Genes, Genomes and Genetic Analysis

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION UNIT 1 © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FORDefining SALE OR DISTRIBUTION and WorkingNOT FOR SALE OR DISTRIBUTION with Genes © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Chapter 1 Genes, Genomes, and Genetic Analysis Chapter 2 DNA Structure and Genetic Variation

9781284136609_CH01_Hartl.indd 1 08/11/17 8:50 am © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION CHAPTER 1 © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Genes, Genomes, © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC and GeneticNOT FOR SALE OR DISTRIBUTION AnalysisNOT FOR SALE OR DISTRIBUTION CHAPTER OUTLINE © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR1.1 SALE DNA OR DISTRIBUTIONas the Genetic Material NOT FOR SALE OR DISTRIBUTION 1.2 DNA Structure and Replication 1.3 Genes and Proteins © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 1.4 Genetic Analysis NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 1.5 Gene Expression: The Central Dogma 1.6 Mutation and Variation 1.7© JonesGenes & and Bartlett Environment Learning, LLC © Jones & Bartlett Learning, LLC 1.8NOT The FOR Molecular SALE OR Unity DISTRIBUTION of Life NOT FOR SALE OR DISTRIBUTION ROOTS OF DISCOVERY: The Black Urine ROOTS OF DISCOVERY: One Gene, Disease One Enzyme © Jones &Archibald Bartlett E. Learning, Garrod (1908) LLC © JonesGeorge & W. Bartlett Beadle andLearning, Edward LLC L. Tatum (1941) Inborn Errors of Metabolism Genetic Control of Biochemical Reactions in NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Neurospora Medical Images RM/Jane Hurd.

9781284136609_CH01_Hartl.indd 2 08/11/17 8:50 am LEARNING OBJECTIVES & SCIENCE COMPETENCIES © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Once you have understood and can apply the principles of genes, genomes, and genetic analysis discussed in this chapter, you will have acquired the following science competencies: ■■ Given the base sequence of a transcribed strand of protein-coding DNA, specify the sequence of bases in the corresponding region of messenger RNA and the corresponding sequence of amino acids in the protein. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC ■■ ■For a mutation in the DNA in which one base is replaced with another, show how the mRNA and protein will be altered. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

■■ Given a linear metabolic pathway for an essential nutrient, determine which intermediates will restore the ability to grow to mutant strains that are defective for any of the enzymes in the pathway. ■■ Interpret© Jones data & specifying Bartlett whichLearning, intermediates LLC in a linear metabolic© Jonespathway & restore Bartlett the Learning, ability of mutants LLC to grow, so as to determine the order in which the enzymes and the intermediates appear in the pathway. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ■■ Given data on the complementation or lack of complementation among all pairs of a set of mutations affecting a biological process, categorize the mutations into groups, each corresponding to a different gene.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ach species of living organism has a unique set organism to understand their molecular organization, of inherited characteristics that makes it differ- function, interaction, and evolutionary history. The Eent from every other species. Each species has its fundamental concept of genetics and genomics is as own developmental plan—often described as a sort of follows: “blueprint” for building© Jones the organism—which& Bartlett Learning, is LLCInherited traits are determined© Jones by &the Bartlett elements Learning, LLC encoded in the DNA moleculesNOT FOR present SALE in itsOR cells. DISTRIBUTION This of heredity that are transmittedNOT FOR from SALE parents OR to DISTRIBUTION developmental plan determines the characteristics offspring in reproduction; these elements of that are inherited. Because organisms in the same spe- heredity are called genes. cies share the same developmental plan, organisms that are members of the same species usually resemble The existence of genes and the rules governing their one another.© Jones For & example, Bartlett itLearning, is easy to distinguish LLC a transmission© Jones from generation & Bartlett to generation Learning, were LLC first humanNOT being FOR from SALE a chimpanzeeOR DISTRIBUTION or a gorilla. articulatedNOT by Gregor FOR Mendel SALE in OR 1866 DISTRIBUTION (described in the A human being habitually stands upright and has long chapter titled Mendelian Genetics: The Principles of Segrega- legs, relatively little body hair, a large brain, and a flat tion and Assortment). Mendel’s formulation of inheri- face with a prominent nose, jutting chin, distinct lips, tance was stated in terms of the abstract rules by which and small teeth. All of these traits are inherited—part hereditary elements (he called them “factors”) are trans- © Jones &of ourBartlett developmental Learning, plan—and LLC help set us apart as© Jonesmitted & fromBartlett parents Learning, to offspring. LLC His objects of study Homo sapiens NOT FOR SALE OR. DISTRIBUTION NOT wereFOR garden SALE peas, OR with DISTRIBUTION variable traits such as pea color But human beings are by no means identical. Many and plant height. Mendel thus introduced studying traits, or observable characteristics, differ from one per- genetics through analysis of the progeny produced from son to another. In addition to notable differences matings. Genetic differences between species were between males and females, there is a great deal of varia- impossible to define, because organisms of different tion in hair color, eye ©color, Jones skin &color, Bartlett height, Learning, weight, LLCspecies usually do not mate;© ifJones they do & mate, Bartlett they typi Learning,- LLC personality traits, andNOT other FOR characteristics. SALE OR DISTRIBUTION Some cally produce hybrid progenyNOT that FOR die or SALEare sterile. OR The DISTRIBUTION human traits (such as sex) are transmitted biologically, approach to the study of genetics through the analysis others culturally. The color of our eyes results from bio- of the offspring from matings is often referred to as clas- logical inheritance, but the native language we learned sical genetics, or organismic or morphological as a child results from cultural inheritance. Many traits genetics. are influenced© Jones jointly & Bartlett by biological Learning, inheritance LLC and envi- By contrast,© Jones molecular & Bartlett genetics Learning, is the study LLC of the ronmentalNOT FORfactors. SALE For example, OR DISTRIBUTION weight is determined chemical natureNOT FORof genes SALE and their OR products. DISTRIBUTION Advances in part by inheritance but also in part by environment: in this area have made it possible to study gene how much food we eat, its nutritional content, our exer- structure and function, as well as differences between cise regimen, and so forth. species, through the comparison and analysis of the Genetics is the study of biologically inherited traits, DNA itself. Nevertheless, there is no fundamental distinc- © Jones &including Bartlett traits Learning, that are influenced LLC in part by the envi©- Jonestion between & Bartlett classical Learning, and molecular LLC genetics. Rather, the Genomics NOT FORronment. SALE OR DISTRIBUTION is the study of all the genes in anNOT twoFOR are SALE different OR DISTRIBUTION and complementary ways of

9781284136609_CH01_Hartl.indd 3 08/11/17 8:50 am 4 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones studying& Bartlett the Learning,same thing: LLCthe function of the genetic© Jones & Bartlett Learning, LLC NOT FORmaterial. SALE ORThis DISTRIBUTIONtext includes many examples showingNOT FOR SALE OR DISTRIBUTION how molecular and classical genetics can be used in combination to enhance the power of genetic analysis. In the rest of this chapter, we will focus on ground- breaking observations© andJones experiments & Bartlett that Learning,form the LLC © Jones & Bartlett Learning, LLC basis for our current understandingNOT FOR SALE of the structure OR DISTRIBUTION and NOT FOR SALE OR DISTRIBUTION function of genes. Before we do so, however, we need to consider the four necessary properties of genetic material: 1. The genetic material must encode information 2.© That Jones information & Bartlett must Learning, be used to LLC direct the © Jones & Bartlett Learning, LLC NOTfunctioning FOR SALE of cellular OR processes. DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 3. The information contained must be transmissi- ble from cell to cell and from generation to generation. © Jones & Bartlett4. There mustLearning, be the potential LLC for mutation that can© Jones© Science & BartlettSource. Learning, LLC NOT FOR SALEresult OR in DISTRIBUTION the physical variation that exists amongNOT FOR SALE OR DISTRIBUTION individuals and between species. By the 1920s, several lines of indirect evidence began to suggest a close relationship between chromosomes 1.1 DNA as the Genetic Material and DNA. Microscopic studies with special stains © Jones & Bartlett Learning, LLCshowed that DNA is present© in Jones chromosomes. & Bartlett Chromo Learning,- LLC The foundation of genetics as a molecular science NOT FOR SALE OR DISTRIBUTIONsomes also contain variousNOT types FOR of proteins, SALE butOR the DISTRIBUTION dates back to 1869, just three years after Mendel amount and kinds of chromosomal proteins differ greatly reported his experiments. It was in that year that from one cell type to another, whereas the amount of Friedrich Miescher discovered a new type of weak DNA per cell is constant. Furthermore, nearly all of the acid, abundant in the nuclei of white blood cells. DNA present in cells of higher organisms is present in the Miescher’s weak acid turned out to be the chemical chromosomes. These arguments for DNA as the genetic © Jones & BartlettDNA Learning, (deoxyribonucleic LLC © Jones & Bartlett Learning, LLC substance we now call material were unconvincing, however, because crude acid)NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION . For many years, the biological function of chemical analyses had suggested (erroneously, as it DNA was unknown, and no role in heredity was turned out) that DNA lacks the chemical diversity needed ascribed to it. This section describes how DNA was to encode the complex set of instructions necessary to eventually isolated and identified as the material of build even a simple cell or organism. The favored candi- © Jones &which Bartlett genes Learning, are made. LLC © Jonesdate for& Bartlettthe genetic Learning, material was LLC protein, because pro- That the cell nucleus plays a key role in inheritance NOT FOR SALE OR DISTRIBUTION NOT teinsFOR were SALE known OR to DISTRIBUTION be an exceedingly diverse collection was recognized in the 1870s when scientists observed of molecules. Proteins therefore became widely accepted that the nuclei of male and female reproductive cells as the genetic material, and DNA was assumed to func- undergo fusion in the process of fertilization. Soon there- tion merely as the structural framework of the chromo- after, chromosomes were first observed inside the somes. The experiments described in this section showed nucleus as thread-like© objects Jones that & become Bartlett visible Learning, in the LLCthat, in fact, DNA is the genetic© Jones material. & Bartlett Learning, LLC light microscope when the cell is stained with certain NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION dyes. Chromosomes were found to exhibit a character- Experimental Proof of the Genetic istic “splitting” behavior in which each daughter cell Function of DNA formed by cell division receives an identical complement of chromosomes (see the chapter titled The In 1928, Frederick Griffith took an important first step in Chromosomal Basis of Inheritance © Jones & Bartlett Learning,). Further LLCevidence for elucidating© DNA’sJones role & Bartlett when he Learning,demonstrated LLC that the importance of chromosomes was provided by the genetic material can be transferred from one bacterial cell observationNOT FOR that, whereasSALE OR the numberDISTRIBUTION of chromosomes to another.NOT Griffith FOR was SALE working OR with DISTRIBUTION two strains of the in each cell may differ among biological species, the bacterium Streptococcus pneumoniae identified as S and R. number of chromosomes is nearly always constant When a bacterial cell is grown on solid medium, it under- within the cells of any particular species. These features goes repeated cell divisions to form a visible clump of cells colony S. pneumoniae © Jones &of chromosomesBartlett Learning, were well LLC understood by about 1900,© Jonescalled & a Bartlett. The Learning, S type of LLC synthesizes a and they made it seem likely that chromosomes were gelatinous capsule composed of complex carbohydrate NOT FORthe SALE carriers OR of theDISTRIBUTION genes. NOT (polysaccharide).FOR SALE OR The DISTRIBUTION enveloping capsule makes each

9781284136609_CH01_Hartl.indd 4 08/11/17 8:51 am 1.1 DNA as the Genetic Material 5

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION R strain NOT FOR SALE SOR strain DISTRIBUTION FIGURE 1.1 Colonies of rough (R, the small colonies) and smooth (S, the large colonies) strains of Streptococcus pneumoniae. The S colonies are larger because of the gelatinous capsule on the S cells. Photograph reproduced from Avery, O.T., MacLeod, C.M., & McCarty, M. (1944). Studies on the chemical nature of the substance inducing transformation of pneumococcal types. Journal of Experimental Medicine, 79(2), 137–158. Copyright 1994 by Rockefeller University Press. Reproduced with permission © Jones &of Rockefeller Bartlett University Learning, Press. doi: 10.1084/jem.79.2.137.LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION colony large and gives it a glistening or smooth (S) appear- system of the host. Both types of bacteria “breed true,” in ance (FIGURE 1.1). This capsule also enables the bacte- the sense that the progeny formed by cell division have rium to cause pneumonia, by protecting it from the the capsular type of the parent, either S or R. defense mechanisms of an infected animal. The R strains Mice injected with living S cells get pneumonia. of S. pneumoniae are unable© Jones to synthesize & Bartlett the Learning,capsular LLCIn contrast, mice injected ©with Jones either & living Bartlett R cells Learning, or LLC polysaccharide; theyNOT form smallFOR coloniesSALE OR that DISTRIBUTIONhave a heat-killed S cells remainNOT healthy. FOR Griffith’s SALE criticalOR DISTRIBUTION rough (R) surface (Figure 1.1). The R strain of the bacte- finding was that mice injected with a mixture of living rium does not cause pneumonia, because without the R cells and heat-killed S cells contract the disease and capsule the bacteria are inactivated by the immune often die of pneumonia (FIGURE 1.2). Bacteria © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Living Living Heat-killed Living R cells plus © Jones & Bartlett Learning,S cells LLC R cells © Jones & BartlettS cells Learning, LLC heat-killed S cells NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Mouse contracts Mouse remains Mouse remains Mouse contracts pneumonia © Jones & Bartletthealthy Learning, LLChealthy © Jonespneumonia & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

S colonies isolated R colonies isolated No colonies isolated R and S colonies isolated from tissue of dead mouse from tissue from tissue from tissue of dead mouse © Jones &FIGURE Bartlett 1.2 Griffith’s Learning, experiment LLC demonstrating bacterial transformation.© Jones A mouse & Bartlett remains healthy Learning, if injected withLLC either the nonvirulent R strain of S. pneumoniae or heat-killed cell fragments of the usually virulent S strain. R cells in the presence of heat-killed S cells are NOT FORtransformed SALE OR into theDISTRIBUTION virulent S strain, causing pneumonia in the mouse.NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 5 08/11/17 8:51 am 6 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones isolated& Bartlett from Learning, blood samples LLC of these dead mice pro-© JonesBecause & Bartlett DNA Learning,contains phosphorus LLC but no sulfur, NOT FORduce SALE S cultures OR DISTRIBUTION with a capsule typical of the injected SNOT whereasFOR SALE most proteinsOR DISTRIBUTION contain sulfur but no phospho- cells, even though the injected S cells had been killed rus, it is possible to label DNA and proteins differen- by heat. Evidently, the injected material from the dead tially by using radioactive isotopes of the two elements. S cells includes a substance that can be transferred to Hershey and Chase produced particles containing living R cells, which then enables the R cells to synthe- radioactive DNA by infecting E. coli cells that had been size the S-type capsule.© InJones other words,& Bartlett the R Learning,bacteria LLCgrown for several generations© Jones in a& medium Bartlett that Learning, LLC 32 can be changed—or undergoNOT FOR transformation SALE OR —intoDISTRIBUTION S included P (a radioactiveNOT isotope FOR of phosphorus) SALE OR and DISTRIBUTION bacteria. Furthermore, the ability to synthesize the then collecting the phage progeny. Other particles con- capsule is inherited by descendants of the transformed taining labeled proteins were obtained in the same bacteria. way, by using a medium that included 35S (a radioac- Transformation in Streptococcus was originally dis- tive isotope of sulfur). covered© Jones in 1928, & butBartlett it was Learning,not until 1944 LLC that the In the© experiments Jones & Bartlettsummarized Learning, in FIGURE LLC 1.5, chemicalNOT substance FOR SALE responsible OR DISTRIBUTION for changing the R cells nonradioactiveNOT E.FOR coli cellsSALE were OR infected DISTRIBUTION with phage into S cells was identified. In a milestone experiment, labeled with either 32P (part A) or 35S (part B) so that the Oswald Avery, Colin MacLeod, and Maclyn McCarty DNA and proteins could be followed on their individ- showed that the substance causing the transformation ual paths. Infected cells were separated from unat- of R cells into S cells was DNA. In doing their experi- tached phage particles by centrifugation, resuspended © Jones &ments, Bartlett these Learning,researchers first LLC needed to develop chemi-© Jonesin fresh & Bartlett medium, Learning, and then swirled LLC violently in a NOT FORcal SALE procedures OR DISTRIBUTIONfor isolating almost pure DNA from cells,NOT kitchenFOR SALE blender OR to shear DISTRIBUTION attached phage material from which had never been done before. When they added the cell surfaces. This treatment was found to have no DNA isolated from S cells to growing cultures of R cells, effect on the subsequent course of the infection, which they observed transformation—that is, a few S cells were implies that the phage genetic material must enter the produced. Although the DNA preparations contained infected cells very soon after phage attachment. The traces of protein and ©RNA Jones (ribonucleic & Bartlett acid, anLearning, abun- LLCkitchen blender turned out© toJones be the &critical Bartlett piece Learning, of LLC dant cellular macromoleculeNOT FOR chemically SALE OR related DISTRIBUTION to equipment. Other methodsNOT had FORbeen tried SALE to tear OR the DISTRIBUTION DNA), the transforming activity was not altered by treat- phage heads from the bacterial cell surface, but nothing ments that destroyed either protein or RNA. Conversely, had worked reliably. Hershey later explained, “We tried treatments that destroyed DNA eliminated the trans- various grinding arrangements, with results that forming activity (FIGURE 1.3). These experiments weren’t very encouraging. When Margaret McDonald implied© Jones that the &substance Bartlett responsible Learning, for geneticLLC trans- loaned us© herJones kitchen & Bartlett blender, Learning, the experiment LLC formationNOT wasFOR the SALE DNA of OR the cell—anDISTRIBUTION hence that DNA promptly NOTsucceeded.” FOR SALE OR DISTRIBUTION is the genetic material. After the phage heads were removed by the blender treatment, the infected bacteria were exam- Genetic Role of DNA in Bacteriophages ined. Most of the radioactivity from 32P-labeled phage Another pivotal finding was reported by Alfred Hershey was found to be associated with the bacteria, whereas © Jones &and Bartlett Martha ChaseLearning, in 1952. LLC They studied cells of the© Jonesonly a& small Bartlett fraction Learning, of the 35S LLCradioactivity was pres- Escherichia coli NOT FORintestinal SALE ORbacterium DISTRIBUTION after infection by theNOT entFOR in theSALE infected OR cells.DISTRIBUTION The retention of most of the virus T2. A virus that attacks bacterial cells is called a labeled DNA, in contrast to the loss of most of the bacteriophage, a term often shortened to phage. labeled protein, implied that a T2 phage transfers most Bacteriophage means “bacteria-eater.” The structure of a of its DNA, but very little of its protein, to the cell it bacteriophage T2 particle is illustrated in FIGURE 1.4. infects. The critical finding (Figure 1.5) was that about This particle is exceedingly© Jones small, & yet Bartlett it has a complexLearning, LLC50 percent of the transferred© 32JonesP-labeled & DNA,Bartlett but lessLearning, LLC 35 structure composed ofNOT head FOR(which SALE contains OR the DISTRIBUTION phage than 1 percent of the transferredNOT FOR S-labeled SALE protein, OR DISTRIBUTION DNA), collar, tail, and tail fibers. (The head of a human was inherited by the progeny phage particles. Hershey sperm is about 30–50 times larger in both length and and Chase interpreted this result to mean that the width than the head of T2.) Hershey and Chase were genetic material in T2 phage is DNA. already aware that T2 infection proceeds via the attach- The experiments of Avery, MacLeod, and McCarty ment© of Jones the tip of& a Bartlett phage particle’s Learning, tail to LLCthe bacterial and those ©of HersheyJones and& Bartlett Chase are Learning, regarded as classicsLLC cell wall,NOT entry FOR of phageSALE material OR DISTRIBUTION into the cell, multipli- in the demonstrationNOT FOR that SALE genes OR consist DISTRIBUTION of DNA. At the cation of this material to form a hundred or more prog- present time, the equivalent of the transformation eny phage, and release of the progeny phage by bursting experiment is carried out daily in many research labo- (lysis) of the bacterial host cell. They also knew that T2 ratories throughout the world, usually with bacteria, particles were composed of DNA and protein in approxi- yeast, or animal or plant cells grown in culture. These © Jones &mately Bartlett equal Learning, amounts. LLC © Jonesexperiments & Bartlett indicate Learning, that DNA LLC is the genetic material NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 6 08/11/17 8:51 am 1.1 DNA as the Genetic Material 7

S cell extract (contains mostly © Jones & Bartlett Learning,DNA LLC with a little © Jones & Bartlett Learning,R colonies andLLC CultureNOT of S FORcells SALE OR DISTRIBUTIONprotein and RNA) Culture of NOTR cells FOR SALE OR DISTRIBUTIONa few S colonies

(B) The transforming activity is not destroyed by either protease or RNase. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Protease or RNase © Jones Plate& Bartlett on Learning, LLC © Jones & Bartlett Learning, LLC NOT FORagar SALE medium OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Conclusion: Transforming activity not protein or RNA S cell extract

Plate on agar medium © Jones & Bartlett Learning, LLC Conclusion: Transforming© Jones activity & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION most likely DNA NOT FOR SALE OR DISTRIBUTION S cell extract

R colonies only Culture of R cells FIGURE© 1.3 JonesA diagram & Bartlett of the Avery–MacLeod–McCarty Learning, LLC experiment demonstrating that© Jones DNA is the & active Bartlett material Learning, in bacterial transforma- LLC tion. (A) Purified DNA extracted from heat-killed S cells can convert some living R cells into S cells, but the material may still contain undetectableNOT FOR traces ofSALE protein and/orOR DISTRIBUTION RNA. (B) The transforming activity is not destroyedNOT by eitherFOR protease SALE or ORRNase. DISTRIBUTION (C) The transforming activity is destroyed by DNase and so probably consists of DNA.

