed for one step in the pathway. © Jones &tively Bartlett common. Learning, In the United LLC States, the inci- The© Jonesresearch & was Bartlett important Learning, not only because LLC it NOT FORdence SALE is ORabout DISTRIBUTION 1 in 8000 among Caucasian solidifiedNOT FOR the SALElink between OR DISTRIBUTION genetics and bio- births. The disease is less common in other eth- chemistry, but also because the experimental nic groups. approach, now called genetic analysis, has In the metabolic pathway in Figure 1.10, been successfully applied to understanding a defects in the breakdown of tyrosine or of wide range of biological processes from the 4-hydroxyphenylpyruvic© Jones acid lead & Bartlett to types ofLearning, genetic LLC control of cell cycle and cancer© Jones to that of& Bartlett Learning, LLC tyrosinemia. These NOTare also FOR severe SALE diseases. OR DISTRIBUTION development and behavior. We shallNOT therefore FOR SALE OR DISTRIBUTION Type II is associated with skin lesions and men- examine the Beadle-Tatum experiments in tal retardation, Type III with severe liver some detail. dysfunction. The genes for the enzymes in the biochemi- Mutant Genes and Defective Proteins © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC cal pathway in Figure 1.10 have all been identi- N. crassa grows in the form of filaments on fied andNOT the FOR nucleotide SALE sequence OR DISTRIBUTION of the DNA a great variety of substratesNOT FOR including SALE laboratory OR DISTRIBUTION determined. In the following list, and through- medium containing only inorganic salts, a sugar, out this book, we use the standard typographi- and the vitamin biotin. Such a medium is cal convention that genes are written in italic known as a minimal medium because it con- type, whereas gene products are not printed in tains only the nutrients that are essential for © Jones &italics. Bartlett This convention Learning, is LLCconvenient, because growth© Jones of the & organism.Bartlett TheLearning, filaments LLC consist NOT FORit SALEmeans thatOR theDISTRIBUTION protein product of a gene can ofNOT a mass FOR of branched SALE OR threads DISTRIBUTION separated into be represented with the same symbol as the interconnected, multinucleate compartments gene itself, but whereas the gene symbol is in allowing free interchange of nuclei and cyto- italics, the protein symbol is not. In Figure 1.10 plasm. Each nucleus contains a single set of the numbers correspond to the following genes seven chromosomes. Beadle and Tatum recog- and enzymes. © Jones & Bartlett Learning,nized LLCthat the ability of Neurospora© toJones grow in& Bartlett Learning, LLC 1. The gene PAHNOT on FORthe long SALE arm OR of DISTRIBUTIONminimal medium implied that theNOT organism FOR SALE OR DISTRIBUTION chromosome 12 encodes phenylalanine must be able to synthesize all metabolic compo- hydroxylase (PAH). nents other than biotin. If the biosynthetic path- 2. The gene TAT on the long arm of chro- ways needed for growth are controlled by genes, mosome 16 encodes tyrosine amino- then a mutation in a gene responsible for syn- © transferaseJones & (TAT).Bartlett Learning, LLC thesizing an essential© Jones nutrient & Bartlett would Learning, be LLC 3.NOT The FORgene HPDSALE on theOR long DISTRIBUTION arm of chro- expected to renderNOT a strainFOR SALEunable ORto grow DISTRIBUTION mosome 12 encodes 4-hydroxyphenyl- unless the strain was provided with the pyruvic acid dioxygenase (HPD). nutrient. 4. The gene HGD on the long arm of chro- These ideas were tested in the following mosome 3 encodes homogentisic acid way. Spores of nonmutant Neurospora were irra- © Jones & Bartlett1,2 dioxygenase Learning, (HGD). LLC diated© Jones with either& Bartlett x-rays Learning,or ultraviolet LLC light to NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.4 Genetic Analysis 15

26105_CH01_001_038.indd 15 4/18/11 2:25 PM produce mutant strains with various nutritional cultures could grow on minimal medium; these © Jones & Bartlett Learning,requirements. LLC (Why these treatments© causeJones & wereBartlett discarded Learning, because LLC they lacked any new NOT FOR SALE OR DISTRIBUTIONmutations is discussed in Chapter 14.) TheNOT isola- FOR SALEmutation OR of DISTRIBUTIONthe desired type. The retained cul- tion of a set of mutants affecting any biological tures were the small number unable to grow in process, in this case metabolism, is called a minimal medium, because they contained a mutant screen. In the initial step for identify- new mutation blocking the synthesis of some ing mutants, summarized in FIGURE 1.11, the irra- essential nutrient. diated ©spores Jones (purple) & Bartlett were used Learning, in crosses with LLC Samples from a© portion Jones of each& Bartlett mutant cul-Learning, LLC an untreatedNOT FOR strain SALE (green). OR Ascospores DISTRIBUTION pro- ture were then transferredNOT FOR to a SALEseries of OR media DISTRIBUTION duced by the sexual cycle in fruiting bodies to determine whether the mutation results in a were individually germinated in complete requirement for a vitamin, an amino acid, or medium, a complex medium enriched with a some other substance (FIGURE 1.12B). In the exam- variety of amino acids, vitamins, and other sub- ple illustrated, the mutant strain requires one © Jonesstances & Bartlett expected Learning, to be essential LLC metabolites (or© possibly Jones more & Bartlett than one) Learning,amino acid, because LLC NOT FORwhose SALE synthesis OR DISTRIBUTION could be blocked by a muta- a mixtureNOT FOR of all SALEamino acids OR addedDISTRIBUTION to the mini- tion. Even those ascospores containing a new mal medium allows growth. Because the mutation affecting synthesis of an essential proportion of irradiated cultures with new nutrient would be expected to germinate and mutations was very small, only a negligible grow in complete medium. number of cultures contained two or more new © Jones & Bartlett Learning,To identify LLC which of the irradiated© Jonesasco- & mutationsBartlett Learning,that had occurred LLC simultaneously. NOT FOR SALE OR DISTRIBUTIONspores contained a new mutation affectingNOT the FOR SALEFor OR nutritional DISTRIBUTION mutants requiring amino synthesis of an essential nutrient, conidia from acids, further experiments testing each of the each culture were transferred to minimal amino acid individually usually revealed that medium (FIGURE 1.12A). The vast majority of only one amino acid was required to be added to © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Filamentous mycelium grows in complete medium and many gentically identical © Jones & Bartlett Learning, LLC © Jones & asexualBartlett spores Learning, are produced. LLC NOT FOR SALE OR DISTRIBUTION AsexualNOT spores FOR SALE OR DISTRIBUTION (conidia) Spore exposed to x rays or Asexual ultraviolet light cycle © Jones & Bartlett Learning, LLC An ascospore© Jones is placed & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION in completeNOT mediumFOR SALE OR DISTRIBUTION in a test tube. Fruiting body Ascus Mycelium

Sexual © Jonescycle & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Germination of ascospore

FIGURE 1.11 Beadle and Tatum obtained mutants of the filamentous fungus Neurospora crassa by exposing asexual spores to x-rays or ultraviolet light. The treated spores were used to start the sexual cycle in fruiting bodies. After any pair of cells and their nuclei undergo fusion, meiosis takes place almost immediately and results in eight sexual spores (ascospores) included in a single ascus. These are removed individually and cultured in complete medium. Ascospores that carry new nutritional mutants © Jones & Bartlett Learning,are identified laterLLC by their inability to grow in minimal© Jonesmedium. & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

16 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 16 4/18/11 2:25 PM minimal medium in order to support growth. In supplemented with either ornithine alone or © Jones FIGURE& Bartlett 1.12C, the Learning, mutant strain LLC requires the amino citrulline© Jones alone & Bartlett(FIGURE 1.12D Learning,). One class LLC of argi- NOT FORacid SALE arginine. OR Even DISTRIBUTION in the 1940s some of the pos- nine-requiringNOT FOR SALE mutants, OR designated DISTRIBUTION Class I, was sible intermediates in amino acid biosynthesis able to grow in minimal medium supplemented had been identified. These were recognized by with either ornithine, cit rulline, or arginine. their chemical resemblance to the amino acid and Other mutants, designated Class II, were able to by being present at low levels in the cells of organ- grow in minimal medium supplemented with isms. In the case of arginine,© Jones two candidates & Bartlett were Learning, either LLCcitrulline or arginine, but not© ornithine. Jones &A Bartlett Learning, LLC ornithine and citrulline.NOT All FOR mutants SALE requiring OR DISTRIBUTIONthird class, Class III, was able to growNOT only inFOR min- SALE OR DISTRIBUTION arginine therefore were tested in medium imal medium supplemented with arginine.

(A) Test© forJones nutritional & Bartlett mutants Learning, LLC (B) Test for required© Jones nutrient & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Asexual Asexual spores spores (conidia) (conidia) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Complete Complete Minimal Minimal MM + MM + MM + medium © Jonesmedium & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC medium medium vitamins amino nucleic acid (MM)NOT FOR SALE OR(MM) DISTRIBUTION acids precursorsNOT FOR SALE OR DISTRIBUTION

Most strains grow A few strains fail to Mutant strains are tested on MM in MM; these are grow in MM; these supplemented with mixtures of nonmutant and are mutant and are nutrients. The mutant strain are ©discarded. Jones & Bartlett keptLearning, for futher study.LLC here requires© Jones amino &acids Bartlett to grow. Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION MM + MM + MM + MM + MM + MM + MM + MM + MM + MM + leucine valine glycine serine arginine lysine proline ornithine citrulline arginine

Mutant strains requiring amino acids are tested on MM Mutant strains requiring arginine supplemented© Jones with& Bartlett each of the Learning, amino acids inLLC turn. are tested on© MMJones supplemented & Bartlett Learning, LLC The mutant strain here requires arginine to grow. with possible precursors of arginine. NOT FOR SALE OR DISTRIBUTION This mutantNOT strain FOR grows onSALE citrulline OR DISTRIBUTION or arginine, but not ornithine.

FIGURE 1.12 (A) Mutant spores can grow in complete medium but not in minimal medium. (B) Each new mutant is tested for growth in minimal medium supplemented with a mixture of nutrients. (C) Mutants that can grow on minimal medium © Jones &supplemented Bartlett with Learning, amino acid are LLC tested with each amino acid individually© Jones. (D) Mutants & Bartlettunable to grow Learning, in the absence LLC of arginine are tested with likely precursors of arginine. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.4 Genetic Analysis 17

26105_CH01_001_038.indd 17 4/18/11 2:25 PM Precursor Each step in the biochemical imply that ornithine is “upstream” from © Jones & Bartlett Learning, LLC pathway is catalyzed by© theJones & Bartlettcitrulline Learning, in the metabolicLLC pathway. NOT FOR SALE OR DISTRIBUTIONenzyme product of a differentNOT FOR SALEThe OR structure DISTRIBUTION of the pathway was further gene. confirmed by the observations that Class III mutants accumulate citrulline and Class II Class I mutants (three complementation mutants accumulate ornithine. Finally, it was groups) Some intermediates in the shown by direct biochemical experiment that © Jones &biochemical Bartlett pathwayLearning, may LLC the inferred enzymes© Joneswere actually & Bartlett present Learning, in LLC not be known. NOT FOR SALE OR DISTRIBUTION nonmutant strainsNOT but FORdefective SALE in mutantOR DISTRIBUTION strains. NH2 O Complementation Test for Mutations in the C NH2 CH2 CH2 CH2 C Same Gene OH © Jones & BartlettOrnithine Learning,H LLC ©Beadle Jones and & Tatum Bartlett were Learning, fortunate to LLC study ClassNOT II mutants FOR SALE OR DISTRIBUTIONWhen the intermediates metabolicNOT FOR pathways SALE inOR a relativelyDISTRIBUTION simple (one complementation are known, the order of group) steps in the pathway can organism in which one gene corresponds to be determined. one enzyme. In such a situation, genetic analysis of the mutants reveals a great deal more O NH2 O about the metabolic pathway than merely the © Jones & NHBartlett2 C NHLearning,CH2 CH LLC2 CH2 C C © Jones & orderBartlett of the Learning, intermediates. LLC By classifying each Citrulline NOT FOR SALE OR DISTRIBUTION H OH NOT FOR SALEmutation OR according DISTRIBUTION to the particular gene it is in, and grouping all the mutations in each gene together, each set of mutations, and therefore Class III mutants The intermediate at this (two complementation step was later shown to be each individual gene, corresponds to one enzy- groups) argininosuccinate. matic step in the metabolic pathway. In Fig- © Jones & Bartlett Learning, LLC ure 1.13, for example,© Jones the mutants & Bartlett in Class Learning, I LLC NOT FOR SALE OR DISTRIBUTION each correspond toNOT one ofFOR three SALE genes, ORwhich DISTRIBUTION NH NH2 O implies that there are three steps in the pathway between the precursor and ornithine. NH2 C NH CH2 CH2 CH2 C C Similarly, the mutants in Class III each corre- Arginine H OH spond to one of two genes, which implies that FIGURE© 1.13 Jones Metabolic & Bartlett pathway for Learning,arginine biosynthesis LLC inferred from genetic there© Jones are two & steps Bartlett in the Learning, pathway between LLC analysis of Neurospora mutants. NOT FOR SALE OR DISTRIBUTION theNOT citrulline FOR and SALE arginine. OR However,DISTRIBUTION all of the mutants in Class II have mutations in the same The types of arginine-requiring mutants gene, which implies only one step in the path- illustrate the logic of genetic analysis as applied way between ornithine and citrulline. to metabolic pathways. The logic is easiest to see Mutations that have defects in the same © Jones & Bartlett Learning,in the context LLC of the metabolic pathway,© which Jones & geneBartlett are identifiedLearning, by LLC means of a comple- NOT FOR SALE OR DISTRIBUTIONis shown in FIGURE 1.13, where arginine isNOT the end FOR SALEmentation OR DISTRIBUTIONtest, in which two mutations are product of a linear metabolic pathway starting brought together into the same cell. In most with some precursor metabolite, and ornithine multicellular organisms and even some sexual and citrulline are intermediates in the pathway. unicellular organisms, the usual way to do this The mutants support this structure of the path- is by means of a mating. When two parents, way because:© Jones & Bartlett Learning, LLC each carrying one ©of Jonesthe two & mutations, Bartlett Learning,are LLC • NOT Mutants FOR able SALE to grow OR in theDISTRIBUTION presence of crossed, fertilizationNOT begins FOR the SALE reproductive OR DISTRIBUTION either ornithine, citrulline, or arginine cells containing the two mutations together, must have a metabolic block between the and through ordinary cell division each cell in precursor metabolite and both of the in- the resulting offspring carries one copy of each termediates. mutant gene. In Neurospora this procedure © Jones & Bartlett• Mutants Learning, able to grow LLC only in the pres- does© Jonesnot work & becauseBartlett nuclear Learning, fusion LLC is fol- NOT FOR SALEence OR of arginineDISTRIBUTION must have a metabolic lowedNOT almost FOR immediately SALE OR by DISTRIBUTION the formation of block in the pathway between arginine ascospores, each of which has only one set of and the most “downstream” of the in- chromosomes. termediates. Complementation tests are nevertheless • Mutants able to grow in the presence of possible in Neurospora owing to the multinucle- © Jones & Bartlett Learning,citrulline LLC or arginine but not ornithine© Jones & ateBartlett nature Learning, of the filaments. LLC Certain strains, NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

