Tonicity-Responsive Enhancer-Binding Protein Mediates Hyperglycemia-Induced Inﬂammation and Vascular and Renal Injury

BASIC RESEARCH www.jasn.org

Soo Youn Choi ,1 Sun Woo Lim,2 Shabnam Salimi,3 Eun Jin Yoo,1 Whaseon Lee-Kwon,1 Hwan Hee Lee,1 Jun Ho Lee,1 Braxton D. Mitchell,3,4 Satoru Sanada,3 Afshin Parsa,3,5 and Hyug Moo Kwon1

1School of Life Sciences, Ulsan National Institute of Science and Technology, Ulsan, Republic of Korea; 2Transplantation Research Center, Catholic University of Korea, Seoul, Republic of Korea; 3Department of Medicine, University of Maryland School of Medicine, Baltimore, Maryland; and 4Geriatrics Research and Education Clinical Center and 5Division of Nephrology, Department of Medicine, Baltimore Veterans Administration Medical Center, Baltimore, Maryland

ABSTRACT Diabetic nephropathy (DN) has become the single leading cause of ESRD in developed nations. Bearing in mind the paucity of effective treatment for DN and progressive CKD, novel targets for treatment are sorely needed. We previously reported that increased activity of tonicity-responsive enhancer-binding protein (TonEBP) in monocytes was associated with early DN in humans. We now extend these findings by testing the hypotheses that TonEBP in macrophages promotes hyperglycemia-mediated proinflammatory activation and chronic renal inflammation leading to DN and CKD, and TonEBP genetic variability in humans is associated with inflammatory, renal, and vascular function–related phenotypes. In a mouse model of DN, compared with the wild-type phenotype, TonEBP haplodeficiency associated with reduced activation of macrophages by hyperglycemia, fewer macrophages in the kidney, lower renal expression of proinflammatory genes, and attenuated DN. Furthermore, in a cohort of healthy humans, genetic variants within TonEBP associated with renal function, BP, and systemic inflammation. One of the genetic variants associated with renal function was replicated in a large population-based cohort. These findings suggest that TonEBP is a promising target for minimizing diabetes- and stress-induced inflammation and renovascular injury.

J Am Soc Nephrol 29: 492–504, 2018. doi: https://doi.org/10.1681/ASN.2017070718

Diabetic nephropathy (DN) is a complex disease In macrophages, TonEBP (tonicity-responsive with progressive decline in renal function that in- enhancer-binding protein) is the rate-limiting com- volves multiple pathways including inﬂammation, ponent of “NFkB enhanceosome” in which TonEBP endothelial injury, and tubular injury. Only 30% of patients with type 1 diabetes and 40% of those with Received July 3, 2017. Accepted September 24, 2017. type 2 diabetes develop DN, indicating considerable S.Y.C. and S.W.L. contributed equally to this work. individual variations in susceptibility.1 Genome- wide studies have uncovered many genetic variants Published online ahead of print. Publication date available at associated with CKD; nevertheless, they only ac- www.jasn.org. count for a small proportion of the total genetic Correspondence: Dr. Hyug Moo Kwon, School of Life Sciences, contribution.2–4 As such, complementary ap- Ulsan National Institute of Science and Technology, 50 UNIST-gil, Ulju-gun, Ulsan 689-798, Republic of Korea 44919, or Dr. Afshin proaches, such as animal models and translational Parsa, University of Maryland School of Medicine, 685 West candidate gene approaches, are needed to better Baltimore Street, MSTF 357, Baltimore, MD 21201. Email: hmkwon@ help delineate genetic contributors and novel targets unist.ac.kr or [email protected] for treatment. Copyright © 2018 by the American Society of Nephrology

492 ISSN : 1046-6673/2902-492 J Am Soc Nephrol 29: 492–504, 2018 www.jasn.org BASIC RESEARCH binds activated NFkB, histone acetylatransferase p300, and RNA Significance Statement polymerase II on the promoters of the TNF-a and other inflammatory genes.5,6 Haplo-deficiency of TonEBP results in a TonEBP (tonicity-responsive enhancer-binding protein), also known reduced NFkB enhanceosome activity and blunted macro- as Nfat5, is a transcription factor with a physiologic role in the re- phage activation in response to inflammatory signals. Thus, sponse to osmotic stress in epithelial cells of the renal medulla. fi Recent evidence points to additional functions in macrophages. This TonEBP haplo-de cient animals display dramatically reduced study provides evidence that TonEBP constitutes a causal link be- inflammatory injury in animal models of rheumatoid arthri- tween hyperglycemia and induction of proinflammatory gene ex- tis7,8 and atherosclerosis.9 We previously reported that among pression in macrophages, renal infiltration by macrophages, and patients with approximately 30 years of type 1 diabetes, pro- macrophage-mediated renal injury. Beyond this, the investigators fi teinuria was associated with approximately 50% higher To- nd in a cohort of healthy humans that genetic variations in the TonEBP gene are associated with systemic inflammation and renal 10 nEBP activity in monocytes. Here, we extend these results function. TonEBP is a novel target for therapy development for by showing in a mouse model that TonEBP mediates the diabetic complications including diabetic nephropathy. hyperglycemia-induced proinflammatory activation of macrophages leading to renal infiltration of macrophages and DN. In humans, we find TonEBP-associated single nucleo- We asked whether the elevated expression of TonEBP in tide polymorphisms (SNPs) to be associated with systemic response to hyperglycemia was responsible for the elevated inflammatory markers, BP, and renal function. Our animal- NFkB activity and M1 polarization. When TonEBP was based findings along with consistent SNP-based association knocked down, the LPS-induced activation of NFkB (Figure in related phenotypes in humans suggest that genetic vari- 1F) and M1 gene expression was reduced without changes in ability in TonEBP leads to differential susceptibility to in- TLR4 mRNA expression (Figure 1G) in high-glucose condi- flammatory responses, vascular injury, and CKD, in response tions. Likewise, the induction of M1 genes by LPS was reduced in PMs and bone marrow–derived macrophages (BMDMs) to stressors such as hyperglycemia. +/Δ obtained from the TonEBP mice compared with those ob- +/+ tained from their TonEBP littermates (Figure 1H). These RESULTS data demonstrate that in macrophages TonEBP is induced by hyperglycemia leading to activation of NFkB and elevation of fi Hyperglycemia Stimulates M1 Polarization and M1 gene expression. In the TonEBP haplo-de cient animals, Migration of Macrophages via Upregulation of TonEBP the M1 gene induction in response to diabetes was blunted We sought to investigate the underlying molecular mechanism (Figure 1B), as expected. fi for our previously noted association between TonEBP activity We showed previously that haplo-de ciency of TonEBP in in monocytes and DN in patients with type 1 diabetes.10 Because bone marrow cells resulted in approximately 80% reduction in previous studies demonstrated the role of macrophage-mediated the size of atherosclerotic plaques in a mouse model of ath- 9 inflammation in the development of DN,11,12 we decided to ex- erosclerosis. The reduced atherosclerotic lesion was asso- amine macrophages in a mouse model of type 1 diabetes. In ciated with reduced cell migration of BMDMs. We asked order to mimic the differences in the level of TonEBP activity, whether hyperglycemia affected migration of macrophages. +/Δ we used the TonEBP heterozygous (TonEBP ) mice because We found that BMDMs from wild-type animals were stimu- they display TonEBP haplo-deficiency.7,9,13 We made the lated by an increase in glucose concentration to 25 mM, but +/Δ +/+ TonEBP mice and their TonEBP wild-type (TonEBP ) litter- not by addition of mannitol to the same osmolality (Figure mates hyperglycemic by injecting streptozotocin (STZ) as shown in 2A). This cell migration was dramatically reduced in BMDMs fi Figure 1A. When peritoneal macrophages (PMs) from the obtained from the TonEBP haplo-de cient animals (Figure +/+ TonEBP animals were examined, higher mRNA expression 2B). Taken together, the data in Figures 1 and 2 demonstrate for TonEBP and M1 polarization, as indicated by increased proin- that hyperglycemia enhances TonEBP expression in macro- flammatory gene expression, in diabetic animals compared with phages, leading to M1 polarization and increased migration nondiabetic animals was observed (Figure 1B). These changes were of macrophages. A modest, approximately 50% reduction in reproduced in Raw264.7 cells cultured in high glucose (Figure 1C): TonEBP expression resulted in a dramatic decrease in the M1 raising glucose concentration to 25 mM resulted in higher TonEBP polarization and migration. expression in a manner synergistic with LPS, whereas addition of mannitol to the same osmolality did not. Furthermore, the high TonEBP Haplo-Deficiency Displays Reduced Number of glucose–enhanced TonEBP expression was associated with ele- Renal Macrophages and Renal Inflammation in Mouse vated NFkB activity in the presence of LPS (Figure 1D). Because Model of DN most of the M1 genes were NFkB target genes, expression of M1 Given the reduced activation and migration of macrophages in genes was elevated as expected (Figure 1E). These observations response to hyperglycemia in the TonEBP haplo-deficient indicate that the enhanced TonEBP expression and M1 polariza- animals (see above), we asked whether reduced renal macro- tion of macrophages from diabetic animals (Figure 1B) are due, at phages were observed in these animals in a mouse model of least in part, to hyperglycemia. DN: deficiency of endothelial nitric oxide synthase (eNOS),

J Am Soc Nephrol 29: 492–504, 2018 TonEBP in Diabetic Nephropathy 493 BASIC RESEARCH www.jasn.org

Δ Figure 1. Hyperglycemia induces TonEBP and stimulates M1 gene expression in macrophages. (A and B) TonEBP+/+ or TonEBP+/ mice were injected with vehicle (nondiabetic [ND], n=6) or STZ (diabetic [D], n=16). (A) Blood glucose and body weight, mean+SEM. (B) mRNA abundance for TonEBP, TNF-a, iNOS, and COX-2 in PMs relative to TonEBP+/+,ND. Mean+SEM, n=6. (C–E) High glucose induces TonEBP, and stimulates NFkB and its target genes in Raw264.7 cells. (C) Cells were treated with various combinations of high glucose, mannitol, vehicle (VH), and LPS as indicated for 24 hours. Immunoblots for TonEBP, iNOS, and Hsc70 are shown. (D) Cells transfected with an NFkB luciferase reporter were treated for 6 hours with VH or LPS in combination with 5.5 or 25 mM glucose, as indicated. Normalized luciferase activity relative to 5.5 mM glucose and VH (fold) is shown as mean+SD, n=3. (E) Cells were treated for 6 hours with various combinations of LPS and 25 mM glucose. mRNA abundance relative to VH and 5.5 mM glucose (fold) is shown as mean+SD, n=3. (F–H) TonEBP deﬁciency inhibits NFkB and reduces proinﬂammatory genes in macrophages under high-glucose conditions. (F) Raw264.7 cells were transfected with scrambled (Scr) or TonEBP siRNA followed by transfection with the NFkB luciferase reporter. After 6 hours of treatment with VH or LPS in 25 mM glucose, TonEBP and Hsc70 were immunoblotted and luciferase was measured. n=3. (G) Raw264.7 cells were transfected with siRNA followed by treatment with LPS in high glucose. mRNA abundance for Δ TNF-a, iNOS, COX-2, and TLR4 relative to Scr siRNA, n=3. (H) PMs and BMDMs obtained from TonEBP+/+ or TonEBP+/ mice were treated and analyzed as above. n=6. Mean+SEM. *P,0.01 compared with corresponding ND (B) or VH (D–F). #P,0.01 compared with corresponding TonEBP+/+ (B and H), 5.5 mM glucose (D and E), and Scr siRNA (F and G).