9781284136609_CH01_Hartl.indd 7 08/11/17 8:51 am 8 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones & Bartlett Learning, LLC © Jonesessentially & Bartlett correct Learning, three-dimensional LLC structure of the Protein Head DNA molecule. The structure was dazzling in its ele- NOT FOR SALE OR DISTRIBUTION(protein NOT FOR SALE OR DISTRIBUTION DNA and DNA) gance and revolutionary in suggesting how DNA dupli- cates itself, controls hereditary traits, and undergoes mutation. Even while their tin-and-wire model of the DNA molecule was still incomplete, Crick would visit © TaJonesil & Bartlett Learning, LLChis favorite pub and exclaim© Jones“we have & discovered Bartlett Learning,the LLC (protein NOTonly) FOR SALE OR DISTRIBUTIONsecret of life.” NOT FOR SALE OR DISTRIBUTION In the Watson–Crick structure, DNA consists of two long chains of subunits, each twisted around the other to form a double-stranded helix. The double helix is (A) (B) right-handed, which means that as one looks along the © Jones & Bartlett Learning, LLC barrel, each© chainJones follows & Bartlett a clockwise Learning, path as LLCit pro- FIGURE 1.4 (A) Drawing of E. coli phage T2, showing various NOT FOR SALE OR DISTRIBUTION gresses. YouNOT can FORvisualize SALE the right-handedOR DISTRIBUTION coiling in components. The DNA is confined to the interior of the head. FIGURE 1.6 (B) An electron micrograph of phage T4, a closely related phage. part A of if you imagine yourself looking Electron micrograph courtesy of Robert Duda, University of Pittsburgh. up into the structure from the bottom. The dark spheres outline the “backbone” of each individual strand, and they coil in a clockwise direction. The subunits of each nucleotides © Jones &in Bartlettthese organisms Learning, as well LLC as in phage T2. Although© Jonesstrand & are Bartlett Learning,, each of whichLLC contains any one bases NOT FORthere SALE are ORno known DISTRIBUTION exceptions to the generalizationNOT ofFOR four SALEchemical OR constituents DISTRIBUTION called attached to that DNA is the genetic material in all cellular organ- a phosphorylated molecule of the five-carbon sugar deoxyribose isms and many viruses, in several types of viruses the . The four bases in DNA are: genetic material consists of RNA. These RNA- ■■ Adenine (A) containing viruses include the human immunodefi- ■■ Guanine (G) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC ciency virus HIV-1 that causes AIDS (acquired ■■ Thymine (T) immunodeficiency syndrome).NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ■■ Cytosine (C) SUMMING UP The chemical structures of the nucleotides and bases need not concern us at this time. They are examined in ■■ DNA was identified as a component of chro- the DNA Structure and Genetic Variation chapter. mosomes,© Jones but& Bartlett its significance Learning, as the LLCgenetic A key© point Jones for & our Bartlett present Learning, purposes isLLC that materialNOT FOR was initiallySALE notOR recognized. DISTRIBUTION the bases NOTin the FORdouble SALE helix areOR paired DISTRIBUTION as shown in ■■ Frederick Griffith showed that genetic informa- Figure 1.6B: tion could be transferred in the process now At any position on the paired strands of a DNA known as transformation. molecule:

■■ Avery, McLeod, and McCarty demonstrated ■■ If one strand has an A, then the partner strand © Jones & Bartlettthat the “transformingLearning, LLC principle” was DNA. © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR hasSALE a T. OR DISTRIBUTION ■■ Hershey and Chase showed that DNA—but not ■■ If one strand has a G, then the partner strand protein—is transferred to host cells during has a C. phage infection. The pairing between A and T and between G and C is complementary © Jones & Bartlett Learning, LLCsaid to be © Jones; the complement& Bartlett Learning, of LLC 1.2 DNA Structure and Replication A is T, and the complement of G is C. The complemen- NOT FOR SALE OR DISTRIBUTIONtary pairing means that eachNOT base FOR along SALE one strand OR ofDISTRIBUTION The inference that DNA is the genetic material left many the DNA is matched with a base in the opposite position questions unanswered. How is the DNA in a gene dupli- on the other strand. Furthermore: cated when a cell divides? How does the DNA in a gene Nothing restricts the sequence of bases in a sin- control© Jones a hereditary & Bartlett trait? What Learning, happens LLC to the DNA gle strand,© Jones so any & sequence Bartlett couldLearning, be present LLC when a mutation (a change in the DNA) takes place in along one strand. a gene?NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION In the early 1950s, a number of researchers began This principle explains how only four bases in DNA can to try to elucidate the detailed molecular structure of code for the huge amount of information needed to DNA in hopes that the structure alone would suggest make an organism. It is the sequence of bases along the © Jones &answers Bartlett to these Learning, questions. LLC In 1953, James Watson and© JonesDNA & that Bartlett encodes Learning, the genetic LLC information, and the Francis Crick at Cambridge University proposed the first sequence is completely unrestricted. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 8 08/11/17 8:51 am 1.2 DNA Structure and Replication 9

E. coli cells grown E. coli cells grown © Jonesin 32 &P-containing Bartlett Learning, LLC in 35©S-containing Jones & Bartlett Learning, LLC NOT FORmedium SALE (labels OR DNA) DISTRIBUTION mediumNOT (labels FOR protein) SALE OR DISTRIBUTION

© Jones & Bartlett PhageLearning, reproduction; LLC © Jones &Phage Bartlett reproduction; Learning, LLC NOT FOR SALE ORcell DISTRIBUTION lysis releases NOT FOR cellSALE lysis releases OR DISTRIBUTION DNA-labeled progeny protein-labeled phage progeny phage

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONDNA-labeled phage NOT FOR SALE OR DISTRIBUTIONProtein-labeled phage used to infect used to infect nonradioactive cells nonradioactive cells

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOTAfter FORinfection, SALE part of phageOR DISTRIBUTION After infection,NOT part ofFOR phage SALE OR DISTRIBUTION remaining attached to cells is remaining attached to cells is removed by violent agitation removed by violent agitation in a kitchen blender in a kitchen blender

Infecting Infected cell Infecting Infected cell labeled DNA nonlabeled DNA

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOTPhage FOR reproduction; SALE ORcell ly sisDISTRIBUTION Phage reproduction;NOT FOR cell SALE OR DISTRIBUTION releases progeny phage that lysis releases progeny contain some 32P-labeled DNA phage that contain almost from the parental phage DNA no 35S-labeled protein

©(A) Jones & Bartlett Learning, LLC (B) © Jones & Bartlett Learning, LLC

NOT FORConclusion: SALE DNA OR from DISTRIBUTION an infecting parental phage is inherited in the progenyNOT phage.FOR SALE OR DISTRIBUTION

FIGURE 1.5 The Hershey–Chase (“blender”) experiment demonstrating that DNA, not protein, is responsible for directing the reproduction of phage T2 in infected E. coli cells. (A) Radioactive DNA is transmitted to progeny phage in substantial amounts. (B) Radioactive protein is transmitted to progeny phage in negligible amounts. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 9 08/11/17 8:51 am 10 CHAPTER 1 Genes, Genomes, and Genetic Analysis

(A) (B) 3’ 5’ © Jones & Bartlett Learning, LLC © Jonesby the & direction Bartlett of Learning, the arrow-like LLC ribbon. The tail of TA the arrow represents the 5 end of the DNA strand, the NOT FOR SALE OR DISTRIBUTION GC NOT FOR SALE OR DISTRIBUTION AT head the 3 end. Beyond the most optimistic hopes, knowledge of CG the structure of DNA immediately gave clues to its CG function: © Jones & Bartlett GCLearning, LLC © Jones & Bartlett Learning, LLC T A 1. The sequence of bases in DNA could be copied Paired NOTnucleotides FOR SALE OR DISTRIBUTION by using each of theNOT separate FOR “partner” SALE strandsOR DISTRIBUTION GC as a pattern for the creation of a new partner T A strand with a complementary sequence of GC TA bases. 2. The DNA could contain genetic information in © Jones & Bartlett Learning,TA LLC © Jones & Bartlett Learning, LLC coded form in the sequence of bases, analogous NOT FOR SALE OR DISTRIBUTIONAT NOT FOR SALE OR DISTRIBUTION GC to letters printed on a strip of paper. T A 3. Changes in genetic information (mutations) could result from errors in copying in CG T A which the base sequence of the DNA became © Jones & Bartlett Learning, LLC GC © Jones &altered. Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION 5’ 3’ NOT InFOR the remainderSALE OR of thisDISTRIBUTION chapter, we discuss some of the implications of these clues. FIGURE 1.6 Molecular structure of the DNA double helix in the standard “B form.” (A) A space-filling model, in which each atom is depicted as a sphere. (B) A diagram highlighting the helical strands around the outside of the molecule and the A–T and An Overview of DNA Replication G–C base pairs inside. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC Watson and Crick noted that the structure of DNA itself NOT FOR SALE OR DISTRIBUTIONsuggested a mechanism forNOT its replication. FOR SALE “It has OR not DISTRIBUTION escaped our notice,” they wrote, “that the specific base The complementary pairing is also called pairing we have postulated immediately suggests a Watson–Crick pairing. In the three-dimensional copying mechanism.” The copying process in which a structure© Jones in Figure & 1.6A,Bartlett the baseLearning, pairs are LLCrepresented single DNA© moleculeJones & gives Bartlett rise to Learning,two identical LLC mole- by the lighter spheres filling the interior of the double cules is called replication. The replication mechanism helix.NOT The baseFOR pairs SALE lie almost OR DISTRIBUTION flat, stacked on top of that WatsonNOT and FOR Crick SALE had in OR mind DISTRIBUTION is illustrated in one another perpendicular to the long axis of the dou- FIGURE 1.7. ble helix, like pennies in a roll. When discussing a As shown in part A of Figure 1.7, the strands of the DNA molecule, biologists frequently refer to original (parent) duplex separate, and each individual the individual strands as single-stranded DNA and strand serves as a pattern, or template, for the synthe- © Jones &to Bartlettthe double Learning, helix as double-strLLC anded DNA or© Jonessis of & a newBartlett strand Learning, (replica). The LLC replica strands are NOT FORduplex SALE DNA OR. DISTRIBUTION NOT synthesizedFOR SALE by OR the additionDISTRIBUTION of successive nucleotides Each DNA strand has a polarity, or directionality, in such a way that each base in the replica is comple- like a chain of circus elephants linked trunk to tail. In mentary (in the Watson–Crick pairing sense) to the this analogy, each elephant corresponds to one nucle- base across the way in the template strand (Figure 1.7B). Although the mechanism in Figure 1.7 otide along the DNA© strand. Jones The & Bartlett polarity isLearning, deter- LLC © Jones & Bartlett Learning, LLC mined by the direction in which the nucleotides are is simple in principle, it is a complex process that is pointing. The “trunk”NOT end ofFOR the strandSALE is OR called DISTRIBUTION the fraught with geometrical problemsNOT FOR and SALErequires OR a vari DISTRIBUTION- 3 end of the strand, and the “tail” end is called the 5 ety of enzymes and other proteins. The details are end. In double-stranded DNA, the paired strands are examined in the DNA Replication and Sequencing chap- oriented in opposite directions, with the 5 end of one ter. The end result of replication is that a single double-  stranded molecule becomes replicated into two copies strand© alignedJones with & Bartlett the 3 end Learning, of the other LLC strand. The © Jones & Bartlett Learning, LLC molecular basis of the polarity, and the reason for the with identical sequences: oppositeNOT orientation FOR SALE of the OR strands DISTRIBUTION in duplex DNA, are NOT FOR SALE OR DISTRIBUTION explained in the DNA Structure and Genetic Variation chapter. In illustrating DNA molecules in this text, we use an arrow-like ribbon to represent the backbone, © Jones &and Bartlett we use tabs Learning, jutting off LLC the ribbon to represent the© Jones & Bartlett Learning, LLC nucleotides. The polarity of a DNA strand is indicated NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 10 08/11/17 8:51 am 1.3 Genes and Proteins 11

Parent molecule of DNA TA © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 5’ 3’ CG NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTIONACGCTTGC AT TGCGAACG 3’ 5’ CG CG Parent © JonesGC & Bartlett Learning,duplex LLC Template strand © JonesCo &mplement Bartlett of Learning, LLC A NOT FOR SALET A OR DISTRIBUTION 5’ 3’NOT FOR“T” adds SALE “A” OR DISTRIBUTION A CGCTTGC TGCGAACG CG Complement of 3’ 5’ T A G “C” adds “G” Template strand CG © Jones & BartlettTA Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE ORTA DISTRIBUTION NOT FOR SALE OR DISTRIBUTION C Complement of “G” adds “C” A T 5’ 3’ 5’ A T A CGCTTGC A C G G TGCGAACG Complement of 5’ 3’ 5’ CG CG “G” adds “C” © Jones & Bartlett Learning, LLC GC © Jones & Bartlett Learning,C LLC NOT FOR SALE OR DISTRIBUTIONGC T A NOT FOR SALE OR DISTRIBUTION T Daughter A And so forth duplex CG CG A T 5’ 3’ 5’ T A C G CG A CGCTTGC ACG T A ACG TGCGAACG © Jones & BartlettTA Learning, LLC © Jones & Bartlett Learning, LLC 5’ 3’ 5’ T A NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Template TA A T strands AT 5’ 3’ 5’ 3’ A CGCTTGC ACGCTTGC T GCGAACG TGCGAACG Replica © Jones & Bartlett Learning, LLC 3’© Jones & Bartlett5’ 3’ Learning, LLC5’ NOT FOR SALE ORstrands DISTRIBUTION NOT FOR SALE OR DISTRIBUTION (A) (B) Daughter molecules of DNA

FIGURE 1.7 Replication of DNA. (A) Replication of a DNA duplex as originally envisioned by Watson and Crick. As the parental strands separate, each parental strand serves as a template for the formation of a new daughter strand by means of A–T and G–C base pairing. (B) Greater detail showing how each of the parental strands serves as a template for the production of a complementary daughter strand, which grows in length by the successive addition of single nucleotides to the 3 end. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Here the bases in the newly synthesized strands are SUMMING UP shown in red. In the duplex on the left, the top strand is the template from the parental molecule and the bot- ■■ DNA consists of a double helix, with the two tom strand is newly synthesized;© Jones & in Bartlett the duplex Learning, on the LLCstrands held together ©by Jones complementary & Bartlett base Learning, LLC pairing. right, the bottom strandNOT is the FOR template SALE from OR the DISTRIBUTION paren- NOT FOR SALE OR DISTRIBUTION tal molecule and the top strand is newly synthesized. ■■ The two strands of the double helix have Note in Figure 1.7B that in the synthesis of each new opposite polarities. strand, new nucleotides are added only to the 3 end of ■■ Each strand of a double-helical DNA molecule the growing chain: serves as a template for synthesis of a new one © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC The obligatory elongation of a DNA strand only during DNA replication. atNOT the 3 FOR end SALEis an essential OR DISTRIBUTION feature of DNA NOT FOR SALE OR DISTRIBUTION replication. 1.3 Genes and Proteins This was a point not recognized by Watson and Crick in The structure of DNA, by itself, suggested how two of two © Jones &1953, Bartlett but rather Learning, one that became LLC clear once the cellular© Jonesof the & four Bartlett necessary Learning, properties LLC of the genetic material machinery of DNA replication was characterized. could be explained. First, complementary base pairing NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 11 08/11/17 8:51 am 12 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones provides& Bartlett a mechanism Learning, for LLCreplication (Figure 1.7). Sec©- JonesAn early & Bartlett name for Learning, homogentisic LLC acid was alkapton— alkaptonuria . NOT FORond, SALE if the OR sequence DISTRIBUTION of nucleotides along the DNA isNOT henceFOR SALEthe name OR DISTRIBUTION for this disease Even thought of as a string of letters on a sheet of paper, then the though alkaptonuria is rare, with an incidence of about genes could be envisioned as distinct words that form sen- one in 200,000 people, it was well known even before tences and paragraphs that give meaning to the pattern of Garrod studied it. The disease itself is relatively mild, letters. Based on the structure of DNA alone, however, it but it has one striking symptom: The urine of the patient is not clear what is coded© Jones for. As we & willBartlett see, a contempo Learning,- LLCturns black because of the© oxidation Jones of& homogentisicBartlett Learning, LLC raneous series of experimentsNOT FOR showed SALE thatOR whatDISTRIBUTION is acid (FIGURE 1.8). For thisNOT reason, FOR alkaptonuria SALE OR is also DISTRIBUTION encoded are proteins, a class of macromolecules that carry called black urine disease. An early case was described in out most of the biochemical activities in the cell. the year 1649: Cells are largely made up of proteins. These include The patient was a boy who passed black urine structural proteins that give the cell rigidity and mobility, and who, at the age of fourteen years, was sub- proteins that form pores in the cell membrane to control © Jones & Bartlett Learning, LLC mitted to© aJones drastic &course Bartlett of treatment Learning, that LLChad the traffic of small molecules into and out of the cell, and NOT FOR SALE OR DISTRIBUTION for its aimNOT the FOR subduing SALE of ORthe fieryDISTRIBUTION heat of his receptor proteins that regulate cellular activities in viscera, which was supposed to bring about the response to molecular signals from the growth medium condition in question by charring and blacken- or from other cells. Proteins are also responsible for most ing his bile. Among the measures prescribed of the metabolic activities of cells. They are essential for were bleedings, purgation, baths, a cold and the synthesis and breakdown of organic molecules and © Jones & Bartlett Learning, LLC © Joneswatery & Bartlett diet, and Learning, drugs galore. LLC None of these for generating the chemical energy needed for cellular NOT FOR SALE OR DISTRIBUTION NOT FORhad SALE any obvious OR DISTRIBUTION effect, and eventually the activities. In 1878, the term enzyme was introduced to patient, who tired of the futile and superfluous refer to the biological catalysts that accelerate biochemi- therapy, resolved to let things take their natural cal reactions in cells. By 1900, thanks largely to the work course. None of the predicted evils ensued. He of the German biochemist Emil Fischer, enzymes were married, begat a large family, and lived a long shown to be proteins. As often happens in science, © Jones & Bartlett Learning, LLCand healthy life, always© passing Jones urine & Bartlett black as Learning, LLC nature’s “mistakes” provide clues as to how things work. NOT FOR SALE OR DISTRIBUTIONink. (Recounted by Garrod,NOT 1908.) FOR SALE OR DISTRIBUTION Such was the case in establishing a relationship between genes and disease, because a “mistake” in a gene (a muta- Garrod was primarily interested in the biochemis- tion) can result in a “mistake” (lack of function) in the cor- try of alkaptonuria, but he took note of family studies responding protein. This provided a fruitful avenue of that indicated that the disease was inherited as though research© Jones for the study& Bartlett of genetics. Learning, LLC it were due© toJones a defect & in Bartlett a single gene.Learning, As to the LLC bio- InbornNOT Errors FOR ofSALE Metabolism OR DISTRIBUTION as chemistry,NOT he deduced FOR SALE that the OR problem DISTRIBUTION in alkapton- a Cause of Hereditary Disease uria was the patients’ inability to break down the phenyl ring of six carbons that is present in homogen- More than a century ago, the British physician Archibald tisic acid. Where does this ring come from? Most Garrod realized that certain heritable diseases followed animals obtain it from foods in their diet. Garrod pro- © Jones &the Bartlett rules of transmission Learning, that LLC Mendel had described for his© Jonesposed & thatBartlett homogentisic Learning, acidLLC originates as a NOT FORgarden SALE peas. OR In DISTRIBUTION 1908, Garrod gave a series of lectures inNOT FOR SALE OR DISTRIBUTION which he proposed a fundamental hypothesis about the relationship between heredity, enzymes, and disease: Any hereditary disease in which cellular metabolism is abnormal results from an inherited defect in an enzyme. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Such diseases became known as inborn errors of metabolism, a term still in use today. Garrod studied a number of inborn errors of metabolism in which the patients excreted abnormal substances© Jones in their & Bartlett urine. One Learning, of these diseases LLC was © Jones & Bartlett Learning, LLC alkaptonuria NOT FOR. In SALE this case, OR the DISTRIBUTION abnormal substance NOT FOR SALE OR DISTRIBUTION excreted is homogentisic acid:

OH O CH C © Jones & Bartlett Learning, LLC2 © JonesFIGURE & 1.8 BartlettUrine from Learning, a person with LLC alkaptonuria turns black OH because of the oxidation of the homogentisic acid that it contains. NOT FOR SALE OR DISTRIBUTIONHO NOT CourtesyFOR SALEof Daniel De OR Aguiar. DISTRIBUTION