18 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 18 4/18/11 2:25 PM including those studied by Beadle and Tatum, same gene, in this case purple. Both of the pur- © Jones have& Bartlett the property Learning, that whenLLC the filaments ple© nucleiJones encode & Bartlett a normal Learning, form of the LLCred pro- NOT FORfrom SALE two ORmutant DISTRIBUTION (or nonmutant) organisms tein,NOT but FOR each SALE purple OR nucleus DISTRIBUTION encodes a come into physical contact, the filaments fuse defective purple protein. When the nuclei are and the new filament contains multiple nuclei together, two different mutant forms of the from each of the participating partners. This purple protein are produced, and so the biosyn- sort of hybrid filament is called a hetero- thetic pathway that requires the purple protein karyon and it contains© Jones mutant &forms Bartlett of both Learning, is still LLCblocked and the heterokaryon© Jones is unable & Bartlett Learning, LLC genes. The word rootsNOT of the FOR term SALE heterokaryon OR DISTRIBUTIONto grow in minimal medium. In otherNOT words,FOR SALE OR DISTRIBUTION mean “different nuclei.” (A list of the most the mutants 2 and 3 in Figure 1.14 fail to com- common word roots used in genetics can be plement, and so they are judged to have muta- found at the end of this book.) tions in the same gene. When a heterokaryon formed from two The following principle underlies the com- nutritional© Jones mutants & Bartlett is inoculated Learning, into minimal LLC plementation test.© Jones & Bartlett Learning, LLC medium,NOT it mayFOR grow SALE or it ORmay DISTRIBUTION fail to grow. If it NOT FOR SALE OR DISTRIBUTION The Principle of Complementation: grows in minimal medium, the mutant genes are A complementation test brings two mutant said to undergo complementation, and this genes together in the same cell or organism. If result indicates that the mutations are in differ- this cell or organism is nonmutant, the muta- ent genes. On the contrary, if the heterokaryon tions are said to complement one another and © Jones &fails Bartlett to grow inLearning, minimal medium, LLC the result indi- © Jonesit means that& Bartlett the parental Learning, strains have LLC muta- NOT FORcates SALE noncomplementation OR DISTRIBUTION, and the two NOTtions FOR in different SALE genes. OR If DISTRIBUTION the cell or organism mutations are inferred to be in the same gene. is mutant, the mutations fail to complement The inferences from complementation or one another, and it means that the parental noncomplementation emerge from the logic mutations are in the same gene. illustrated in FIGURE 1.14. Here the multinucleate filament is shown, and© Jonesthe mutant & Bartlett nuclei are Learning, Analysis LLC of Complementation Data© Jones & Bartlett Learning, LLC color coded accordingNOT to which FOR of twoSALE different OR DISTRIBUTIONIn the mutant screen for NeurosporaNOT mutants FOR SALE OR DISTRIBUTION genes (red or purple) is mutant. The red and requiring arginine, Beadle and Tatum found that purple squiggles represent the proteins encoded mutants in different classes (Class I, Class II, and in the mutant nuclei, and a “burst” represents a Class III in Figure 1.13) always complemented defect in the protein at that position resulting one another. This result makes sense, because from© a mutationJones & in Bartlett the corresponding Learning, gene. LLC the genes in each ©class Jones encode & enzymes Bartlett that Learning, act LLC PartNOT A depicts FOR theSALE situation OR whenDISTRIBUTION the mutant at different levels betweenNOT FOR the known SALE intermedi- OR DISTRIBUTION strains have mutations in different genes. In the ates. However, some of the mutants in Class I heterokaryon, the red nuclei produce mutant failed to complement others in Class I, and some forms of the red protein and normal forms of the in Class III failed to complement others in Class purple protein, whereas the purple nuclei pro- III. These results allow the number of genes in © Jones &duce Bartlett mutant Learning, forms of the LLC purple protein and each© Jones class to be& Bartlettidentified. Learning, LLC NOT FORnormal SALE forms OR of DISTRIBUTION the red protein. The result is that NOTTo illustrateFOR SALE this aspect OR DISTRIBUTIONof genetic analysis, the red/purple heterokaryon has normal forms we will consider six mutant strains in Class III. of both the red and purple protein. It also has These strains were taken in pairs to form hetero- mutant forms of both proteins, but these do not karyons and their growth on minimal medium matter. What matters is that the normal forms assessed. The data are shown in FIGURE 1.15A. The allow the heterokaryon© Jones to grow & onBartlett minimal Learning, mutant LLC genes in the six strains are© denoted Jones x1 &, Bartlett Learning, LLC medium because all neededNOT nutrients FOR SALE can be ORsyn- DISTRIBUTIONx2, and so forth, and the data are presentedNOT FOR in the SALE OR DISTRIBUTION thesized. In other words, the normal purple gene form of a matrix in which indicates growth in in the red nucleus complements the defective minimal medium (complementation) and purple gene in the purple nucleus, and the other indicates lack of growth in minimal medium way around. The logic of complementation is (lack of complementation). The diagonal entries captured© Jones in the &ancient Bartlett nursery Learning, rhyme, “JackLLC are all , which reflects© Jones the fact & Bartlettthat two copies Learning, LLC SpratNOT could FOReat no SALEfat / His ORwife DISTRIBUTIONcould eat no lean of the identical mutationNOT FOR cannot SALE show ORcomple- DISTRIBUTION / And so between the two of them / They licked mentation. The pattern of and signs in the the platter clean,” because each partner makes matrix indicate that mutations x1 and x5 fail to up for the defect in the other. complement one another; hence x1 and x5 are Part B in Figure 1.14 shows a heterokaryon mutations in the same gene. Likewise, mutations © Jones &formed Bartlett between Learning, mutants LLC with defects in the x2©, x3 Jones, x4, and & x6 Bartlett fail to complement Learning, one LLCanother NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.4 Genetic Analysis 19

26105_CH01_001_038.indd 19 4/18/11 2:25 PM (A) Heterokaryon formation (B) Heterokaryon formation © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE ORMutant DISTRIBUTION 1 MutantNOT 2 FOR SALE OR DISTRIBUTIONMutant 3

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC Each multinucleate cell Each multinucleate cell NOTwith a FORred nucleus SALE has OR DISTRIBUTIONwith a purple nucleus has NOT FOR SALE OR DISTRIBUTION mutant form of red mutant form of purple enzyme and a normal enzyme and a normal form of purple enzyme. form of red enzyme. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Heterokaryons Heterokaryons of red and purple© Jones & Bartlett Learning, LLC © Jonesof & two Bartlett different Learning, LLC mutants have a purple mutants normal form of NOT FOR SALE OR DISTRIBUTION NOT FORhave SALE two differen OR tDISTRIBUTION each enzyme (as mutant forms of well as a mutant the purple enzyme form of each (as well as normal enzyme). forms of the red © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning,enzyme). LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC Complementation No complementation NOT FOR SALE OR DISTRIBUTION(mutations in different genes) NOT FOR SALE(mutations OR inDISTRIBUTION same gene)

FIGURE 1.14 Molecular interpretation of a complementation test using heterokaryons to determine whether two mutant strains have mutations in© different Jones genes & (A) Bartlett or mutations Learning, in the same gene LLC (B). In (A) each nucleus contributes© Jonesa nonmutant & form Bartlett of one or Learning,the other polypeptide LLC chain,NOT and FOR so the SALEheterokaryon OR is ableDISTRIBUTION to grow in minimal medium. In (B) both nuclei NOTcontribute FOR a mutant SALE form of OR the same DISTRIBUTION polypeptide chain; hence, no nonmutant form of that polypeptide can be synthesized and the heterokaryon is unable to grow in minimal medium.

20 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 20 4/18/11 2:25 PM in all pairwise combinations; hence x2, x3, x4, and © AJones plus sign & in Bartlett the complementation Learning, LLCThis connecting line means © Jones x6& areBartlett all mutations Learning, in the LLCsame gene, but a dif- matrix means that the indicated that x1 and x5 fail to complement NOT FORferent SALE gene OR from DISTRIBUTION that represented by x1 and x5. NOTmutations FOR do SALE complement OR oneDISTRIBUTION one another; they are different Data in a complementation matrix conve- another. mutant forms of one gene. niently can be analyzed by arranging the mutant x1 x2 x3 x4 x5 x6 (B) genes in the form of a circle as shown in FIG- (A) _ _ x1 URE 1.15B. Then, for each possible pair of mutations, x1 + + + + © Jones & Bartlett Learning, LLC_ _ © Jones & Bartlett Learning, LLC connect the pair by a straight line if the mutations x2 _ + _ x6 x2 fail to complement (NOT signs in FOR part A).SALE According OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION _ _ _ to the principle of complementation, these lines x3 + connect mutations that are in the same gene. Each _ _ x4 + x3 of the groups of noncomplementing mutations is x5 A minus sign in the x5 _ + called a complementation group. As we have x4 seen,© each Jones complementation & Bartlett Learning, group defines LLC a complementation © Jones & Bartlett Learning, LLC matrix means that the x6 _ gene,NOT so the FOR complementation SALE OR testDISTRIBUTION actually pro- indicated mutations NOT FOR SALEThese ORconnecting DISTRIBUTION lines mean that x2, vides the geneticist's operational definition: do not complement x3, x4, and x6 fail to complement one one another. another in any pairwise combination; A gene is defined experimentally as a set of they are mutant forms of a different gene. mutations that make up a single complemen- FIGURE 1.15 A method for interpreting the results of complementation tests. (A) Results of © Jones & Bartletttation group. Learning, Any pair of LLC mutations within a complementation© Jones tests. & (B)Bartlett To interpret Learning, the results, arrange LLC the mutations in a circle. Connect complementation group fail to complement by a straight line any pair of mutations that fail to complement—that is, that yield a mutant NOT FOR SALEone another. OR DISTRIBUTION heterokaryon.NOT AnyFOR pair SALEof mutations OR connected DISTRIBUTION by a straight line are mutations in the same gene, and are more than likely mutations at different nucleotide sites in the gene. This example The mutations in Figure 1.15 therefore rep- shows two complementation groups, each of which represents a single gene needed for resent two genes, and mutation of any one of arginine biosynthesis. them results in the inability of the strain to convert citrulline to arginine.© Jones On the & assumptionBartlett Learning, LLC © Jones & Bartlett Learning, LLC that one gene encodesNOT one FOR enzyme, SALE which OR is DISTRIBUTIONgenes are, what they do, how they NOTinteract FOR with SALE OR DISTRIBUTION largely true for metabolic enzymes in Neurospora, each other, and in what order they function. the pathway from citrulline to arginine in Fig- Beadle and Tatum themselves analyzed ure 1.13 must comprise two steps with an many metabolic pathways for a wide variety of unknown intermediate in between. This inter- essential nutrients, but their experiments were mediate© Jones was later & found Bartlett to be argininosuccinate.Learning, LLC especially important© Jonesin deciphering & Bartlett pathways Learning, of LLC Likewise,NOT Class FOR I mutants SALE definedOR DISTRIBUTION three comple- amino acid biosynthesis.NOT FORTheir findingsSALE overOR justDISTRIBUTION mentation groups and hence there are three a few years are said to have “contributed more enzymatic steps from the precursor to ornithine. knowledge of amino acid biosynthetic pathways These intermediates also were soon identified. than had been accumulated during decades of Finally, Class II mutations all failed to comple- traditional study.” They were awarded the 1958 © Jones &ment Bartlett one another, Learning, and the LLC finding of only one Nobel© Jones Prize in& Physiology Bartlett Learning,or Medicine forLLC their NOT FORcomplementation SALE OR DISTRIBUTION group means that there is but research,NOT FOR and SALEin the intervening OR DISTRIBUTION years at least a single enzymatic step that converts ornithine to five more Nobel Prizes in Physiology or Medi- citrulline. cine were awarded in which genetic analysis carried out along the lines of Beadle and Tatum Other Applications of Genetic Analysis played a significant role. Here is a list, with quo- The type of genetic© Jonesanalysis & pioneered Bartlett by Learning, tations LLC from the official citations ©of Jonesthe Nobel & Bartlett Learning, LLC Beadle and Tatum is NOTimmensely FOR powerfulSALE OR for DISTRIBUTIONFoundation: NOT FOR SALE OR DISTRIBUTION identifying the genetic control of complex bio- • 1958: George Beadle and Edward Tatum logical processes. Their approach lays out a sys- “for their discovery that genes act by tematic path, a cookbook if you will, for gene regulating definite chemical events,” discovery. First, decide what process you want shared with Joshua Lederberg “for his to study.© Jones Next figure& Bartlett out what Learning, characteristics LLC discoveries© concerning Jones & genetic Bartlett recombi- Learning, LLC mutantNOT organisms FOR SALE with a disruptionOR DISTRIBUTION in that pro- nation andNOT the FOR organization SALE OR of DISTRIBUTIONthe cess would display. Then do a mutant screen for genetic material of bacteria” (Chapter 9). mutants showing these characteristics. Carry • 1965: François Jacob, André Lwoff, and out complementation tests to find out how Jacques Monod “for their discoveries many different genes you have identified. concerning genetic control of enzyme © Jones &Finally, Bartlett find Learning,out what the LLC products of those © Jonesand virus & Bartlett synthesis” Learning, (Chapter 11). LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.4 Genetic Analysis 21