+/Δ 2/2 +/+ 2/2 +/+ 2/2 i.e., TonEBP ,eNOS versus TonEBP ,eNOS (Figure 3D) were higher in the TonEBP animals on the eNOS +/+ 3, A and B; see also Supplemental Material for details). Renal background compared with those on the eNOS back- 2/2 macrophage numbers assessed by F4/80 mRNA expression (Fig- ground. In those animals on the eNOS background, but +/+ ure 3C) and immunohistochemical analyses of F4/80 (Figure not those on the eNOS background, both the mRNA

494 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 492–504, 2018 www.jasn.org BASIC RESEARCH

reported18,20: mesangiolysis, mesangial expansion, microaneurysm, and diffuse and nodular sclerotic lesions (Figure 5A). The glomerular injury was significantly milder in the TonEBP haplo-deficient animals on the basis of visual impression (Figure 5A) and the percentage of injured glomeruli (Figure 5B). Albuminuria displayed the same pattern of changes (Figure 5C). Tubulointerstitial fibrosis was absent in animals with normal endothelial function but dramatically induced with endothelial dysfunction (Figure 6, A and B). Diabetes exacerbated the fibrosis, which was amelio- rated in the TonEBP-deficient animals. In- terestingly, immunohistochemical signals of TGF-b (Figure 6C) mirrored the changes in fibrosis, suggesting that changes Figure 2. High glucose–induced macrophage migration is defective in TonEBP de- in TGF-b expression were responsible for fi ficiency. (A) BMDMs isolated from wild-type (TonEBP+/+) animals were cultured in normal the variations in brosis. Thus, diabetic glucose (5.5 mM), high glucose (25 mM), or 5.5 mM glucose +19.5 mM mannitol (osmotic renal injuries were dramatically tempered control for high glucose). The cells were then plated on membranes with 5-mmporesand in the TonEBP haplo-deficient animals in cell migration for 16 hours through the pores in response to MCP-1 was visualized by association with reduced macrophage infil- DAPI staining. Cells migrated were counted and expressed relative to 5.5 mM glucose tration and renal inflammation. Δ condition (fold). (B) BMDMs isolated from TonEBP+/+ or TonEBP+/ mice were cultured in high glucose and analyzed as above. Mean+SEM, n=3. *P,0.01 compared with 5.5, 2 (A) Hypotension and Hyperreninemia in or(+/+)(B).+/+,wild-type;+/D,heterozygous. TonEBP Haplo-Deficiency A recent report shows that the SNP rs33063 in the TonEBP gene is associated with pulse abundance and the number of F4/80-positive cells were lower in pressure.21 Because the functional significance of the associ- +/Δ +/+ the TonEBP mice compared with their TonEBP littermates. ated variant was not established, we tested whether reduced The decrease in the F4/80-positive cells was observed both in the TonEBP levels were associated with BP using the TonEBP glomerular (Figure 3E) and the tubular regions (Figure haplo-deficient mice. Consistent with the human association 3F). Thus, the reduced cell migration of the TonEBP haplo- studies, these animals displayed reduced systolic BP (SBP). We deficient macrophages (Figure 2) was translated into reduced also noted elevated renal renin expression and circulating re- 2/2 renal macrophage infiltration on the eNOS animals. This nin levels (Figure 7), presumably as a compensatory reaction pattern of reduced renal macrophage numbers in TonEBP to the reduced BP. haplo-deficiency on the background of endothelial deficiency was maintained in the renal expression of NFkB-driven, proin- Association of TonEBP Polymorphisms with flammatory genes—IL-6, MCP-1, IP-10, IL-8, TNF-a,IL-1b, Inflammatory, Vascular, and Renal Function Markers in RANTES, IL-18, and INF-g (Figure 4, A–I). All of these genes Humans have been implicated in DN both in patients14–16 and ani- Data in the previous sections demonstrate the relevance of mals.15,17 In correlation with the reduced IL-6 mRNA expres- TonEBP to glycemic stress–induced inflammation, renal sion, IL-6 signaling measured by phosphorylation of STAT3 was function, and BP. Moreover, previously published associa- reduced (Figure 4J), suggesting that the lower gene expression in tions of TonEBP expression with inflammation,6,22 rheuma- TonEBP haplo-deficiency led to reduced inflammation in the toid arthritis,7,8 atherosclerosis,9 and DN in humans10 raised kidney. the possibility that variations in TonEBP might affect similar phenotypes in humans. Accordingly, we performed a look-up TonEBP Haplo-Deficiency Displays Reduced Renal of TonEBP variant association in a highly homogeneous co- Injury in Mouse Model of DN hort of healthy individuals with minimal confounders (see Compared with animals with normal endothelial function, Methods and Supplemental Material for details) with mea- eNOS-deficient animals displayed significantly more mesan- sures of inflammation, renal function, and BP. gial expansion and glomerulosclerosis in basal conditions, as We identified a total of 320 SNPs on the basis of full se- reported previously (Figure 5, A and B).18,19 The glomerular quencing of the TonEBP gene region, from which we identi- injury worsened dramatically in diabetic animals as previously fied 16 haplotype blocks23 and selected 16 single haplotype

J Am Soc Nephrol 29: 492–504, 2018 TonEBP in Diabetic Nephropathy 495 BASIC RESEARCH www.jasn.org

and found a significant association between rs118095741 and absolute monocyte count (P=0.002). We also found rs74956396 to be suggestively associated with serum IL-1b (P,0.01) and homocysteine (P,0.01), whereas rs244416 was independently also suggestively associated with IL-1b (P,0.01). For our BP phenotypes, we found rs2287970 to be significantly associated with diastolic BP (DBP) (b=1.4, P=0.003) and suggestively with SBP (b=1.65, P=0.04). Lastly, for our renal phenotypes, we found a significant association between rs17297179 and eGFR (b=6.3, P=0.003) and suggestive association between rs17232663 and albuminuria (b=0.36, P,0.01). Further details are provided in the Supplemental Material. Sec- ondary adjustments for eGFR and BP, as appropriate, did not modify our findings (see Supplemental Material). Functional an- notations for our top identified SNPs are also summarized in Supplemental Table 3. We also attempted to replicate our renal function associated SNP within the open source CKDGen consortium meta-GWAS results for eGFR24 (n=67,093) and albuminuria.25 Neither our albuminuria se- Figure 3. TonEBP haplo-deficiency reduces renal macrophages in a mouse model of Δ quence based variant rs17232663 nor any DN. Mice were bred to generate littermates of TonEBP+/+ or TonEBP+/ animals on 2 2 SNPs in strong linkage disequilibrium eNOS+/+ or eNOS / background as indicated. Animals were injected with vehicle (LD) with it were identified in the more (VH) or STZ to induce diabetes as described in Figure 1. Seven weeks later, kidneys were analyzed. (A and B) Immunoblot images and quantification of TonEBP. (C) F4/80 limited HapMap based CKDGen database mRNA was measured using qRT-PCR. (D) Representative images of immunohisto- and hence could not be tested for replica- chemical staining for F4/80. (E and F) Number of F4/80-positive cells per glomerulus tion. Our eGFR variant rs17297179 or other (E) or 0.5 mm2 of tubular area (F) was counted. Mean+SEM, n=8. *P,0.05 compared variants in strong LD were similarly not with corresponding VH. #P,0.05 compared with corresponding TonEBP+/+. +/+, wild- available. However, we were able to identify type; +/D, heterozygous; 2/2, knock out. rs1064825, our second-best association with eGFR, which is in moderate LD with our top SNP (rs17297179), to be associated with tagging SNPs (Supplemental Figure 1). We then looked at the eGFR in CKDGen (b=0.006, P,0.003), hence validating our association between the 16 identified SNPs and our pheno- finding. types. On the basis of Bonferroni correction for the number In summary, in a highly homogeneous cohort of healthy of SNPs, a P value ,0.05/16=0.003 was considered statistically individuals with minimal confounders, gene variants in TonEBP significant. We also identified SNP-based associations with are associated with inflammation, renal function, and BP, all in P values ,0.05 but .0.003 as suggestively associated. On the accordance with our mouse TonEBP haplo-deficiency findings basis of this, we identified five significant and eight suggestive described here and previously. The association with renal func- associations, as noted in Table 1. For our inflammatory phe- tion is replicated in the CKDGen cohort, suggesting its relevance notypes, we found significant associations between rs72783114 to renal function. and serum matrix metalloprotease-1 (MMP-1) (P,0.001) and suggestive association with serum white blood cell count (P=0.04). We also found rs564919090 to be significantly as- DISCUSSION sociated with serum MMP-1 (P=0.001), independently of rs72783114. Given our previous findings of higher TonEBP Numerous underlying molecular mechanisms involved in glu- expression in monocytes from individuals with DN,10 we cose toxicity have been defined, including oxidative stress and also looked at the association with absolute monocyte values, advanced glycan end products (for a review, see 26). Here, we which were available in a different group of 473 healthy Amish, have demonstrated that hyperglycemia is a proinflammatory