9781284136609_CH01_Hartl.indd 12 08/11/17 8:51 am 1.3 Genes and Proteins 13

© Jones breakdown& Bartlett productLearning, of two LLC amino acids, phenylala-© JonesPhenyl & Bartlett ring Learning, LLC NOT FORnine SALE and tyrosine,OR DISTRIBUTION which also contain a phenyl ring.NOT FOR SALE OR DISTRIBUTION An amino acid is one of the “building blocks” from CC NH2 O which proteins are made. Phenylalanine and tyrosine C CCCH2 C are constituents of normal proteins. The scheme that C C H OH illustrates the relationship between the molecules is Phenylalanine (a normal amino acid) FIGURE 1.9 shown in ©. Any Jones such &sequence Bartlett of biochemLearning,- LLC © Jones &Each Bartlett arrow Learning, LLC ical reactions is calledNOT a biochemical FOR SALE pathway OR DISTRIBUTION or a NOT FOR representsSALE OR one DISTRIBUTION metabolic pathway. Each arrow in the pathway rep- 1 step in the resents a single step depicting the transition from the biochemical pathway. “input” or substrate molecule, shown at the head of product molecule the arrow, to the “output” or , CC NH2 O shown© Jonesat the tip. & BiochemicalBartlett Learning, pathways LLCare usually © Jones & Bartlett Learning, LLC HO C C CH2 C C oriented either vertically with the arrows pointing NOT FOR SALE OR DISTRIBUTION NOTC CFOR SALE OROH DISTRIBUTION down, as in Figure 1.9, or horizontally, with the H Tyrosine (a normal amino acid) arrows pointing from left to right. Garrod did not know all of the details of the pathway in Figure 1.9, but he did understand that the key step in the 2 © Jones &breakdown Bartlett ofLearning, homogentisic LLC acid is the breaking open© Jones & Bartlett Learning, LLC NOT FORof SALE the phenyl OR DISTRIBUTION ring and that the phenyl ring in NOT FOR SALE ORCC DISTRIBUTIONO O homogentisic acid comes from dietary phenylalanine HO C C CH2 C C and tyrosine. C C OH What allows each step in a biochemical pathway 4-Hydroxyphenylpyruvic acid to occur? Garrod correctly surmised that each step requires a specific enzyme© Jones to catalyze & Bartlett the reaction Learning, for LLC © Jones & Bartlett Learning, LLC 3 the chemical transformation.NOT FOR Persons SALE with OR an DISTRIBUTIONinborn NOT FOR SALE OR DISTRIBUTION error of metabolism, such as alkaptonuria, have a In the next step, the phenyl ring defect in a single step of a metabolic pathway because OH is opened at this they lack a functional enzyme for that step. When an position. enzyme in a pathway is defective, the pathway is said CC O to have© Jones a block & at Bartlett that step. Learning, One frequent LLC result of a ©C JonesC CH& 2BartlettC Learning, LLC blockedNOT pathway FOR SALE is that theOR substrate DISTRIBUTION of the defective NOTC CFOR SALEOH OR DISTRIBUTION enzyme accumulates. Observing the accumulation of OH homogentisic acid in patients with alkaptonuria, Homogentisic acid (formerly known as alkapton) Garrod proposed that there must be an enzyme whose function is to open the phenyl ring of homogentisic This is the step © Jones &acid Bartlett and that Learning, this enzyme LLC is missing in these patients.© Jones & Bartlett Learning, LLCthat is blocked NOT FORIsolation SALE ORof the DISTRIBUTION enzyme that opens the phenyl ring ofNOT FOR SALE OR DISTRIBUTION4 in alkaptonuria; homogentisic acid was not actually achieved until X homogentisic acid accumulates. 50 years after Garrod’s lectures. In the average person, it is found in cells of the liver, and just as Garrod had predicted, the enzyme is defective in patients with O O O © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC alkaptonuria. C CH CH C CH2 C CH2 C The pathway for theNOT breakdown FOR SALE of phenylalanine OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION HO O OH and tyrosine, as it is understood today, is shown in 4-Maleylacetoacetic acid FIGURE 1.10. In this figure, the emphasis is on the enzymes rather than on the structures of the metabolites, or small molecules, on which © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC the enzymes act. Each step in the pathway requires Further breakdown the presenceNOT FOR of aSALE particular OR DISTRIBUTIONenzyme that catalyzes NOT FOR SALE OR DISTRIBUTION FIGURE 1.9 Metabolic pathway for the breakdown of phenylala- that step. nine and tyrosine. Each step in the pathway, represented by an Although Garrod knew only about alkaptonuria, arrow, requires a specific enzyme to catalyze the reaction. The in which the defective enzyme is homogentisic acid key step in the breakdown of homogentisic acid is the breaking open of the phenyl ring. © Jones &1,2-dioxygenase, Bartlett Learning, we now LLC know the clinical conse©- Jones & Bartlett Learning, LLC quences of defects in the other enzymes. Unlike alkap- NOT FORtonuria, SALE which OR DISTRIBUTION is a relatively benign inherited disease,NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 13 08/11/17 8:51 am 14 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones & Bartlett ROOTS Learning, OF LLC DISCOVERY © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION The Black Urine Disease Archibald E. Garrod (1908) St. Bartholomew’s Hospital London, England Inborn Errors© Jones of Metabolism & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Although he was a distinguished physician, Garrod’s lec- and phenylalanin, or it is an intermediate product of nor- tures on the relationship between heredity and congenital mal metabolism, which in alcaptonurics escapes further defects in metabolism had no impact when they were deliv- change . . . It appears to me that the evidence in favour of ered.© The Jones important & Bartlett concept that Learning, one gene corresponds LLC to the theory of© anJones intermediate & Bartlett product Learning, far outweighs LLC that oneNOT enzyme FOR (the “oneSALE gene–one OR DISTRIBUTION enzyme hypothesis”) was which can beNOT brought FOR against SALE it (p. OR 38) . DISTRIBUTION. . developed independently in the 1940s by George W. Beadle The second hypothesis is the one that proved to be a and Edward L. Tatum, who used the bread mold Neuros- cornerstone of modern genetics, connecting Mendel’s pora crassa as their experimental organism. When Beadle laws with metabolic traits. © Jones & finallyBartlett became Learning, aware of Garrod’s LLC hypothesis about inborn© JonesIt & was Bartlett pointed outLearning, [by others] LLC that the mode of inci- NOT FOR SALEerrors of OR metabolism, DISTRIBUTION he was generous in praising it. ThisNOT denceFOR ofSALE alkaptonuria OR DISTRIBUTION finds a ready explanation if the excerpt shows Garrod at his anomaly be regarded as a best, interweaving history, rare recessive character in clinical medicine, heredity, We may further conceive that the splitting of the the Mendelian sense . . . Of “phenyl ring in normal metabolism is the work of a and biochemistry© in Jones his & Bartlett Learning, LLC the© Jonescases of &alkaptonuria, Bartlett Learning,a LLC special enzyme and that in congenital alkaptonuria account of alkaptonuria.NOT The FOR SALE OR DISTRIBUTION veryNOT large FOR proportion SALE ORhave DISTRIBUTION excerpt also illustrates how this enzyme is wanting.” been in the children of first the severity of a genetic dis- cousin marriages . . . It is also ease depends on its social noteworthy that, if one takes context. Garrod writes as though alkaptonuria were a families with five or more children [with both parents © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC harmless curiosity. This is indeed largely true when the life normal and at least one child affected with alkapton- NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION expectancy is short. With today’s longer life span, alkap- uria], the totals work out in strict conformity to Mendel’s tonuria patients accumulate the dark pigment in their car- law, i.e., 57 [normal children]:19 [affected children] in the tilage and joints and can eventually develop arthritis. proportions 3:1 (pp. 23–25). Garrod’s book Inborn Errors of Metabolism, published It is completely understandable why Beadle had high © Jones & inBartlett 1903, dealt Learning, with a number LLC of inherited metabolic disorders,© Jonespraise & for Bartlett Garrod. In Learning, fact, the hypotheses LLC in Inborn Errors NOT FOR SALEbut two chaptersOR DISTRIBUTION (four and five) were devoted to alkapton-NOT ofFOR Metabolism SALE wereOR DISTRIBUTIONin essence those that Beadle and uria. In them, he proposes two critical hypotheses. The first Tatum tested in their experiments with Neurospora. hypothesis relates to the source of the homogentisic acid in Remarkably, Garrod arrived at them through synthesis of the urine of affected individuals. medical and physiological observations (his own and that Two explanations© Jonesare possible & Bartlett [for] the Learning,fact that LLCof others) that were not made© inJones the context & Bartlett of genetic Learning, LLC alcaptonurics excreteNOT homogentisic FOR SALE acid whereas OR DISTRIBUTION normal analysis. Indeed, in 1903, that NOTcontext FOR was in SALE its infancy. OR DISTRIBUTION

persons do not. Either the alcapton acid is a strictly abnor- Source: Harris, H. (1963). Garrod, A. (1903) Inborn errors of metabolism. mal product formed by a perverted metabolism of tyrosin Oxford University Press.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC the othersNOT areFOR very SALE serious. OR The DISTRIBUTION condition known as defects inNOT myelin FOR formation SALE thatOR DISTRIBUTIONdamage a child’s phenylketonuria (PKU) results from the absence of (or developing nervous system and lead to severe intellec- a defect in) the enzyme phenylalanine hydroxylase tual disability. (PAH). When this step in the pathway is blocked, phe- However, if PKU is diagnosed in children soon © Jones &nylalanine Bartlett accumulates. Learning, TheLLC excess phenylalanine is© Jonesenough & Bartlettafter birth, Learning, they can be placedLLC on a specially for- broken down into harmful metabolites that cause mulated diet that is low in phenylalanine. The child is NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 14 08/11/17 8:51 am 1.4 Genetic Analysis 15

Phenylalanine © Jones & Bartlett Learning, LLC A defect in this © JonesThe & Bartlettgenes for theLearning, enzymes in LLC the biochemical path- Each step in a 1 enzyme leads to way in Figure 1.10 have all been identified and the nucle- metabolic pathway Phenylalanine NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTIONhydroxylase accumulation of requires a different phenylalanine and otide sequence of the DNA determined. In the following enzyme. to phenylketonuria. list, and throughout this text, we use the standard typo- graphical convention that genes are written in italic type, Tyrosine A defect in this whereas gene products are not printed in italics. This 2 enzyme leads to © JonesTyrosine & Bartlett Learning, LLCconvention is convenient, because© Jones it means & Bartlett that the proLearning,- LLC aminotransferase accumulation of NOT FOR SALEtyrosine OR and toDISTRIBUTIONtein product of a gene can beNOT represented FOR SALE with the OR same DISTRIBUTION tyrosinemia type II. symbol as the gene itself, but whereas the gene symbol is in italics, the protein symbol is not. In Figure 1.10, the 4-Hydroxyphenyl- pyruvic acid numbers correspond to the following genes and A defect in this enzymes: 3 Each enzyme is 4-Hydroxyphenyl- enzyme leads to 1. PAH encoded© Jones in a & Bartlettpyruvic acid Learning,accumulation LLC of The© gene Jones on& Bartlettthe long arm Learning, of chromosome LLC different gene. dioxygenase 4-hydroxyphenyl- 12 encodes phenylalanine hydroxylase (PAH). NOT FOR SALE OR DISTRIBUTIONpyruvic acid and to NOT FOR SALE OR DISTRIBUTION tyrosinemia type III. 2. The gene TAT on the long arm of chromosome

Homogentisic acid 16 encodes tyrosine aminotransferase (TAT). A defect in this 3. The gene HPD on the long arm of chromosome 4 enzyme leads to Homogentisic acid 12 encodes 4-hydroxyphenylpyruvic acid dioxy- © Jones & Bartlett Learning,1,2-dioxygenase LLC accumulation of © Jones & Bartlett Learning, LLC homogentisic acid genase (HPD). NOT FOR SALE OR DISTRIBUTION and to alkaptonuria. NOT FOR SALE OR DISTRIBUTION 4. The gene HGD on the long arm of chromosome 4-Maleylacetoacetic acid 3 encodes homogentisic acid 1,2 dioxygenase (HGD).

Further breakdown © Jones & Bartlett Learning, LLCSUMMING UP © Jones & Bartlett Learning, LLC FIGURE 1.10 Inborn errorsNOT of metabolism FOR SALE that affect OR the DISTRIBUTION NOT FOR SALE OR DISTRIBUTION breakdown of phenylalanine and tyrosine. An inherited disease ■■ Archbold Garrod identified the genetic basis of results when any of the enzymes is missing or defective. Alkap- “inborn errors of metabolism.” tonuria results from a mutant homogentisic acid 1,2-dioxygenase; phenylketonuria results from a mutant phenylalanine hydroxylase. ■■ Diseases such as alkaptonuria are the result of the absence of a particular enzyme in a bio- © Jones & Bartlett Learning, LLC chemical© Jones pathway. & Bartlett Learning, LLC allowedNOT only FOR as much SALE phenylalanine OR DISTRIBUTION as can be used in ■■ With someNOT inbornFOR SALEerrors ofOR metabolism, DISTRIBUTION the synthesis of proteins, thereby ensuring excess phe- such as phenylketonuria, dietary regulation nylalanine does not accumulate. The special diet is very can prevent adverse symptoms from strict. It excludes meat, poultry, fish, eggs, milk and developing. milk products, legumes, nuts, and bakery goods manu- © Jones &factured Bartlett with Learning, regular flour. LLC These foods are replaced by© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION an expensive synthetic formula. With the special diet, 1.4 Genetic Analysis however, the detrimental effects of excess phenylalanine on intellectual development can largely be The genetic implications of Garrod’s research on inborn avoided, although in adult women with PKU who are errors of metabolism were not widely appreciated, most likely because his writings focused primarily on bio- pregnant, the fetus is at© risk.Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC In many countries, including the United States, all chemical pathways rather than inheritance. And, of newborn babies haveNOT their FORblood SALEtested for OR chemical DISTRIBUTION course, since the genes and NOTenzymes FOR were SALE being studiedOR DISTRIBUTION signs of PKU. Routine screening is cost-effective in humans, the potential for classical genetic analysis because PKU is relatively common. In the United was limited. States, the incidence is about 1 in 8000 among Cauca- The definitive connection between genes and sian ©births. Jones The &disease Bartlett is less Learning, common in LLCother ethnic enzymes came© Jones from studies & Bartlett carried Learning, out in the 1940s LLC by groups. George W. Beadle and Edward L. Tatum using a filamen- InNOT the metabolicFOR SALE pathway OR DISTRIBUTIONdepicted in Figure 1.10, tous fungusNOT Neurospora FOR SALE crassa ,OR commonly DISTRIBUTION called red defects in the breakdown of tyrosine or of 4-hydroxyphe- bread mold—an organism they chose because both nylpyruvic acid lead to types of tyrosinemia. Like PKU, genetic and biochemical analyses could be done with these diseases have severe effects: Type II is associated ease. In these experiments, Beadle and Tatum identified © Jones &with Bartlett skin lesions Learning, and intellectual LLC disability, and Type III© Jonesnew mutations,& Bartlett each Learning, of which LLC caused a block in the with severe liver dysfunction. metabolic pathway for the synthesis of some needed NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 15 08/11/17 8:51 am 16 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones & Bartlett ROOTS Learning, OF LLC DISCOVERY © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION One Gene, One Enzyme George W. Beadle and Edward L. Tatum (1941) Stanford University, Stanford, California Genetic Control© Jones of & Biochemical Bartlett Learning, Reactions LLC in Neurospora© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION How do genes control metabolic processes? The suggestion they point out the limitations of starting with the physiological that genes control enzymes was made very early in the his- basis of a trait (such as black urine disease) and attempting tory of genetics, most notably by the British physician to determine its genetic basis. First, these analyses are lim- Archibald© Jones Garrod & in Bartlett his 1903 book Learning, Inborn Errors LLC of Metabo- ited to traits© whose Jones variants & Bartlettare nonlethal. Learning, Second, the LLC vari- lismNOT. Nevertheless, FOR SALE the precise OR relationship DISTRIBUTION between genes ants must haveNOT visible FOR effects. SALE To get OR around DISTRIBUTION these problems, and enzymes was still uncertain. Perhaps each enzyme is Beadle and Tatum turned the problem on its head. controlled by more than one gene, or perhaps each gene [These limitations] have led us to investigate the general contributes to the control of several enzymes. The classic problem of the genetic control of development and meta- © Jones & experimentsBartlett Learning, of Beadle and LLCTatum showed that the relation-© Jonesbolic reactions& Bartlett by reversing Learning, the ordinary LLC procedure . . . [by NOT FOR SALEship is usually OR DISTRIBUTION remarkably simple: One gene codes for oneNOT settingFOR out]SALE to determine OR DISTRIBUTION if and how genes control known enzyme. Their pioneering biochemical reactions . . . If the experiments united genetics These preliminary results appear to us to indicate organism must be able to and biochemistry, and for the that“ the approach may offer considerable promise as a carry out a certain chemical “one gene, one enzyme”© Jones con- &method Bartlett of learning Learning, more about LLC how genes regulate reaction© Jones to survive & Bartlett on a given Learning, LLC cept, Beadle and TatumNOT were FOR SALE ORdevelopment DISTRIBUTION and function. medium,NOT FOR a mutant SALE unable OR to DISTRIBUTION awarded a Nobel Prize in 1958 ” do this will obviously be lethal (Joshua Lederberg shared the prize for his contributions to on this medium. . . . [It can be] studied, however, if it will grow microbial genetics). Because we now know that some on a medium to which has been added the essential prod- enzymes contain polypeptide chains encoded by two (or uct of the genetically blocked reaction. . . . © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC occasionally more) different genes, a more accurate state- Thus, rather than starting with observed differences in NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ment of the principle is “one gene, one polypeptide.” Beadle traits among individuals, Beadle and Tatum started by gen- and Tatum’s experiments also demonstrate the importance erating mutations (in their case, mutations resulting from of choosing the right organism. Neurospora had been intro- X-irradiation of Neurospora cells) and then identified those duced as a genetic organism only a few years earlier, and that on minimal medium are lethal, but on medium supple- © Jones & BeadleBartlett and TatumLearning, realized LLC that they could take advantage© Jonesmented & withBartlett the normal Learning, product of LLC the mutated gene. This NOT FOR SALEof this organism’s OR DISTRIBUTION ability to grow on a simple medium com-NOT experimentalFOR SALE approach OR DISTRIBUTION ranks among the most important posed of known substances. experimental tool of genetic analysis.

Beadle and Tatum’s work was published in 1941 and Source: G. W. Beadle and E. L. Tatum, Genetic Control of Biochemical can be found at the reference at the end of this feature. In it, Reactions in Neurospora. Proc. Natl. Acad. Sci. USA 27 (1941): 499–506. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

nutrient, and showed that each of these blocks corre- Mutant Genes and Defective Proteins sponded to a defective enzyme needed for one step in N. crassa grows in the form of filaments on a great variety the pathway. Their research was important not only © Jones & Bartlett Learning, LLC of substrates,© Jones including & Bartletta laboratory Learning, medium contain LLC - because it solidified the link between genetics and bio- ing only inorganic salts, a sugar, and the vitamin biotin. chemistry,NOT FOR but SALE also because OR DISTRIBUTION their experimental Such a minimalNOT FORmedium SALE contains OR DISTRIBUTIONonly the nutrients approach, now called genetic analysis, has been suc- that are essential for growth of the organism. The cessfully applied to understanding a wide range of bio- N. crassa filaments consist of a mass of branched threads logical processes, from the genetic control of the cell separated into interconnected, multinucleate compart- cycle and cancer to the genetic influences on develop- © Jones & Bartlett Learning, LLC © Jonesments, & whichBartlett allow Learning, free interchange LLC of nuclei and cyto- ment and behavior. For this reason, we will examine plasm. Each nucleus contains a single set of seven NOT FORthe SALE Beadle‒—Tatum OR DISTRIBUTION experiments in some detail. NOT chromosomes.FOR SALE OR Beadle DISTRIBUTION and Tatum recognized that the

9781284136609_CH01_Hartl.indd 16 08/11/17 8:51 am 1.4 Genetic Analysis 17

© Jones ability& Bartlett of Neurospora Learning, to growLLC in minimal medium© Jonesmutation & Bartlett affecting Learning, synthesis of LLC an essential nutrient NOT FORimplied SALE that OR the DISTRIBUTION organism must be able to synthesize allNOT wouldFOR SALEbe expected OR toDISTRIBUTION germinate and grow in complete metabolic components other than biotin. If the biosyn- medium. thetic pathways needed for growth are controlled by To identify which of the irradiated ascospores con- genes, then a mutation in a gene responsible for synthe- tained a new mutation affecting the synthesis of an sizing an essential nutrient would be expected to render essential nutrient, conidia from each culture were trans- a strain unable to grow© unlessJones the & strain Bartlett was providedLearning, LLCferred to minimal medium© ( FIGUREJones &1.12A Bartlett). The vastLearning, LLC with the nutrient. NOT FOR SALE OR DISTRIBUTIONmajority of cultures could NOTgrow onFOR minimal SALE medium; OR DISTRIBUTION These ideas were tested in the following way. Spores these were discarded because they lacked any new of nonmutant Neurospora were irradiated with either mutation of the desired type. The retained cultures were x-rays or ultraviolet light to produce mutant strains with the small number unable to grow in minimal medium, various nutritional requirements. (Why these treat- because they contained a new mutation blocking the ments© causeJones mutations & Bartlett is discussed Learning, in the LLC Mutation, synthesis of© some Jones essential & Bartlett nutrient. Learning, LLC Repair,NOT and RecombinationFOR SALE chapter.) OR DISTRIBUTION The isolation of a set SamplesNOT from FOR a portion SALE of OR each DISTRIBUTION mutant culture of mutants affecting any biological process—in this case, were then transferred to a series of media to determine metabolism—is called a mutant screen. In the initial whether the mutation resulted in a requirement for a step for identifying mutants, summarized in vitamin, an amino acid, or some other substance FIGURE 1.11, the irradiated spores (purple) were used (FIGURE 1.12B). In the example illustrated, the © Jones &in crossesBartlett with Learning, an untreated LLC strain (green). Ascospores© Jonesmutant & Bartlettstrain requires Learning, one (or possibly LLC more than one) NOT FORproduced SALE OR by the DISTRIBUTION sexual cycle in fruiting bodies wereNOT aminoFOR SALE acid, because OR DISTRIBUTION a mixture of all amino acids individually germinated in a complete medium—that added to the minimal medium allows growth. Because is, a complex medium enriched with a variety of amino the proportion of irradiated cultures with new muta- acids, vitamins, and other substances expected to be tions was very small, only a negligible number of cul- essential metabolites whose synthesis could be blocked tures contained two or more new mutations that had by a mutation. Even those© Jones ascospores & Bartlett containing Learning, a new LLCoccurred simultaneously. © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Filamentous mycelium grows in complete medium and many gentically identical © Jones & Bartlett Learning, LLC © Jonesasex ual& sporesBartlett are prLearning,oduced. LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Asexual spores (conidia) Spore exposed to x-rays or Asexual ultraviolet light cycle © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC An ascospore is placed NOT FOR SALE OR DISTRIBUTION in complete mediumNOT FOR SALE OR DISTRIBUTION in a test tube. Fruiting body Ascus Mycelium

Sexual© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC cycleNOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Germination of ascospore

FIGURE 1.11 Beadle and Tatum obtained mutants of the filamentous fungus Neurospora crassa by exposing asexual spores to x-rays or ultraviolet light. The treated spores were used to start the sexual cycle in fruiting bodies. After any pair of cells and their nuclei undergo © Jones &fusion, Bartlett meiosis takesLearning, place almost LLC immediately and results in eight© sexual Jones spores & (ascospores)Bartlett includedLearning, in a single LLC ascus. These are removed individually and cultured in complete medium. Ascospores that carry new nutritional mutants are identified later by their inability NOT FORto SALE grow in minimal OR DISTRIBUTION medium. NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 17 08/11/17 8:51 am 18 CHAPTER 1 Genes, Genomes, and Genetic Analysis

(A) Test for nutritional mutants (B) Test for required nutrient © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Asexual Asexual spores spores (conidia) (conidia) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Complete Complete Minimal Minimal MM + MM + MM + medium medium medium medium vitamins amino nucleic acid © Jones & Bartlett(MM) Learning, LLC (MM) © Jones & Bartlettacids precursor Learning,s LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Most strains grow A few strains fail to Mutant strains are tested on MM in MM; these are grow in MM; these supplemented with mixtures of nonmutant and are mutant and are nutrients. The mutant strain are discarded. kept for futher study. here requires amino acids to grow. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION (C) Test for specific amino acid (D) Test of arginine precursors

NOTMM FOR + SALEMM + ORMM +DISTRIBUTIONMM + MM + MM + MM + NOTMM FOR + SALEMM + ORMM DISTRIBUTION + leucine valine glycine serine arginine lysine proline ornithine citrulline arginine

Mutant strains requiring amino acids are tested on MM Mutant strains requiring arginine supplemented with each of the amino acids in turn. are tested on MM supplemented © Jones & BartlettThe Learning, mutant strain LLC here requires arginine to grow©. Jones & Bartlettwith possible Learning, precursors LLC of arginine. This mutant strain grows on citrulline NOT FOR SALE OR DISTRIBUTION NOT FOR SALEor arginine OR , DISTRIBUTIONbut not ornithine.