26105_CH01_001_038.indd 21 4/18/11 2:25 PM • 1995: Edward B. Lewis, Christiane code for the polypeptide chain of PAH is there- © Jones & Bartlett Learning,Nüsslein-Volhard, LLC and Eric F. Wieschaus© Jones & foreBartlett 452 Learning,3 1356 nucleotide LLC pairs. The entire NOT FOR SALE OR DISTRIBUTION“for their discoveries concerningNOT the FOR SALEgene is veryOR muchDISTRIBUTION longer—about 90,000 nucle- genetic control of early embryonic devel- otide pairs. Only 1.5 percent of the gene is opment” (Chapter 13). devoted to coding for the amino acids. The non- • 2001: Leland H. Hartwell, Tim Hunt, and coding part includes some sequences that con- Sir Paul Nurse “for their discoveries of trol the activity of the gene, but it is not known ©key Jones regulators & Bartlett of the cell Learning, cycle” (Chap LLC how much of the gene© Jones is involved & Bartlett in regulation. Learning, LLC NOTter 15). FOR SALE OR DISTRIBUTION There are 20 differentNOT FOR amino SALE acids. OR Only DISTRIBUTION • 2002: Sydney Brenner, H. Robert Hor- four bases code for these 20 amino acids, with vitz, and John E. Sulston “for their dis- each “word” in the genetic code consisting of coveries concerning genetic regulation three adjacent bases. For example, the base of organ development and programmed sequence ATG specifies the amino acid methio- © Jones & Bartlettcell death” Learning, (Chapter LLC13). nine© Jones(Met), TCC & Bartlett specifies Learning, serine (Ser), LLC ACT NOT FOR SALE• 2007: OR Mario DISTRIBUTION R. Capecchi, Martin J. specifiesNOT FORthreonine SALE (Thr), OR and DISTRIBUTION GCG specifies Evans, and Oliver Smithies “for their alanine (Ala). There are 64 possible three-base discoveries of principles for introducing combinations but only 20 amino acids because specific gene modifications in mice by some combinations specify the same amino the use of embryonic stem cells” (Chap- acid. For example, TCT, TCC, TCA, TCG, AGT, © Jones & Bartlett Learning,ter 12).LLC © Jones & andBartlett AGC allLearning, code for serineLLC (Ser), and CTT, NOT FOR SALE OR DISTRIBUTIONThe Beadle and Tatum experimentsNOT estab- FOR SALECTC, CTA, OR CTG, DISTRIBUTION TTA, and TTG all code for leu- lished that a defective enzyme results from a cine (Leu). An example of the relationship mutant gene, but how? For all they knew, genes between the nucleotide sequence in a DNA were enzymes. This would have been a logical duplex and the amino acid sequence of the hypothesis at the time. We now know that the corresponding protein is shown in FIGURE 1.16. relationship© Jones between & Bartlett genes andLearning, enzymes LLC is This particular DNA© Jones duplex & is Bartlett the human Learning, LLC somewhatNOT indirect. FOR SALEWith a fewOR exceptions, DISTRIBUTION each sequence that codesNOT for theFOR first SALE seven ORamino DISTRIBUTION enzyme is encoded in a particular sequence of acids in the polypeptide chain of PAH. nucleotides present in a region of DNA. The The scheme outlined in Figure 1.16 indi- DNA region that codes for the enzyme, as well cates that DNA codes for protein not directly but as adjacent regions that regulate when and in indirectly through the processes of transcription © Joneswhich & Bartlett cells the Learning, enzyme is produced,LLC make up and© translation Jones &. TheBartlett indirect Learning, route of informa- LLC NOT FORthe SALE “gene” OR that DISTRIBUTION encodes the enzyme. Next we tionNOT transfer, FOR SALE OR DISTRIBUTION turn to the issue of how genes code for enzymes DNA Ǟ RNA Ǟ Protein and other proteins. is known as the central dogma of molecular genetics. The term dogma means “set of beliefs”; © Jones & Bartlett Learning,1.5 Gene LLC Expression: The Central© Jones & Bartlett Learning, LLC Dogma it dates from the time the idea was put forward NOT FOR SALE OR DISTRIBUTION NOT FOR SALEfirst as ORa theory. DISTRIBUTION Since then the “dogma” has Watson and Crick were correct in proposing been confirmed experimentally, but the term that the genetic information in DNA is con- persists. The central dogma is shown in FIG- tained in the sequence of bases in a manner URE 1.17. The main concept in the central dogma analogous to letters printed on a strip of paper. is that DNA does not code for protein directly In a region© Jones of DNA & that Bartlett directs Learning, the synthesis LLC of but rather acts through© Jones an intermediary & Bartlett mole- Learning, LLC a protein,NOT the FOR genetic SALE code OR for DISTRIBUTIONthe protein is cule of ribonucleicNOT acid (RNA)FOR SALE. The structure OR DISTRIBUTION contained in only one strand, and it is decoded of RNA is similar to, but not identical with, that in a linear order. A typical protein is made up of of DNA. There is a difference in the sugar (RNA one or more polypeptide chains; each polypep- contains the sugar ribose instead of deoxyri- tide chain consists of a linear sequence of bose), RNA is usually single-stranded (not a © Jonesamino & Bartlett acids connected Learning, end toLLC end. For example, duplex),© Jones and RNA& Bartlett contains Learning, the base uracil LLC (U) NOT FORthe SALE enzyme OR PAH DISTRIBUTION consists of four identical poly- insteadNOT ofFOR thymine SALE (T), OR which DISTRIBUTION is present in peptide chains, each 452 amino acids in length. DNA. Actually, three types of RNA take part in In the decoding of DNA, each successive “code the synthesis of proteins: word” in the DNA specifies the next amino acid • A molecule of messenger RNA to be added to the polypeptide chain as it is (mRNA), which carries the genetic © Jones & Bartlett Learning,being made. LLC The amount of DNA required© Jones to & Bartlettinformation Learning, from LLC DNA and is used as a NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

22 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 22 4/18/11 2:25 PM template for polypeptide synthesis. In © Jones & Bartlettmost mRNALearning, molecules, LLC there is a high Nucleotide© Jones sequence & BartlettATGTCCACTGCG Learning, LLCGTCCTGGAA NOT FOR SALEproportion OR DISTRIBUTION of nucleotides that actually inNOT DNA moleculeFOR SALE ORTACAGGTGACGCCAGGACCTT DISTRIBUTION code for amino acids. For example, the mRNA for PAH is 2400 nucleotides in length and codes for a polypeptide of TRANSCRIPTION 452 amino acids; in this case, more than 50 percent of ©the Jones length &of Bartlettthe mRNA Learning, LLC © Jones & Bartlett Learning, LLC codes for aminoNOT acids. FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION • Four types of ribosomal RNA (rRNA), Two-step decoding An RNA intermediate which are major constituents of the cel- process synthesizes plays the role of a polypeptide. lular particles called ribosomes on which ”messenger“ polypeptide synthesis takes place. •© AJones set of about & Bartlett 45 transfer Learning, RNA (tRNA) LLC © Jones & Bartlett Learning, LLC NOTmolecules, FOR SALEeach of ORwhich DISTRIBUTION carries a par- NOT FOR SALE OR DISTRIBUTION ticular amino acid as well as a three-base TRANSLATION recognition region that base-pairs with a group of three adjacent bases in the Amino acid sequence mRNA. As each tRNA participates in © Jones & Bartlett Learning, LLC in© polypeptide Jones & chain BartlettMet Learning,Ser Thr LLCAla Val Leu Glu translation, its amino acid becomes the ATGTCCACTGCGGTCCTGGAA NOT FOR SALEterminal OR DISTRIBUTION subunit added to the length of NOT FOR SALE OR DISTRIBUTION the growing polypeptide chain. A tRNA DNA triplets encoding each amino acid that carries methionine is denoted FIGURE 1.16 DNA sequence coding for the first seven amino acids in a Met polypeptide chain. The DNA sequence specifies the amino acid sequence tRNA , one that carries serine is denoted through a molecule of RNA that serves as an intermediary “messenger.” Ser tRNA , and so© forth. Jones (Because & Bartlett there are Learning, Although LLC the decoding process is indirect, the© net Jones result is that& eachBartlett amino Learning, LLC more than 20 different tRNAs but only acid in the polypeptide chain is specified by a group of three adjacent bases in 20 amino acids,NOT some FOR amino SALE acids ORcor- DISTRIBUTIONthe DNA. In this example, the polypeptide chainNOT is that FOR of phenylalanine SALE OR DISTRIBUTION hydroxylase (PAH). respond to more than one tRNA.) The central dogma is the fundamental principle of molecular genetics because it summa- rizes how the genetic information in DNA © Jones & Bartlett Learning, LLC © JonesDNA & Bartlett Learning, LLC becomes expressed in the amino acid sequence in a polypeptideNOT FOR chain: SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

The sequence of nucleotides in a gene speci- TRANSCRIPTION fies the sequence of nucleotides in a molecule of messenger RNA; in turn, the sequence of © Jones & Bartlettnucleotides Learning, in the messenger LLC RNA specifies the © Jones & Bartlett Learning, LLC sequence of amino acids in the polypeptide NOT FOR SALE OR DISTRIBUTION NOTrRNA FOR SALE ORmRNA DISTRIBUTION tRNA chain. (ribosomal) (messenger) (transfer) Given a process as conceptually simple as DNA coding for protein, what might account for the additional complexity of RNA intermediar- Ribosome ies? One possible reason© Jones is that an& BartlettRNA inter- Learning, LLC © Jones & Bartlett Learning, LLC mediate gives anotherNOT level FOR for SALEcontrol, OR for DISTRIBUTION NOT FOR SALE OR DISTRIBUTION example, by degrading the mRNA for an unneeded protein. Another possible reason may TRANSLATION be historical. RNA structure is unique in having both an informational content present in its © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC sequence of bases and a complex, folded three- Protein dimensionalNOT FOR structure SALE that OR endows DISTRIBUTION some RNA NOT FOR SALE OR DISTRIBUTION molecules with catalytic activities. Many scien- FIGURE 1.17 The “central dogma” of molecular genetics: DNA codes for tists believe that in the earliest forms of life, RNA, and RNA codes for protein. The DNA Ǟ RNA step is transcription, RNA served both for genetic information and and the RNA Ǟ protein step is translation. catalysis. As evolution proceeded, the informa- © Jones &tional Bartlett role was Learning, transferred LLC to DNA and the © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.5 Gene Expression: The Central Dogma 23

26105_CH01_001_038.indd 23 4/18/11 2:25 PM catalytic role to protein. However, RNA became Transcription © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning,locked into LLCits central location as a go-between The manner in which genetic information is NOT FOR SALE OR DISTRIBUTIONin the processes of information transfer andNOT pro- FOR SALEtransferred OR fromDISTRIBUTION DNA to RNA is shown in FIG- tein synthesis. This hypothesis implies that the URE 1.18. The DNA opens up, and one of the participation of RNA in protein synthesis is a strands is used as a template for the synthesis of a relic of the earliest stages of evolution—a complementary strand of RNA. (How the tem- “molecular fossil.” The hypothesis is supported © Jones & Bartlett Learning, LLC plate strand is chosen© isJones discussed & inBartlett Chapter 10.)Learning, LLC by a variety of observations. For example, The process of making an RNA strand from a (1) DNANOT replication FOR SALE requires OR an DISTRIBUTIONRNA molecule DNA template is transcriptionNOT FOR SALE, and the OR RNA DISTRIBUTION in order to get started (Chapter 6), (2) an RNA molecule that is made is the transcript. The base mole cule is essential in the synthesis of the tips se quence in the RNA is complementary (in the of the chromosomes (Chapter 7), and (3) some Watson–Crick pairing sense) to that in the DNA RNA molecules act to catalyze key reactions in © Jones & Bartlett Learning, LLC template,© Jones except & Bartlettthat U (which Learning, pairs with LLC A) is protein synthesis (Chapter 10). present in the RNA in place of T. The rules of base NOT FOR SALE OR DISTRIBUTION pairingNOT between FOR SALE DNA and OR RNA DISTRIBUTION are summarized in FIGURE 1.19. Each RNA strand has a polarity—a 3’ 5’ 5n end and a 3n end—and, as in the synthesis of TA DNA, nucleotides are added only to the 3n end of n © Jones & Bartlett Learning, LLC CG © Jones & aBartlett growing RNALearning, strand. Hence,LLC the 5 end of the AT RNA transcript is synthesized first, and transcrip- NOT FOR SALE OR DISTRIBUTION NOT FOR SALEtion proceeds OR DISTRIBUTION along the template DNA strand in n n CG the 3 -to-5 direction. Each gene includes nucleo- CG tide sequences that initiate and terminate transcription. The RNA transcript made from any GC gene begins at the initiation site in the template © Jones & BartlettT A Learning, LLC © Jones & Bartlett Learning, LLC strand, which is located “upstream” from the NOT FOR SALE OR DISTRIBUTION amino acid–coding region,NOT FOR and ends SALE at the OR termi- DISTRIBUTION CG nation site, which is located “downstream” from T A the amino acid–coding region. For any gene, the CG length of the RNA transcript is very much smaller TA © Jones & Bartlett Learning, LLC than© theJones length & of Bartlett the DNA Learning,in the chromosome. LLC Direction of For example, the transcript of the PAH gene for DNA strandNOT FOR SALE ORTA DISTRIBUTION NOT FOR SALE OR DISTRIBUTION growth of phenyl alanine hydroxylase is about 90,000 being transcribed A T RNA strand nucleotides in length, but the DNA in chromo- A T some 12 is about 130,000,000 nucleotide pairs. C 3’ G In this case, the length of the PAH transcript is less CG G than 0.1 percent of the length of the DNA in the © Jones & Bartlett Learning, LLC C © Jones & chromosome.Bartlett Learning, A different LLC gene in chromosome G C A NOT FOR SALE OR DISTRIBUTION NOT FOR SALE12 would OR be DISTRIBUTION transcribed from a different region T A of the DNA molecule in chromo some 12, and RNA transcript C perhaps from the opposite strand, but the tran- CG T scribed region would again be small in compari- * U A CG© Jones & Bartlett Learning,C LLC son with the total© length Jones of the& Bartlett DNA in Learning,the LLC * UA chromosome. NOT FOR SALE ORT DISTRIBUTION NOT FOR SALE OR DISTRIBUTION G T A A A U T 5’ Base in DNA template * Adenine Thymine Guanine Cytosine 3’ 5’ © Jones & Bartlett Learning, LLC © AJones & BartlettT Learning,G LLCC U in RNA pairs U A C G NOTwith FOR A in DNA SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