496 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 492–504, 2018 www.jasn.org BASIC RESEARCH

migration in macrophages. The reduced renal injury in response to STZ-induced diabetes in the TonEBP haplo-deficient animals can be readily explained by the reduced macrophage numbers in the kidney in combination with reduced expression of proinflammatory genes by the macrophages. These data provide a mechanistic basis for the association of TonEBP activity in monocytes and DN in patients with type 1diabetes.10 In line with this, we previously reported that TonEBP haplo-deficiency in bone marrow cells led to an 80% reduction in the size of atherosclerotic lesions.9 The same pathway in monocytes can also ex- plain the dramatically reduced rheumatoid arthritis7,8 in the TonEBP haplo-deficient animals. Other investigators have reported that monocytes isolated from humans with both type 1 and type 2 diabetes display an inflammatory phenotype because they secrete higher levels of proinflammatory cytokines.27–29 The data presented here re- veal that hyperglycemia stimulates NFkB via induction of TonEBP: TonEBP is a transcriptional cofactor of NFkB by way of recruiting histone acetyl transferase p300 leading to increased expression of proinflammatory cytokines and COX-26.Thus, TonEBP is a critical mediator of diabetes- induced inflammation in macrophages. Given our animal-based findings, we examined whether TonEBP gene variants in humans were associated with phenotypes that are affected by TonEBP expression levels Figure 4. TonEBP haplo-deficiency reduces renal expression of proinflammatory in our animal model and noted multiple fi fi genes and STAT3 activation in a mouse model of DN. mRNA for IL-6 (A), MCP-1 (B), IP- consistent ndings. This included signi - 10 (C), IL-8 (D), TNF-a (E), IL-1b (F), RANTES (G), IL-18 (H), and IFN-g (I) was measured cant associations with serum MMP-1 and from the kidney samples described in Figure 3 using qRT-PCR. Animals injected with absolute monocyte counts. This corrobo- VH are shown in open bars, and those injected with STZ in filled bars. Mean+SEM, rates our previous finding of increases in n=8. *P,0.05 compared with corresponding VH. #P,0.05 compared with corre- TonEBP expression in monocytes of indi- sponding TonEBP+/+. (J) Representative images of immunohistochemical staining for viduals with DN.10 Because IL-1b is a direct phosphorylated STAT3. Arrow heads denote intense signals in tubulointerstitial areas. transcriptional target of TonEBP,5,6 the 2 2 VH, vehicle; +/+, wild-type; +/D, heterozygous; / , knock out. suggestive association of TonEBP SNPs with circulating levels of IL-1b and homo- signal for macrophages (Figure 8). The effects of hyperglyce- cysteine observed in this study supports the notion that To- mia are similar to those of LPS6: like LPS, hyperglycemia en- nEBP genetic variability may possibly affect IL-1b expression hances TonEBP expression which in turn drives the expression in humans. The previously noted association between TonEBP of proinflammatory genes via stimulation of NFkB. In addi- variants and pulse pressure21 also confirms our association tion, hyperglycemia stimulates the migration of macrophages, with BP, whereas the associations with eGFR and albuminuria another key proinflammatory phenotype, which is also To- are novel. Interestingly, in a cohort which included .700 in- nEBP-dependent. Even more interesting is the finding that dividuals with DN, Kavanagh et al.30 found rs17297207 in TonEBP haplo-deficiency is associated with dramatically re- TonEBP to be weakly associated with DN (OR, 0.66; duced expression of the proinflammatory genes as well as P=0.04). The rs17297207 SNP from the Kavanagh et al. study

J Am Soc Nephrol 29: 492–504, 2018 TonEBP in Diabetic Nephropathy 497 BASIC RESEARCH www.jasn.org

tissue-specific enhancer and repressor can provide additional mechanisms for differential regulation of various downstream pathways. Consistent with our findings, three distinct TonEBP signals have been associated with various phenotypes, such as: (1) rs7193778 with uric acid and CRP,33,34 rs33063 with pulse pressure,21,35 and rs9980 with plasma osmolality,35 which are all in strong LD with each other and rs244416 from our analysis (associated with IL-1b and DBP); (2) rs12599391 with age at menarche36 and rs6499244 with allogeneic hematopoietic stem cell transplantation outcomes,37 which are in LD with each other but not with any of our identified SNP’s; and (3) rs17297207 with DN,30 which is in LD with our monocyte count–associated SNP (rs118095741). Lastly, in an interesting human case of TonEBP haplo-insufficiency, disturbances in both innate and adaptive im- munity leading to intestinal autoimmunity38 were noted, again supporting our findings. Limitations of our findings include the lack of information on the putative functional SNPs driving our associations, as well as their effect on TonEBP expression. Ac- fi Figure 5. TonEBP haplo-de ciency reduces glomerular injury and albuminuria in a cordingly, we cannot prove that the noted – mouse model of DN. (A) Representative images of periodic acid Schiff staining of kidney associations between the TonEBP SNPs in sections. (B) Percentage of glomeruli with injury: mesangial matrix expansion, me- our and previous studies are due to differen- sangiolysis, and glomerulosclerosis. (C) Albumin and creatinine were measured from urine tial expression of TonEBP. Moreover, our set samples, and micrograms albumin per milligram of creatinine was calculated. Mean+SEM, fi n=8. *P,0.05 compared with corresponding VH. #P, 0.05 compared with corresponding of statistically suggestive ndings should not TonEBP+/+. VH, vehicle; +/+, wild-type; +/D, heterozygous; 2/2,knockout. be over-interpreted without further valida- tion with more data in independent cohorts. is in perfect LD with rs118095741, which we found to be sig- However, there are factors that suggest these suggestive findings, nificantly associated with serum monocyte count (P,0.002) in addition to our significantly associated findings, are worth and MMP-1 measures in our population. This is also in agree- further study. Most notably, we have already established, via ment with our previously noted association of a near 50% our animal-based experiments, mechanistic pathways by which increase in TonEBP expression in monocytes of type 1 diabetic TonEBP deficiency can affect our selected outcomes. Second, individuals with proteinuria.10 many of our findings are at least partially corroborated by related Although several variants were each associated with multi- previous publications. Last, our findings are highly consistent ple related phenotypes, as in our animal model, we also noted a across our mouse model and identified human phenotypes. significant amount of distinct associations between several These findings provide further impetus for the targeting of To- variants and phenotypes. A plausible explanation for this is nEBPas a potential novel treatment for inhibiting inflammation- that these variants are associated with differential expression of based renal injury. Lastly, we previously showed that cerulenin distinct TonEBP isoforms. Indeed, given that this gene can could suppress the TonEBP-mediated proinflammatory activa- regulate hundreds of genes,5,7 both as enhancer and tion of NFkB and downstream inflammation,16 demonstrating suppressor, a complex regulatory process is arguably required. that the targeting of TonEBP may be a viable therapeutic option. For example, it has been shown to stimulate genes as a DNA binding transcription factor31 or as a transcriptional cofactor for NFkB and other DNA binding proteins,6 while suppressing CONCISE METHODS other genes by recruiting histone methylase32 or by recruiting DNA methylase to promoter regions (unpublished observa- Animals tions by H.H.L.). It has also been noted to have seven splice All animal procedures were approved by the Institutional Animal Care isoforms (Ensembl, GRCh38.p10), which in addition to and Use Committee at Ulsan National Institute of Science and Tech-

498 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 492–504, 2018 www.jasn.org BASIC RESEARCH

STZ injections were considered diabetic. Con- trol, nondiabetic animals were injected with the buffer. Six or 7 weeks post the STZ injections the animals were analyzed for macrophages (see be- low) and nephropathy. Body weight and blood glucose levels were monitored weakly. After spot urine was collected, animals were euthanized with intraperitoneal injection of Zoletil 50 (10 mg/kg; Virbac Laboratories, Carros, France) and Rompun (15 mg/kg; Bayer, Leuverkusen, Germany) to collect blood samples and tissue

specimens. Fractional excretion of sodium (FENA), urine osmolality, urine creatinine, urine albumin, and BUN were measured as described previously with slight modification.39,40 Tissue sections were stained with periodic acid–Schiff and Trichrome to assess glomerular injury and renal interstitial fibrosis, respectively. Randomly selected fields were analyzed to quantify injuries and fibrosis. For BP and renin analyses, 5-week-old Figure 6. TonEBP haplo-deficiency reduces tubulointerstitial fibrosis and TGF-b ex- animals were used. pression. (A) Representative images of Masson’s trichrome staining of kidney sections. (B) Blue areas representing collagen deposition were measured and expressed as percentage. Mean+SEM, n=8. *P,0.05 compared with corresponding VH. #P,0.05 Raw264.7 Cells, PMs, and BMDMs compared with corresponding TonEBP+/+. (C) Representative images of immunohis- Raw264.7 cells were obtained from the American tochemical staining for TGF-b. Asterisks denote intense signals in tubulointerstitial Type Culture Collection (Manassas, VA) and areas. VH, vehicle; +/+, wild-type; +/D,heterozygous;2/2, knock out. were grown in DMEM (Hyclone, Logan, UT) supplemented with 10% (v/v) FBS (Gibco +/Δ nology. The TonEBP mice on C57BL/6 background were obtained BRL, Grand Island, NY). Where indicated, cells were switched to from Dr. S.N. Ho.13 They were crossed back to the C57BL/6 line (The 25 mM D-glucose or 5.5 mM D-glucose plus 19.5 mM mannitol +/Δ Jackson Laboratory, Bar Harbor, ME) to produce TonEBP animals (osmotic control for high glucose). Growth media were changed every +/+ and their TonEBP littermates. Where indicated, the animals 12 hours to prevent glucose depletion. PMs were isolated from non- 2/2 were bred to the eNOS-deficient (eNOS ) line on C75BL/6 (The diabetic or diabetic mice as described.41 In short, 1 ml thioglycollate +/Δ 2/2 Jackson Laboratory) to produce TonEBP , eNOS mice and their (30 mg/ml) was injected intraperitoneally and the macrophages were +/+ 2/2 littermates—TonEBP , eNOS . Mice were kept on a 12-hour collected 4 days later. The cells were adhesion-purified for 1 hour light/dark cycle with free access to standard chow and water. Males followed by a wash with PBS to remove nonadherent cells. Bone were selected and made diabetic by daily intraperitoneal injections of marrow cells obtained from femurs were differentiated for 7 days freshly prepared STZ (50 mg/kg body weight; Sigma-Aldrich, using 20% L929-conditioned medium, as a source of M-CSF, to ob- St. Louis, MO) in 0.1 M citrate buffer (pH 4.5) for 4 days. Animals tain BMDMs. Where indicated, cells were stimulated with 100 ng/ml displaying fasting blood glucose levels .250 mg/dl after 2 weeks of LPS for 6 hours (RNA analysis) or 24 hours (for protein analysis).