FIGURE 1.12 (A) Mutant spores can grow in complete medium but not in minimal medium. (B) Each new mutant is tested for growth in minimal medium supplemented with a mixture of nutrients. (C) Mutants that can grow on minimal medium supplemented with amino acid are tested with each amino acid individually. (D) Mutants unable to grow in the absence of arginine are tested with likely precursors of arginine. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

For nutritional mutants requiring amino acids, fur- citrulline. All mutants requiring arginine, therefore, ther experiments testing each amino acid individually were tested in medium supplemented with either ornithine alone or citrulline alone (FIGURE 1.12D). One usually© Jones revealed & that Bartlett only one Learning, additional LLC amino acid © Jones & Bartlett Learning, LLC was needed in the minimal medium to support class of arginine-requiring mutants, designated Class I, growth.NOT In FORFIGURE SALE 1.12C OR, the DISTRIBUTION mutant strain requires was able toNOT grow FOR in minimal SALE mediumOR DISTRIBUTION supplemented the amino acid arginine. As early as the 1940s, some with either ornithine, citrulline, or arginine. Other of the possible intermediates in amino acid biosynthe- mutants, designated Class II, were able to grow in sis had been identified. They were recognized by their minimal medium supplemented with either citrulline or arginine, but not ornithine. A third class, Class III, © Jones &chemical Bartlett resemblance Learning, to LLCthe amino acid and by their© Jones & Bartlett Learning, LLC presence at low levels in the cells of organisms. In the was able to grow only in minimal medium supple- NOT FORcase SALE of arginine, OR DISTRIBUTION two candidates were ornithine andNOT mentedFOR SALE with arginine. OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 18 08/11/17 8:51 am 1.4 Genetic Analysis 19

© Jones & BartlettThe types Learning, of arginine-requiring LLC mutants illustrate the© Jonesthat the& Bartlettinferred enzymes Learning, were actuallyLLC present in non- NOT FORlogic SALE of genetic OR analysisDISTRIBUTION as applied to metabolic pathways.NOT mutantFOR SALE strains OR but DISTRIBUTIONeither absent or nonfunctional in The logic is easiest to see in the context of the metabolic mutant strains. FIGURE 1.13 pathway, shown in , where arginine is the Complementation Test for Mutations end product of a linear metabolic pathway starting with some precursor metabolite, and ornithine and citrulline in the Same Gene are intermediates in the© Jonespathway. & The Bartlett mutants Learning, support LLCBeadle and Tatum were fortunate© Jones to study& Bartlett metabolic Learning, LLC this structure of the pathwayNOT FOR for the SALE following OR reasons: DISTRIBUTIONpathways in a relatively simpleNOT organism FOR SALE in which OR one DISTRIBUTION ■■ Mutants able to grow in the presence of either gene corresponds to one enzyme. In such a situation, ornithine, citrulline, or arginine must have a genetic analysis of the mutants reveals a great deal more metabolic block between the precursor metabo- about the metabolic pathway than merely the order of lite and both of the intermediates. the intermediates. When each mutation is classified ©■■ Mutants Jones able& Bartlett to grow Learning, only in the LLC presence of according to© theJones particular & Bartlett gene it is Learning,in, and when LLC all the NOTarginine FOR must SALE have OR a metabolicDISTRIBUTION block in the mutationsNOT in each FOR gene SALE are grouped OR DISTRIBUTION together, each set pathway between arginine and the most “down- of mutations—and therefore each individual gene— stream” of the intermediates. corresponds to one enzymatic step in the metabolic pathway. In Figure 1.13, for example, the mutants in ■■ Mutants able to grow in the presence of citrulline Class I each correspond to one of three genes, which or arginine but not ornithine imply that orni- © Jones & Bartlett Learning, LLC © Jonesimplies & Bartlett that there Learning, are three stepsLLC in the pathway thine is “upstream” from citrulline in the meta- NOT FOR SALE OR DISTRIBUTION NOT betweenFOR SALE the precursor OR DISTRIBUTION and ornithine. Similarly, the bolic pathway. mutants in Class III each correspond to one of two The structure of the pathway was further confirmed genes, which implies that there are two steps in the by the observations that Class III mutants accumulate pathway between citrulline and arginine. However, all citrulline and Class II mutants accumulate ornithine. of the mutants in Class II have mutations in the same Finally, it was shown ©by Jonesdirect biochemical & Bartlett experiment Learning, LLCgene, which implies only© one Jones step in& theBartlett pathway Learning, LLC NOT FOR SALE OR DISTRIBUTIONbetween ornithine and citrulline.NOT FOR SALE OR DISTRIBUTION Mutations that have defects in the same gene are identified by means of a complementation test, in Precursor Each step in the biochemical pathway is catalyzed by the which two mutations are brought together into the enzyme product of a different same cell. In most multicellular organisms and even gene. © Jones & Bartlett Learning, LLC some sexual© unicellularJones & organisms,Bartlett Learning, the usual way LLC to do ClassNOT I mutants FOR SALE OR DISTRIBUTION this is by meansNOT FORof a mating. SALE When OR DISTRIBUTIONtwo parents, each (three complementation carrying one of the two mutations, are crossed, fertiliza- groups) Some intermediates in the biochemical pathway may tion brings the reproductive cells containing the two not be known. mutations together. As the result of ordinary cell division, each cell in the offspring then carries one copy of © Jones & Bartlett Learning, LLCNH2 O © Joneseach &mutant Bartlett gene. Learning, In Neurospora, LLC this procedure does

NOT FOR SALE ORNH 2 DISTRIBUTIONCH2 CH2 CH2 C C NOT notFOR work SALE because OR nuclearDISTRIBUTION fusion is followed almost Ornithine H OH immediately by the formation of ascospores, each of Class II mutants When the intermediates which has only one set of chromosomes. (one complementation are known, the order of Complementation tests are nevertheless possible in group) steps in the pathway can be determined. Neurospora owing to the multinucleate nature of the fila- © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC O NH2 O ments. Certain strains, including those studied by Beadle NOT FOR SALE OR DISTRIBUTIONand Tatum, have the propertyNOT that FOR when SALE the filaments OR DISTRIBUTION NH2 C NH CH2 CH2 CH2 C C from two mutant (or nonmutant) organisms come into Citrulline H OH physical contact, the filaments fuse and the new filament contains multiple nuclei from each of the participating The intermediate at this Class III mutants partners. This sort of hybrid filament, which is called a (two complementation© Jones & Bartlett Learning,step was later shownLLC to be © Jones & Bartlett Learning, LLC groups) argininosuccinate. heterokaryon, contains mutant forms of both genes. The NOT FOR SALE OR DISTRIBUTION word rootsNOT of the FOR term SALE heterokaryon OR DISTRIBUTION mean “different nuclei.” (A list of the most common word roots used in NH NH 2 O genetics can be found at the end of this text.) NH2 C NH CH2 CH2 CH2 C C When a heterokaryon formed from two nutritional Arginine H OH © Jones & Bartlett Learning, LLC © Jonesmutants & Bartlett is inoculated Learning, into minimal LLC medium, it may FIGURE 1.13 Metabolic pathway for arginine biosynthesis either grow or fail to grow. If it grows in minimal NOT FORinferred SALE from OR genetic DISTRIBUTION analysis of Neurospora mutants. NOT medium,FOR SALE the OR mutant DISTRIBUTION genes are said to undergo

9781284136609_CH01_Hartl.indd 19 08/11/17 8:51 am 20 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones complementation& Bartlett Learning,, and thisLLC result indicates that the© Jonescomplements & Bartlett the Learning,defective purple LLC gene in the purple NOT FORmutations SALE OR are inDISTRIBUTION different genes. Conversely, if the het-NOT nucleus,FOR SALE and vice OR versa. DISTRIBUTION The logic of complementation erokaryon fails to grow in minimal medium, the result is captured in the ancient nursery rhyme, “Jack Sprat indicates noncomplementation, and the two muta- could eat no fat / His wife could eat no lean / And so tions are inferred to be in the same gene. between the two of them / They licked the platter To illustrate this concept, let’s consider two hypo- clean,” because each partner makes up for the defect in thetical examples: © Jones & Bartlett Learning, LLCthe other. © Jones & Bartlett Learning, LLC 1. HeterokaryonsNOT are formed FOR betweenSALE OR Class DISTRIBUTION II and Part B in Figure 1.14 showsNOT a heterokaryonFOR SALE formedOR DISTRIBUTION Class III mutants. In this case, the nuclei contain- between mutants with defects in the same gene—in this ing the Class II mutants are unable to convert case, purple. Both of the purple nuclei encode a normal ornithine to citrulline, but they do produce the form of the red protein, but each purple nucleus enzyme (or enzymes) necessary to convert citrul- encodes a defective purple protein. When the nuclei are ©line Jones to arginine. & Bartlett The Class Learning, III mutants, LLC in con- together, two© Jones different & mutant Bartlett forms Learning, of the purple LLC pro- NOTtrast, FOR can SALE perform OR the DISTRIBUTION ornithine-to-citrulline tein are produced,NOT FOR so theSALE biosynthetic OR DISTRIBUTION pathway that conversion, but they are unable to convert citrul- requires the purple protein is still blocked and the het- line to arginine. In the same heterokaryon, erokaryon is unable to grow in minimal medium. In therefore, both steps can occur, so that growth other words, the mutants 2 and 3 in Figure 1.14 fail to on minimal medium occurs. These two muta- complement, so they are judged to have mutations in © Jones & Bartletttions areLearning, said to be LLCcomplementary. © Jonesthe same & Bartlett gene. Learning, LLC The following principle underlies the complemen- NOT FOR SALE2. Heterokaryons OR DISTRIBUTION are formed between two inde-NOT FOR SALE OR DISTRIBUTION tation test: pendently derived Class II mutations. Neither of these mutations can carry out the ornithine-to- Principle of Complementation: A complemen- citrulline step; hence no growth on minimal tation test brings two mutant genes together in medium will occur. These mutations are the same cell or organism. If this cell or organism noncomplementary© Jones. & Bartlett Learning, LLCis nonmutant, the mutations© Jones are said & toBartlett comple -Learning, LLC NOT FOR SALE OR DISTRIBUTIONment each other, and theNOT parental FOR strainsSALE must OR DISTRIBUTION Now let’s consider two Class III mutations. Are they have mutations in different genes. If the cell or complementary? If the citrulline-to-arginine conversion organism is mutant, the mutations fail to comple- includes only a single biochemical step, then we would ment each other, and the parental mutations expect them to be noncomplementary. Beadle and must be in the same gene. These latter mutations Tatum, however, discovered that some pairs of mutants © Jones & Bartlett Learning, LLC form a complementation© Jones & Bartlett group Learning,. LLC did complementNOT FOR eachSALE other, OR whereasDISTRIBUTION others did not. NOT FOR SALE OR DISTRIBUTION The theory that one gene codes for one enzyme led them to conclude that more than one enzyme is required for Analysis of Complementation Data this step. In the mutant screen for Neurospora mutants requiring The inferences from complementation or non arginine, Beadle and Tatum found that mutants in © Jones &complementation Bartlett Learning, emerge LLC from the logic illustrated in© Jonesdiffer &ent Bartlett classes (ClassLearning, I, Class LLC II, and Class III in FIGURE 1.14. Here the multinucleate filament is shown, Figure 1.13) always complemented one another. This NOT FORand SALE the mutant OR DISTRIBUTION nuclei are color coded according toNOT resultFOR makesSALE senseOR DISTRIBUTION because the genes in each class which of two different genes (red or purple) is mutant. encode enzymes that act at different levels between the The red and purple lines represent the proteins encoded known intermediates. However, some of the mutants in the mutant nuclei, and an asterisk represents a in Class I failed to complement others in Class I, and defect in the protein ©at Jonesthat position & Bartlett resulting Learning, from a LLCsome in Class III failed to complement© Jones others& Bartlett in Class Learning, III. LLC mutation in the corresponding gene. These results allow the number of genes in each class to Part A depicts theNOT situation FOR in SALE which ORthe mutantDISTRIBUTION be identified. NOT FOR SALE OR DISTRIBUTION strains have mutations in different genes. In the hetero- To illustrate this aspect of genetic analysis, we will karyon, the red nuclei produce mutant forms of the red consider six mutant strains in Class III. These strains were protein and normal forms of the purple protein, taken in pairs to form heterokaryons and their growth whereas© Jones the purple & Bartlett nuclei produce Learning, mutant LLC forms of the on minimal© Jonesmedium & assessed. Bartlett The Learning, data are shown LLC in purple protein and normal forms of the red protein. FIGURE 1.15. The mutant genes in the six strains are The resultNOT isFOR that theSALE red/purple OR DISTRIBUTION heterokaryon has nor- denoted x1NOT, x2, and FOR so forth, SALE and OR the data DISTRIBUTION are presented in mal forms of both the red and purple protein. It also the form of a matrix in which a plus sign (1) indicates has mutant forms of both proteins, but these do not growth in minimal medium (complementation) and a matter. What matters is that the normal forms allow minus sign (2) indicates lack of growth in minimal © Jones &the Bartlett heterokaryon Learning, to grow LLC on minimal medium© Jonesmedium & Bartlett (lack of complementation). Learning, LLC The diagonal entries because all needed nutrients can be synthesized. In are all minus signs, which reflects the fact that two copies NOT FORother SALE words, OR the DISTRIBUTION normal purple gene in the red nucleusNOT ofFOR the identical SALE mutationOR DISTRIBUTION cannot show complementation.

9781284136609_CH01_Hartl.indd 20 08/11/17 8:51 am 1.4 Genetic Analysis 21

(A) (B) © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE ORMutant DISTRIBUTION 1 MutantNOT 2 FOR SALE OR DISTRIBUTIONMutant 3

Complementation No complementation © Jones(mutations & Bartlett in different Learning,genes) LLC (mutations in same gene)© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Complementation Non-complementation Growth on minimal No growth on minimal © Jones &medium Bartlett Learning, LLC © Jones &medium Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

FIGURE 1.14 Molecular interpretation of a complementation test using heterokaryons to determine whether two mutant strains have mutations in different genes (A) or mutations in the same gene (B). In (A), each nucleus contributes a nonmutant form of one or the other polypeptide chain, so the heterokaryon is able to grow in minimal medium. In (B), both nuclei contribute a mutant form of the same polypep- © Jones &tide Bartlett chain; hence, Learning, no nonmutant LLC form of that polypeptide can be synthesized© Jones and & the Bartlett heterokaryon Learning, is unable to grow LLC in minimal medium. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

The pattern of 1 and 2 signs in the matrix indicates that The mutations in Figure 1.15 therefore represent mutations x1 and x5 fail to complement each other; hence two genes, and mutation of any one of them results in x1 and x5 are mutations in the same gene. Likewise, muta- the inability of the strain to convert citrulline to argi- tions x2, x3, x4, and x6 ©fail Jones to complement & Bartlett one another Learning, in LLCnine. On the assumption that© Jones one gene & Bartlettencodes one Learning, LLC all pairwise combinations;NOT hence FOR x2 SALE, x3, x4, andOR x6 DISTRIBUTION are all enzyme, which is largely trueNOT for FOR metabolic SALE enzymes OR DISTRIBUTION mutations in the same gene, but a different gene from that in Neurospora, the pathway from citrulline to arginine represented by x1 and x5. depicted in Figure 1.13 must consist of two steps, with Each of the groups of noncomplementary muta- an unknown intermediate in between the steps. This complementation group tions is called a . As we have seen, intermediate was later found to be argininosuccinate. each© complementation Jones & Bartlett group Learning, defines a gene,LLC so the Likewise,© the Jones Class I& mutants Bartlett define Learning, three comple LLC - complementationNOT FOR SALE test actually OR DISTRIBUTION provides the geneticist’s mentationNOT groups, FOR so thereSALE are OR three DISTRIBUTION enzymatic steps operational definition: from the precursor to ornithine. These intermediates A gene is defined experimentally as a set of also were soon identified. Finally, Class II mutations mutations that make up a single complementa- all fail to complement one another, and the finding of tion group. Any pair of mutations within a © Jones & Bartlett Learning, LLC © Jonesonly one& Bartlett complementation Learning, group LLC means that there is complementation group fails to complement but a single enzymatic step that converts ornithine to NOT FOR SALEeach other. OR DISTRIBUTION NOT citrulline.FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 21 08/11/17 8:51 am 22 CHAPTER 1 Genes, Genomes, and Genetic Analysis