FIGURE 1.18 Transcription is the production of an RNA strand that is complementary Uracil Adenine Cytosine Guanine in base sequence to a DNA strand. In this example, the DNA strand at the bottom is Base in RNA transcript being transcribed into a strand of RNA. Note that in an RNA molecule, the base U FIGURE 1.19 Pairing between bases in DNA and in RNA. (uracil) plays the role of T (thymine) in that it pairs with A (adenine). Each AȕU pair is The DNA bases A, T, G, and C pair with the RNA bases U, A, © Jonesmarked. & Bartlett Learning, LLC © Jones & C,Bartlett and G, respectively. Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

24 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 24 4/18/11 2:25 PM Translation to the other in steps, three nucleotides at a time © Jones & Bartlett Learning, LLC © Jones & BartlettThe synthesis Learning, of a polypeptide LLC under the (codon by codon). As each new codon comes NOT FORdirection SALE ORof an DISTRIBUTION mRNA molecule is known as intoNOT place, FOR the SALE next tRNA OR bindsDISTRIBUTION with the ribo- translation. Although the sequence of bases in some. Then the growing end of the polypeptide the mRNA codes for the sequence of amino acids chain becomes attached to the amino acid on the in a polypeptide, the molecules that actually do tRNA. In this way, each tRNA in turn serves tem- porarily to hold the polypeptide chain as it is the “translating” are ©the Jones tRNA molecules. & Bartlett The Learning, LLC © Jones & Bartlett Learning, LLC mRNA molecule is translated in nonoverlapping being synthesized. As the polypeptide chain is groups of three basesNOT called FOR codons SALE. For OReach DISTRIBUTIONtransferred from each tRNA to theNOT next inFOR line, SALE OR DISTRIBUTION codon in the mRNA that specifies an amino acid, the tRNA that previously held the polypeptide is there is one tRNA molecule containing a comple- released from the ribosome. The polypeptide mentary group of three adjacent bases that can chain elongates one amino acid at each step until any one of three particular codons specifying pair with© Jones the codon. & Bartlett The correct Learning, amino acid LLC is © Jones & Bartlett Learning, LLC attached to one end of the tRNA, and when the “stop” is encountered. At this point, synthesis of tRNANOT comes FOR into line, SALE the aminoOR DISTRIBUTION acid to which it the chain of aminoNOT acids isFOR finished, SALE and theOR poly- DISTRIBUTION is attached becomes the most recent addition to peptide chain is released from the ribosome. (This the growing end of the polypeptide chain. brief description of translation glosses over many The role of tRNA in translation is illustrated of the details that are presented in Chapter 10.) © Jones &in FIGUREBartlett 1.20 andLearning, can be described LLC as follows: © JonesThe Genetic & BartlettCode Learning, LLC NOT FOR SALEThe mRNA OR DISTRIBUTIONis read codon by codon. Each NOTFigure FOR 1.20 SALE indicates OR that DISTRIBUTION the mRNA codon codon that specifies an amino acid matches AUG specifies methionine (Met) in the poly- with a complementary group of three adjacent peptide chain, UCC specifies Ser (serine), ACU bases in a single tRNA molecule. One end specifies Thr (threonine), and so on. The com- of the tRNA is attached to the correct amino plete decoding table is called the genetic code, acid, so the correct amino acid is brought © Jones & Bartlett Learning,and it LLCis shown in TABLE 1.1. For any© codon,Jones the & Bartlett Learning, LLC into line. NOT FOR SALE OR DISTRIBUTIONcolumn on the left correspondsNOT to the FOR first SALE OR DISTRIBUTION The tRNA molecules used in translation do nucleotide in the codon (reading from the 5n not line up along the mRNA simultaneously as end), the row across the top corresponds to the shown in Figure 1.20. The process of translation second nucleotide, and the column on the right takes place on a ribosome, which combines with corresponds to the third nucleotide. The com- a single© JonesmRNA and & Bartlettmoves along Learning, it from one LLC end plete codon is given© Jones in the body& Bartlett of the table,Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

The coding sequence of bases in mRNA specifies Messenger the amino acid sequence RNA (mRNA) © Jones & Bartlett Learning, LLC © Jones &of Bartletta polypeptide Learning, chain. LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Bases A UGU CCACUGCGGUCCUGGAA Each group of three

in the U AC [ adjacent bases is a codon. A GG mRNA UGA CGC CAG The mRNA is translated Transfer © Jones & BartlettGAC Learning, LLC codon by codon by means© Jones & Bartlett Learning, LLC CUU RNA of tRNA molecules. MetNOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION (tRNA) Ser Thr Each tRNA has a different Ala Val base sequence but about Leu the same overall shape. © Jones & Bartlett Learning, LLC Glu © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION EachNOT tRNA FORcarries SALEan OR DISTRIBUTION amino acid to be added to the polypeptide chain.

FIGURE 1.20 The role of messenger RNA in translation is to carry the information contained in a sequence of DNA bases to a ribosome, where it is translated into a polypeptide chain. Translation is mediated by transfer RNA (tRNA) molecules, each of © Jones &which Bartlett can base-pair Learning, with a group LLCof three adjacent bases in the mRNA.© Each Jones tRNA also & Bartlettcarries an amino Learning, acid. As each LLC tRNA, in turn, is brought to the ribosome, the growing polypeptide chain is elongated. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.5 Gene Expression: The Central Dogma 25

26105_CH01_001_038.indd 25 4/18/11 2:25 PM © JonesTable & 1.1BartlettThe standard Learning, genetic LLCcode © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION Second nucleotideNOT in FOR codon SALE OR DISTRIBUTION UC A G UUU Phe F Phenylalanine UCU Ser S Serine UAU Tyr Y Tyrosine UGU Cys C Cysteine U UUC Phe F Phenylalanine UCC Ser S Serine UAC Tyr Y Tyrosine UGC Cys C Cysteine C U © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC UUA Leu L Leucine UCA Ser S Serine UAA Termination UGA Termination A

NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTIONThird nucleotide in codon (3' end) UUG Leu L Leucine UCG Ser S Serine UAG Termination UGG Trp W Tryptophan G CUU Leu L Leucine CCU Pro P Proline CAU His H Histidine CGU Arg R Arginine U CUC Leu L Leucine CCC Pro P Proline CAC His H Histidine CGC Arg R Arginine C C CUA© LeuJones L Leucine & Bartlett CCALearning, Pro P LLCProline CAA Gln Q ©Glutamine Jones & BartlettCGA Arg Learning, R Arginine LLCA CUGNOT Leu FOR L Leucine SALE ORCCG DISTRIBUTION Pro P Proline CAG Gln Q NOTGlutamine FOR SALECGG ArgOR RDISTRIBUTIONArginine G AUU Ile I Isoleucine ACU Thr T Threonine AAU Asn N Asparagine AGU Ser S Serine U AUC Ile I Isoleucine ACC Thr T Threonine AAC Asn N Asparagine AGC Ser S Serine C A AUA Ile I Isoleucine ACA Thr T Threonine AAA Lys K Lysine AGA Arg R Arginine A

© JonesFirst nucleotide in codon (5' end) &AUG Bartlett Met MLearning,Methionine LLCACG Thr T Threonine AAG© Jones Lys & K BartlettLysine Learning,AGG ArgLLC R Arginine G NOT FORGUU SALE Val OR V DISTRIBUTIONValine GCU Ala A Alanine GAUNOT AspFOR DSALEAspartic OR acid DISTRIBUTIONGGU Gly G Glycine U GUC Val V Valine GCC Ala A Alanine GAC Asp D Aspartic acid GGC Gly G Glycine C G GUA Val V Valine GCA Ala A Alanine GAA Glu E Glutamic acid GGA Gly G Glycine A GUG Val V Valine GCG Ala A Alanine GAG Glu E Glutamic acid GGG Gly G Glycine G © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC Codon Three-letter and single-letter abbreviations NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

along with the amino acid (or translational complete.) In most organisms, the Met © Jones“stop”) & Bartlett that the Learning, codon specifies. LLC Each amino © JonestRNA & used Bartlett for initiation Learning, of translation LLC acid is designated by its full name and by a is the same tRNAMet used to specify NOT FORthree- SALE letter OR abbreviation DISTRIBUTION as well as a single- NOTmethio FOR nine SALE at internal OR DISTRIBUTION positions in a poly- letter abbreviation. Both types of abbreviations peptide chain. are used in molecular genetics. The code in • The codons UAA, UAG, and UGA are Table 1.1 is the “standard” genetic code used in each a “stop” that specifies the termina- translation in the cells of nearly all organisms. tion of translation and results in release © Jones & Bartlett Learning,In Chapter LLC10 we examine general features© Jones of & Bartlettof the Learning, completed LLCpolypeptide chain from NOT FOR SALE OR DISTRIBUTIONthe standard genetic code and the minorNOT differ- FOR SALE theOR ribosome. DISTRIBUTION These codons do not have ences found in the genetic codes of certain tRNA molecules that recognize them but organisms and cellular organelles. At this point, are instead recognized by protein factors we are interested mainly in understanding how that terminate translation. the genetic code is used to translate the codons How the genetic code table is used to infer in mRNA© Jones into the & amino Bartlett acids Learning,in a polypeptide LLC the amino acid sequence© Jones of a polypeptide & Bartlett chain Learning, LLC chain.NOT FOR SALE OR DISTRIBUTION can be illustrated byNOT using FOR PAH SALE again, inOR par- DISTRIBUTION In addition to the 61 codons that code only ticular the DNA sequence coding for amino for amino acids, there are four codons that have acids 1 through 7. The DNA sequence is specialized functions: • The codon AUG, which specifies Met 5-ATGTCCACTGCGGTCCTGGAA-3 © Jones & Bartlett(methionine), Learning, is also LLCthe “start” codon for © Jones3-TACAGGTGACGCCAGGACCTT-5 & Bartlett Learning, LLC NOT FOR SALEpolypeptide OR DISTRIBUTION synthesis. The positioning of NOT FOR SALE OR DISTRIBUTION a tRNAMet bound to AUG is one of the first This region is transcribed into RNA in a left-to- steps in the initiation of polypeptide syn- right direction, and because RNA grows by the thesis, so all polypeptide chains begin addition of successive nucleotides to the 3 end with Met. (Many polypeptides have the (Figure 1.18), it is the bottom strand that is © Jones & Bartlett Learning,initial LLC Met cleaved off after translation© Jones is & transcribed.Bartlett Learning, The nucleotide LLC sequence of the NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

26 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 26 4/18/11 2:25 PM © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION THE WOMEN IN THE WEDDING photograph are sisters. Both have two copies of the same mutant PAH gene. The bride is the younger of the two. She was diagnosed just three days after birth and put on the PKU diet soon after. Her older sister, the maid of honor, was diagnosed too late to begin the diet and is mentally retarded. The two-year old pictured in the photo at the right is the daughter of the married couple. They planned the pregnancy: dietary control was strict from conception to delivery to avoid the hazards of excess phenylalanine harming the fetus. Their daughter has passed all developmental milestones with distinction. © Jones &[Courtesy Bartlett of Charles Learning, R. Scriver, Montreal LLC Children’s Hospital Research ©Institute, Jones McGill & University.] Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION RNA is that of the top strand of the DNA, except Codon number that U replaces T, so the mRNA for amino acids in PAH gene 1 through 7 is 1234567 5-AUGUCCACUGCGGUCCUGGAA-3© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION A TGTCCANOTCTGCG FORGTCCTGGAA SALE OR DISTRIBUTION The codons are read from left to right according DNA TACAGGTGACGCCAGGACCTT to the genetic code shown in Table 1.1. Codon AUG codes for Met (methionine), UCC codes for TRANSCRIPTION Ser (serine), and so on. Altogether, the amino acid sequence© Jones of &this Bartlett region of Learning, the polypeptide LLC is ©mRNA JonesA UG &U CCACBartlettUGCG Learning,GUCCUGGAA LLC U AC NOT5-AUG FOR UCC SALE ACU GCG OR GUC DISTRIBUTION CUG G A A-3 NOT FORA SALEGG OR DISTRIBUTION UGA Met Ser Thr Ala Val Leu Glu CGC TRANSLATION CAG or, in terms of the single-letter abbreviations, GAC CUU 5-AUG UCC ACU GCG GUC CUG G A A-3 Met Ser © Jones & BartlettM Learning,S T A LLCV L E © Jones & Bartlett Learning,Thr LLC NOT FOR SALE OR DISTRIBUTION NOT FORPolypeptide SALE OR DISTRIBUTIONAla The full decoding operation for this region of Val Leu the PAH gene is shown in FIGURE 1.21. In this fig- Amino acid number Glu ure, the initiation codon AUG is highlighted in PAH polypeptide 1234567 because some patients with PKU have a mutation in this particular codon. As might be FIGURE 1.21 The central dogma in action. The DNA that encodes PAH serves © Jones & Bartlett Learning,as a template LLC for the production of a messenger© RNA,Jones and the& mRNABartlett serves Learning,to LLC expected from the factNOT that AUG FOR is theSALE initiation OR DISTRIBUTIONspecify the sequence of amino acids in the PAHNOT polypeptide FOR chain SALE through OR DISTRIBUTION codon for polypeptide synthesis, cells in patients interactions with the ribosome and tRNA molecules. The total number of amino with this particular mutation fail to produce any acids in the PAH polypeptide chain is 452, but only the first 7 are shown. of the PAH polypeptide. Mutation and its consequences are considered next. DNA. The change may be simple, such as the © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC Mutation substitution of one pair of bases in a duplex mol- 1.6NOT FOR SALE OR DISTRIBUTION ecule for a differentNOT pair ofFOR bases. SALE For example, OR DISTRIBUTION a The term mutation refers to any heritable CȕG pair in a duplex molecule may mutate to change in a gene (or, more generally, in the TȕA, AȕT, or GȕC. The change in nucleotide genetic material) or to the process by which such sequence may also be more complex, such as the deletion or addition of base pairs. These and © Jones &a changeBartlett takes Learning, place. One LLC type of mutation © Jones & Bartlett Learning, LLC results in a change in the sequence of bases in other types of mutations are considered in NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.6 Mutation 27