Δ Figure 7. TonEBP haplo-deﬁciency is associated with reduced SBP, hyperreninemia, and elevated renal expression of renin. Male TonEBP+/ mice or their TonEBP+/+ littermates were analyzed for body weight (A), pulse rate (B), SBP (C), plasma renin activity (D), and renal renin immunoblot (E). Mean+SEM, n=8. #P,0.05 compared with corresponding TonEBP+/+. VH, vehicle; +/+, wild-type; +/D, heterozygous; 2/2, knock out.

J Am Soc Nephrol 29: 492–504, 2018 TonEBP in Diabetic Nephropathy 499 BASIC RESEARCH www.jasn.org

Table 1. Top SNP associations with selected traits SDS-PAGE and immunoblotted using specific antibodies. The antigen- MAF Effect antibody binding was detected by enhanced chemiluminescence SNP Allele Trait n P Value (%) Size western blotting detection reagents (GE Healthcare, Little Chalfont, 31 rs564919090 G 5 MMP-1 710 0.28 0.001a UK). Primary antibodies used were anti-TonEBP antibody, anti- rs72783114 G 5 MMP-1 710 20.31 ,0.001a iNOS antibody (BD Biosciences, Franklin Lakes, NJ), and anti-Hsc70 WBC 771 0.06 0.04 (Rockland, Gilbertsville, PA). Monocyte 473 56 0.01 a rs118095741 G 12 Monocyte 473 47.3 0.002 Macrophage Migration Assay rs74956396 C 3 Homocysteine 766 20.61 ,0.01 Macrophage migration was measured using a modified Boyden chamber IL-1b 710 0.52 ,0.01 (NeuroProbe, Gaithersburg, MD). BMDMs were plated in the upper cham- 2 , rs244416 C 18 IL-1b 710 0.23 0.01 ber on a 5-mm porous membrane and cultured in DMEM containing 2 DBP 776 1.2 0.04 normal glucose (5.5 mM), high glucose (25 mM), or 5.5 mM glucose rs2287970 G 37 DBP 776 1.4 0.003a +19.5 mM mannitol. MCP-1 (10 ng/ml) was added to the lower chamber SBP 776 1.65 0.04 as a chemoattractant. After 16 hours, cells were removed from the upper side rs17232663 G 3 Albuminuria 668 0.36 ,0.01 rs17297179 A 5 eGFR 776 6.34 0.003a of membranes and nuclei of migratory cells on the lower side of the mem- For IL-1b, WBC, c-IMT, and MMP-1, log transformations were used to cal- brane were stained with DAPI. The number of migratory cells was visualized culate effect size—IL-1b in pg/ml, MMP-1 in ng/ml. SNP, the SNP nucleotide by fluorescence microscopy and quantified using ImageJ software. associated with the outcome; allele, reference allele; MAF, minor allele frequency; n, sample size; effect size, effect size for SNP for selected traits, adjusted for age, sex, and family structure; MMP-1, MMP-1 (interstitial col- Immunohistochemistry lagenase); WBC, white blood cell count; monocyte, absolute monocyte cell Immunohistochemistry was performed as described previously.39 count; DBP, DBP (mmHg); albuminuria, log-transformed urinary albumin-to- The F4/80, STAT3, and TGF-b1weredetectedin4-mm tissue sections 2 creatinine ratio (mg/gm); eGFR, eGFR (ml/min per 1.73 m ). fi aStatistical significanceonthebasisofP,0.003 (0.05/16 haplotypes=0.003). by incubating tissue slides for 12 hours with speci c antibodies against F4/80 (Serotec, Oxford, UK), STAT3 (Cell signaling, Boston, MA), and TGF-b1 (Proteintech, Chicago, IL) at 4°C. Transfection and Luciferase Reporter Assay Dicer-substrate small interfering RNA (siRNA) targeting TonEBP (59- Histologic Analyses CCAGUUCCUACAAUGAUAACACUga-39) and nontargeting negative Kidneys were fixed with 2% paraformaldehyde-lysine-periodate and control (scrambled) siRNA (59-CGUUAAUCGCGUAUAAUACGC- embedded in paraffin. Sections were stained with periodic acid–Schiff GUA-39) were purchased from Integrated DNA Technologies (Coral- reaction plus hematoxylin counterstain. For quantitative assessment ville, IA). Raw264.7 cells were transfected for 1 day with 2 nM siRNA of glomerular injury, .50 glomeruli were examined from each ani- using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Transfected cells mal. Percentage of glomeruli displaying mesangiolysis, mesangial ex- were cultured for another day in fresh culture medium before LPS pansion, microaneurysm, nodular lesions, and sclerosis was assessed treatment. For NF-kB luciferase assays, siRNA-transfected cells were in a blinded manner. transfected with the NF-kB–dependent luciferase reporter plasmid (pGL4.32[luc2P/NF-KB-RE/Hygro]; Promega, Madison, WI) using Blood Collection, Renin Activity, and Lipofectamine 2000 reagent (Invitrogen). The phRL-TK vector was co- Renin Immunoblot transfected to normalize for transfection efficiency. After 24 hours, the Blood was taken from conscious mice by tail vein puncture and col- cells were treated with LPS for 8 hours. The cell lysates were prepared lected into a 75-ml hematocrit tube that contained 1 ml of 125 mM with a passive lysis buffer and used to measure the luciferase activity EDTA at its tip. Plasma was collected by centrifugation and stored according to the manufacturer’s instructions for the luciferase reporter frozen. Renin concentration was measured by Gammacoat plasma assay system (Promega). The luciferase assays were carried out using a renin activity radioimmunoassay kit (DiaSorin, Stillwater, MN). Re- GloMax 96 Microplate Luminometer (Promega). nal renin expression was evaluated using immunoblot analysis. Renin was detected by incubating for 12 hours with specific antibody, goat RNA Isolation and Real-Time PCR polyclonal renin antibody (Santa Cruz Biotechnology, Santa Cruz, Total RNA was isolated using the TRIzol reagent according to the CA). Relative OD of the band in each lane was normalized relative to manufacturer’s instructions (Invitrogen). After reverse transcription, the density of the Hsc70 band from the same gel. quantitative PCR was performed using SYBR Green I Master and LightCycler 480 II (Roche Applied Sciences, Indianapolis, IN) and BP and Heart Rate primers described in Supplemental Table 4. Resulting cycle threshold SBP and heart rate of TonEBP heterozygotes and their wild-type (Ct) values were normalized with cyclophilin A and the DDCt littermatesweredeterminedbynoninvasivetail-cuffBPsystem(Hatteras method was then used to express values as fold over control samples. Instruments SC-1000, Cary, NC). Animals were conditioned by placing them into the holding device on three consecutive days before the Western Blotting first measurement. BP was determined for 3 days in a row, and values Protein extraction from tissues was performed as previously de- were calculated as averages of these three measurements for each indi- scribed.39 Equal amounts of protein from samples were separated by vidual mouse.

500 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 492–504, 2018 www.jasn.org BASIC RESEARCH

IL-1b an inflammatory cytokine, homocysteine, MMP-1, matrix metalloprotease-9 (MMP-9), C-reactive protein (CRP), monocyte count, and white blood cell count as markers of systemic inflammation.43,44 Albuminuria was on the basis of spot morning collected urine albumin-to- creatinine ratio. GFR was estimated on the basis of serum creatinine using the Modification of Diet in Renal Disease formula.45 Details regarding methods for selection of individuals and phenotype measures have been previously published.42,43,46,47 Genotyping by whole-genome sequencing was done under the National Heart, Lung, and Blood Institute (NHLBI) Trans-Omics for Pre- cision Medicine program (http://www.nhlbi. nih.gov/research/resources/nhlbi-precision- medicine-initiative/topmed). We selected all SNPs with MAF$3% within a 2-kb window of the TonEBP gene. We then used Haploview to identify the number of haplotype blocks and tagging SNPs.23 We then looked at the association between the identified tagging SNPs and our selected phenotypes. Once we identified our top candidate SNPs for each phenotype, we used the HaploReg software package V4.1 to extract the functional annotation for each SNP of interest.36 For each variant, we looked for its predicted chromatin segmentation, including histone markers, focusing on enhancers as well as DNase I hypersensitive sites across a variety of tissue and cell types. Expression quantitative trait loci annotation was on the basis of Figure 8. TonEBP mediates hypergycemia-induced DN. In a mouse, TonEBP promotes inflammatory gene expression and cell migration leading to higher inflammation the Genotype-Tissue Expression Project, the and renal injury due to enhanced infiltrating macrophages. TonEBP SNPs are associated Geuvadis RNA-sequencing project, and the lat- with inflammation and renal function in humans. ↑,increase;M1,proinflammatory re- est NHLBI-supported GRASP databases. sponse. All SNP to phenotype associations were adjusted for age, sex, and family relatedness using the Mixed Models Analysis for Populations and Human Population, Genotyping, and Pedigrees (MMAP) program (http://edn.som.umaryland.edu/ Phenotype Analyses mmap/index.php). All baseline inflammatory marker and albumin- Our primary population consisted of 868 participants from the HAPI uria values were natural logarithm transformed to remove skewness. Heart study.42 These participants were healthy white individuals from the Old order closed Amish founder population in Lancaster, PA. Subjects recruited for this study were $20 years old and were ex- cluded if they had severe hypertension (BP.180/105 mmHg); ma- ACKNOWLEDGMENTS lignancy; or kidney, liver, or untreated thyroid disease. Additionally, all participants were not on any active medications at the time of the This work was supported by the National Research Foundation grants study.42 This unique genetically and environmentally homogenous (NRF-2011-0020163, 2016R1D1A1B03932335) and Health Tech- population was selected to minimize potential confounders and nology Research and Development Project grant (HI16C1837) of enhance the ability to detect genetic contributions to a variety of Korea, and Ulsan National Institute of Science and Technology In- cardiovascular phenotypes, including selected markers of systemic tramural Support (1.160078.01). This work was also supported in part inflammation. Resting protocol–based SBP and DBP measures were from National Institutes of Health (NIH) grants U01 HL072515 also obtained while participants were off any antihypertensive and P30 DK072488. The whole-genome sequencing in Trans-Omics medications. Baseline measures of inflammatory markers: serum for Precision Medicine (TOPMed) was performed at the Broad In-