A plus sign in the complementation years many more Nobel Prizes in Physiology or Medi- © Jones & Bartlett Learning,matrix means LLC that the indicated © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONmutations do complement one NOT cineFOR were SALE awarded OR DISTRIBUTIONin which genetic analysis carried another. out along the lines of Beadle and Tatum played a significant role. Here is a list, with quotations from the official x1 x2 x3 x4 x5 x6 citations of the Nobel Foundation: x1 _ + + + _ + ■■ 1958: George Beadle and Edward Tatum “for ©_ Jones_ _ & Bartlett_ Learning, LLC © Jones & Bartlett Learning, LLC x2 + their discovery that genes act by regulating defi- NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION _ _ + _ nite chemical events,” shared with Joshua Leder- x3 berg “for his discoveries concerning genetic _ _ x4 + recombination and the organization of the A minus sign in the x5 _ + genetic material of bacteria.” complementation ■■ 1965: François Jacob, André Lwoff, and Jacques © Jones & Bartlett Learning,_ LLC © Jones & Bartlett Learning, LLC matrix means that the x6 Monod “for their discoveries concerning genetic NOTindicated FOR mutations SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION do not complement control of enzyme and virus synthesis.” one another. ■■ 1995: Edward B. Lewis, Christiane Nüsslein- Volhard, and Eric F. Wieschaus “for their discov- FIGURE 1.15 Interpreting the results of complementation eries concerning the genetic control of early © Jones &tests. Rows Bartlett and Learning, columns are particular, LLC independently derived © Jones & Bartlett Learning, LLC mutations. Pluses indicate pairs that complement; minuses embryonic development.” NOT FORare ones SALE that OR do not.DISTRIBUTION A complementation group is defined as NOT FOR■■ 2001:SALE Leland OR DISTRIBUTION H. Hartwell, Tim Hunt, and Sir all mutations that do not complement one another but do complement all other mutations. In this case, x1 and x4 Paul Nurse “for their discoveries of key regulators constitute one group, while x2, x3, x4, and x6 make up a of the cell cycle.” second group. ■■ 2002: Sydney Brenner, H. Robert Horvitz, and © Jones & Bartlett Learning, LLC John E. Sulston “for ©their Jones discoveries & Bartlett concerning Learning, LLC NOT FOR SALE OR DISTRIBUTION genetic regulation ofNOT organ FOR development SALE OR and DISTRIBUTION programmed cell death.” Other Applications of Genetic Analysis ■■ 2007: Mario R. Capecchi, Martin J. Evans, and The type of genetic analysis pioneered by Beadle and Oliver Smithies “for their discoveries of principles Tatum is immensely powerful for identifying the genetic for introducing specific gene modifications in control© Jonesof complex & Bartlettbiological processes.Learning, Their LLC approach mice© byJones the use & of Bartlett embryonic Learning, stem cells.” LLC lays out a systematic path—a cookbook if you will—for NOT FOR SALE OR DISTRIBUTION ■■ 2009:NOT Elizabeth FOR SALEBlackburn, OR CarolDISTRIBUTION Greider, and gene discovery, one that we will see used repeatedly Jack Szostak “for the discovery of how chromo- throughout this text: somes are protected by telomeres and the enzyme 1. Decide which process you want to study, and telomerase.” figure out which characteristics would be dis- ■■ 2013: James Rothman, Randy Shekman, and © Jones & Bartlettplayed Learning, by mutant organismsLLC with a disruption© Jones &Thomas Bartlett Sudhof Learning, “for their LLC discoveries of machin- NOT FOR SALEin thatOR process.DISTRIBUTION NOT FOR erySALE regulating OR DISTRIBUTION vesicle traffic, a major transport 2. Perform mutant screening for mutants showing system in our cells.” these characteristics. ■■ 2015: Tomas Lindahl, Paul Modrich, and 3. Carry out complementation tests to find out how Aziz Sancar “for mechanistic studies of many different© genes Jones you &have Bartlett identified. Learning, LLC DNA repair.” © Jones & Bartlett Learning, LLC 4. Identify the products of those genes, and deter- NOT FOR SALE OR DISTRIBUTIONThe Beadle and Tatum experimentsNOT FOR establishedSALE OR that DISTRIBUTION mine what they do, how they interact with each a defective enzyme results from a mutant gene, but other, and in which order they function. how? For all they knew, genes were enzymes. This Beadle and Tatum analyzed many metabolic path- would have been a logical hypothesis at the time. We ways© for Jones a wide &variety Bartlett of essential Learning, nutrients, LLC but their now know© thatJones the relationship& Bartlett betweenLearning, genes LLC and experiments were especially important in deciphering enzymes is somewhat indirect. With a few exceptions, the pathwaysNOT FOR of aminoSALE acid OR biosynthesis. DISTRIBUTION Their find- each enzymeNOT is encoded FOR inSALE a particular OR DISTRIBUTION sequence of nucle- ings over the span of just a few years were remarkable, otides present in a region of DNA. The DNA region that in that they deduced much more about the nature of codes for the enzyme, as well as adjacent regions that biosynthetic pathways than had been learned from regulate when and in which cells the enzyme is pro- © Jones &decades Bartlett of biochemical Learning, research. LLC Beadle and Tatum© Jonesduced, & makeBartlett up the Learning, “gene” that LLC encodes the enzyme. were awarded the 1958 Nobel Prize in Physiology or Next, we turn to the issue of how genes code for enzymes NOT FORMedicine SALE OR for theirDISTRIBUTION research, and in the interveningNOT andFOR other SALE proteins. OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 22 08/11/17 8:51 am 1.5 Gene Expression: The Central Dogma 23

© Jones &SUMMING Bartlett Learning, UP LLC © JonesNucleotide & Bartlett sequence Learning,ATGTCCA LLCCTGCGGTCCTGGAA in DNA molecule TACAGGTGACGCCAGGACCTT NOT FOR SALE■■ Genetic OR analysis DISTRIBUTION is an experimental NOT FOR SALE OR DISTRIBUTION methodology whereby inferences based on the outcomes of genetic crosses can be used to TRANSCRIPTION elucidate a wide variety of biological processes. ■■ Using Neurospora© crassa Jones, Beadle & Bartlett and Tatum Learning, LLC © Jones & Bartlett Learning, LLC developed the methods of mutant screening. NOT FOR SALE OR DISTRIBUTIONTwo-step decoding NOTAn RNA FOR intermediate SALE OR DISTRIBUTION ■■ Complementation analysis is a powerful means process synthesizes plays the role of for determining the number of steps in a a polypeptide. “messenger” biochemical pathway. ■■ These analyses led Beadle and Tatum to the “one© Jones gene, one& Bartlett enzyme” Learning,hypothesis. LLC © Jones & BartlettTRANSLATION Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Amino acid sequence 1.5 Gene Expression: The Central in polypeptide chain Met Ser Thr Ala ValLeu Glu Dogma ATGTCCACTGCGGTCCTGGAA DNA triplets encoding each amino acid © Jones &Watson Bartlett and Learning,Crick were correct LLC in proposing that the© Jones & Bartlett Learning, LLC NOT FORgenetic SALE information OR DISTRIBUTION in DNA is contained in the sequenceNOT FIGUREFOR SALE1.16 DNA OR sequence DISTRIBUTION coding for the first seven amino acids in a polypeptide chain. The DNA sequence specifies the amino acid of bases in a manner analogous to letters printed on a strip sequence through a molecule of RNA that serves as an intermediary of paper. In a region of DNA that directs the synthesis of a “messenger.” Although the decoding process is indirect, the net protein, the genetic code for the protein is contained in result is that each amino acid in the polypeptide chain is specified by only one strand, and it is decoded in a linear order. A typi- a group of three adjacent bases in the DNA. In this example, the polypeptide chain is that of phenylalanine hydroxylase (PAH). cal protein is made up ©of oneJones or more & Bartlett polypeptide Learning, chains; LLC © Jones & Bartlett Learning, LLC each polypeptide chainNOT consists FOR of SALE a linear OR sequence DISTRIBUTION of NOT FOR SALE OR DISTRIBUTION amino acids connected end to end. For example, the enzyme PAH consists of four identical polypeptide chains, each 452 amino acids in length. In the decoding of DNA, Figure 1.16 indicates that DNA codes for protein not directly but indirectly through the processes of transcrip- each ©successive Jones “code & Bartlett word” in Learning,the DNA specifies LLC the next © Jones & Bartlett Learning, LLC amino acid to be added to the polypeptide chain as it is tion and translation. The indirect route of information beingNOT made. FOR The amount SALE of OR DNA DISTRIBUTION required to code for the transfer is thus:NOT FOR SALE OR DISTRIBUTION polypeptide chain of PAH is therefore 452 3 3 = 1356 DNA → RNA → Protein nucleotide pairs. The entire gene is very much longer— about 90,000 nucleotide pairs. Only 1.5 percent of the This relationship leads us to the central dogma of gene is devoted to coding for the amino acids. The non- molecular genetics. The term dogma means “set of © Jones &coding Bartlett part includesLearning, some LLC sequences that control the© Jonesbeliefs”; & Bartlettit dates from Learning, the time the LLC idea was put forward NOT FORactivity SALE of ORthe gene, DISTRIBUTION but it is not known how much of theNOT firstFOR as SALEa theory. OR Since DISTRIBUTION then the “dogma” has been con- gene is involved in regulation. firmed experimentally, but the term persists. The main There are 20 different amino acids encoded by DNA. concept in the central dogma, as stated by Francis Crick Only four bases code for these 20 amino acids, with each in 1958, is as follows: “word” in the genetic code consisting of three adjacent © Jones & Bartlett Learning, LLCOnce “information” has© passed Jones into & Bartlett protein, itLearning, LLC bases. For example, the base sequence ATG specifies the cannot get out again. amino acid methionineNOT (Met), FOR TCC SALEspecifies OR serine DISTRIBUTION (Ser), NOT FOR SALE OR DISTRIBUTION ACT specifies threonine (Thr), and GCG specifies alanine With respect to gene expression in most cells, the (Ala). There are 64 possible three-base combinations but central dogma can be illustrated as in FIGURE 1.17. The only 20 amino acids because some combinations specify “information” is that which is encoded in DNA, and the same© Jones amino & acid. Bartlett For example, Learning, TCT, LLC TCC, TCA, which specifies© Jones the sequences & Bartlett of proteins.Learning, Its passage LLC TCG, AGT, and AGC all code for serine (Ser), and CTT, from DNA to protein does not occur directly, but rather CTC,NOT CTA, CTG,FOR TTA, SALE and ORTTG allDISTRIBUTION code for leucine (Leu). through interactionsNOT FOR with SALE the ORintermediary DISTRIBUTION molecule An example of the relationship between the nucleo- known as ribonucleic acid (RNA). The structure of tide sequence in a DNA duplex and the amino acid RNA is similar, but not identical, to the structure of sequence of the corresponding protein is shown in DNA. There is a difference in the sugars in DNA and FIGURE 1.16 ribose © Jones & Bartlett .Learning, This particular LLC DNA duplex is the human© JonesRNA &(RNA Bartlett contains Learning, the sugar LLC instead of deoxy- sequence that codes for the first seven amino acids in the ribose), RNA is usually single-stranded (not a duplex), NOT FORpolypeptide SALE OR chain DISTRIBUTION of PAH. The scheme outlined inNOT andFOR RNA SALE contains OR the DISTRIBUTION base uracil (U) instead of thymine

9781284136609_CH01_Hartl.indd 23 08/11/17 8:51 am 24 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones & Bartlett Learning,DNA LLC © Jones &participates Bartlett Learning, in translation, LLC its amino acid NOT FOR SALE OR DISTRIBUTION NOT FOR becomesSALE OR the DISTRIBUTION terminal subunit added to the length of the growing polypeptide chain. TRANSCRIPTION A tRNA that carries methionine is denoted tRNAMet, one that carries serine is denoted tRNASer, and so forth. (Because there are more © Jones & Bartlett Learning, LLC than 20 different tRNAs© Jones but & only Bartlett 20 amino Learning, LLC rRNA mRNA tRNA acids, some amino acids correspond to more (ribosomal) NOT(messenger) FOR SALE (transfer)OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION than one tRNA.) The central dogma is the fundamental principle of molecular genetics because it summarizes how the Ribosome genetic information in DNA becomes expressed in the © Jones & Bartlett Learning, LLC amino acid© sequence Jones in& aBartlett polypeptide Learning, chain: LLC NOT FOR SALE OR DISTRIBUTION The sequenceNOT FOR of nucleotides SALE OR in a DISTRIBUTION gene specifies TRANSLATION the sequence of nucleotides in a molecule of messenger RNA; in turn, the sequence of nucleotides in the messenger RNA specifies the sequence of amino acids in the polypeptide chain. © Jones & Bartlett Learning,Pro LLCtein © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FORGiven SALE a process OR DISTRIBUTIONas conceptually simple as DNA cod- FIGURE 1.17 Gene expression at the molecular level. DNA codes ing for protein, what might account for the additional for RNA, and RNA codes for protein. The DNA → RNA step is complexity of RNA intermediaries? One possible expla- transcription, and the RNA → protein step is translation. → nation is that an RNA intermediate gives another level for control—for example, by degrading the mRNA for an © Jones & Bartlett Learning, LLCunneeded protein. © Jones & Bartlett Learning, LLC (T), which is present inNOT DNA. FOR Information SALE flow OR between DISTRIBUTION Another possible reasonNOT may FOR be historical. SALE OR RNA DISTRIBUTION DNA and RNA follows the rules of Watson–Crick base structure is unique in having both informational con- pairing, and as we will see elsewhere in this text, in tent present in its sequence of bases and a complex, some cases it can occur in both directions (DNA → RNA folded three-dimensional structure that endows some or RNA → DNA). However, information flow from RNA molecules with catalytic activities. Many scien- RNA© to Jones proteins & requires Bartlett translation Learning, of nucleicLLC acid tists believe© thatJones in the & earliestBartlett forms Learning, of life, RNA LLC had sequencesNOT intoFOR polypeptide SALE OR sequences. DISTRIBUTION This process is roles bothNOT as genetic FOR information SALE OR and DISTRIBUTION in catalysis. As irreversible. There is no known case in which the evolution proceeded, the informational role was trans- sequence of a protein codes or the sequence of a nucleic ferred to DNA and the catalytic role to protein. How- acid (either DNA or RNA). ever, RNA became locked into its central location as a Three types of RNA take part in the synthesis of go-between in the processes of information transfer © Jones &proteins: Bartlett Learning, LLC © Jonesand protein & Bartlett synthesis. Learning, This hypothesis LLC implies that the ■■ participation of RNA in protein synthesis is a relic of NOT FOR SALEA moleculeOR DISTRIBUTION of messenger RNA (mRNA), whichNOT FOR SALE OR DISTRIBUTION carries the genetic information from DNA and is the earliest stages of evolution—a “molecular fossil.” It used as a template for polypeptide synthesis. In is supported by a variety of observations. For example, most mRNA molecules, there is a high propor- (1) DNA replication requires an RNA molecule to get tion of nucleotides that actually code for amino started, (2) an RNA molecule is essential in the synthe- acids. For example,© Jones the mRNA & Bartlett for PAH Learning, is 2400 LLCsis of the tips of the chromosomes,© Jones and & (3) Bartlett some RNA Learning, LLC molecules act to catalyze key reactions in protein nucleotides in lengthNOT andFOR codes SALE for a ORpolypeptide DISTRIBUTION NOT FOR SALE OR DISTRIBUTION of 452 amino acids; in this case, more than synthesis. 50 percent of the length of the mRNA codes for Transcription amino acids. FIGURE 1.18 depicts the manner in which genetic infor- ■■ Four types of ribosomal RNA (rRNA), which are © Jones & Bartlett Learning, LLC mation is© transferred Jones & from Bartlett DNA Learning,to RNA. The LLC DNA major constituents of the cellular particles called opens up, and one of the strands is used as a template ribosomes NOT FOR SALE on which OR DISTRIBUTION polypeptide synthesis for the synthesisNOT FOR of a complementary SALE OR DISTRIBUTION strand of RNA. takes place. (How the template strand is chosen is discussed in the ■■ A set of approximately 45 transfer RNA (tRNA) Molecular Biology of Gene Expression chapter.) The process molecules, each of which carries a particular of making an RNA strand from a DNA template is transcription © Jones & Bartlettamino Learning, acid as well LLC as a three-base recognition© Jonescalled & Bartlett Learning,, and the LLCRNA molecule that is region that base-pairs with a group of three adja- made is the transcript. The base sequence in the RNA NOT FOR SALEcent OR bases DISTRIBUTION in the mRNA. As each tRNANOT isFOR complementary SALE OR (in DISTRIBUTION the Watson–Crick pairing sense)

9781284136609_CH01_Hartl.indd 24 08/11/17 8:51 am 1.5 Gene Expression: The Central Dogma 25

3’ 5’ first, and transcription proceeds along the template DNA © Jones & Bartlett Learning, LLCTA © Jones & Bartlett Learning, LLC strand in the 3-to-5 direction. NOT FOR SALE OR DISTRIBUTIONCG NOT FOR SALE OR DISTRIBUTION AT Each gene includes nucleotide sequences that initiate and terminate transcription. The RNA transcript CG made from any gene begins at the initiation site in the CG template strand, which is located “upstream” from the © JonesGC & Bartlett Learning, LLCamino acid–coding region,© and Jones ends at & the Bartlett termination Learning, LLC T A NOT FOR SALE OR DISTRIBUTIONsite, which is located “downstream”NOT FOR from SALE the ORamino DISTRIBUTION CG acid–coding region. For any gene, the length of the RNA T A transcript is very much smaller than the length of the CG DNA in the chromosome. For example, the transcript TA of the PAH gene for phenylalanine hydroxylase is about 90,000 nucleotides in length, but the DNA in chromo- DNA© strand Jones & BartlettTA Learning, LLCDirection of © Jones & Bartlett Learning, LLC growth of some 12 is about 130,000,000 nucleotide pairs. In this NOTbeing FOR SALEA ORT DISTRIBUTION NOT FOR SALE OR DISTRIBUTION transcribed RNA strand PAH A T case, the length of the transcript is less than 0.1 per- C 3’ G cent of the length of the DNA in the chromosome. A C G G different gene in chromosome 12 would be transcribed C G C A from a different region of the DNA molecule in chromo- © Jones & Bartlett Learning,T LLC © Jonessome & 12, Bartlett and perhaps Learning, from the oppositeLLC strand, but the RNA transcript A NOT FOR SALE OR DISTRIBUTION C NOT transcribedFOR SALE region OR would DISTRIBUTION again be small in comparison C G T with the total length of the DNA in the chromosome. * U A C G C U A Translation * T G The synthesis of a polypeptide under the direction of an T A A mRNA molecule is known as translation. Although the A U © Jones & BartlettT Learning,5’ LLC © Jones & Bartlett Learning, LLC * sequence of bases in the mRNA codes for the sequence 3’ NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 5’ of amino acids in a polypeptide, the molecules that actu- U in RNA pairs ally do the “translating” are the tRNA molecules. The with A in DNA mRNA molecule is translated in nonoverlapping groups of three bases called codons. For each codon in the FIGURE 1.18 Transcription is the production of an RNA strand that is© complementary Jones & Bartlettin base sequence Learning, to a DNA strand.LLC In this mRNA that© specifiesJones an& aminoBartlett acid, Learning, there is one LLC tRNA example,NOT the FORDNA strand SALE at the OR bottom DISTRIBUTION is being transcribed into a molecule containingNOT FOR a SALEcomplementary OR DISTRIBUTION group of three strand of RNA. Note that in an RNA molecule, the base U (uracil) adjacent bases that can pair with the codon. The correct plays the role of T (thymine), in that it pairs with A (adenine). Each amino acid is attached to one end of the tRNA, and A–U pair is marked. when the tRNA comes into line, the amino acid to which it is attached becomes the most recent addition © Jones & BartlettBase in DNALearning, template LLC © Jonesto the & growing Bartlett end Learning, of the polypeptide LLC chain. Adenine Thymine Guanine Cytosine The role of tRNA in translation is illustrated in NOT FOR SALE OR DISTRIBUTION NOT FIGUREFOR SALE 1.20 and OR can DISTRIBUTION be described as follows: A T G C The mRNA is read codon by codon. Each codon U A C G that specifies an amino acid matches with a Uracil Adenine Cytosine Guanine complementary group of three adjacent bases in a single tRNA molecule. One end of the tRNA is Base in RNA transcript© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONattached to the correct aminoNOT acid,FOR so SALE the correct OR DISTRIBUTION FIGURE 1.19 Pairing between bases in DNA and in RNA. The amino acid is brought into line. DNA bases A, T, G, and C pair with the RNA bases U, A, C, and G, respectively. The tRNA molecules used in translation do not line up along the mRNA simultaneously, as shown in © Jones & Bartlett Learning, LLC Figure 1.20.© TheJones process & Bartlett of translation Learning, takes place LLC on a to that in the DNA template, except that U (which pairs ribosome, which combines with a single mRNA and withNOT A) is present FOR SALE in the RNA OR inDISTRIBUTION place of T. The rules of moves alongNOT it from FOR one SALE end to OR the otherDISTRIBUTION in steps, three base pairing between DNA and RNA are summarized nucleotides at a time (codon by codon). As each new in FIGURE 1.19. codon comes into place, the next tRNA binds with the Each RNA strand has a polarity—a 5 end and a 3 ribosome. Then the growing end of the polypeptide chain © Jones &end—and, Bartlett as Learning,in the synthesis LLC of DNA, nucleotides are© Jonesbecomes & Bartlett attached toLearning, the amino acidLLC on the tRNA. In this added only to the 3 end of a growing RNA strand. way, each tRNA in turn serves temporarily to hold the NOT FORHence, SALE the OR 5 endDISTRIBUTION of the RNA transcript is synthesizedNOT polypeptideFOR SALE chain OR DISTRIBUTIONas it is being synthesized. As the

9781284136609_CH01_Hartl.indd 25 08/11/17 8:51 am 26 CHAPTER 1 Genes, Genomes, and Genetic Analysis

The coding sequence of © Jones & Bartlett Learning, LLC bases in mRNA specifies © JonesAt this & point, Bartlett synthesis Learning, of the chain LLC of amino acids is fin- Messenger the amino acid sequence RNA (mRNA) ished, and the polypeptide chain is released from the ribo- NOT FOR SALE OR DISTRIBUTION of a polypeptide chain. NOT FOR SALE OR DISTRIBUTION some. (This brief description of translation glosses over Bases A UGU CCACUGCGGUCCUGGAA Each group of three many of the details that are presented in the Molecular

in the U AC [ A GG adjacent bases is a codon. Biology of Gene Expression mRNA UGA chapter.) CGC CAG The mRNA is translated The Genetic Code Transfer GAC codon by codon by means CUU RNA © Jones & ofBartlett tRNA molecule Learning,s. LLC © Jones & Bartlett Learning, LLC Met (tRNA) Ser Figure 1.20 indicates that the mRNA codon AUG speci- Thr NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Ala Each tRNA has a different fies methionine (Met) in the polypeptide chain, UCC Val base sequence but about Leu the same overall shape. specifies Ser (serine), ACU specifies Thr (threonine), and Glu so on. The complete decoding table is called the genetic Each tRNA carries an code TABLE 1.1 amino acid to be added , and it is shown in . For any codon, the © Jones & Bartlett Learning,to the polypeptide LLC chain. column on© the Jones left corresponds & Bartlett to the Learning, first nucleotide LLC in  NOT FOR SALE OR DISTRIBUTION the codon NOT(reading FOR from SALE the 5 end),OR DISTRIBUTIONthe row across the FIGURE 1.20 The role of messenger RNA in translation is to carry top corresponds to the second nucleotide, and the col- the information contained in a sequence of DNA bases to a ribosome, where it is translated into a polypeptide chain. Translation umn on the right corresponds to the third nucleotide. is mediated by transfer RNA (tRNA) molecules, each of which can The complete codon is given in the body of the table, base-pair with a group of three adjacent bases in the mRNA. Each along with the amino acid (or translational “stop”) that tRNA also carries an amino acid. As each tRNA, in turn, is brought the codon specifies. Each amino acid is designated by its © Jones &to theBartlett ribosome, Learning, the growing polypeptide LLC chain is elongated. © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT fullFOR name SALE and byOR a three-letter DISTRIBUTION abbreviation as well as a single-letter abbreviation. Both types of abbreviations are used in molecular genetics. polypeptide chain is transferred from each tRNA to the The code in Table 1.1 is the “standard” genetic code next in line, the tRNA that previously held the polypep- used in translation in the cells of nearly all organisms. tide is released from the© ribosome. Jones & The Bartlett polypeptide Learning, chain LLCIn the Molecular Biology of ©Gene Jones Expression & Bartlett chapter, Learning,we LLC elongates one amino NOTacid at FOR each stepSALE until OR any DISTRIBUTION one of examine general features ofNOT the standardFOR SALE genetic OR code DISTRIBUTION three particular codons specifying “stop” is encountered. and the minor differences found in the genetic codes of