26105_CH01_001_038.indd 27 4/18/11 2:25 PM Chapter 7. Geneticists also use the term mutant, for V (valine). Although the M1V mutant is © Jones & Bartlett Learning,which refers LLC to the result of a mutation. ©A muta-Jones & quiteBartlett rare Learning,worldwide, LLCit is common in some NOT FOR SALE OR DISTRIBUTIONtion yields a mutant gene, which in turnNOT pro- FOR SALElocalities, OR such DISTRIBUTION as Québec Province in Canada. duces a mutant mRNA, a mutant protein, and One PAH mutant that is quite common is finally a mutant organism that exhibits the designated R408W, which means that codon effects of the mutation—for example, an inborn 408 in the PAH polypeptide chain has been error of metabolism. changed from one coding for arginine (R) to one DNA© Jones from patients & Bartlett from all Learning, over the world LLC coding for tryptophan© Jones(W). This & mutation Bartlett is oneLearning, LLC who haveNOT phenylketonuria FOR SALE OR has beenDISTRIBUTION studied to of the four most commonNOT FOR among SALE European OR DISTRIBUTION determine what types of mutations are respon- Caucasians with PKU. The molecular basis of sible for the inborn error. There are a large vari- the mutant is shown in FIGURE 1.23. In this case, ety of mutant types. More than 400 different the first base pair in codon 408 is changed from mutations have been described in the gene for a CȕG base pair into a TȕA base pair. The result © JonesPAH. & Bartlett In some Learning,cases part of theLLC gene is missing, is that© Jones the PAH & mRNABartlett has Learning, a mutant codon LLC at NOT FORso theSALE genetic OR information DISTRIBUTION to make a complete positionNOT 408;FOR specifically, SALE OR it has DISTRIBUTION UGG instead of PAH enzyme is absent. In other cases the genetic CGG. Translation does occur in this mutant defect is more subtle, but the result is still either because everything else about the mRNA is nor- the failure to produce a PAH protein or the pro- mal, but the result is that the mutant PAH car- duction of a PAH protein that is inactive. In the ries a tryptophan (Trp) instead of an arginine © Jones & Bartlett Learning,mutation shown LLC in FIGURE 1.22, substitution© Jones of a & (Arg)Bartlett at position Learning, 408 in LLC the polypeptide chain. NOT FOR SALE OR DISTRIBUTIONGȕC base pair for the normal AȕT baseNOT pair atFOR SALEThe consequence OR DISTRIBUTION of the seemingly minor the very first position in the coding sequence change of one amino acid is very drastic. changes the normal codon AUG (Met) used for Although the R408W polypeptide is complete, the initiation of translation into the codon GUG, the enzyme has less than 3 percent of the activ- which normally specifies valine (Val) and can- ity of the normal enzyme. not be© used Jones as a “start” & Bartlett codon. TheLearning, result is thatLLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION translation of the PAH mRNA cannot occur, and Genes and Environment so no PAH polypeptide is made. This mutant is 1.7 designated M1V because the codon for M Inborn errors of metabolism illustrate the gen- (methionine) at amino acid position 1 in the eral principle that genes code for proteins and PAH polypeptide has been changed to a codon that mutant genes code for mutant proteins. In © Jones & Bartlett Learning, LLC cases© Jonessuch as PKU,& Bartlett mutant Learning,proteins cause LLC such NOT FOR SALE OR DISTRIBUTION a drasticNOT FORchange SALE in metabolism OR DISTRIBUTION that a severe genetic defect results. But biology is not neces- A G Codon 1 in Mutation of T C sarily destiny. Organisms are also affected by the PAH gene environment. PKU serves as an example of this principle, because patients who adhere to a diet 1234567 © Jones & Bartlett Learning, LLC © Jones & restrictedBartlett Learning,in the amount LLC of phenyl alanine NOT FOR SALE OR DISTRIBUTION NOT FOR SALEdevelop OR mental DISTRIBUTION capacities within the normal G TGTCCACTGCGGTCCTGGAA DNA C ACAGGTGACGCCAGGACCTT range. What is true in this example is true in general. Most traits are determined by the inter- action of genes and environment. Mutant initiation codon TRANSCRIPTION It is also true that most traits are affected by © Jonesin PAH & mRNA Bartlett Learning, LLC multiple genes. No one© Jones knows how& Bartlett many genes Learning, LLC NOT FOR SALE OR DISTRIBUTION are involved in the developmentNOT FOR andSALE maturation OR DISTRIBUTION mRNA G UGUCCACUGCGGUCCUGGAA of the brain and nervous system, but the number CAC must be in the thousands. This number is in addition to the genes that are required in all cells to carry out metabolism and other basic life func- TRANSLATION tRNAVal © Jones & Bartlett Learning, LLC tions.© Jones It is easy & to Bartlett lose sight Learning,of the multiplicity LLC of NOT FORX SALENo PAHOR polypeptideDISTRIBUTION is produced genesNOT when FOR considering SALE ORextreme DISTRIBUTION examples, such because tRNAVal cannot be used Val as PKU, in which a single mutation can have such to initiate polypeptide synthesis. a drastic effect on mental development. The situ- FIGURE 1.22 The M1V mutant in the PAH gene. The methionine codon needed for ation is the same as that with any complex initiation mutates into a codon for valine. Translation cannot be initiated, and no PAH machine. An airplane can function properly pro- © Jonespolypeptide & Bartlett is produced. Learning, LLC © Jones & videdBartlett that Learning,thousands of LLC parts work together in NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

28 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 28 4/18/11 2:25 PM Mutation of C T Codon 408 in © Jones & Bartlett Learning, LLC G ©A Jones & Bartlett Learning, LLC PAH gene NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 408

G CCACAATAC CT T GGCCCTTCTCAGTTCGC DNA CGGTGTTATG GA ACCGGGAAGAGTCAAGCG © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC TRANSCRIPTIONNOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

mRNA G CCACAAUACCU UGGCCCUUC UCAGUUCGC C GG U GU UAU Mutant codon © Jones & Bartlett Learning, LLC GGA ©in PAHJones mRNA & Bartlett Learning, LLC TRANSLATION ACC NOT FOR SALE OR DISTRIBUTION GGG NOT FOR SALE OR DISTRIBUTION AAG Ala AGU Thr CAA Ile GCG Polypeptide Pro Trp Pro © Jones & Bartlett Learning, LLC Mutant amino acid © Jones &Phe Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALESer OR DISTRIBUTION in PAH polypeptide Val Arg FIGURE 1.23 The R408W mutant in the PAH gene. Codon 408 for arginine (R) is mutated into a codon for tryptophan (W). The result is that position 408 in the mutant PAH polypeptide is occupied by tryptophan rather than by arginine. The mutant protein has only a low level of PAH enzyme activity. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC harmony, but only oneNOT defective FOR part, SALE if that OR part DISTRIBUTIONnot known, the traits wouldNOT seem FOR com- SALE OR DISTRIBUTION affects a vital system, can bring it down. Likewise, pletely unrelated. PKU is not unusual in the development and functioning of every trait this regard. Many mutant genes affect require a large number of genes working in har- multiple traits through their secondary mony, but in some cases a single mutant gene can or indirect effects. The various, some- have© catastrophic Jones & consequences. Bartlett Learning, LLC times seemingly© Jones unrelated, & Bartlett effects Learning, of LLC InNOT other FOR words, SALE the relationship OR DISTRIBUTION between a a mutant NOTgene areFOR called SALE pleiotropic OR DISTRIBUTION gene and a trait is not necessarily a simple one. effects, and the phenomenon itself is The biochemistry of organisms is a complex known as pleiotropy. FIGURE 1.24 shows branching network in which different enzymes a cat with white fur and blue eyes, a may share substrates, yield the same products, pattern of pigmentation that is often © Jones &or Bartlettbe responsive Learning, to the sameLLC regulatory ele- © Jones(about & 40Bartlett percent Learning, of the time) LLC asso- NOT FORments. SALE The OR result DISTRIBUTION is that most visible traits of NOTciated FOR withSALE deafness. OR DISTRIBUTION Hence deafness organisms are the net result of many genes act- can be regarded as a pleiotropic effect ing together and in combination with environ- of white coat and blue eye color. The mental factors. PKU affords examples of each of developmental basis of this pleiotropy is three principles governing these interactions: unknown. 1. One gene can affect© Jones more than& Bartlett one trait Learning,. 2. LLCAny trait can be affected by© moreJones than & Bartlett Learning, LLC Children withNOT extreme FOR forms SALE of ORPKU DISTRIBUTIONone gene. We discussed thisNOT principle FOR SALE OR DISTRIBUTION often have blond hair and reduced body earlier in connection with the large pigment. This is because the absence of number of genes that are required for PAH is a metabolic block that prevents the normal development and function- conversion of phenylalanine into tyro- ing of the brain and nervous system. © sine,Jones which & Bartlettis the precursor Learning, of the LLC pig- Among these© Jones are genes & Bartlettthat affect Learning, the LLC NOTment FOR melanin. SALE The OR relationship DISTRIBUTION between function ofNOT the FOR blood–brain SALE ORbarrier, DISTRIBUTION severe mental retardation and decreased which consists of specialized glial cells pigmentation in PKU makes sense only wrapped tightly around capillary walls if one knows the metabolic connec- in the brain, forming an impediment to tions among phenylalanine, tyrosine, the passage of most water-soluble mol- © Jones & Bartlettand melanin. Learning, If these LLC connections were © Jonesecules & from Bartlett the blood Learning, to the brain. LLC The NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.7 Genes and Environment 29

26105_CH01_001_038.indd 29 4/18/11 2:25 PM example. The metabolic pathway is illus- © Jones & Bartlett Learning, LLC © Jones & Bartletttrated Learning, in Figure LLC 1.10. Four enzymes NOT FOR SALE OR DISTRIBUTION NOT FOR SALE inOR the DISTRIBUTION pathway are indicated, but even more enzymes are involved at the stage labeled “further breakdown.” Because differences in the activity of any of these enzymes can affect the rate at which © Jones & Bartlett Learning, LLC phenylalanine© Jonescan be broken & Bartlett down andLearning, LLC NOT FOR SALE OR DISTRIBUTION excreted, all NOTof the FORenzymes SALE in the OR path- DISTRIBUTION way are important in determining the amount of excess phenylalanine in the blood of patients with PKU. 3. Most traits are affected by environmen- © Jones & Bartlett Learning, LLC © Jonestal factors & Bartlett as well as Learning, by genes. Here LLC we NOT FORFIGURE SALE 1.24 AmongOR DISTRIBUTIONcats with white fur and blue eyes, about NOTcome FOR back SALE to theOR low-phenylalanineDISTRIBUTION 40 percent are born deaf. The reason is that pigment cells diet. Children with PKU are not doomed derived from the neural crest migrate to various tissues to severe mental deficiency. Their capa- including hair follicles, the eyes, and the middle ear, where their function is essential for hearing. Defective pigment cells bilities can be brought into the normal resulting in white fur and blue eyes can, therefore, lead to range by dietary treatment. PKU serves © Jones & Bartlett Learning,deafness, which LLC may be regarded as a pleiotropic effect© Jones of & Bartlettas an Learning, example of LLC what motivates genet- NOT FOR SALE OR DISTRIBUTIONwhite fur and blue eyes. [© Ronen/ShutterStock, Inc.]NOT FOR SALE icistsOR DISTRIBUTIONto try to discover the molecular basis of inherited disease. The hope is blood–brain barrier therefore affects the that knowing the metabolic basis of the extent to which excess free phenyl- disease will eventually make it possible alanine in the blood can enter the brain to develop methods for clinical inter- ©itself. Jones Because & Bartlett the effectiveness Learning, of LLCthe © Jones & Bartlett Learning, LLC vention through diet, medication, or blood–brain barrier differs among indi- NOT FOR SALE OR DISTRIBUTION other treatmentsNOT FORthat will SALE ameliorate OR DISTRIBUTION viduals, PKU patients with very similar the severity of the disease. levels of blood phenylalanine can have dramatically different levels of cognitive development. This also explains in part 1.8 The Molecular Unity of Life © Jones & Bartlettwhy adherence Learning, to a LLC controlled-phenyl- The© pathway Jones for & theBartlett breakdown Learning, and excretion LLC of NOT FOR SALEalanine OR dietDISTRIBUTION is critically important in phenylalanineNOT FOR is SALE by no means OR DISTRIBUTION unique to human children but less so in adults; the blood– beings. One of the remarkable generalizations to brain barrier is less well developed in have emerged from molecular genetics is that children and is therefore less effective in blocking the excess phenylalanine. © Jones & Bartlett Learning, MultipleLLC genes affect even ©simpler Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONmetabolic traits. PhenylalanineNOT break- FOR SALE OR DISTRIBUTION down and excretion serve as a convenient