J Am Soc Nephrol 29: 492–504, 2018 TonEBP in Diabetic Nephropathy 501 BASIC RESEARCH www.jasn.org stitute of Massachusetts Institute of Technology and Harvard 7. Yoon HJ, You S, Yoo SA, Kim NH, Kwon HM, Yoon CH, Cho CS, Hwang (HHSN268201500014C). Centralized joint genotype calling, map- D, Kim WU: NF-AT5 is a critical regulator of inflammatory arthritis. Ar- – ping, and harmonization, along with variant quality metrics and fil- thritis Rheum 63: 1843 1852, 2011 8. Choi S, You S, Kim D, Choi SY, Kwon HM, Kim HS, Hwang D, Park YJ, tering, were provided by the TOPMed Informatics Research Center Cho CS, Kim WU: Transcription factor NFAT5 promotes macrophage (3R01HL-117626-02S1, Principle Investigator Abecasis). Dr. Salimi is survival in rheumatoid arthritis. JClinInvest127: 954–969, 2017 supported by NIH training grant T32 AG00262. 9. Halterman JA, Kwon HM, Leitinger N, Wamhoff BR: NFAT5 expression S.Y.C., S.W.L., A.P., and H.M.K. conceived and designed the ex- in bone marrow-derived cells enhances atherosclerosis and drives periments. S.Y.C., S.W.L., S.S., E.J.Y., W.L-K., H.H.L., J.H.L., B.D.M., macrophage migration. Front Physiol 3: 313, 2012 10. Yang B, Hodgkinson AD, Oates PJ, Kwon HM, Millward BA, Demaine and S.S. performed the experiments and analyzed data. H.M.K. and AG: Elevated activity of transcription factor nuclear factor of activated A.P.supervised the research and wrote the manuscript with input and T-cells 5 (NFAT5) and diabetic nephropathy. Diabetes 55: 1450–1455, editing from all of the authors. 2006 11. Chow F, Ozols E, Nikolic-Paterson DJ, Atkins RC, Tesch GH: Macro- phages in mouse type 2 diabetic nephropathy: Correlation with diabetic state and progressive renal injury. Kidney Int 65: 116–128, 2004 DISCLOSURES 12. Nguyen D, Ping F, Mu W, Hill P, Atkins RC, Chadban SJ: Macrophage None. accumulation in human progressive diabetic nephropathy. Nephrol- ogy (Carlton) 11: 226–231, 2006 13. Go WY, Liu X, Roti MA, Liu F, Ho SN: NFAT5/TonEBP mutant mice define osmotic stress as a critical feature of the lymphoid microenvi- REFERENCES ronment. Proc Natl Acad Sci U S A 101: 10673–10678, 2004 14. Navarro-González JF, Mora-Fernández C: The role of inflammatory 1. US Renal Data System: 2015 Annual Data Report: Chapter 2. End-stage cytokines in diabetic nephropathy. JAmSocNephrol19: 433–442, Renal Disease in the US, 2015. Available at: www.usrds.org. 2008 2. Wuttke M, Köttgen A: Insights into kidney diseases from genome-wide 15. Wolkow PP, Niewczas MA, Perkins B, Ficociello LH, Lipinski B, Warram association studies. Nat Rev Nephrol 12: 549–562, 2016 JH, Krolewski AS: Association of urinary inflammatory markers and renal 3. Gorski M, van der Most PJ, Teumer A, Chu AY, Li M, Mijatovic V, Nolte decline in microalbuminuric type 1 diabetics. JAmSocNephrol19: IM, Cocca M, Taliun D, Gomez F, Li Y, Tayo B, Tin A, Feitosa MF, 789–797, 2008 Aspelund T, Attia J, Biffar R, Bochud M, Boerwinkle E, Borecki I, 16. Schmid H, Boucherot A, Yasuda Y, Henger A, Brunner B, Eichinger F, Bottinger EP, Chen MH, Chouraki V, Ciullo M, Coresh J, Cornelis MC, Nitsche A, Kiss E, Bleich M, Gröne HJ, Nelson PJ, Schlöndorff D, Cohen Curhan GC, d’Adamo AP, Dehghan A, Dengler L, Ding J, Eiriksdottir G, CD, Kretzler M; European Renal cDNA Bank (ERCB) Consortium: Endlich K, Enroth S, Esko T, Franco OH, Gasparini P, Gieger C, Girotto Modular activation of nuclear factor-kappaB transcriptional programs G, Gottesman O, Gudnason V, Gyllensten U, Hancock SJ, Harris TB, in human diabetic nephropathy. Diabetes 55: 2993–3003, 2006 Helmer C, Höllerer S, Hofer E, Hofman A, Holliday EG, Homuth G, Hu 17. Lim AK, Tesch GH: Inflammation in diabetic nephropathy. Mediators FB, Huth C, Hutri-Kähönen N, Hwang SJ, Imboden M, Johansson Å, Inflamm 2012: 146154, 2012 Kähönen M, König W, Kramer H, Krämer BK, Kumar A, Kutalik Z, 18. Nakagawa T, Sato W, Glushakova O, Heinig M, Clarke T, Campbell- Lambert JC, Launer LJ, Lehtimäki T, de Borst M, Navis G, Swertz M, Liu Thompson M, Yuzawa Y, Atkinson MA, Johnson RJ, Croker B: Diabetic Y, Lohman K, Loos RJF, Lu Y, Lyytikäinen LP, McEvoy MA, Meisinger C, endothelial nitric oxide synthase knockout mice develop advanced Meitinger T, Metspalu A, Metzger M, Mihailov E, Mitchell P, Nauck M, diabetic nephropathy. J Am Soc Nephrol 18: 539–550, 2007 Oldehinkel AJ, Olden M, Wjh Penninx B, Pistis G, Pramstaller PP, 19. Li F, Wang CH, Wang JG, Thai T, Boysen G, Xu L, Turner AL, Wolberg Probst-Hensch N, Raitakari OT, Rettig R, Ridker PM, Rivadeneira F, AS, Mackman N, Maeda N, Takahashi N: Elevated tissue factor ex- Robino A, Rosas SE, Ruderfer D, Ruggiero D, Saba Y, Sala C, Schmidt H, pression contributes to exacerbated diabetic nephropathy in mice Schmidt R, Scott RJ, Sedaghat S, Smith AV, Sorice R, Stengel B, Stracke lacking eNOS fed a high fat diet. J Thromb Haemost 8: 2122–2132, S, Strauch K, Toniolo D, Uitterlinden AG, Ulivi S, Viikari JS, Völker U, 2010 Vollenweider P, Völzke H, Vuckovic D, Waldenberger M, Jin Wang J, 20. Mohan S, Reddick RL, Musi N, Horn DA, Yan B, Prihoda TJ, Natarajan M, Yang Q, Chasman DI, Tromp G, Snieder H, Heid IM, Fox CS, Köttgen A, Abboud-Werner SL: Diabetic eNOS knockout mice develop distinct Pattaro C, Böger CA, Fuchsberger C: 1000 Genomes-based meta- macro- and microvascular complications. Lab Invest 88: 515–528, 2008 analysis identifies 10 novel loci for kidney function. Sci Rep 7: 45040, 21. Tragante V, Barnes MR, Ganesh SK, Lanktree MB, Guo W, Franceschini 2017. N, Smith EN, Johnson T, Holmes MV, Padmanabhan S, Karczewski KJ, 4. Parsa A, Kanetsky PA, Xiao R, Gupta J, Mitra N, Limou S, Xie D, Xu H, Almoguera B, Barnard J, Baumert J, Chang YP, Elbers CC, Farrall M, Anderson AH, Ojo A, Kusek JW, Lora CM, Hamm LL, He J, Sandholm N, Fischer ME, Gaunt TR, Gho JM, Gieger C, Goel A, Gong Y, Isaacs A, Jeff J, Raj DE, Böger CA, Bottinger E, Salimi S, Parekh RS, Adler SG, Kleber ME, Mateo Leach I, McDonough CW, Meijs MF, Melander O, Langefeld CD, Bowden DW, Groop PH, Forsblom C, Freedman BI, Nelson CP, Nolte IM, Pankratz N, Price TS, Shaffer J, Shah S, Lipkowitz M, Fox CS, Winkler CA, Feldman HI; FIND Consortium; and the Tomaszewski M, van der Most PJ, Van Iperen EP, Vonk JM, Witkowska Chronic Renal Insufficiency Cohort (CRIC) Study Investigators: Genome- K, Wong CO, Zhang L, Beitelshees AL, Berenson GS, Bhatt DL, Brown wide association of CKD progression: The chronic renal insufficiency M, Burt A, Cooper-DeHoff RM, Connell JM, Cruickshanks KJ, Curtis SP, cohort study. JAmSocNephrol28: 923–934, 2017 Davey-Smith G, Delles C, Gansevoort RT, Guo X, Haiqing S, Hastie CE, 5. Buxadé M, Lunazzi G, Minguillón J, Iborra S, Berga-Bolaños R, Del Val Hofker MH, Hovingh GK, Kim DS, Kirkland SA, Klein BE, Klein R, Li YR, M, Aramburu J, López-Rodríguez C: Gene expression induced by Toll- Maiwald S, Newton-Cheh C, O’Brien ET, Onland-Moret NC, Palmas W, like receptors in macrophages requires the transcription factor NFAT5. Parsa A, Penninx BW, Pettinger M, Vasan RS, Ranchalis JE, M Ridker P, JExpMed209: 379–393, 2012 Rose LM, Sever P, Shimbo D, Steele L, Stolk RP, Thorand B, Trip MD, 6. Lee HH, Sanada S, An SM, Ye BJ, Lee JH, Seo YK, Lee C, Lee-Kwon W, van Duijn CM, Verschuren WM, Wijmenga C, Wyatt S, Young JH, Küper C, Neuhofer W, Choi SY, Kwon HM: LPS-induced NFkB enhan- Zwinderman AH, Bezzina CR, Boerwinkle E, Casas JP, Caulfield MJ, ceosome requires TonEBP/NFAT5 without DNA binding. Sci Rep 6: Chakravarti A, Chasman DI, Davidson KW, Doevendans PA, 24921, 2016 Dominiczak AF, FitzGerald GA, Gums JG, Fornage M, Hakonarson H,

502 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 492–504, 2018 www.jasn.org BASIC RESEARCH