TABLE 1.1 The standard genetic code © Jones & Bartlett Learning, LLCSecond nucleotide in codon © Jones & Bartlett Learning, LLC NOT FOR SALEU OR DISTRIBUTIONC ANOT FOR SALE ORG DISTRIBUTION UUU Phe F Phenylalanine UCU Ser S Serine UAU Tyr Y Tyrosine UGU Cys C Cysteine U UUC Phe F Phenylalanine UCC Ser S Serine UAC Tyr Y Tyrosine UGC Cys C Cysteine C U UUA Leu L Leucine UCA Ser S Serine UAA Termination UGA Termination A © Jones & BartlettUUG LeuLearning,L Leucine LLC UCG Ser S Serine © JonesUAG & BartlettTermination Learning, UGG Trp LLCW Tryptophan G Third nucleotide in codon (3  end) NOT FOR SALECUU ORLeu DISTRIBUTIONL Leucine CCU Pro P Proline NOTCAU FORHis SALE H Histidine OR DISTRIBUTIONCGU Arg R Arginine U CUC Leu L Leucine CCC Pro P Proline CAC His H Histidine CGC Arg R Arginine C C CUA Leu L Leucine CCA Pro P Proline CAA Gln Q Glutamine CGA Arg R Arginine A CUG Leu L Leucine CCG Pro P Proline CAG Gln Q Glutamine CGG Arg R Arginine G © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC AUU Ile I Isoleucine ACU Thr T Threonine AAU Asn N Asparagine AGU Ser S Serine U NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION AUC Ile I Isoleucine ACC Thr T Threonine AAC Asn N Asparagine AGC Ser S Serine C A AUA Ile I Isoleucine ACA Thr T Threonine AAA Lys K Lysine AGA Arg R Arginine A

First nucleotide in codon (5  end) in codon First nucleotide AUG Met M Methionine ACG Thr T Threonine AAG Lys K Lysine AGG Arg R Arginine G © GUUJonesVal &V BartlettValine Learning,GCU Ala LLC A Alanine GAU Asp D ©Aspartic Jones acid & GGUBartlettGly GLearning,Glycine LLCU NOTGUC FORVal SALEV Valine OR DISTRIBUTIONGCC Ala A Alanine GAC Asp D NOTAspartic FOR acid SALEGGC Gly ORG DISTRIBUTIONGlycine C G GUA Val V Valine GCA Ala A Alanine GAA Glu E Glutamic acid GGA Gly G Glycine A GUG Val V Valine GCG Ala A Alanine GAG Glu E Glutamic acid GGG Gly G Glycine G

9781284136609_CH01_Hartl.indd 26 08/11/17 8:51 am 1.5 Gene Expression: The Central Dogma 27

certain organisms and cellular organelles. At this point, Codon number © Jones & Bartlett Learning, LLC © Jones &in Bartlett PAH gene Learning, LLC NOT FORwe SALE are interested OR DISTRIBUTION mainly in understanding how theNOT FOR SALE OR DISTRIBUTION genetic code is used to translate the codons in mRNA 1234567 into the amino acids in a polypeptide chain. ATG TCCACTGCGGTCCTGGAA In addition to the 61 codons that code only for DNA TAC AGGTGACGCCAGGACCTT amino acids, there are four codons that have specialized functions: © Jones & Bartlett Learning, LLCTRANSCRIPTION © Jones & Bartlett Learning, LLC ■■ The codon AUG,NOT which FOR specifies SALE Met OR (methio DISTRIBUTION- NOT FOR SALE OR DISTRIBUTION mRNA A UGU CCACUGCGGUCCUGGAA nine), is also the “start” codon for polypeptide syn- U AC Met A GG thesis. The positioning of a tRNA bound to AUG UGA is one of the first steps in the initiation of polypep- CGC TRANSLATION CAG tide synthesis, so all polypeptide chains begin with GAC © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLCCUU Met. (Many polypeptides have the initial Met Met Ser NOTcleaved FOR off afterSALE translation OR DISTRIBUTION is complete.) In most NOT FOR SALE ORThr DISTRIBUTION Met Polypeptide Ala organisms, the tRNA used for initiation of trans- Val lation is the same tRNAMet used to specify methio- Leu Amino acid number Glu nine at internal positions in a polypeptide chain. in PAH polypeptide 1234567 ■■ © Jones & BartlettThe codons Learning, UAA, LLC UAG, and UGA are each a© Jones & Bartlett Learning, LLC NOT FOR SALE“stop” OR that DISTRIBUTION specifies the termination of translationNOT FIGUREFOR SALE1.21 The OR central DISTRIBUTION dogma in typical gene expression. The and results in release of the completed polypep- DNA that encodes PAH serves as a template for the production of tide chain from the ribosome. These codons do a messenger RNA, and the mRNA serves to specify the sequence of amino acids in the PAH polypeptide chain through interactions not have tRNA molecules that recognize them, with the ribosome and tRNA molecules. The total number of but are instead recognized by protein factors that amino acids in the PAH polypeptide chain is 452, but only the first 7 terminate translation.© Jones & Bartlett Learning, LLCare shown. © Jones & Bartlett Learning, LLC How the geneticNOT code FORtable isSALE used toOR infer DISTRIBUTION the NOT FOR SALE OR DISTRIBUTION amino acid sequence of a polypeptide chain can be illus- initiation codon AUG is highlighted because some trated by using PAH again—in particular, the DNA patients with PKU have a mutation in this particular sequence coding for amino acids 1 through 7. The DNA codon. As might be expected from the fact that AUG is sequence is: the initiation codon for polypeptide synthesis, cells in © Jones5-ATGTCCACTGCGGTCCTGGAA-3 & Bartlett Learning, LLC patients with© Jones this particular & Bartlett mutation Learning, fail to produce LLC NOT3 FOR-TACAGGTGACGCCAGGACCTT-5 SALE OR DISTRIBUTION any of theNOT PAH polypeptide.FOR SALE Mutation OR DISTRIBUTION and its consequences are considered next. This region is transcribed into RNA in a left-to-right direction. Because RNA grows by the addition of successive nucleotides to the 3 end (Figure 1.18), it is the bottom SUMMING UP © Jones &strand Bartlett that is transcribed.Learning, The LLC nucleotide sequence of the© Jones & Bartlett Learning, LLC ■■ Proteins consist of polypeptides—that is, RNA is that of the top strand of the DNA, except that U NOT FOR SALE OR DISTRIBUTION NOT FORchains SALE of amino OR DISTRIBUTION acids whose order is deter- replaces T, so the mRNA for amino acids 1 through 7 is: mined by the sequences of bases in the genes 5-AUGUCCACUGCGGUCCUGGAA-3 encoding them. The codons are read from left to right according to the ■■ The central dogma of molecular biology states genetic code shown in© Table Jones 1.1. Codon& Bartlett AUG codesLearning, for LLCthat information, in the© form Jones of molecular & Bartlett Learning, LLC Met (methionine), UCCNOT codes FOR for Ser SALE (serine), OR and DISTRIBUTION so on. sequences, passes fromNOT nucleic FOR acids SALE to OR DISTRIBUTION Altogether, the amino acid sequence of this region of the proteins, but not the reverse. polypeptide is: ■■ In gene expression, this process involves transcription of DNA into messenger RNA and translation of mRNA into protein. © Jones & Bartlett Learning, LLC ■■ In addition© Jones to mRNA, & Bartlett ribosomal Learning, RNA and LLC or, inNOT terms FOR of the SALEsingle-letter OR abbreviations:DISTRIBUTION transferNOT RNA FOR play criticalSALE roles OR DISTRIBUTIONin the translation process. ■■ The standard genetic code consists of 64 three-letter words, or codons, 61 of which PAH © Jones &The Bartlett full decoding Learning, operation LLC for this region of the © Jonesencode & Bartlett amino Learning, acids. LLC gene is shown in FIGURE 1.21. In this figure, the NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 27 08/11/17 8:51 am 28 CHAPTER 1 Genes, Genomes, and Genetic Analysis

THE WOMEN IN THE WEDDING photograph are sisters. Both have two copies of the same mutant PAH gene. The bride is the younger of © Jones &the Bartlett two. She was Learning, diagnosed just LLC three days after birth and put on ©the Jones PKU diet soon& Bartlett after. Her older Learning, sister, the maid LLC of honor, was diagnosed too late to begin the diet and is intellectually disabled. The two-year old pictured in the photo at the right is the daughter of the NOT FORmarried SALE couple. OR They DISTRIBUTION planned the pregnancy: Dietary control wasNOT strict from FOR conception SALE to ORdelivery DISTRIBUTION to avoid the hazards of excess phenylalanine harming the fetus. Their daughter has passed all developmental milestones with distinction. Courtesy of Charles R. Scriver, Montreal Children’s Hospital Research Institute, McGill University Health Center.

© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 1.6 MutationNOT and FOR Variation SALE OR DISTRIBUTIONsubtle, but the result is still eitherNOT theFOR failure SALE to produce OR DISTRIBUTION a PAH protein or the production of an inactive PAH pro- We now turn to the fourth essential property of the tein. In the mutation shown in FIGURE 1.22, substitu- genetic material—namely, its ability to generate varia- mutation tion of a G–C base pair for the normal A–T base pair at the tion through mutation. The term refers to any very first position in the coding sequence changes the heritable© Jones change & in Bartlett a gene (or, Learning, more generally, LLC in the normal codon© Jones AUG (Met) & Bartlett used for theLearning, initiation ofLLC trans- genetic material) or to the process by which such a NOT FOR SALE OR DISTRIBUTION lation intoNOT the codon FOR GUG, SALE which OR normallyDISTRIBUTION specifies change takes place. One type of mutation results in valine (Val) and cannot be used as a “start” codon. The a change in the sequence of bases in DNA. This kind of result is that translation of the PAH mRNA cannot occur, change may be simple, such as the substitution of one pair of bases in a duplex molecule for a different pair of bases. For example, a C–G pair in a duplex molecule Mutation of A G Codon 1 in T C PAH gene © Jones &may Bartlett mutate toLearning, T–A, A–T, orLLC G–C. The change in nucleo©- Jones & Bartlett Learning, LLC NOT FORtide SALE sequence OR mayDISTRIBUTION also be more complex, such as theNOT FOR SALE OR DISTRIBUTION1234567 deletion or addition of base pairs. These and other types Mutation, Repair, and G TGTCCACTGCGGTCCTGGAA of mutations are considered in the DNA C ACAGGTGACGCCAGGACCTT Recombination chapter. Geneticists also use the term mutant, which refers © Jones & Bartlett Learning, LLCTRANSCRIPTION Mutant© Jones initiation & codon Bartlett Learning, LLC to the result of a mutation. A mutation yields a mutant in PAH mRNA gene, which in turnNOT produces FOR a SALEmutant OR mRNA, DISTRIBUTION a NOT FOR SALE OR DISTRIBUTION

mutant protein, and finally a mutant organism that mRNA GUGUCCACUGCGGUCCUGGAA exhibits the effects of the mutation—for example, an CAC inborn error of metabolism. TRANSLATION tRNAVal DNA© Jones from patients & Bartlett from all Learning, over the world LLC who have © Jones & Bartlett Learning, LLC phenylketonuria has been studied to determine which X No PAH polypeptide is produced typesNOT of mutations FOR SALE are responsible OR DISTRIBUTION for the inborn error. A NOT FORbecause SALE tRNA ORVal cannotDISTRIBUTION be used Val large variety of mutant types have been identified. More to initiate polypeptide synthesis. than 400 different mutations have been described in the FIGURE 1.22 The M1V mutant in the PAH gene. The methionine gene for PAH. In some cases part of the gene is missing, codon needed for initiation mutates into a codon for valine. © Jones &so Bartlettthe genetic Learning, information LLC to make a complete PAH© JonesTranslation & Bartlett cannot be initiated,Learning, and no LLC PAH polypeptide is enzyme is absent. In other cases the genetic defect is more produced. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 28 08/11/17 8:51 am 1.6 Mutation and Variation 29

Mutation of C T Codon 408 in © Jones & Bartlett Learning, GLLCA PAH gene © Jonesto think & Bartlett of populations Learning, as consisting LLC of a few rare variants among large numbers of “wild type” individuals, NOT FOR SALE OR DISTRIBUTION408 NOT FOR SALE OR DISTRIBUTION suggesting that overall levels of genetic variation were G CCACAA TAC C T T GGCCCT TCTCAGTT CGC DNA CGGTGTTATG G A ACCGGGA AGAGTCAAGCG quite low. This picture later changed dramatically as, based TRANSCRIPTION on the one gene‒one enzyme hypothesis, it became pos-

mRNA G CCA©CAAU JonesACCU UG&G BartlettCCCUUC UCAG Learning,U UCGC LLCsible to quantify genetic variation—first© Jones & Bartlettat the level Learning, of LLC C GG U GU protein sequence, and subsequently at the level of NOTUA UFOR SALE MutantOR DISTRIBUTIONcodon NOT FOR SALE OR DISTRIBUTION GGA in PAH mRNA DNA sequence. Early work with protein variation in TRANSLATION ACC GGG both fruit flies (Drosophila pseudoobscura) and humans AAG Ala AGU Thr CAA yielded unexpected findings: When the protein prod- Ile GCG Polypeptide Pro ucts of several genes were examined, approximately Trp polymorphic © Jones & Bartlett Learning,Pro LLC 30 percent© of Jones them were & Bartlett found to Learning, be LLC , Mutant amino acid Phe Ser meaning that there were two or more variants, or NOT FORin PAHSALE polypeptide OR DISTRIBUTIONVal NOT FOR SALE OR DISTRIBUTION Arg alleles, for those genes present in the sampled individuals. Similar findings were made for almost every FIGURE 1.23 The R408W mutant in the PAH gene. Codon 408 for arginine (R) is mutated into a codon for tryptophan (W). The species examined with these methods, leading to the result is that position 408 in the mutant PAH polypeptide is recognition that variation—rather than uniformity—is © Jones &occupied Bartlett by tryptophan Learning, rather thanLLC by arginine. The mutant © Jonesthe norm & Bartlett at the genetic Learning, level in LLCmost species. protein has only a low level of PAH enzyme activity. NOT FOR SALE OR DISTRIBUTION NOT FORIn SALErecent years,OR DISTRIBUTION the methods we describe in the chapter titled DNA Replication and Sequencing have allowed investigators to change their focus from so no PAH polypeptide is made. This mutant is desig- single genes to entire genomes. One outcome of that nated M1V because the codon for M (methionine) at effort has been the 1000 Genomes Project, an ongoing amino acid position 1© in Jones the PAH & polypeptide Bartlett Learning,has been LLCinternational research program© Jones seeking & to Bartlett survey com- Learning, LLC changed to a codon forNOT V (valine). FOR SALE Although OR the DISTRIBUTION M1V mon human genetic variationNOT and FOR to identify SALE common OR DISTRIBUTION mutant is quite rare worldwide, it is common in some human genetic variants associated with disease. To localities, such as Québec Province in Canada. date, the project has sequenced 2504 genomes from 26 One PAH mutant that is quite common is desig- worldwide populations, which have been divided nated R408W, which means that codon 408 in the into 5 “superpopulations” (FIGURE 1.24). More than PAH© polypeptide Jones & chainBartlett has Learning,been changed LLC from one 80 million© polymorphisms Jones & Bartlett have been Learning, identified, LLC most codingNOT for arginineFOR SALE (R) to OR one DISTRIBUTIONcoding for tryptophan of which NOT consist FOR of singleSALE nucleotide OR DISTRIBUTION differences (W). This mutation is one of the four most common (single-nucleotide polymorphisms, or SNPs). These among European Caucasians with PKU. The molecu- publicly available data provide a global perspective on lar basis of the mutant is shown in FIGURE 1.23. In this genetic variation in Homo sapiens, and have become an case, the first base pair in codon 408 is changed from invaluable tool for researchers in medical genetics, evo- © Jones &C–G Bartlett base into Learning, T–A. As a result, LLC the PAH mRNA has a© Joneslutionary & Bartlett biology, andLearning, anthropology. LLC Most importantly, mutant codon at position 408; specifically, it has UGG NOT FOR SALE OR DISTRIBUTION NOT genomicFOR SALE analysis OR ofDISTRIBUTION humans and other species has instead of CGG. Translation does occur in this mutant shown that the classical view, which suggests genetic because everything else about the mRNA is normal, variation consists of common wild-type alleles and rare but the result is that the mutant PAH carries a trypto- variants, needs to be revised substantially. Much of the phan (Trp) instead of an arginine (Arg) at position 408 genome of a particular species is indeed invariant, but in the polypeptide chain.© Jones The consequence & Bartlett of theLearning, seem- LLCfor significant portions of it,© variation Jones &is theBartlett rule rather Learning, LLC ingly minor change of one amino acid is very drastic. than the exception. Although the R408WNOT polypeptide FOR SALE is complete, OR DISTRIBUTION the NOT FOR SALE OR DISTRIBUTION enzyme has less than 3 percent of the activity of the SUMMING UP normal enzyme. ■■ All new genetic variation originates as a muta- Variation in Populations tion, or change in DNA sequence. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC ■■ Different, independently occurring mutations MuchNOT of the FOR classic SALE work OR in DISTRIBUTIONgenetics, from Gregor NOT FOR SALE OR DISTRIBUTION Mendel onward, involved genetic analysis of visible may occur in the same gene. differences in organismal traits that are the results of ■■ Genomic sequencing has provided powerful particular mutations. Most of the variants used, such tools to characterize the extent and nature of as white eyes in Drosophila, shrunken kernels in maize, genetic variation in many species, including © Jones &or Bartlett even inherited Learning, diseases LLC like alkaptonuria in © Joneshumans. & Bartlett Learning, LLC NOT FORhumans, SALE ORare quite DISTRIBUTION rare. Thus, early geneticists tendedNOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 29 08/11/17 8:51 am 30 CHAPTER 1 Genes, Genomes, and Genetic Analysis

Finland © Jones & Bartlett Learning,United LLC © Jones & Bartlett Learning, LLC Kingdom NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION France United Spain States China Italy Pakistan Japan Bangladesh Puerto Rico Mexico © Jones & Bartlett Learning,Barbados LLC © JonesIndia & Bartlett Learning, LLC Gambia NOT FOR SALE OR DISTRIBUTION NOT FOR SALEVietnam OR DISTRIBUTION Colombia Sierra Nigeria Kenya Leone Tanzania Peru

Ancestry populations American AfricanEuropeanSouth Asian East Asian

FIGURE 1.24 Geographic© distribution Jones &of populationsBartlett sampledLearning, in the 1000LLC Genomes Project. Each dot ©indicates Jones a study & Bartlett population; Learning, LLC colors indicate superpopulationsNOT FOR as indicated SALE in the legend. OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Data from International Genome Sample Resource. (2016). IGSR and the 1000 Genomes Project. Retrieved from http://www.internationalgenome.org.