MEMBRANE-BOUND MITOCHONDRIA, similar in form and function, are present in both plant (left) and animal (right) cells. Despite the fact that these cells come from two very different organisms, their similarities speak to a fundamental unity of life. Taking up much of each cell is the nucleus, where the genetic material resides. [(left) Dr. Jeremy Burgess/Science Photo Library/Photo © Jones & Bartlett Learning,Researchers, Inc.LLC (right) Dr. Gopal Murti/Science Photo© Jones Library/Photo & BartlettResearchers, Learning, Inc.] LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

30 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 30 4/18/11 2:25 PM organisms that are very distinct—for example, extreme environments, such as hot © Jones plants& Bartlett and animals—share Learning, manyLLC features in their © Jonessprings & Bartlettor high Learning,salt concentrations. LLC NOT FORgenetics SALE and OR biochemistry. DISTRIBUTION These similarities indi- NOTThey FOR are SALE widely OR distributed DISTRIBUTION in more cate a fundamental “unity of life”: normal environments as well. Superfi- cially resembling bacteria, the cells of All creatures on Earth share many features of the genetic apparatus, including genetic archaeans show important differences in the manner in which their mem- information encoded© inJones the sequence & Bartlett of bases Learning, LLC © Jones & Bartlett Learning, LLC in DNA, transcription into RNA, and transla- brane lipids are chemically linked. The tion into protein onNOT ribosomes FOR with SALE the use OR DISTRIBUTIONmachinery for DNA replicationNOT FOR and SALE OR DISTRIBUTION of transfer RNAs. All creatures also share transcription in archaeans resembles certain characteristics in their biochemistry, that of eukaryans, whereas their metab- including many enzymes and other proteins olism strongly resembles that of bac- that are similar in amino acid sequence, three- teria. DNA sequence analysis indicates dimensional© Jones structure,& Bartlett and function.Learning, LLC that about ©half Jones of the & genesBartlett found Learning, in LLC NOT FOR SALE OR DISTRIBUTION the kingdomNOT Archaea FOR are SALE unique OR to thisDISTRIBUTION Prokaryotes and Eukaryotes group. Organisms share a common set of similar 3. Eukarya This group includes all organ- genes and proteins because they evolved by isms whose cells contain an elabo- descent from a common ancestor. The process rate network of internal membranes, a © Jones &of evolutionBartlett Learning, takes place whenLLC a population of © Jonesmembrane-bounded & Bartlett Learning, nucleus, and LLC mito- NOT FORorganisms SALE OR gradually DISTRIBUTION changes in genetic compo- NOTchondria. FOR SALE Their OR DNA DISTRIBUTION is present in the sition through time. Evolutionary changes in form of linear molecules organized into genes and proteins result in differences in true chromosomes, and cell division metabolism, development, and behavior among takes place by means of mitosis (dis- organisms, which allows them to become pro- cussed in Chapter 4). The eukaryotes gressively better adapted© Jones to their environments.& Bartlett Learning, LLCinclude plants and animals© asJones well as& Bartlett Learning, LLC From an evolutionaryNOT perspective, FOR SALE the unity OR of DISTRIBUTIONfungi and many single-celledNOT organ-FOR SALE OR DISTRIBUTION fundamental molecular processes in organisms isms, such as amoebae and ciliated alive today reflects inheritance from a distant protozoa. common ancestor in which the molecular The members of the groups Bacteria and mechanisms were already in place. Archaea are often grouped together into a larger Not© Jones only the & unityBartlett of life Learning, but also many LLC assemblage called ©prokaryotes Jones & ,Bartlett which literally Learning, LLC otherNOT features FOR of living SALE organisms OR DISTRIBUTION become com- means “before [theNOT evolution FOR of]SALE the nucleus.” OR DISTRIBUTION prehensible from an evolutionary perspective. This terminology is convenient for designating For example, the interposition of an RNA inter- prokaryotes as a group in contrast with eukary- mediate in the basic flow of genetic information otes, which literally means “good [well-formed] from DNA to RNA to protein makes sense if the nucleus.” © Jones &earliest Bartlett forms Learning, of life used RNALLC for both genetic © Jones & Bartlett Learning, LLC NOT FORinformation SALE OR and DISTRIBUTION enzyme catalysis. The impor- NOTThe FOROrigin ofSALE Life on OR Earth DISTRIBUTION tance of the evolutionary perspective in under- The core cellular processes of bacteria and standing aspects of biology that seem pointless archaeans are quite similar. Both use double- or needlessly complex is summed up in a stranded DNA as their genetic material, tran- famous aphorism of the evolutionary biologist scribe DNA into messenger RNA, and use the Theodosius Dobzhansky:© Jones “Nothing & Bartlett in biology Learning, messenger LLC RNA to specify the ©amino Jones acid & Bartlett Learning, LLC makes sense except inNOT the light FOR of evolution.”SALE OR DISTRIBUTIONsequence in proteins by means NOTof the FOR same SALE OR DISTRIBUTION Biologists distinguish three major kingdoms genetic code. Likewise, most of their metabolic of organisms: pathways for the synthesis or breakdown of 1. Bacteria This group includes most bac- small molecules are similar. These resemblances teria and cyanobacteria (formerly called imply that bacteria and archaeans most likely © blue-greenJones & algae).Bartlett Cells Learning, of these organ- LLC shared a common© ancestor. Jones Because& Bartlett one ofLearning, the LLC NOTisms FOR lack a SALEmembrane-bounded OR DISTRIBUTION nucleus key differences betweenNOT FOR the SALEgroups isOR in DISTRIBUTIONthe and mitochondria, are surrounded by a chemistry of their membrane lipids, it seems cell wall, and divide by binary fission. likely that bacteria and archaeans shared a com- 2. Archaea This group was initially dis- mon ancestor prior to the time that life became covered among microorganisms that cellularized by the synthesis of a surrounding © Jones & Bartlettproduce Learning, methane LLCgas or that live in membrane.© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.8 The Molecular Unity of Life 31

26105_CH01_001_038.indd 31 4/18/11 2:25 PM The common ancestor of bacteria and photosynthesis. The absence of free oxygen © Jones & Bartlett Learning,archaea (and LLC eukaryotes as well) has a name.© Jones It & meansBartlett that Learning, the atmosphere LLC was reducing, and NOT FOR SALE OR DISTRIBUTIONis called LUCA, which stands for last universalNOT FOR SALEthe ready OR availability DISTRIBUTION of electrons was conducive common ancestor. Where did LUCA come from? to forming chemical bonds. In the early 1950s, Some scientists have speculated that it might Stanley Miller and Harold Urey prepared an have come from another planet by way of con- apparatus that simulated lighting (electrical taminated space debris such as an asteroid. But sparks) acting on an atmosphere of hydrogen, if LUCA© lackedJones a membrane,& Bartlett then Learning, it must have LLC methane, and ammonia© Jones in the presence& Bartlett of liquid Learning, LLC been aNOT fragile FOR creature, SALE and OR seems DISTRIBUTION more likely water and demonstratedNOT FORthe creation SALE of OR many DISTRIBUTION to have been homegrown from natural chemi- small organic molecules including the amino cal and physical processes. acids alanine, glycine, valine, serine, phenylala- About 9 billion years after the universe came nine, aspartic acid, and glutamic acid. These into being, planet Earth was formed through the results supported earlier speculation that life © Jonesaggregation & Bartlett of smallLearning, particles LLC of ice and dust that, originally© Jones arose & in Bartlett a sort of rich Learning, broth of accumu- LLC NOT FORas itSALE grew larger, OR DISTRIBUTION was able to attract larger bodies lated,NOT spontaneously FOR SALE synthesized, OR DISTRIBUTION small organic through gravitational attraction. This was about molecules. The central role of RNA in extant life 4.5 billion years ago, and in FIGURE 1.25 the origin has given rise to the view that the very earliest of Earth is shown as the 0 point of a 24-hour forms of life depended on RNA for both informa- clock ending now. Each second of this virtual tion storage and enzyme catalysis, and that later © Jones & Bartlett Learning,clock corresponds LLC to about 50 thousand© years Jones of & inBartlett evolution, Learning, as LUCA gradually LLC came into being, NOT FOR SALE OR DISTRIBUTIONreal time. The newborn planet is thoughtNOT to have FOR SALEthe informational OR DISTRIBUTION role of RNA was taken over by cooled rather quickly and acquired an atmo- DNA and most of the catalytic role by proteins. sphere of gases such as hydrogen, methane, car- A popular current hypothesis is that life on bon dioxide, ammonia, and nitrogen escaping Earth may have originated in microscopic porous from volcanoes, with liquid water added by col- chambers within giant carbonate spires reaching lisions ©with Jones icy asteroids. & Bartlett Missing Learning, from the list LLC of as high as 10-story ©buildings Jones formed & Bartlett at alkaline Learning, LLC early atmosphericNOT FOR gasesSALE is freeOR oxygen,DISTRIBUTION which hydrothermal vents NOTnear mid-ocean FOR SALE ridges OR where DISTRIBUTION came much later with the evolution of the sea floor spreads and sea water swoops down and accumulates minerals before heating up and rising again (FIGURE 1.26). These tiny Modern humans carbonate chambers are coated with Nonbird dinosaur extinction © Jones & Bartlett HomoLearning,Neandertal LLC extinction © Jonesa &thin Bartlett layer of metalLearning, sulfide LLCthat in Flowering plants NOT FOR SALE OR DISTRIBUTION NOT FORthe SALEreducing OR environment DISTRIBUTION can serve Birds NOW as catalyst to promote chemical reac- Mammals EARTH’S ORIGIN (4.5 billion years ago) tions among the chemicals in the Reptiles Midnight Time 0 Amphibians water moving through. The cham- Land plants bers act to concentrate the reaction © Jones & BartlettVertebrates Learning,10 PMLLC 2 AM© Jones & Bartlett Learning,products and LLC to partially isolate one NOT FOR SALEArthropods OR DISTRIBUTION NOT FOR SALE OR chamberDISTRIBUTION from the next. Membranes Animals Prokaryotes were not needed as separators until 8 PM 4 AM after all of the basic cellular processes had evolved, but their evolution allowed the earliest cells to become Multicellular © Jones & Bartlett Learning, LLC free living.© Jones & Bartlett Learning, LLC organisms NOT FOR SALE OR DISTRIBUTION HoweverNOT FOR and SALEwherever OR life DISTRIBUTION 6 PM 6 AM In this 24-hour time clock originated, biologists know some- representing the history of thing about its chronology. The first life on Earth, each second evidence of prokaryotes is in the corresponds to approxi- form of fossilized biofilms dating © Jones &4 Bartlett PM mately Learning, 50,000 years. LLC 8 AM © Jonesback & Bartlett 3.8 billion Learning, years. LLCIn the NOT FOR SALE OR DISTRIBUTION PhotosynthesisNOT FOR24-hour SALE virtual OR clockDISTRIBUTION in Figure 1.25, the time is about 3:45 AM. The earli- 2 PM 10 AM est fossils of photosynthetic bacteria Noon (cyanobacteria) date to 3 billion Eukaryotes year ago, which in our clock is 8:00 FIGURE 1.25 Timing of major events in life history calibrated according to a 24-hour clock beginning © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning,AM. At around LLC this time the NOT FORwith SALE the formation OR ofDISTRIBUTION Earth 4.5 billion years ago. NOT FOR SALE OR DISTRIBUTION

32 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 32 4/18/11 2:25 PM atmosphere began to change as photosynthetic recorded human history? In our clock it is a mere © Jones organisms& Bartlett took Learning, up carbon dioxide LLC and water and snap© Jones of the fingers: & Bartlett one-tenth Learning, of a second! LLC NOT FORreleased SALE free OR oxygen. DISTRIBUTION Eukaryotes do not appear NOT FOR SALE OR DISTRIBUTION in the fossil record until about 2 billion years ago, Genomes and Proteomes about 1:20 PM in our clock. Eukaryotes appear to The totality of DNA in a cell, nucleus, or have originated as a fusion between an archaean organelle is called its genome. When used with cell and a bacterial cell. The archaean genome reference to a species of organism, for example, eventually evolved into© the Jones nucleus, & andBartlett the bac- Learning,in phrases LLC such as “the human genome,”© Jones the & Bartlett Learning, LLC terial genome into theNOT mitochondria, FOR SALE although OR DISTRIBUTIONterm genome is defined as the DNANOT present FOR in a SALE OR DISTRIBUTION most of the bacterial genes were eventually normal reproductive cell. transferred to the nucleus. (More on organelles Modern methods for sequencing DNA dis- in Chapter 16.) Evidence for multicellular organ- cussed in Chapter 6 are so rapid and efficient isms dates to 1 billion years (6:40 PM in our that the complete DNA sequence is known for clock),© Jonesand photosynthetic & Bartlett plantsLearning, eventually LLC hundreds of different© Jones species & Bartlettof organisms. Learning, LLC aroseNOT by incorporating FOR SALE a OR cyanobacteria DISTRIBUTION that These include theNOT genomes FOR of SALEmultiple OR repre- DISTRIBUTION became the chloroplast. And so life goes on. The sentatives of all of the groups of organisms in hour before midnight in the virtual clock includes Figure 1.25, including Neandertals (sequenced the rise of birds (from dinosaur ancestors), the from DNA extracted from fossil bones). TABLE 1.2 proliferation of flowering plants, the extinction shows a small sample of sequenced genomes. © Jones &of Bartlettthe dinosaurs, Learning, the debut LLC of the genus Homo Genome© Jones size &is givenBartlett in megabases Learning, (Mb), LLC or mil- NOT FORthat SALE includes OR our DISTRIBUTION species about 2.5 million years lionsNOT of baseFOR pairs. SALE The ORgenome DISTRIBUTION of the bacterium ago (48 seconds before midnight on the clock), Hemophilus influenzae, like that of most bacteria, anatomically modern humans (3.8 seconds is very compact in that most of it codes for pro- before midnight), and the extinction of our near- teins. A high density of genes, relative to the est relative the Neandertal (0.5 seconds before amount of DNA, is also found in the budding midnight). (Neandertals© Jones are not & Bartlettcompletely Learning, yeast, LLCthe nematode worm, the fruit© fly,Jones and the & Bartlett Learning, LLC extinct, as we shall seeNOT in Chapter FOR 19, SALE as they OR left DISTRIBUTIONdiminutive flowering plant ArabidopsisNOT thaliana FOR .SALE OR DISTRIBUTION some of their genes in the genome of humans The human genome, by contrast, contains large alive today). What about the 5 thousand years of amounts of noncoding DNA. Comparison with the nematode is illuminating. Whereas the human genome is about 30 times larger than © Jones & Bartlett Learning, LLC that of the worm,© the Jones number & Bartlettof genes is Learning, less LLC NOT FOR SALE OR DISTRIBUTION than 2 times larger.NOT This FORdiscrepancy SALE reflects OR DISTRIBUTIONthe fact that only about 1.5 percent of the human genome sequence codes for protein. (About 27 percent of the human genome is present in genes, but much of the DNA sequence present © Jones & Bartlett Learning, LLC in© genes Jones is not & protein-coding.)Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOTThe FORcomplete SALE set of OR proteins DISTRIBUTION encoded in the genome is known as the proteome. In less complex genomes, such as the yeast, worm, and fruit fly, the number of proteins in an organism’s proteome is approximately the same as the number of © Jones & Bartlett Learning,genes. LLCHowever, as we shall see in© Chapter Jones 11, & Bartlett Learning, LLC FPONOT FOR SALE OR DISTRIBUTIONsome genes encode two or more proteinsNOT through FOR SALE OR DISTRIBUTION a process called alternative splicing in which seg- ments of the original RNA transcript are joined together in a variety of combinations to produce different messenger RNAs. Alternative splicing is © Jones & Bartlett Learning, LLC especially prevalent© in Jones the human & Bartlettgenome. At Learning, least LLC NOT FOR SALE OR DISTRIBUTION one third of humanNOT genes, FOR and possibly SALE as OR many DISTRIBUTION as two thirds, undergo alternative splicing, and among the genes that undergo alternative splicing, the FIGURE 1.26 The core chemical processes of life may have originated among millions of tiny chambers in giant number of different messenger RNAs per gene carbonate spires like this, which are formed from hydrother- ranges from 2 to 7. Hence, with its seemingly lim- © Jones &mal Bartlett vents near mid-ocean Learning, ridges. LLC ited© repertoireJones & of Bartlett25,000 genes, Learning, the human LLC genome NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