Halder I, Hillege HL, Illig T, Jarvik GP, Johnson JA, Kastelein JJ, Koenig 29. Jagannathan-Bogdan M, McDonnell ME, Shin H, Rehman Q, Hasturk H, W, Kumari M, März W, Murray SS, O’Connell JR Jr., Oldehinkel AJ, Apovian CM, Nikolajczyk BS: Elevated proinflammatory cytokine pro- Pankow JS, Rader DJ, Redline S, Reilly MP, Schadt EE, Kottke-Marchant duction by a skewed T cell compartment requires monocytes and K, Snieder H, Snyder M, Stanton AV, Tobin MD, Uitterlinden AG, van promotes inflammation in type 2 diabetes. JImmunol186: 1162–1172, der Harst P, van der Schouw YT, Samani NJ, Watkins H, Johnson AD, 2011 Reiner AP, Zhu X, de Bakker PI, Levy D, Asselbergs FW, Munroe PB, 30. Kavanagh DH, Savage DA, Patterson CC, McKnight AJ, Crean JK, Keating BJ: Gene-centric meta-analysis in 87,736 individuals of Euro- Maxwell AP, McKay GJ; Warren 3/UK GoKinD Study Group: Haplotype pean ancestry identifies multiple blood-pressure-related loci. Am J association analysis of genes within the WNT signalling pathways in Hum Genet 94: 349–360, 2014 diabetic nephropathy. BMC Nephrol 14: 126, 2013 22. Choi SY, Lee HH, Lee JH, Ye BJ, Yoo EJ, Kang HJ, Jung GW, An SM, 31. Miyakawa H, Woo SK, Dahl SC, Handler JS, Kwon HM: Tonicity- Lee-Kwon W, Chiong M, Lavandero S, Kwon HM: TonEBP suppresses responsive enhancer binding protein, a rel-like protein that stimulates IL-10-mediated immunomodulation. Sci Rep 6: 25726, 2016 transcription in response to hypertonicity. Proc Natl Acad Sci U S A 96: 23. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: Analysis and visuali- 2538–2542, 1999 zation of LD and haplotype maps. Bioinformatics 21: 263–265, 2005 32. Lee JH, Lee HH, Ye BJ, Lee-Kwon W, Choi SY, Kwon HM: TonEBP 24. Köttgen A, Pattaro C, Böger CA, Fuchsberger C, Olden M, Glazer NL, suppresses adipogenesis and insulin sensitivity by blocking epigenetic Parsa A, Gao X, Yang Q, Smith AV, O’Connell JR, Li M, Schmidt H, transition of PPARg2. Sci Rep 5: 10973, 2015 Tanaka T, Isaacs A, Ketkar S, Hwang SJ, Johnson AD, Dehghan A, 33. Köttgen A, Albrecht E, Teumer A, Vitart V, Krumsiek J, Hundertmark C, Teumer A, Paré G, Atkinson EJ, Zeller T, Lohman K, Cornelis MC, Probst- Pistis G, Ruggiero D, O’Seaghdha CM, Haller T, Yang Q, Tanaka T, Hensch NM, Kronenberg F, Tönjes A, Hayward C, Aspelund T, Eiriksdottir Johnson AD, Kutalik Z, Smith AV, Shi J, Struchalin M, Middelberg RP, G, Launer LJ, Harris TB, Rampersaud E, Mitchell BD, Arking DE, Brown MJ, Gaffo AL, Pirastu N, Li G, Hayward C, Zemunik T, Huffman J, Boerwinkle E, Struchalin M, Cavalieri M, Singleton A, Giallauria F, Metter J, Yengo L, Zhao JH, Demirkan A, Feitosa MF, Liu X, Malerba G, Lopez de Boer IH, Haritunians T, Lumley T, Siscovick D, Psaty BM, Zillikens MC, LM, van der Harst P, Li X, Kleber ME, Hicks AA, Nolte IM, Johansson A, Oostra BA, Feitosa M, Province M, de Andrade M, Turner ST, Schillert A, Murgia F, Wild SH, Bakker SJ, Peden JF, Dehghan A, Steri M, Tenesa A, Ziegler A, Wild PS, Schnabel RB, Wilde S, Munzel TF, Leak TS, Illig T, Lagou V, Salo P, Mangino M, Rose LM, Lehtimäki T, Woodward OM, Klopp N, Meisinger C, Wichmann HE, Koenig W, Zgaga L, Zemunik T, Okada Y, Tin A, Müller C, Oldmeadow C, Putku M, Czamara D, Kraft P, Kolcic I, Minelli C, Hu FB, Johansson A, Igl W, Zaboli G, Wild SH, Wright Frogheri L, Thun GA, Grotevendt A, Gislason GK, Harris TB, Launer LJ, AF, Campbell H, Ellinghaus D, Schreiber S, Aulchenko YS, Felix JF, McArdle P, Shuldiner AR, Boerwinkle E, Coresh J, Schmidt H, Schallert Rivadeneira F, Uitterlinden AG, Hofman A, Imboden M, Nitsch D, M, Martin NG, Montgomery GW, Kubo M, Nakamura Y, Tanaka T, Brandstätter A, Kollerits B, Kedenko L, Mägi R, Stumvoll M, Kovacs P, Munroe PB, Samani NJ, Jacobs DR Jr., Liu K, D’Adamo P, Ulivi S, Rotter Boban M, Campbell S, Endlich K, Völzke H, Kroemer HK, Nauck M, Völker JI, Psaty BM, Vollenweider P, Waeber G, Campbell S, Devuyst O, U, Polasek O, Vitart V, Badola S, Parker AN, Ridker PM, Kardia SL, Navarro P, Kolcic I, Hastie N, Balkau B, Froguel P, Esko T, Salumets A, Blankenberg S, Liu Y, Curhan GC, Franke A, Rochat T, Paulweber B, Khaw KT, Langenberg C, Wareham NJ, Isaacs A, Kraja A, Zhang Q, Wild Prokopenko I, Wang W, Gudnason V, Shuldiner AR, Coresh J, Schmidt R, PS, Scott RJ, Holliday EG, Org E, Viigimaa M, Bandinelli S, Metter JE, Ferrucci L, Shlipak MG, van Duijn CM, Borecki I, Krämer BK, Rudan I, Lupo A, Trabetti E, Sorice R, Döring A, Lattka E, Strauch K, Theis F, Gyllensten U, Wilson JF, Witteman JC, Pramstaller PP, Rettig R, Hastie N, Waldenberger M, Wichmann HE, Davies G, Gow AJ, Bruinenberg M, Chasman DI, Kao WH, Heid IM, Fox CS: New loci associated with kidney Stolk RP, Kooner JS, Zhang W, Winkelmann BR, Boehm BO, Lucae S, function and chronic kidney disease. Nat Genet 42: 376–384, 2010 Penninx BW, Smit JH, Curhan G, Mudgal P, Plenge RM, Portas L, 25. Böger CA, Chen MH, Tin A, Olden M, Köttgen A, de Boer IH, Fuchsberger Persico I, Kirin M, Wilson JF, Mateo Leach I, van Gilst WH, Goel A, C, O’Seaghdha CM, Pattaro C, Teumer A, Liu CT, Glazer NL, Li M, Ongen H, Hofman A, Rivadeneira F, Uitterlinden AG, Imboden M, von O’Connell JR, Tanaka T, Peralta CA, Kutalik Z, Luan J, Zhao JH, Hwang SJ, Eckardstein A, Cucca F, Nagaraja R, Piras MG, Nauck M, Schurmann C, Akylbekova E, Kramer H, van der Harst P, Smith AV, Lohman K, de Budde K, Ernst F, Farrington SM, Theodoratou E, Prokopenko I, Andrade M, Hayward C, Kollerits B, Tönjes A, Aspelund T, Ingelsson E, Stumvoll M, Jula A, Perola M, Salomaa V, Shin SY, Spector TD, Sala C, Eiriksdottir G, Launer LJ, Harris TB, Shuldiner AR, Mitchell BD, Arking DE, Ridker PM, Kähönen M, Viikari J, Hengstenberg C, Nelson CP, Meschia Franceschini N, Boerwinkle E, Egan J, Hernandez D, Reilly M, Townsend JF, Nalls MA, Sharma P, Singleton AB, Kamatani N, Zeller T, Burnier M, RR, Lumley T, Siscovick DS, Psaty BM, Kestenbaum B, Haritunians T, Attia J, Laan M, Klopp N, Hillege HL, Kloiber S, Choi H, Pirastu M, Tore Bergmann S, Vollenweider P, Waeber G, Mooser V, Waterworth D, S, Probst-Hensch NM, Völzke H, Gudnason V, Parsa A, Schmidt R, Johnson AD, Florez JC, Meigs JB, Lu X, Turner ST, Atkinson EJ, Leak TS, Whitfield JB, Fornage M, Gasparini P, Siscovick DS, Polašek O, Aasarød K, Skorpen F, Syvänen AC, Illig T, Baumert J, Koenig W, Krämer Campbell H, Rudan I, Bouatia-Naji N, Metspalu A, Loos RJ, van Duijn BK, Devuyst O, Mychaleckyj JC, Minelli C, Bakker SJ, Kedenko L, CM, Borecki IB, Ferrucci L, Gambaro G, Deary IJ, Wolffenbuttel BH, Paulweber B, Coassin S, Endlich K, Kroemer HK, Biffar R, Stracke S, Völzke Chambers JC, März W, Pramstaller PP, Snieder H, Gyllensten U, Wright H, Stumvoll M, Mägi R, Campbell H, Vitart V, Hastie ND, Gudnason V, AF, Navis G, Watkins H, Witteman JC, Sanna S, Schipf S, Dunlop MG, Kardia SL, Liu Y, Polasek O, Curhan G, Kronenberg F, Prokopenko I, Rudan Tönjes A, Ripatti S, Soranzo N, Toniolo D, Chasman DI, Raitakari O, Kao I, Arnlöv J, Hallan S, Navis G, Parsa A, Ferrucci L, Coresh J, Shlipak MG, WH, Ciullo M, Fox CS, CaulfieldM,BochudM,GiegerC;LifeLines Bull SB, Paterson NJ, Wichmann HE, Wareham NJ, Loos RJ, Rotter JI, Cohort Study; CARDIoGRAM Consortium; DIAGRAM Consortium; Pramstaller PP, Cupples LA, Beckmann JS, Yang Q, Heid IM, Rettig R, ICBP Consortium; MAGIC Consortium: Genome-wide association Dreisbach AW, Bochud M, Fox CS, Kao WH; CKDGen Consortium: CUBN analyses identify 18 new loci associated with serum urate concentra- is a gene locus for albuminuria. J Am Soc Nephrol 22: 555–570, 2011 tions. Nat Genet 45: 145–154, 2013 26. Forbes JM, Cooper ME: Mechanisms of diabetic complications. Physiol 34. Parsa A, Brown E, Weir MR, Fink JC, Shuldiner AR, Mitchell BD, McArdle Rev 93: 137–188, 2013 PF: Genotype-based changes in serum uric acid affect blood pressure. 27. Devaraj S, Glaser N, Griffen S, Wang-Polagruto J, Miguelino E, Jialal I: Kidney Int 81: 502–507, 2012 Increased monocytic activity and biomarkers of inflammation in pa- 35. Böger CA, Gorski M, McMahon GM, Xu H, Chang YC, van der Most PJ, tients with type 1 diabetes. Diabetes 55: 774–779, 2006 Navis G, Nolte IM, de Borst MH, Zhang W, Lehne B, Loh M, Tan ST, 28. Bradshaw EM, Raddassi K, Elyaman W, Orban T, Gottlieb PA, Kent SC, Boerwinkle E, Grams ME, Sekula P, Li M, Wilmot B, Moon JG, Scheet P, Hafler DA: Monocytes from patients with type 1 diabetes spontaneously Cucca F, Xiao X, Lyytikäinen LP, Delgado G, Grammer TB, Kleber ME, secrete proinflammatory cytokines inducing Th17 cells. J Immunol 183: Sedaghat S, Rivadeneira F, Corre T, Kutalik Z, Bergmann S, Nielson CM, 4432–4439, 2009 Srikanth P, Teumer A, Müller-Nurasyid M, Brockhaus AC, Pfeufer A,