1.7 Genes and Environment Likewise, the development and functioning of every © Jones & Bartlett Learning, LLC trait require© Jonesa large number & Bartlett of genes Learning, working inLLC har- Inborn errors of metabolism illustrate the general prin- NOT FOR SALE OR DISTRIBUTION mony, butNOT in some FOR cases SALE a single OR mutant DISTRIBUTION gene can have ciple that genes code for proteins and mutant genes code catastrophic consequences. for mutant proteins. In diseases such as PKU, mutant In short, the relationship between a gene and a proteins cause such a drastic change in metabolism that trait is not necessarily a simple one. The biochemistry a severe genetic defect results. Nevertheless, biology is of organisms is a complex branching network in which not necessarily destiny—organisms are also affected by different enzymes may share substrates, yield the same © Jones &the Bartlett environment. Learning, PKU serves LLC as an example of this prin©- Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT products,FOR SALE or be OR responsive DISTRIBUTION to the same regulatory ele- ciple, because patients who adhere to a diet restricted in ments. Most visible traits of organisms are the net the amount of phenylalanine develop intellectual result of many genes acting together and in combina- capacities within the normal range. What is true in this tion with environmental factors. PKU affords exam- example is true in general: Most traits are determined ples of each of three principles governing these by the interaction of genes© Jones and environment. & Bartlett Learning, LLCinteractions: © Jones & Bartlett Learning, LLC It is also true that most traits are affected by multiple genes. No one knowsNOT how many FOR genes SALE are OR involved DISTRIBUTION in 1. One gene can affect moreNOT than FOR one SALEtrait. Children OR DISTRIBUTION the development and maturation of the brain and ner- with extreme forms of PKU often have blond vous system, but the number must be in the thousands. hair and reduced body pigment. These manifes- This number is in addition to the genes that are required tations occur because the absence of PAH is a in all© cells Jones to carry & Bartlettout metabolism Learning, and other LLC basic life metabolic© Jones block & Bartlett that prevents Learning, conversion LLC of functions. It is easy to lose sight of the multiplicity of phenylalanine into tyrosine, which is the precur- genesNOT when FOR considering SALE ORextreme DISTRIBUTION examples, such as sor NOT of the FOR pigment SALE melanin. OR DISTRIBUTION The relationship PKU, in which a single mutation can have such a drastic between severe intellectual disability and effect on intellectual development. The situation is the decreased pigmentation in PKU makes sense same as that with any complex machine. An airplane only if one knows the metabolic connections © Jones &can Bartlett function Learning,properly provided LLC that thousands of parts© Jones &among Bartlett phenylalanine, Learning, tyrosine, LLC and melanin. If work together in harmony, but just one defective part, these connections were not known, the traits NOT FORif SALEthat part OR affects DISTRIBUTION a vital system, can bring it down.NOT FOR wouldSALE seem OR completelyDISTRIBUTION unrelated.

9781284136609_CH01_Hartl.indd 30 08/11/17 8:51 am 1.8 The Molecular Unity of Life 31

© Jones & Bartlett Learning, LLC © Jones &children Bartlett but Learning, less so in adults;LLC the blood–brain NOT FOR SALE OR DISTRIBUTION NOT FOR barrierSALE isOR less DISTRIBUTION well developed in children and, therefore, less effective in blocking the excess phenylalanine. Multiple genes affect even simpler metabolic traits. Phenylalanine breakdown and excretion © Jones & Bartlett Learning, LLC serve as a convenient© Jones example. & TheBartlett metabolic Learning, LLC NOT FOR SALE OR DISTRIBUTION pathway illustrated NOTin Figure FOR 1.10 SALE indicates OR four DISTRIBUTION enzymes play roles in this process, but even more enzymes are involved at the stage labeled “further breakdown.” Because differences in the activity of any of these enzymes can affect the rate at © Jones & Bartlett Learning, LLC which© Jones phenylalanine & Bartlett is brokenLearning, down LLC and NOT FOR SALE OR DISTRIBUTION excreted,NOT allFOR of the SALE enzymes OR inDISTRIBUTION the pathway are important in determining the amount of excess phenylalanine in the blood of patients with PKU. FIGURE 1.25 Among cats with white fur and blue eyes, approxi- 3. Most traits are affected by environmental factors as well mately 40 percent are born deaf. The reason is that pigment cells as by genes. Here we come back to the low-phenyl- © Jones &derived Bartlett from the Learning, neural crest migrate LLC to various tissues including © Jones & Bartlett Learning, LLC hair follicles, the eyes, and the middle ear, where their function is alanine diet. Children with PKU are not doomed NOT FORessential SALE for OR hearing. DISTRIBUTION Defective pigment cells resulting in white furNOT FOR toSALE severe OR intellectual DISTRIBUTION deficiency; their capabilities and blue eyes can, therefore, lead to deafness, which may be regarded as a pleiotropic effect of white fur and blue eyes. can be brought into the normal range by dietary © Ronen/Shutterstock. treatment. PKU serves as an example of what motivates geneticists to try to discover the molecular basis of inherited disease. The hope is that PKU is not unusual© Jones in this & regard. Bartlett Many Learning, mutant LLC knowing the metabolic© Jones basis of& Bartlett a disease willLearning, LLC genes affect multipleNOT FORtraits through SALE theirOR DISTRIBUTIONsecond- eventually lead to methodsNOT FOR for clinical SALE interven OR DISTRIBUTION- ary or indirect effects. The various, sometimes tion through diet, medication, or other treatments seemingly unrelated, effects of a mutant gene are that will ameliorate the severity of the disease. called pleiotropic effects, and the phenomenon itself is known as pleiotropy. FIGURE 1.25 shows SUMMING UP © aJones cat with & white Bartlett fur and Learning, blue eyes, LLC a pattern of © Jones & Bartlett Learning, LLC NOTpigmentation FOR SALE that ORis often DISTRIBUTION (about 40 percent of ■■ Most traitsNOT are FOR affected SALE by ORmultiple DISTRIBUTION genes. the time) associated with deafness. Hence, deaf- ■■ One gene can affect multiple traits. ness can be regarded as a pleiotropic effect of ■■ Most traits are affected by a combination of white coat and blue eye color. The developmental genes and the environment. basis of this pleiotropy is unknown. © Jones & Bartlett2. Any trait Learning, can be affected LLC by more than one gene. We© Jones & Bartlett Learning, LLC NOT FOR SALEdiscussed OR DISTRIBUTION this principle earlier in connectionNOT 1.8 FOR SALEThe MolecularOR DISTRIBUTION Unity of Life with the large number of genes that are required The pathway for the breakdown and excretion of phe- for the normal development and functioning of nylalanine is by no means unique to human beings. One the brain and nervous system. Among these are of the remarkable generalizations to have emerged from genes that affect the function of the blood–brain © Jones & Bartlett Learning, LLCmolecular genetics is that organisms© Jones that& Bartlett are very disLearning,- LLC barrier, which consists of specialized glial cells tinct—for example, plants and animals—share many fea- wrapped tightlyNOT around FOR capillary SALE wallsOR DISTRIBUTION in the NOT FOR SALE OR DISTRIBUTION tures in their genetics and biochemistry. These brain, forming an impediment to the passage of similarities indicate a fundamental “unity of life”: most water-soluble molecules from the blood to the brain. The blood–brain barrier therefore All creatures on Earth share many features of the genetic apparatus, including genetic infor- © affectsJones the & extent Bartlett to which Learning, excess free LLC phenylala- © Jones & Bartlett Learning, LLC nine in the blood can enter the brain itself. mation encoded in the sequence of bases in NOTBecause FOR the SALE effectiveness OR DISTRIBUTION of the blood–brain bar- DNA, transcriptionNOT FOR into SALE RNA, OR and DISTRIBUTION translation into rier differs among individuals, patients with protein on ribosomes with the use of transfer PKU who have very similar levels of blood phe- RNAs. All creatures also share certain character- nylalanine can have dramatically different levels istics in their biochemistry, including many enzymes and other proteins that are similar in © Jones & Bartlettof cognitive Learning, development. LLC This factor also© Jones & Bartlett Learning, LLC explains in part why adherence to a controlled- amino acid sequence, three-dimensional struc- NOT FOR SALEphenylalanine OR DISTRIBUTION diet is critically important inNOT FORture, SALE and function. OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 31 08/11/17 8:51 am 32 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones Prokarya,& Bartlett Archaea,Learning, and LLC Eukarya © Jones &true Bartlett chromosomes, Learning, and cellLLC division takes place The Chromo- NOT FOROrganisms SALE OR share DISTRIBUTION a common set of similar genes andNOT FOR bySALE means OR of DISTRIBUTIONmitosis (discussed in proteins because they evolved by descent from a com- somal Basis of Inheritance chapter). The eukary- mon ancestor. The process of evolution takes place otes include plants and animals as well as fungi when a population of organisms gradually changes in and many single-celled organisms, such as amoe- its genetic composition through time. Evolutionary bae and ciliated protozoa. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC changes in genes and proteins result in differences in Genomes and Proteomes metabolism, development,NOT FOR and SALE behavior OR amongDISTRIBUTION NOT FOR SALE OR DISTRIBUTION organisms, which allows them to become progres- The totality of DNA in a cell, nucleus, or organelle is sively better adapted to their environments. From an called its genome. When used with reference to a spe- evolutionary perspective, the unity of fundamental cies of organism (for example, in phrases such as “the molecular processes in organisms alive human genome”), the term genome is defined as the DNA today© reflects Jones inheritance & Bartlett from Learning, a distant LLC common present in ©a normal Jones reproductive & Bartlett cell. Learning, LLC ancestorNOT in FOR which SALE the molecular OR DISTRIBUTION mechanisms were ModernNOT methods FOR for SALE sequencing OR DISTRIBUTION DNA (discussed already in place. in the DNA Replication and Sequencing chapter) are so Not just the unity of life but many other features rapid and efficient that the complete DNA sequence is of living organisms become comprehensible from an now known for more than 1000 different species of evolutionary perspective. For example, the interposi- organisms. These include the genomes of multiple rep- © Jones &tion Bartlett of an RNA Learning, intermediate LLC in the basic flow of © Jonesresentatives & Bartlett of all Learning,of the groups LLC of organisms, includ- NOT FORgenetic SALE information OR DISTRIBUTION from DNA to RNA to proteinNOT ingFOR Neandertals SALE OR (an DISTRIBUTION extinct species closely related to makes sense if the earliest forms of life used RNA for Homo sapiens, sequenced from DNA extracted from both genetic information and enzyme catalysis. The fossil bones). importance of the evolutionary perspective in under- TABLE 1.2 shows a small sample of sequenced standing aspects of biology that seem pointless or genomes. Genome size is given in megabases (Mb), or © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC needlessly complex is summed up in a famous apho- millions of base pairs. The genome of the bacterium rism of the evolutionaryNOT FOR biologist SALE Theodosius OR DISTRIBUTION Haemophilus influenzae, likeNOT that FOR of most SALE bacteria, OR DISTRIBUTIONis Dobzhansky: “Nothing in biology makes sense except very compact in that most of it codes for proteins. A in the light of evolution.” high density of genes, relative to the amount of DNA, Biologists distinguish three major domains of is also found in the budding yeast, the nematode organisms: worm, the fruit fly, and the diminutive flowering © Jones & Bartlett Learning, LLC plant Arabidopsis© Jones thaliana & Bartlett. The human Learning, genome, LLC by 1. Prokarya. This group includes most bacteria and NOT FOR SALE OR DISTRIBUTION contrast, containsNOT FOR large SALE amounts OR of DISTRIBUTION noncoding DNA. cyanobacteria (formerly called blue-green algae). Comparison with the nematode is illuminating. Cells of these organisms lack a membrane- Whereas the human genome is about 30 times larger bounded nucleus and mitochondria, are sur- than that of the worm, the number of genes is less than rounded by a cell wall, and divide by binary 2 times larger. This discrepancy reflects the fact that fission. © Jones & Bartlett Learning, LLC © Jonesonly about& Bartlett 1.5 percent Learning, of the human LLC genome sequence 2. Archaea NOT FOR SALE OR DISTRIBUTION. This group was initially discoveredNOT codesFOR forSALE protein. OR (ApproximatelyDISTRIBUTION 27 percent of the among microorganisms that produce methane gas human genome is present in genes, but much of the or that live in extreme environments, such as hot DNA sequence present in genes does not code for springs or high salt concentrations. They are proteins.) widely distributed in more normal environments The complete set of proteins encoded in the genome as well. Superficially© Jones resembling & Bartlett bacteria, Learning, the cells LLCis known as the proteome©. In Jones less complex & Bartlett genomes, Learning, LLC of archaeans showNOT important FOR SALE differences OR DISTRIBUTION in the such as the yeast, worm, andNOT fruit FOR fly, theSALE number OR ofDISTRIBUTION manner in which their membrane lipids are chem- proteins in an organism’s proteome is approximately ically linked. The machinery for DNA replication the same as the number of genes. However, as we shall and transcription in archaeans resembles that of see the chapter titled The Molecular Biology of Gene Expres- eukarya, whereas their metabolism strongly sion, some genes encode two or more proteins through © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC resembles that of bacteria. DNA sequence analysis a process called alternative splicing in which segments of NOTindicates FOR that SALE about OR half DISTRIBUTIONof the genes found in the the originalNOT RNA FOR transcript SALE are joinedOR DISTRIBUTION together in a vari- kingdom Archaea are unique to this group. ety of combinations to produce different messenger 3. Eukarya. This group includes all organisms RNAs. Alternative splicing is especially prevalent in the whose cells contain an elaborate network of human genome. At least one third of human genes, and © Jones & Bartlettinternal Learning, membranes, LLC a membrane-bounded© Jonespossibly & Bartlett as many Learning,as two thirds, LLC undergo alternative nucleus, and mitochondria. Their DNA is pres- splicing; among the genes that undergo alternative splic- NOT FOR SALEent OR in the DISTRIBUTION form of linear molecules organized intoNOT ing,FOR the SALE number OR of differentDISTRIBUTION messenger RNAs per gene

9781284136609_CH01_Hartl.indd 32 08/11/17 8:51 am 1.8 The Molecular Unity of Life 33

© Jones &TABLE Bartlett 1.2 Comparison Learning, of genesLLC and proteins © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTIONGenome size, Mba NumberNOT FOR of genes SALE Number OR ofDISTRIBUTION distinct proteins Shared protein Organism (approximate) (approximate) in proteomeb (approximate) families

Haemophilus influenzae 1.9 1700 1400 (causes bacterial meningitis)

Saccharomyces cerevisiae© Jones & Bartlett13 Learning, LLC6000 4400© Jones & Bartlett Learning, LLC (budding yeast) NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

Caenorhabditis elegans 100 20,000 9500 3000 (soil nematode) }

Drosophila melanogaster 120c 16,000 8000 © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, 5000 LLC (fruit fly) } NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Mus musculus 2500 25,000 10,000 7000d (laboratory mouse) }

Homo sapiens 2900e 25,000 10,000 9900f © Jones &(human Bartlett being) Learning, LLC © Jones & Bartlett Learning, LLC } NOT FORa MillionsSALE of base OR pairs. DISTRIBUTION NOT FOR SALE OR DISTRIBUTION b Excludes “families” of proteins with similar sequences (and hence related functions). c Excludes 60 Mb of specialized DNA (“heterochromatin”) that has a very low content of genes. d Based on similarity with sequences in messenger RNA (mRNA). e For convenience, this estimate is rounded to 3000 Mb elsewhere in this text. f Based on the observation that only about 1 percent of mouse genes lack a similar gene in the human genome, and vice versa. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ranges from 2 to 7. Hence, with its seemingly limited multicellular animals share 5000 to 10,000 proteins repertoire of 25,000 genes, the human genome can cre- that are similar in sequence and function. Approxi- ate approximately 60,000 to 90,000 different mRNAs. mately 3000 of these are shared with eukaryotes as dis- The widespread© Jones & use Bartlett of alternative Learning, splicing LLC to multiply tantly related© Jones as yeast, & andBartlett approximately Learning, 1000 LLC with the coding capacity of genes is one source of human prokaryotes as distantly related as bacteria. What these geneticNOT complexity. FOR SALE OR DISTRIBUTION comparisonsNOT among FOR proteomes SALE OR imply DISTRIBUTION is that biological Most eukaryotic organisms contain families of systems are based on protein components numbering related proteins that can be grouped according to simi- in the thousands. This is a challenging level of complex- larities in their amino acid sequence. These families ity to understand, but the challenge is much less intimi- exist because the evolution of a new gene function is dating than it appeared to be at an earlier time when © Jones &typically Bartlett preceded Learning, by the LLC duplication of an existing© Joneshuman & cellsBartlett were thoughtLearning, to produce LLC as many as 1 mil- NOT FORgene, SALE followed OR DISTRIBUTION by changes in nucleotide sequence inNOT lionFOR different SALE proteins. OR DISTRIBUTION one of the copies that gives rise to the new function. The new function is usually similar to the previous one (for example, a change in the substrate specificity of a trans- SUMMING UP porter protein), so that© the Jones new protein & Bartlett retains Learning, enough LLC © Jones & Bartlett Learning, LLC similarity in amino acid sequence to the original that NOT FOR SALE OR DISTRIBUTION■■ The processes of DNANOT replication, FOR SALEtranscrip OR- DISTRIBUTION their common ancestry can be recognized. tion, and translation, as well as the genetic The molecular unity of life can be seen in the simi- code, are nearly universal properties of life. larity of proteins in the proteome among diverse types ■■ Cellular organisms are divided into three of organisms. Such comparisons are shown in the right- domains—prokarya, eukarya, and archaea. hand© column Jones in & Table Bartlett 1.2. In Learning,this tabulation, LLC each fam- © Jones & Bartlett Learning, LLC ily of related proteins is counted only once, to estimate ■■ The genomes of organism vary greatly in total the numberNOT FOR of proteins SALE in OR the DISTRIBUTIONproteome that are “dis- size, butNOT less FOR so in SALEterms of OR the DISTRIBUTIONnumber of tinct” in the sense that their sequences are dissimilar. In proteins encoded by them. yeast, worms, and flies, the number of distinct proteins ■■ The proteome of an organism consists of is approximately 4400, 9500, and 8000, respectively. families of related proteins, many of which are © Jones &The Bartlett brackets inLearning, Table 1.2 indicate LLC the number of distinct© Jonesshared & Bartlett among Learning, organisms inLLC different domains proteins that share sequence similarity between species. of life. NOT FORFrom SALE these OR comparisons,DISTRIBUTION it appears that most NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 33 08/11/17 8:51 am 34 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones CHAPTER& Bartlett SUMMARYLearning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE■■ Inherited OR traits DISTRIBUTION are affected by genes. NOT FOR■■ ■DNA SALE occasionally OR DISTRIBUTION mutates, and the mutant forms ■■ ■Genes are composed of the chemical deoxyribo- specify altered proteins that have reduced activity nucleic acid (DNA). or stability. ■■ ■■ ■DNA replicates to form copies of itself ■A mutant enzyme is an “inborn error of metabo- that are identical (except© Jones for rare & Bartlett Learning, LLClism” that blocks one step© inJones a biochemical & Bartlett pathway Learning, LLC mutations). for the metabolism of small molecules. NOT FOR SALE OR DISTRIBUTION■■ NOT FOR SALE OR DISTRIBUTION ■■ DNA■ contains a genetic code specifying which Traits■ are affected by environment as well as by genes. types of enzymes and other proteins are made ■■ ■The molecular unity of life is seen in comparisons of in cells. genomes and proteomes.

REVIEW© Jones THE &BASICS Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ■■ ■What were the key experiments showing that DNA ■■ ■What is an inborn error of metabolism? How did is the genetic material? this concept serve as a bridge between genetics and ■■ ■How did understanding the molecular structure of biochemistry? DNA give clues to its ability to replicate, to code for ■■ ■How does the “central dogma” explain Garrod’s © Jones & Bartlettproteins, Learning,and to undergo LLC mutation? © Jonesdiscovery & Bartlett that nonfunctionalLearning, LLC enzymes result from NOT FOR SALE■■ ■Why isOR the DISTRIBUTIONpairing of complementary bases a key NOT FORmutant SALE genes? OR DISTRIBUTION feature of DNA replication? ■■ Explain■ why many mutant forms of phenylalanine ■■ ■What is the process of transcription, and in which hydroxylase have a simple amino acid replacement, ways does it differ from DNA replication? yet the mutant polypeptide chains are absent or present in very small amounts. ■■ ■What is the difference between transcription and ■■ translation? © Jones & Bartlett Learning, LLC■What is a pleiotropic effect© Jonesof a gene &mutation? Bartlett Learning, LLC Give an example. ■■ ■Which three typesNOT of RNA FOR participate SALE in ORprotein DISTRIBUTION NOT FOR SALE OR DISTRIBUTION ■■ synthesis, and what is the role of each type ■What are some of the major differences in cellular of RNA? organization among prokarya, archaea, and eukarya? ■■ ■What is the “genetic code,” and how is it relevant to the translation of a polypeptide chain from a molecule© Jones of messenger& Bartlett RNA? Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION GUIDE TO PROBLEM SOLVING

PROBLEM 1 In the human gene for the protein huntingtin ANSWER To deduce the RNA sequence, we must apply © Jones &(so Bartlett named because Learning, it is associated LLC with Huntington dis©- Jonesthree concepts.& Bartlett First, Learning, the base pairing LLC is such so that A, T, C, NOT FORease), SALE the ORfirst 21DISTRIBUTION nucleotides in the amino acid—codingNOT andFOR G inSALE the DNA OR template DISTRIBUTION strand are transcribed as U, A, region are: G, and C, respectively, in the RNA. Second, the DNA tem- 3-TACCCACCGTTATAAGAGAGT-5 plate strand and RNA transcript have the opposite polarity. Third (and critically for this problem), the RNA strand is What is the sequence of a partner strand? always transcribed in the 5-to-3 direction. Because we are © Jones & Bartlett Learning, LLCtold that transcription takes place© Jones from left & toBartlett right, we Learning,can LLC ANSWER The base pairing between the strands is A with deduce that the transcribed strand is that given in Problem T and C with G, but NOTit is equally FOR importantSALE OR that DISTRIBUTION the 1. The RNA transcript thereforeNOT has FORthe base SALE sequence OR DISTRIBUTION strands in a DNA duplex have opposite polarity. The complementary strand is therefore oriented 5-AUGGGUGGCAAUAUUCUCUCA-3 with its 5-end at the left. The base sequence of the partner strand is: PROBLEM 3 © Jones & Bartlett Learning, LLC © Jones Given the & RNABartlett sequence Learning, coding for LLC part of human huntingtin deduced in Problem 2, what is the 5-ATGGGTGGCAATATTCTCTCA-3 NOT FOR SALE OR DISTRIBUTION amino acidNOT sequence FOR in thisSALE part ORof huntingtin? DISTRIBUTION PROBLEM 2 If the DNA duplex for huntingtin in ANSWER The polypeptide chain is translated in successive Problem 1 were transcribed from left to right, deduce the groups of three nucleotides (codons), starting at 5 end of base sequence of the RNA in this coding region. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 34 08/11/17 8:52 am Analysis and Applications 35