1.8 The Molecular Unity of Life 33

26105_CH01_001_038.indd 33 4/18/11 2:25 PM © JonesTable & Bartlett 1.2 The Learning, standard genetic LLC code © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALENumber OR of distinct DISTRIBUTION proteins Genome size, Mba Number of genes in proteomeb (approximate) Shared protein Organism (approximate) (approximate) families Hemophilus influenzae 1.9 1700 1400 (causes bacterial meningitis)© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC Saccharomyces cerevisiae 13 6000 4400 (budding yeast) NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 3000 Caenorhabditis elegans 100 20,000 9500 } (soil nematode) 5000 Drosophila melanogaster 120c 16,000 8000 } (fruit fly)© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC } 7000d Mus musculusNOT FOR(laboratory SALE OR DISTRIBUTION2500 25,000 NOT FOR10,000 SALE OR DISTRIBUTION mouse) 9900f Homo sapiens (human being) 2900e 25,000 10,000 } aMillions of base pairs. bExcludes “families” of proteins with similar sequences (and hence related functions). © Jones cExcludes& Bartlett 60 Mb ofLearning, specialized DNA LLC (“heterochromatin”) that has a very© lowJones content &of genes.Bartlett Learning, LLC dBased on similarity with sequences in messenger RNA (mRNA). NOT FOReFor SALE convenience, OR thisDISTRIBUTION estimate is rounded to 3000 Mb elsewhere in thisNOT book. FOR SALE OR DISTRIBUTION fBased on the observation that only about 1% of mouse genes lack a similar gene in the human genome, and vice versa.

can create approximately 60,000–90,000 different this tabulation, each family of related proteins is mRNAs.© TheJones widespread & Bartlett use of alternative Learning, splicing LLC counted only once, in© order Jones to estimate & Bartlett the number Learning, LLC to multiplyNOT the FOR coding SALE capacity OR ofDISTRIBUTION genes is one of proteins in the proteomeNOT thatFOR are SALE “distinct” OR in the DISTRIBUTION source of human genetic complexity. sense that their sequences are dissimilar. In yeast, Most eukaryotic organisms contain families worms, and flies, the number of distinct proteins is of related proteins that can be grouped according approximately 4400, 9500, and 8000, respectively. to similarities in their amino acid sequence. The brackets in Table 1.2 indicate the number of © JonesThese & Bartlett families Learning, exist because LLC the evolution of a distinct© Jones proteins & Bartlettthat share Learning,sequence similarity LLC NOT FORnew SALE gene functionOR DISTRIBUTION is typically preceded by the betweenNOT FORspecies. SALE From OR these DISTRIBUTION comparisons, it duplication of an already existing gene, followed appears that most multicellular animals share by changes in nucleotide sequence in one of the 5,000–10,000 proteins that are similar in sequence copies that gives rise to the new function. The and function. Approximately 3000 of these are new function is usually similar to the previous shared with eukaryotes as distantly related as yeast, © Jones & Bartlett Learning,one (for example, LLC a change in the substrate© Jonesspec- & andBartlett approximately Learning, 1000 LLCwith prokaryotes as dis- NOT FOR SALE OR DISTRIBUTIONificity of a transporter protein), so that NOTthe new FOR SALEtantly related OR DISTRIBUTION as bacteria. What these comparisons protein retains enough similarity in amino acid among proteomes imply is that biological systems sequence to the original that their common are based on protein components numbering in the ancestry can be recognized. thousands. This is a challenging level of complexity The molecular unity of life can be seen in the to understand, but the challenge is much less intim- similarity© Jones of proteins & Bartlett in the proteome Learning, among LLC idating than it appeared© Jones to be at& an Bartlett earlier time Learning, LLC diverseNOT types ofFOR organisms. SALE Such OR comparisonsDISTRIBUTION are when human cells NOTwere thought FOR SALE to produce OR asDISTRIBUTION shown in the right-hand column in Table 1.2. In many as a million different proteins.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Inherited traits are affected by DNA replicates to form copies of and other proteins are made in genes. itself that are identical (except for cells. Genes are composed of the chem- rare mutations). DNA occasionally mutates, and ical deoxyribonucleic acid (DNA). DNA contains a genetic code the mutant forms specify altered © Jones & Bartlett Learning, LLC specifying what© Jones types of & enzymes Bartlett Learning,proteins that LLC have reduced NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTIONactivity or stability.

34 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 34 4/18/11 2:25 PM © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALEA mutant OR enzyme DISTRIBUTION is an “inborn Traits are affectedNOT by FOR environ- SALE OR DISTRIBUTIONThe molecular unity of life is seen error of metabolism” that blocks ment as well as by genes. in comparisons of genomes and one step in a biochemical path- All living organisms share certain proteomes. way for the metabolism of small features of cellular physiology molecules. © Jones & Bartlettand metabolismLearning, owing LLC to descent © Jones & Bartlett Learning, LLC from common ancestors. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

What were the key experiments showing that What three types of RNA participate in Explain why many mutant forms of DNA© is Jonesthe genetic & material? Bartlett Learning,protein LLC synthesis, and what is the role ©of Jonesphenylalanine & Bartlett hydroxylase Learning, have a simple LLC How did understanding the molecular each type of RNA? amino acid replacement, yet the mutant structureNOT of FORDNA give SALE clues to itsOR ability DISTRIBUTION to What is the “genetic code,” and how isNOT it FORpolypeptide SALE chains OR are DISTRIBUTION absent or present in replicate, to code for proteins, and to relevant to the translation of a polypeptide very small amounts. undergo mutation? chain from a molecule of messenger RNA? What is a pleiotropic effect of a gene Why is the pairing of complementary bases What is an inborn error of metabolism? How mutation? Give an example. a key feature of DNA replication? did this concept serve as a bridge between What are some of the major differences in © Jones & WhatBartlett is the process Learning, of transcription LLC and in genetics and biochemistry?© Jones & Bartlett Learning,cellular organization LLC among Bacteria, NOT FOR SALEwhat ways OR does DISTRIBUTIONit differ from DNA How does the “centralNOT dogma” FOR explain SALE OR DISTRIBUTIONArchaea, and Eukarya? replication? Garrod’s discovery that nonfunctional enzymes result from mutant genes?

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC In the humanNOT gene FOR for the SALE protein OR huntingtin DISTRIBUTION Given the RNA sequenceNOT FOR coding SALE for partOR ofDISTRIBUTION (so named because it is associated with Huntington dis- human huntingtin deduced in Problem 2, what is the ease), the first 21 nucleotides in the amino-acid-coding amino acid sequence in this part of huntingtin? region are Answer The polypeptide chain is translated in successive © Jones3-TACCCACCGTTATAAGAGA & Bartlett Learning,GT-5 LLC groups of three© Jones nucleotides & Bartlett (codons), Learning, starting at 5 LLC end of NOT FOR SALE OR DISTRIBUTION the coding NOTsequence FOR and SALE moving ORin the DISTRIBUTION 5 -to-3 direction. What is the sequence of a partner strand? The amino acid corresponding to each codon can be found in the genetic code table. The first seven amino acids in the Answer The base pairing between the strands is A with T and polypeptide chain are C with G, but it is equally important that the strands in a DNA duplex have opposite polarity. The complementary 5-AUG GGU GGC AAU AUU CUC UCA-3 © Jones &strand Bartlett is therefore Learning, oriented LLCwith its 5’-end at the left. The© Jones & BartlettMet Gly Learning, Gly Asn LLCIle Leu Ser NOT FORbase SALE sequence OR ofDISTRIBUTION the partner strand is NOT FOR SALE OR DISTRIBUTION Suppose that a mutation in the human hunting- 5-ATGGGTGGCAATATTCTCTCA-3 tin gene occurs in the DNA sequence shown in Problem 1. In this mutation, the red G is replaced with a T. What is the If the DNA duplex for huntingtin in Problem 1 nucleotide sequence of this region of the DNA duplex were transcribed from left to right, deduce the base (both strands), and that of the messenger RNA, and what sequence of the RNA in© this Jones coding & region. Bartlett Learning, LLCis amino acid sequence of the© mutant Jones huntingtin? & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Answer To deduce the RNA sequence, we must apply three Answer The DNA, RNA, and polypeptide chain have the concepts. First, the base pairing is such so that an A, T, C sequences as follows, where the differences from the non- and G in DNA template strand is transcribed as U, A, G and mutant gene are in red. The mutation results in stop codon C, respectively, in the RNA. Second, the DNA template and premature termination of huntingtin synthesis. strand and RNA transcript have the opposite polarity. Third© (and Jones critically & Bartlett for this problem), Learning, the RNA LLC strand is DNA (transcribed© Jones &strand) Bartlett Learning, LLC alwaysNOT transcribed FOR SALE in the 5OR-to-3 DISTRIBUTION direction. Because we NOT3-TAC FOR CCA CCGSALE TTA ORTAA DISTRIBUTIONGAG ATT-5 are told that transcription takes place from left to right, we DNA (nontranscribed strand) can deduce that the transcribed strand is that given in 5-ATG GGT GGC AAT ATT CTC TAA-3 Problem 1. The RNA transcript therefore has the base RNA coding region sequence 5-AUG GGU GGC AAU AUU CUC UAA-3 © Jones & Bartlett Learning,5-AUGGGUGGCAAUAUUCUCUCA-3 LLC © JonesPolypeptide & Bartlett chain Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALEMet OR Gly DISTRIBUTION Gly Asn Ile Leu STOP