J Am Soc Nephrol 29: 492–504, 2018 TonEBP in Diabetic Nephropathy 503 BASIC RESEARCH www.jasn.org

Rathmann W, Peters A, Matsumoto M, de Andrade M, Atkinson EJ, Herzog W, Weir MR, Peyser PA, Shuldiner AR: The genetic response to Robinson-Cohen C, de Boer IH, Hwang SJ, Heid IM, Gögele M, Concas short-term interventions affecting cardiovascular function: Rationale MP, Tanaka T, Bandinelli S, Nalls MA, Singleton A, Tajuddin SM, and design of the Heredity and Phenotype Intervention (HAPI) Heart Adeyemo A, Zhou J, Doumatey A, McWeeney S, Murabito J, study. Am Heart J 155: 823–828, 2008 Franceschini N, Flessner M, Shlipak M, Wilson JG, Chen G, Rotimi CN, 43. Cheng YC, Kao WH, Mitchell BD, Sharrett AR, Ryan KA, Vogel RA, Zonderman AB, Evans MK, Ferrucci L, Devuyst O, Pirastu M, Shuldiner A, Shuldiner AR, Pollin TI: Genetic effects on postprandial variations of Hicks AA, Pramstaller PP, Kestenbaum B, Kardia SL, Turner ST, Study LC, inflammatory markers in healthy individuals. Obesity (Silver Spring) 18: Briske TE, Gieger C, Strauch K, Meisinger C, Meitinger T, Völker U, 1417–1422, 2010 Nauck M, Völzke H, Vollenweider P, Bochud M, Waeber G, Kähönen M, 44. Keyszer G, Lambiri I, Nagel R, Keysser C, Keysser M, Gromnica-Ihle E, Lehtimäki T, März W, Dehghan A, Franco OH, Uitterlinden AG, Hofman Franz J, Burmester GR, Jung K: Circulating levels of matrix metal- A, Taylor HA, Chambers JC, Kooner JS, Fox CS, Hitzemann R, Orwoll ES, loproteinases MMP-3 and MMP-1, tissue inhibitor of metalloproteinases 1 Pattaro C, Schlessinger D, Köttgen A, Snieder H, Parsa A, Cohen DM: (TIMP-1), and MMP-1/TIMP-1 complex in rheumatic disease. Correla- NFAT5 and SLC4A10 loci associate with plasma osmolality. JAmSoc tion with clinical activity of rheumatoid arthritis versus other surrogate Nephrol 28: 2311–2321, 2017 markers. J Rheumatol 26: 251–258, 1999 36. Chen CT, Fernández-Rhodes L, Brzyski RG, Carlson CS, Chen Z, Heiss 45. Levey AS, Bosch JP, Lewis JB, Greene T, Rogers N, Roth D: A more G, North KE, Woods NF, Rajkovic A, Kooperberg C, Franceschini N: accurate method to estimate glomerular filtration rate from serum Replication of loci influencing ages at menarche and menopause in creatinine: A new prediction equation. Modi fication of diet in renal Hispanic women: The Women’s Health Initiative SHARe study. Hum disease study group. Ann Intern Med 130: 461–470, 1999 Mol Genet 21: 1419–1432, 2012 46. Post W, Bielak LF, Ryan KA, Cheng YC, Shen H, Rumberger JA, Sheedy 37. Martín-Antonio B, Álvarez-Laderas I, Cardesa R, Márquez-Malaver F, PF 2nd, Shuldiner AR, Peyser PA, Mitchell BD: Determinants of coro- Baez A, Carmona M, Falantes J, Suarez-Lledo M, Fernández-Avilés F, nary artery and aortic calcification in the old order Amish. Circulation Martínez C, Rovira M, Espigado I, Urbano-Ispizua Á: A constitutional 115: 717–724, 2007 variant in the transcription factor EP300 strongly influences the clinical 47. Mitchell GF, Verwoert GC, Tarasov KV, Isaacs A, Smith AV, Yasmin, outcome of patients submitted to allo-SCT. Bone Marrow Transplant Rietzschel ER, Tanaka T, Liu Y, Parsa A, Najjar SS, O’Shaughnessy KM, 47: 1206–1211, 2012 Sigurdsson S, De Buyzere ML, Larson MG, Sie MP, Andrews JS, Post 38. Boland BS, Widjaja CE, Banno A, Zhang B, Kim SH, Stoven S, Peterson WS, Mattace-Raso FU, McEniery CM, Eiriksdottir G, Segers P, Vasan RS, MR, Jones MC, Su HI, Crowe SE, Bui JD, Ho SB, Okugawa Y, Goel A, van Rijn MJ, Howard TD, McArdle PF, Dehghan A, Jewell ES, Marietta EV, Khosroheidari M, Jepsen K, Aramburu J, López-Rodríguez C, Newhouse SJ, Bekaert S, Hamburg NM, Newman AB, Hofman A, Sandborn WJ, Murray JA, Harismendy O, Chang JT: Immunodeficiency Scuteri A, De Bacquer D, Ikram MA, Psaty BM, Fuchsberger C, Olden and autoimmune enterocolopathy linked to NFAT5 haploinsufficiency. M, Wain LV, Elliott P, Smith NL, Felix JF, Erdmann J, Vita JA, Sutton- JImmunol194: 2551–2560, 2015 Tyrrell K, Sijbrands EJ, Sanna S, Launer LJ, De Meyer T, Johnson AD, 39. Sheen MR, Kim JA, Lim SW, Jung JY, Han KH, Jeon US, Park SH, Kim J, Schut AF, Herrington DM, Rivadeneira F, Uda M, Wilkinson IB, Kwon HM: Interstitial tonicity controls TonEBP expression in the renal Aspelund T, Gillebert TC, Van Bortel L, Benjamin EJ, Oostra BA, Ding J, medulla. Kidney Int 75: 518–525, 2009 Gibson Q, Uitterlinden AG, Abecasis GR, Cockcroft JR, Gudnason V, 40. Lim SW, Doh KC, Jin L, Jin J, Piao SG, Heo SB, Chung BH, Yang CW: De Backer GG, Ferrucci L, Harris TB, Shuldiner AR, van Duijn CM, Ginseng treatment attenuates autophagic cell death in chronic cyclo- Levy D, Lakatta EG, Witteman JC: Common genetic variation in the sporine nephropathy. Nephrology (Carlton) 19: 490–499, 2014 39-BCL11B gene desert is associated with carotid-femoral pulse 41. Zhang X, Goncalves R, Mosser DM: The isolation and characterization wave velocity and excess cardiovascular disease risk: The AortaGen of murine macrophages. Curr Protoc Immunol 83:14.1: 14.1.1–14.1.14, Consortium. Circ Cardiovasc Genet 5: 81–90, 2012 2008 42. Mitchell BD, McArdle PF, Shen H, Rampersaud E, Pollin TI, Bielak LF, Jaquish C, Douglas JA, Roy-Gagnon MH, Sack P, Naglieri R, Hines S, Horenstein RB, Chang YP, Post W, Ryan KA, Brereton NH, Pakyz RE, This article contains supplemental material online at http://jasn.asnjournals. Sorkin J, Damcott CM, O’Connell JR, Mangano C, Corretti M, Vogel R, org/lookup/suppl/doi:10.1681/ASN.2017070718/-/DCSupplemental.

504 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 492–504, 2018 Supplementary Information

TonEBP mediates hyperglycemia-induced inflammation, and vascular and renal injury

Soo Youn Choi1,#, Sun Woo Lim2,#, Shabnam Salimi3, Eun Jin Yoo1, Whaseon Lee-Kwon1,

Hwan Hee Lee1, Jun Ho Lee1, Braxton D. Mitchell3,4, Satoru Sanada3, Afshin Parsa3,5,*, Hyug

Moo Kwon1,*

1School of Life Sciences, UNIST, Korea; 2Transplantation Research Center, Catholic

University of Korea; 3Department of Medicine, University of Maryland Baltimore, USA;

4Geriatrics Research and Education Clinical Center, Baltimore Veterans Administration

Medical Center, USA: 5 Department of Medicine, Division of Nephrology, Baltimore Veterans

Administration Medical Center, Baltimore, USA.

# These authors contributed equally to the study.

* Address correspondence to HMK at [email protected] or AP at

[email protected].

Supplementary Results

Mouse model of DN

While most mice not develop many features of DN, mouse lines with endothelial

dysfunction, endothelial nitric oxide synthase-deficient (eNOS-/-) lines, display most features of human DN except for renal insufficiency1-4. We decided to adopt this system to test the

effects of TonEBP haplodeficiency on the development of DN. For this, we bred the TonEBP

haplo-deficient animals onto the eNOS-/- line. Type 1 diabetes was induced as described in Fig

1 and the animals were analyzed 7 weeks later. Supplementary Table 1 summarizes physiological parameters of TonEBP +/∆ mice and their TonEBP +/+ littermates on the eNOS-/- and eNOS+/+ backgrounds. All the parameters were comparable between the TonEBP +/∆ animals and their TonEBP +/+ littermates, except that renal hypotrophy indicated by reduced

ratio of kidney weight over body weight lessened in the TonEBP +/∆ animals on the eNOS-/- background. Reduced renal TonEBP expression in the TonEBP +/∆ animals were confirmed on

both the eNOS-/- and eNOS+/+ backgrounds (Fig 3a, b).