© Jones the& Bartlett coding sequence Learning, and moving LLC in the 5-to-3 direction.© JonesANSWER & Bartlett The DNA, Learning, RNA, and polypeptideLLC chain have The amino acid corresponding to each codon can be foundNOT theFOR sequences SALE as OR follows, DISTRIBUTION where the differences from the NOT FORin SALE the genetic OR code DISTRIBUTION table. The first seven amino acids in the nonmutant gene are in red. The mutation results in stop polypeptide chain are: codon and premature termination of huntingtin synthesis. 5-AUG GGU GGC AAU AUU CUC UCA-3 Met Gly ©Gly Jones Asn Ile& Bartlett Leu Ser Learning, LLCDNA (transcribed strand)© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION 3-TAC CCA CCGNOT TTA FOR TAA SALEGAG AT ORT-5 DISTRIBUTION PROBLEM 4 Suppose that a mutation in the human hun- DNA (nontranscribed strand) tingtin gene occurs in the DNA sequence shown in 5-ATG GGT GGC AAT ATT CTC TAA-3 Problem 1. In this mutation, the red G is replaced with a T. RNA coding region What is the nucleotide sequence of this region of the DNA 5-AUG GGU GGC AAU AUU CUC UAA-3 Polypeptide chain duplex© (bothJones strands), & Bartlett and that Learning, of the messenger LLC RNA, © Jones & Bartlett Learning, LLC and what is the amino acid sequence of the mutant Met Gly Gly Asn Ile Leu STOP huntingtin?NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

ANALYSIS AND APPLICATIONS © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 1.1 Classify each of the following statements as true or would be expected if the S-strain extract had been NOT FOR SALEfalse. OR DISTRIBUTION NOT FOR treatedSALE with OR phenol?DISTRIBUTION If it had been treated with a strong alkali? (a) Each gene is responsible for only one visible trait. 1.7 Which feature of the physical organization of bacte- (b) Every trait is potentially affected by many riophage T2 made it suitable for use in the Hershey‒ genes. © Jones & Bartlett Learning, LLC Chase experiments? © Jones & Bartlett Learning, LLC (c) The sequence of nucleotides in a gene specifies the sequenceNOT of FOR amino SALE acids inOR a DISTRIBUTION protein NOT FOR SALE OR DISTRIBUTION 1.8 Like DNA, molecules of RNA contain large encoded by the gene. amounts of phosphorus. When Hershey and (d) There is one-to-one correspondence between Chase grew their T2 phage in bacterial cells in the the set of codons in the genetic code and the presence of radioactive phosphorus, the RNA set of amino acids encoded. © Jones & Bartlett Learning, LLC must© alsoJones have &incorporated Bartlett theLearning, labeled phospho LLC - 1.2 rus, yet the experimental result was not compro- NOTFrom FOR their SALEexamination OR DISTRIBUTIONof the structure of DNA, mised.NOT Why FOR not? SALE OR DISTRIBUTION what were Watson and Crick able to infer about the probable mechanisms of DNA replication, coding 1.9 The DNA extracted from a bacteriophage contains capability, and mutation? 16 percent A, 16 percent T, 34 percent G, and 1.3 34 percent C. What can you conclude about the © Jones & BartlettWhat Learning,does it mean LLC to say that each strand of a© Jones &structure Bartlett of thisLearning, DNA molecule? LLC duplex DNA molecule has a polarity? What does it NOT FOR SALEmean OR to DISTRIBUTION say that the paired strands in a duplex molNOT- FOR SALE OR DISTRIBUTION 1.10 The DNA extracted from a bacteriophage consists ecule have opposite polarity? of 20 percent A, 34 percent T, 35 percent G, and 1.4 11 percent C. What is unusual about this DNA? What important observation about the S and R What can you conclude about its structure? strains of Streptococcus pneumoniae prompted Avery, MacLeod,© Jones and McCarty & Bartlett to study Learning, this LLC © Jones & Bartlett Learning, LLC 1.11 A region along a DNA strand that is transcribed con- organism? NOT FOR SALE OR DISTRIBUTIONtains no A. Which baseNOT will FOR be missing SALE in theOR cor DISTRIBUTION- responding region of the RNA? 1.5 In the transformation experiments of Avery, MacLeod, and McCarty, what was the strongest 1.12 If one strand of a DNA duplex has the sequence evidence that the substance responsible for 5-ATCAG-3, what is the sequence of the comple- the transformation was DNA rather than © Jones & Bartlett Learning, LLC mentary© Jones strand? & (Write Bartlett the answer Learning, with the LLC 5 end protein? NOT FOR SALE OR DISTRIBUTION at theNOT left.) FOR SALE OR DISTRIBUTION 1.6 A chemical called phenol (carbolic acid) destroys 1.13 Suppose that a double-stranded DNA molecule is proteins but not nucleic acids, and strong alkalis separated into its constituent strands, and the such as sodium hydroxide destroy both proteins strands are purified using a high-speed centrifuge. and nucleic acids. In the transformation experi- In one of the strands, the base composition is © Jones & Bartlettments Learning,with Streptococcus LLC pneumoniae, which result© Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 35 08/11/17 8:52 am 36 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones & Bartlett25 percent Learning, A, 18 percent LLC T, 20 percent G, and© Jones1.21 &Wi Bartlettth in vitro Learning, translation of LLC an RNA into a polypep- 37 percent C. What is the base composition of theNOT FOR tideSALE chain, OR the DISTRIBUTION translation can begin anywhere NOT FOR SALEother OR strand? DISTRIBUTION along the RNA molecule. A synthetic RNA molecule has the sequence 1.14 Consider a region along one strand of a double- 5-CGCUUACCACAUGUCGCGAAC-3 stranded DNA molecule that consists of tandem repeats of the trinucleotide 5-GTA-3, so that the How many reading frames are possible if this mole- sequence in this© strand Jones is 5 &-GTAGTAGTAGT…-3 Bartlett Learning,. LLC cule is translated in vitro?© Jones How many & Bartlett reading frames Learning, LLC What is the sequenceNOT FORin the SALEother strand? OR DISTRIBUTION (Write are possible if this moleculeNOT FORis translated SALE in vivo,OR DISTRIBUTIONin the answer with the 5 end at the left.) which translation starts with the codon AUG?

1.15 If the template strand of a DNA duplex has the 1.22 You have sequenced both strands of a double- sequence 5-TCAG-3, what is the sequence of the stranded DNA molecule. To evaluate the potential ©RNA Jones transcript? & Bartlett (Write theLearning, answer with LLC the 5 end of this© moleculeJones &for Bartlettcoding amino Learning, acids, you concepLLC - NOTat the FOR left.) SALE OR DISTRIBUTION tuallyNOT transcribe FOR it SALE into RNA OR and DISTRIBUTION then conceptually translate the RNA into a polypeptide chain. How 1.16 If the nontemplate strand of a DNA duplex has the many reading frames would you have to examine? sequence 5-ATCAG-3, what is the sequence of the RNA transcript across this region? (Write the 1.23 A synthetic mRNA molecule consists of the repeat-  © Jones & Bartlettanswer Learning, with the 5 end LLC at the left). © Jones &ing Bartlett base sequence Learning, LLC NOT FOR1.17 SALE A duplex OR DISTRIBUTION DNA molecule contains a random sequenceNOT FOR SALE OR5 -ACACACACACACAC…-3DISTRIBUTION  of the four nucleotides with equal proportions of When this molecule is translated in vitro, the result each. What is the average spacing between consecu- is a polypeptide chain consisting of the alternating tive occurrences of the sequence 5 -ATGC-3? amino acids Thr–His–Thr–His–Thr–His–. . . . Why Between consecutive occurrences of the sequence do the amino acids alternate? What does this result 5-TACGGC-3?© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC imply about the codons for threonine (Thr) and his- NOT FOR SALE OR DISTRIBUTION tidine (His)? NOT FOR SALE OR DISTRIBUTION 1.18 An RNA molecule folds back upon itself to form a “hairpin” structure held together by a region of base 1.24 A synthetic mRNA molecule consists of the repeat- pairing. One segment of the molecule in the paired ing base sequence region has the base sequence 5-UAUCGUAU-3. What is the base sequence with which this segment © Jones & Bartlett Learning, LLC © Jones5-AUCAUCAUCAUCAUC…-3 & Bartlett Learning, LLC is paired? NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION When this molecule is translated in vitro, the 1.19 A synthetic mRNA molecule consists of the repeat- result is a mixture of three different polypeptide ing base sequence chains. One consists of repeating isoleucines (Ile – Ile – Ile – Ile –. . .), another of repeating ser- 5-AAAAAAAA…-3 ines (Ser – Ser – Ser – Ser –. . .), and the third of © Jones & Bartlett Learning, LLC © Jones &repeating Bartlett histidines Learning, (His LLC – His – His –His –. . .). NOT FOR SALEWhen OR this DISTRIBUTION molecule is translated in vitro usingNOT FOR WhatSALE does OR this DISTRIBUTION result imply about the manner in ribosomes, transfer RNAs, and other necessary which an mRNA is translated? constituents from E. coli, the result is a polypeptide chain consisting of the repeating amino acid Lys– 1.25 How is it possible for a gene with a mutation in the Lys–Lys–. . . . If you assume that the genetic code is coding region to encode a polypeptide with the a triplet code, what© Jones does this & result Bartlett imply aboutLearning, the LLC same amino acid sequence© Jones as the nonmutant& Bartlett gene? Learning, LLC codon for lysine (Lys)? NOT FOR SALE OR DISTRIBUTION1.26 A polymer has a randomNOT sequence FOR SALE consisting OR ofDISTRIBUTION 1.20 A synthetic mRNA molecule consisting of the 75 percent G and 25 percent U. Among the amino repeating base sequence acids in the polypeptide chains resulting from in vitro translation, what is the expected frequency of Trp? Of Val? Of Phe? © Jones 5&-UUUUUUUUUUUU…-3 Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOTis terminated FOR SALE by the OR addition, DISTRIBUTION to the right-hand 1.27 ResultsNOT of complementationFOR SALE OR tests DISTRIBUTION of the six indepen- end, of a single nucleotide bearing A. When trans- dent recessive mutations a–f are shown in the lated in vitro, the resulting polypeptide consists of accompanying matrix, where 1 indicates comple- a repeating sequence of phenylalanines terminated mentation and 2 indicates lack of complementa- by a single leucine. What does this result imply tion. Classify the mutations into complementation © Jones & Bartlettabout theLearning, codon for leucine?LLC © Jones &groups, Bartlett and Learning, write the names LLC of the mutations in NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 36 08/11/17 8:52 am Analysis and Applications 37

© Jones & Bartletteach complementationLearning, LLC group in the blanks© Jones1.29 & The Bartlett coding Learning,sequence in theLLC messenger RNA for provided below. (Some of the blanks may remainNOT FOR aminoSALE acids OR 1 DISTRIBUTION through 10 of human phenylalanine NOT FOR SALEempty.) OR DISTRIBUTION hydroxylase is: b c d e f 5-AUGUCCACUGCGGUCCUGGAAAACCCAGGC-3 a ++__+ (a) What are the first 10 amino acids? (b) b ++++ Which sequence would result from a mutant © Jones & Bartlett Learning, LLC RNA in which the© redJones A was & changed Bartlett to G? Learning, LLC c NOT FOR++ SALE+ OR DISTRIBUTION (c) Which sequenceNOT would FOR result SALE from a OR mutant DISTRIBUTION _ RNA in which the red C was changed to G? d + (d) Which sequence would result from a mutant e + RNA in which the red U was changed to C? (e) Which sequence would result from a mutant ©Mutations Jones & in Bartlett complementation Learning, LLC ©RNA Jones in which & Bartlett the red G wasLearning, changed toLLC U? NOTgroup FOR 1: ___ SALE ___ OR___ DISTRIBUTION______NOT FOR SALE OR DISTRIBUTION 1.30 A “frameshift” mutation is a mutation in which Mutations in complementation some number of base pairs, other than a multiple of group 2: ______three, is inserted into or deleted from a coding Mutations in complementation region of DNA. The result is that, at the point of the © Jones & Bartlettgroup 3:Learning, ______LLC______© Jones &frameshift Bartlett mutation, Learning, the readingLLC frame of protein translation is shifted with respect to the nonmutant NOT FOR SALEMutations OR DISTRIBUTION in complementation NOT FOR gene.SALE To ORsee the DISTRIBUTION consequence of a frameshift muta- group 4: ______tion, consider that the coding sequence in the messenger RNA for the first 10 amino acids in human 1.28 A mutant screen is carried out in Neurospora crassa beta hemoglobin (part of the oxygen-carrying pro- for mutants that are unable to synthesize an amino tein in the blood) is acid, that we will© Jones symbolize & Bartlettas G. A number Learning, of LLC © Jones & Bartlett Learning, LLC   mutants are isolated and classified into four groups 5 -AUG GUG CAC CUG ACU CCU GAG GAG AAG UCU…–3 NOT FOR SALE1 OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION according to their ability to grow ( ) or not grow (a) What is the amino acid sequence in this part 2 ( ) in minimal medium supplemented with pos- of the polypeptide chain? sible precursors D, E, and F. The data are shown in (b) What would be the consequence of a the accompanying table. frameshift mutation resulting in an RNA © Jones & Bartlett Learning, LLC ©missing Jones the & red Bartlett U? Learning, LLC DEFG (c) NOT FOR SALE OR DISTRIBUTION NOTWhat FOR would SALE be theOR consequenceDISTRIBUTION of a Class 1 1 1 1 1 frameshift mutation resulting in an RNA with Class 2 2 2 2 1 a G inserted immediately in front of the red U? 2 2 1 1 Class 3 1.31 A news headline reads “Gene for Schizophrenia Class 4 1 2 1 1 Identified.” Does this necessarily mean © Jones & Bartlett Learning, LLC © Jones &that Bartlett schizophrenia Learning, in an LLCindividual can be diag- NOT FOR SALEComplete OR DISTRIBUTION the diagram shown below. Each arrowNOT FOR nosedSALE by OR genetic DISTRIBUTION analysis alone? Explain your indicates one or more biochemical reactions. answer. Within each circle, write the class of mutants 1.32 (1–4) whose products contribute to the reactions Using the data in Table 1.2, construct a graph, plot- symbolized by the arrow; in the squares, write the ting genome size for the different organisms on the x y name of the amino© Jones acid or precursor& Bartlett (D–G) Learning, at that LLC -axis and number of ©genes Jones on the & -axis. Bartlett Now, conLearning,- LLC Ambystoma position in the pathway. sider the case of the Mexican axolotl ( NOT FOR SALE OR DISTRIBUTIONmexicana), with an estimatedNOT FOR genome SALE size of OR 32 bil- DISTRIBUTION lion base pairs. Based on your graph, can you pre- dict the number of genes that are present in this genome? Explain your answer. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 37 08/11/17 8:52 am 38 CHAPTER 1 Genes, Genomes, and Genetic Analysis

© Jones CHALLENGE& Bartlett Learning, PROBLEMS LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION CHALLENGE PROBLEM 1 With regard to the wild-type CHALLENGE PROBLEM 3 The 10 mutants in Challenge and mutant RNA molecules described in Problem 1.30, Problem 2 were tested for complementation in all pairwise deduce the base sequence in both strands of the corre- combinations using heterokaryons. The results are shown sponding double-stranded DNA for: in the matrix, in which 1 indicates the ability of the heterokaryon to grow in minimal medium and 2 indicates inabil- (a) The wild-type sequence© Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC ity to grow in minimal medium. (b) The single-base deletionNOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION (c) The single-base insertion 2 3 4 5 6 7 8 9 10 CHALLENGE PROBLEM 2 You are carrying out Beadle‒ Mutant 1 1 1 2 1 1 1 1 1 1 Tatum type experiments to analyze a metabolic pathway in 2 1 1 1 1 1 1 1 1 Neurospora© Jones. You know & Bartlett that the precursor Learning, in the LLC pathway is a © Jones & Bartlett Learning, LLC molecule symbolized as P and that the product is a vitamin 3 1 1 1 2 1 1 1 symbolizedNOT asFOR Z. You SALE are sure OR that DISTRIBUTIONthe pathway from P to Z is NOT FOR SALE OR DISTRIBUTION 4 1 1 1 1 1 1 linear and that the molecules W, X, and Y are intermediates. However, there may be other intermediates not yet identi- 5 1 1 1 1 1 fied. You obtain 10 independent mutations that cannot grow 6 1 1 1 1 on minimal medium supplemented with P, but can grow on © Jones &minimal Bartlett medium Learning, supplemented LLC with Z. The 10 mutants fall© Jones & Bartlett7 Learning, LLC 1 1 1 NOT FORinto SALE four classesOR DISTRIBUTION that can grow (1) or cannot grow (2) onNOT FOR SALE OR DISTRIBUTION 8 minimal medium supplemented with the nutrients W, X, 1 1 or Y. The data are shown in the accompanying table. 9 2

PWXYZ Assume that each complementation group defines a Class I (mutant 5) © Jones2 & Bartlett 2 2 Learning, 2 1 LLCdifferent gene, and assume© Jones further & that Bartlett each gene Learning, LLC encodes an enzyme that catalyzes a single step in the Class II (mutants 1, 3, 4, NOT6, 7) FOR2 SALE 1 1OR 1DISTRIBUTION 1 NOT FOR SALE OR DISTRIBUTION metabolic pathway, which converts one molecule of Class III (mutant 2) 2 1 2 1 1 substrate into one molecule of product. Class IV (mutants 8, 9, 10) 2 2 2 1 1 (a) Redraw the metabolic pathway deduced from Chal- lenge Problem 2. Use a right arrow to indicate each Draw© a linearJones metabolic & Bartlett pathway Learning, with P on theLLC left and Z enzymatic© Jones step in the& Bartlett pathway, Learning,and label each LLC arrow on theNOT right, FOR in which SALE each ofOR the DISTRIBUTION intermediates W, X, and with theNOT mutant FOR number SALE 1–10 OR that DISTRIBUTION blocks the enzy- Y is shown in the order in which it occurs in the metabolic matic step. In some cases, you will not be able to specify pathway in the synthesis of Z from P. the order in which the enzymes occur in the pathway, so you may write them in any order you wish. (b) In the metabolic pathway that you have deduced from the data, how many unknown intermediates are there © Jones & Bartlett Learning, LLC © Jonesbetween & Bartlett the precursor Learning, P and the LLC vitamin Z? NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION FOR FURTHER READING

The 1000 Genomes Consortium. (2015). A global refer- Beadle, G. W., & Tatum, E. L. (1941). Genetic control of ence for human genetic© Jonesvariation. & BartlettNature, 526 Learning,(7571), LLCbiochemical reactions in Neurospora© Jones. Proceedings& Bartlett of Learning,the LLC National Academy of Sciences of the United States of America 68–74. http://doi.org/10.1038/nature15393NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION, 27(11), 499–506. http://www.ncbi.nlm.nih.gov/ An overview of the 1000 Genomes Project. pubmed/16588492 Avery, O. T. (1944). Studies on the chemical nature of the The origin of the one gene–one enzyme hypothesis. substance inducing transformation of pneumococcal Crick, F. (1970). Central dogma of molecular biology. types: Induction of transformation by a deoxyribonucleic © Jones & Bartlett Learning, LLC Nature, 227©(5258), Jones 561–563.& Bartlett http://doi.org/10.1038 Learning, LLC acid fraction isolated from pneumococcus type III. Journal NOT FOR SALE OR DISTRIBUTION /227561a0NOT FOR SALE OR DISTRIBUTION of Experimental Medicine, 79(2), 137–158. http://doi. Crick’s clearest statement of the central dogma, in terms of infor- org/10.1084/jem.79.2.137 mation flow from DNA to protein but not the reverse. Considered by most to be the definitive evidence that DNA is the genetic material. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 38 08/11/17 8:52 am FOR FURTHER READING 39

© Jones Griffith,& Bartlett F. (1928). Learning, The significance LLC of pneumococcal types.© JonesWatson, & Bartlett J. D., & Crick, Learning, F. H. (1953). LLC Molecular structure Journal of Hygiene 27 , (2), 113. http://doi.org/10.1017/NOT ofFOR nucleic SALE acids: OR A structure DISTRIBUTION for deoxyribose nucleic acid. NOT FORS0022172400031879 SALE OR DISTRIBUTION Nature, 171(4356), 737–738. http://www.ncbi.nlm.nih. The first demonstration that there is a “transforming gov/pubmed/13054692 principle.” The original publication describing the double-helical structure of DNA. Hershey, A. D., & Chase, M. (1952). Independent functions of viral protein and© nucleicJones acid & inBartlett growth of Learning, bacterio- LLCWatson, J. D., & Crick, F. H.© (1953).Jones Genetical & Bartlett implica Learning,- LLC phage. Journal of GeneralNOT Physiology FOR, SALE36(1), 39–56. OR DISTRIBUTION http:// tions of the structure of deoxyribonucleicNOT FOR SALE acid. NatureOR DISTRIBUTION. doi.org/10.1085/jgp.36.1.39 http://doi.org/10.1038/171964b0 Further confirmation that DNA, as opposed to protein, is the A less well-known but nevertheless very important paper in which genetic material. Watson and Crick first suggest a basis for the genetic code. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION

9781284136609_CH01_Hartl.indd 39 08/11/17 8:52 am