Guide to Problem Solving 35

26105_CH01_001_038.indd 35 4/18/11 2:25 PM © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR 1.1SALE Classify OR each DISTRIBUTION of the following statements as true orNOT FORare SALE purified OR using DISTRIBUTION a high-speed centrifuge. In one of false. the strands the base composition is 25 percent A, (a) Each gene is responsible for only one visible trait. 18 percent T, 20 percent G, and 37 percent C. What (b) Every trait is potentially affected by many genes. is the base composition of the other strand? (c) The sequence of nucleotides in a gene specifies 1.14 Consider a region along one strand of a double- the sequence© of Jonesamino acids & Bartlettin a protein Learning, encoded LLC stranded DNA molecule© consists Jones of tandem& Bartlett repeats Learning, of LLC by the gene. NOT FOR SALE OR DISTRIBUTIONthe trinucleotide 5-GTA-3NOT, soFOR that theSALE sequence OR DISTRIBUTIONin (d) There is one-to-one correspondence between the this strand is 5-GTAGTAGTAGT…-3 What is the set of codons in the genetic code and the set of sequence in the other strand? (Write the answer with amino acids encoded. the 5 end at the left.) 1.2 From their examination of the structure of DNA, 1.15 If the template strand of a DNA duplex has the sequence ©what Jones were Watson& Bartlett and Crick Learning, able to infer LLC about the 5 -TCAG-3© Jones, what & is Bartlett the sequence Learning, of the RNA LLC tran- probable mechanisms of DNA replication, coding script? (Write the answer with the 5 end at the left.) NOTcapability, FOR and SALE mutation? OR DISTRIBUTION 1.16 If theNOT nontemplate FOR strandSALE of OR a DNA DISTRIBUTION duplex has the 1.3 What does it mean to say that each strand of a duplex sequence 5-ATCAG-3, what is the sequence of the DNA molecule has a polarity? What does it mean to RNA transcript across this region? (Write the answer say that the paired strands in a duplex molecule have with the 5 end at the left). opposite polarity? 1.17 A duplex DNA molecule contains a random sequence © Jones & 1.4 Bartlett What important Learning, observation LLC about S and R strains of© Jones of& the Bartlett four nucleotides Learning, with equalLLC proportions of each. NOT FOR SALEStreptococcus OR DISTRIBUTION pneumoniae prompted Avery, MacLeod,NOT FORWhat SALE is the OR average DISTRIBUTION spacing between consecutive and McCarty to study this organism? occurrences of the sequence 5-ATGC-3? Between 1.5 In the transformation experiments of Avery, consecutive occurrences of the sequence MacLeod, and McCarty, what was the strongest evi- 5-TACGGC-3? dence that the substance responsible for the transfor- 1.18 An RNA molecule folds back upon itself to form a mation was DNA© rather Jones than & protein? Bartlett Learning, LLC “hairpin”structure held© together Jones by & a Bartlettregion of baseLearning, LLC 1.6 A chemical called phenol (carbolic acid) destroys pro- pairing. One segment of the molecule in the paired teins but not nucleicNOT acids, FOR and SALE strong alkaliOR DISTRIBUTION such as region has the base sequenceNOT 5 FOR-UAUCGUAU-3 SALE OR. What DISTRIBUTION sodium hydroxide destroys both proteins and nucleic is the base sequence with which this segment is paired? acids. In the transformation experiments with Strep- 1.19 A synthetic mRNA molecule consists of the repeating tococcus pneumoniae, what result would be expected if base sequence the S-strain extract had been treated with phenol? If ©it hadJones been &treated Bartlett with strongLearning, alkali? LLC © Jones 5&-AAAAAAAA…-3 Bartlett Learning, LLC 1.7 NOT What featureFOR SALEof the physical OR DISTRIBUTION organization of bacterio- WhenNOT this molecule FOR SALE is translated OR DISTRIBUTION in vitro using ribo- phage T2 made it suitable for use in the Hershey- somes, transfer RNAs, and other necessary constitu- Chase experiments? ents from E. coli, the result is a polypeptide chain 1.8 Like DNA, molecules of RNA contain large amounts consisting of the repeating amino acid Lys – Lys – Lys of phosphorus. When Hershey and Chase grew their - … If you assume that the genetic code is a triplet T2 phage in bacterial cells in the presence of radio- code, what does this result imply about the codon for © Jones & Bartlettactive phosphorus, Learning, the LLC RNA must also have incor-© Jones lysine& Bartlett (Lys)? Learning, LLC NOT FOR SALEporated OR theDISTRIBUTION labeled phosphorus, and yet theNOT 1.20FOR A SALEsynthetic OR mRNA DISTRIBUTION molecule consisting of the repeat- experimental result was not compromised. Why not? ing base sequence 1.9 The DNA extracted from a bacteriophage contains 16 percent A, 16 percent T, 34 percent G, and 34 5 -UUUUUUUUUUUU…-3 percent C. What can you conclude about the struc- is terminated by the addition, to the right-hand end, ture of this DNA molecule?© Jones & Bartlett Learning, LLC of a single nucleotide bearing© Jones A. When & Bartlett translated Learning, in LLC 1.10 The DNA extractedNOT from FOR a bacteriophage SALE OR consists DISTRIBUTION of vitro, the resulting polypeptideNOT FOR consists SALE of a repeating OR DISTRIBUTION 20 percent A, 34 percent T, 35 percent G, and 11 per- sequence of phenylalanines terminated by a single cent C. What is unusual about this DNA? What can leucine. What does this result imply about the codon you conclude about its structure? for leucine? 1.11 A region along a DNA strand that is transcribed con- 1.21 With in vitro translation of an RNA into a polypeptide tains no A. What base will be missing in the corre- © Jones & Bartlett Learning, LLC chain,© the Jones translation & Bartlett can begin Learning, anywhere along LLC the sponding region of the RNA? RNA molecule. A synthetic RNA molecule has the 1.12 NOT If one FOR strand SALE of a DNA OR duplex DISTRIBUTION has the sequence sequenceNOT FOR SALE OR DISTRIBUTION 5-ATCAG-3, what is the sequence of the complementary strand? (Write the answer with the 5 end at 5-CGCUUACCACAUGUCGCGAAC-3 the left.) How many reading frames are possible if this mole- 1.13 Suppose that a double-stranded DNA molecule is cule is translated in vitro? How many reading frames © Jones & Bartlettseparated Learning, into its constituent LLC strands, and the strands© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

36 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 36 4/18/11 2:25 PM © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALEare possible OR DISTRIBUTION if this molecule is translated in vivo, inNOT FOR Mutations SALE ORin complementation DISTRIBUTION which translation starts with the codon AUG? group 1: ______1.22 You have sequenced both strands of a double- Mutations in complementation stranded DNA molecule. To evaluate the potential of group 2: ______this molecule for coding amino acids, you conceptu- Mutations in complementation ally transcribe it ©into Jones RNA and& Bartlett then conceptually Learning, LLC group 3: ______© Jones______& Bartlett Learning, LLC translate the RNANOT into FOR a polypeptide SALE ORchain. DISTRIBUTION How Mutations in complementationNOT FOR SALE OR DISTRIBUTION many reading frames would you have to examine? group 4: ______1.23 A synthetic mRNA molecule consists of the repeating 1.28 A mutant screen is carried out in Neurospora crassa for base sequence mutants that are unable to synthesize an amino acid, that we shall symbolize as G. A number of mutants 5-ACACACACACACAC…-3 © Jones & Bartlett Learning, LLC are isolated© Jones and classified & Bartlett into four Learning, groups according LLC When this molecule is translated in vitro, the result is to their ability to grow (+) or not grow (–) in minimal aNOT polypeptide FOR SALE chain consistingOR DISTRIBUTION of the alternating mediumNOT supplemented FOR SALE with ORpossible DISTRIBUTION precursors D, E, amino acids Thr – His – Thr – His – Thr – His… Why and F. The data are shown in the accompanying table. do the amino acids alternate? What does this result imply about the codons for threonine (Thr) and his- DEFG tidine (His)? Class 1 + + + + © Jones &1.24 Bartlett A synthetic Learning, mRNA molecule LLC consists of the repeating© Jones & Bartlett Learning, LLC Class 2 – – – + NOT FOR SALEbase sequenceOR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Class 3 – – + + 5-AUCAUCAUCAUCAUC…-3 Class 4 + – + + When this molecule is translated in vitro, the result is a mixture of three different polypeptide chains. One Complete the diagram shown below. Each arrow consists of repeating isoleucines (Ile – Ile – Ile – Ile © Jones & Bartlett Learning, LLC indicates one or more biochemical© Jones &reactions. Bartlett Within Learning, LLC …), another of repeating serines (Ser – Ser – Ser – each circle write the class of mutants (1–4) whose Ser…), and the thirdNOT of repeating FOR SALE histidines OR (His DISTRIBUTION – His NOT FOR SALE OR DISTRIBUTION products contribute to the reactions symbolized by – His – His…). What does this result imply about the the arrow, and in the squares write the name of the manner in which an mRNA is translated? amino acid or precursor (D – G) at that position in the 1.25 How is it possible for a gene with a mutation in the pathway. coding region to encode a polypeptide with the same ©amino Jones acid sequence& Bartlett as the Learning, nonmutant LLC gene? © Jones & Bartlett Learning, LLC 1.26 NOT A polymer FOR is madeSALE that OR has DISTRIBUTIONa random sequence con- NOT FOR SALE OR DISTRIBUTION sisting of 75 percent Gs and 25 percent Us. Among the amino acids in the polypeptide chains resulting from in vitro translation, what is the expected fre- quency of Trp? of Val? of Phe? 1.29 The coding sequence in the messenger RNA for 1.27 Results of complementation tests of the six indepen- amino acids 1 through 10 of human phenylalanine © Jones & Bartlettdent recessive Learning, mutations LLC a–f are shown in the accom-© Jones & Bartlett Learning, LLC hydroxylase is NOT FOR SALEpanying OR matrix, DISTRIBUTION where indicates complementationNOT FOR SALE OR DISTRIBUTION and indicates lack of complementation. Classify the 5-AUGUCCACUGCGGUCCUGGAAAACCCAGGC-3 mutations into complementation groups, and write the names of the mutations in each complementation (a) What are the first 10 amino acids? group in the blanks provided below. (Some of the (b) What sequence would result from a mutant RNA blanks may remain© empty.)Jones & Bartlett Learning, LLC in which the red A ©was Jones changed & to Bartlett G? Learning, LLC (c) What sequence would result from a mutant RNA b NOTc FORd e SALEf OR DISTRIBUTION in which the red C NOTwas changed FOR SALEto G? OR DISTRIBUTION (d) What sequence would result from a mutant RNA a ++__+ in which the red U was changed to C? b ++++ (e) What sequence would result from a mutant RNA in which the red G was changed to U? © Jones c& Bartlett+++ Learning, LLC 1.30 A “frameshift”© Jones mutation & Bartlett is a Learning,mutation in LLCwhich NOT FOR SALE OR DISTRIBUTION_ + someNOT number FOR of base SALE pairs, OR other DISTRIBUTION than a multiple d of three, is inserted into or deleted from a coding e + region of DNA. The result is that, at the point of the

Analysis and Applications 37

26105_CH01_001_038.indd 37 4/18/11 2:25 PM © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALEframeshift OR DISTRIBUTION mutation, the reading frame of proteinNOT FOR(a) SALE What isOR the DISTRIBUTION amino acid sequence in this part of translation is shifted with respect to the nonmutant the polypeptide chain? gene. To see the consequence of a frameshift muta- (b) What would be the consequence of a frameshift tion, consider that the coding sequence in the mes- mutation resulting in an RNA missing the red U? senger RNA for the first 10 amino acids in human (c) What would be the consequence of a frameshift beta hemoglobin© (part Jones of the & oxygen Bartlett carrying Learning, pro- LLC mutation resulting© in Jonesan RNA &with Bartlett a G inserted Learning, LLC tein in the blood)NOT is FOR SALE OR DISTRIBUTION immediately in frontNOT of the FOR red U?SALE OR DISTRIBUTION 5-AUG GUG CAC CUG ACU CCU GAG GAG AAG UCU…–3

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION With regard to the wildtype and mutant The 10 mutants in the Challenge Prob- RNA molecules described in Problem 1.30, deduce the lem 2 were tested for complementation in all pairwise base sequence in both strands of the corresponding combinations using heterokaryons. The results are double-stranded DNA for: shown in the matrix, in which + indicates the abil- (a) The wildtype sequence ity of the heterokaryon to grow in minimal medium © Jones & Bartlett(b) The Learning,single-base deletion LLC © Jonesand & Bartlett– indicates Learning,inability to grow LLC in minimal medium. (c) The single-base insertion NOT FOR SALE OR DISTRIBUTION NOT FOR SALE2345678910 OR DISTRIBUTION You are carrying out Beadle-Tatum type Mutant 1 + + – ++++++ experiments to analyze a metabolic pathway in Neu- rospora. You know that the precursor in the pathway 2 ++++++++ is a molecule symbolized as P and that the product is a 3 +++–+++ vitamin symbolized© as Jones Z. You are & sure Bartlett that the Learning, pathway LLC 4© ++++++ Jones & Bartlett Learning, LLC from P to Z is linearNOT and that FOR the moleculesSALE OR W, X,DISTRIBUTION and Y NOT FOR SALE OR DISTRIBUTION are intermediates. However, there may be other inter- 5 +++++ mediates not yet identified. You obtain 10 independent 6 ++++ mutations that cannot grow on minimal medium sup- 7 +++ plemented with P but can grow on minimal medium 8++ supplemented© Jones & withBartlett Z. The Learning, 10 mutants fallLLC into four © Jones & Bartlett Learning, LLC classes that can grow () or cannot grow () on mini- 9– NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION mal medium supplemented with the nutrients W, X, Assume that each complementation group defines a or Y. The data are shown in the accompanying table. different gene, and assume further that each gene PWX Y Z encodes an enzyme that catalyzes a single step in the Class I (mutant 5) ––––+ metabolic pathway, that converts one molecule of substrate into one molecule of product. © Jones &Class Bartlett II (mutants Learning, 1, 3, 4, 6, 7) LLC – ++++© Jones (a)& Bartlett Redraw the Learning, metabolic LLCpathway deduced from NOT FOR ClassSALE III (mutant OR DISTRIBUTION2) –+–++NOT FOR SALEChallenge OR ProblemDISTRIBUTION 2. Use a right arrow to indi- Class IV (mutants 8, 9, 10) – – – + + cate each enzymatic step in the pathway, and label each arrow with the mutant number 1–10 Draw a linear metabolic pathway with P on the left that blocks the enzymatic step. In some cases, and Z on the right in which each of the intermediates you will not be able to specify the order in which W, X, and Y shown© in Jones the order & in Bartlett which they Learning, occur in LLC the enzymes occur© in Jonesthe pathway, & Bartlett so you may Learning, LLC the metabolic pathway in the synthesis of Z from P. write them in any order you wish. NOT FOR SALE OR DISTRIBUTION(b) In the metabolic pathwayNOT FOR above SALE that you OR have DISTRIBUTION deduced from the data, how many UNKNOWN intermediates are there between the precursor P GENETICS on the web and the vitamin Z? GeNETics© Jones on the Web & will Bartlett introduce you Learning, to some of the most LLC important © Jones & Bartlett Learning, LLC sitesNOT for finding FOR genetics SALE information OR on DISTRIBUTIONthe Internet. To explore these NOT FOR SALE OR DISTRIBUTION sites, visit the Jones & Bartlett companion site to accompany Genetics: Analysis of Genes and Genomes, Eighth Edition at http://biology.jbpub .com/book/genetics/8e/.

There you will find a chapter-by-chapter list of highlighted keywords. © Jones &When Bartlett you select Learning,one of the keywords, LLC you will be linked to a Web site © Jones & Bartlett Learning, LLC NOT FOR containingSALE informationOR DISTRIBUTION related to that keyword. NOT FOR SALE OR DISTRIBUTION

38 CHAPTER 1 Genes, Genomes and Genetic Analysis

26105_CH01_001_038.indd 38 4/18/11 2:25 PM