Association of TonEBP polymorphisms with inflammatory, vascular and renal function markers

in humans

In view of our primary animal TonEBP haplo-deficiency findings as noted above, and

previously published associations of TonEBP expression and/or gene variants with

inflammation5,6, rheumatoid arthritis7,8, atherosclerosis9, and DN in humans10 and in animals

(see above), we hypothesized that genetic variation in TonEBP would be associated with subclinical inflammatory, vascular and renal phenotypes. To test this hypothesis, we performed a look-up of genetic association results carried out in 878 participants from the HAPI Heart

Study11, a study of the genetic determinants of cardiometabolic health carried out in the Old

Order Amish founder population of Lancaster, County, PA from 2002 - 2006. HAPI Heart Study participants were 20 years of age or older, relatively healthy with a homogenous genetic and

environmental background population, and free of any medications at the time of study.

Characteristics of study participants are summarized in Supplementary Table 2.

Phenotypes measured in the HAPI Heart Study and relevant to this report related to inflammation and renal function included: serum IL-1β an inflammatory cytokine,

homocysteine, matrix metalloprotease-1 (MMP-1), matrix metalloprotease-9 (MMP-9), C- reactive protein (CRP), monocyte count and white blood cell count (WBC) as markers of systemic inflammation12,13. Renal function phenotypes included: albuminuria and estimated

glomerular filtration rate (eGFR). Resting protocol based systolic and diastolic blood pressure

(SBP and DBP) measures were also obtained while participants were off any anti-hypertensive

medications.

All HAPI Heart Study participants underwent whole genome sequencing as part of the

NHLBI-sponsored Trans-Omics in Precision Medicine (TOPMed) program. For this report we

considered all sequenced variants within the TonEBP gene plus variants ± 2 kb away with a

minor allele frequency (MAF) of 3%. From these 320 SNPs, using Haploview, we identified 16

haplotype blocks14. We then identified all single haplotype tagging SNPs (Supplementary

Figure 1) and looked at the association between the identified SNPs and our phenotypes.

For each phenotype or trait, we identified the top associated signals with a P value < 0.05

(Table 1). We defined statistical significance threshold based on a Bonferroni correction for

the number of haplotype blocks (p value < 0.05/16 = 0.003). Considering that our animal model

demonstrated the effect of TonEBP haplo-deficiency on these phenotypes, increasing the a-

priori probability of true associations, we also identified SNP based associations with p values

< 0.05 but > 0.003 as suggestive. For our inflammatory phenotypes, we found significant

associations between rs72783114 with serum MMP-1 (β = -0.31, p = 0.0003) and suggestive association with serum WBC (β = 0.06, p = 0.04). We also found rs564919090 to be significantly associated with serum MMP-1 (β = 0.28, p = 0.001), independently of rs72783114 (Table 1). Given our previous findings of higher TonEBP expression in monocytes from

individuals with DN10, we also looked at the association with absolute monocyte values, which

were available in a different group of 473 healthy Amish and found a significant association

between rs118095741 with absolute monocyte count (β = 47.3, p = 0.002). We also found

rs74956396 to be suggestively associated with serum IL-1β (β = 0.52, p = 0.009) and

homocysteine (β = -0.61, p = 0.008), while rs244416 was independently also suggestively associated with IL-1β (β = -0.22, p = 0.009). For our blood pressure phenotypes, we found rs2287970 to be significantly associated with DBP (β = 1.4, p = 0.003) and suggestively with

SBP (β = 1.65, p = 0.04). Lastly, for our renal phenotypes, we found a significant association between rs17297179 with eGFR (β = 6.3, p = 0.003) and suggestive association between rs17232663 with albuminuria (β = 0.36, p = 0.008). Given that blood pressure (BP) can affect renal function and vice versa, we secondarily adjusted for BP in our eGFR and albuminuria outcomes, as well as adjusted for eGFR with our BP outcomes, which did not meaningfully alter the results. Lastly, the noted associations with our inflammatory markers were also independent of eGFR and BP.

We did not find an association with CRP. This might be accounted for by the modest number of individuals in our study, as in a previous secondary analysis of a uric acid meta-

GWAS in which we participated, a modest association between the rs7193778 and CRP was noted, though other TonEBP SNPs were not tested43. We also did not find an association

between our selected TonEBP variants and MMP-9.

Box plot graphs showing the mean values and distribution for each of our significantly

associated measures stratified by genotype can be seen in Supplementary Fig 2. Locus zoom

plots showing location of significantly associated SNPs with each phenotype can be seen in

Supplementary Fig 3.

We also explored the functional annotation for our top identified SNPs which are

summarized in Supplementary Table 3. Of these eight SNPs of interest, five of them had enhancer activity defined with H3K27AC marker in various tissues, but rs2287970 and rs17297179 were also notable as active enhancer with DNase hypersensitivity, which suggests them to be functionally active. Variation in rs2287970 also results in change in various motifs with zinc-finger domain such as WTN1 and Znf143 (Supplementary Table 3).

Supplementary Table 1. Physiological parameters of experimental animals.

eNOS (+/+) eNOS (-/-)

Parameter TonEBP (+/+) TonEBP (+/Δ) TonEBP (+/+) TonEBP (+/Δ)

VH STZ VH STZ VH STZ VH STZ

Body weight (g) 28.9 ± 0.6 24.1 ± 0.8 28.9 ± 0.9 22.8 ± 0.7 24.4 ± 0.7 20.7 ± 0.8 24.3 ± 0.6 20.8 ± 0.6

Kidney/Body weight 14.3 ± 0.6 17.1 ± 0.9 13.2 ± 0.4 16.4 ± 0.9 7.7 ± 0.4 12.9 ± 0.4 8.6 ± 0.6 15.6 ± 0.4# (mg/g)

Blood glucose (mg/dL) 163 ± 12 453 ± 31 150 ± 18 482 ± 34 198 ± 12 560 ± 31 177 ± 22 577 ± 13

Spot urine osmolality 1894 ± 130 787 ± 110 1627 ± 173 813 ± 31 1205 ± 107 541 ± 36 1057 ± 109 545 ± 25 (mmoL/kg) Blood urea nitrogen 11.7 ± 0.8 20.0 ± 1.9 12.6 ± 0.7 17.9 ± 1.1 28.4 ± 2.3 25.3 ± 2.2 30.5 ± 1.3 32.3 ± 1.9 (mg/dL)

FENa (%) 0.47 ± 0.08 0.85 ± 0.24 1.16 ± 0.28 2.38 ± 0.72 0.64 ± 0.10 1.17 ± 0.17 0.41 ± 0.05 1.15 ± 0.21

Mice were bred to generate littermates of TonEBP+/+ or TonEBP +/∆ animals on eNOS+/+ or eNOS-/- background as indicated. Animals were injected with vehicle (VH) or streptozotocin (STZ) to induce diabetes as described in Fig 1. 7 weeks later, body weight and kidney weight were measured; serum and urine samples were collected to determine blood glucose, urine osmolality, blood urea nitrogen, and fractional excretion of sodium (FENa). Mean ± SE, n = 8. #p< 0.05 compared to TonEBP +/+, eNOS-/-.

Supplementary Table 2. Clinical characteristics (mean ± SD; median (IQR)) of the 868 Old Order Amish enrolled in the HAPI Heart Study, Lancaster County, Pennsylvania

Characteristic Men (n=460) Women (n=408)

Age (years) 42.2 ± 13.6 45.4 ± 14.2

BMI (kg/m2) 25.6 ± 3.2 27.8 ± 5.5

Total cholesterol (mg/dl) 202.5 ± 44.3 215.7 ± 49.0

Triglycerides (mg/dl) 63.9 ± 1.7 73.8 ± 45.4

SBP (mm Hg) 121.5 ± 12.6 121.4 ± 16.9

DBP (mm Hg) 77.6 ± 8.8 75.8 ± 8.4

Diabetes (%) 0.9 1.0

Current smokers (%)a 20.0 0.0

Lipid-lowering meds (%)b 1.0 1.0

Antihypertensive meds (%)b 0.2 0.3

4.2±10.1 4.6±11.1 IL-1β (pg/mL) 0.78(0.78-1.38) 0.78(0.78-1.22) 3.6±2.4 3.9±2.5 MMP-1(ng/ml) 2.9(1.8-4.7) 3.2(2.0-5.5) 561±343 511.6±340.8 MMP-9 (ng/ml) 474(315-725) 413(263-673) 2.3±6.3 1.8±2.3 CRP (pg/mL) 0.8(0.3-1.7) 1.0(0.6-2.4)

eGFR (ml/min/1.73m2) 101.0±17.7 90.0±17.4

Abbreviations: BMI, body mass index; DBP, diastolic blood pressure; HAPI, Hereditary and Phenotype Intervention; meds, medication; SBP, systolic blood pressure. aIndicates use of cigarettes, cigars, and pipes. bMedication use assessed at the time of recruitment, before participants were asked to discontinue use, per our study protocol. IQR: interquartile range,MMP-1: metaloproteinase-1, CRP: C-reactive protein, eGFR: estimated glomerular filteration rate (ml/min/1.73m2).

Supplementary Table 3. In silico functional annotation of candidate TonEBP SNPs

Active DNAase I Conservation DNase and Enhancer hyper Phylop Motif change GTEX active H3K27AC sensitivity Mean(SD) enhancer H3K4me1 47 15 including WWP2 rs2287970 47 tissues 0.29 (1.07) In 40 tissues tissues WT1, Znf143 NPIPB14P

rs72783114 10 tissues - 0.33 (0.9) AIRE, Fox, HDA - -

rs564919090 0.13 (0.7)

WWP2- rs118095741 7 tissues 0.09 (0.55) SEF1 - PDXDC2P

rs74956396 - - 0.27 (0.7) - CTD, NQ1 -

CLEC18C rs244416 - - -0.001 (0.6) Crx CLEC18A PDXDC2P HDAC2, Irf, rs149721946 15 tissue - -0.04 (0.9) - - TATA, Zfp105

rs17232663 - - -0.11 (0.98) Ets,SIX5 CLEC18A -

BCL, NFKB, STAT, P300, Primary T Primary T Primary T rs17297179 0.40 (0.8) PRDM1, Pou2f2, helper cell helper cell helper cell HMG-IY, Irf, Maf, Nkx3, GATA

Supplementary Table 4. Primer pairs used for quantitative RT-PCR

Genes NCBI ref seq Forward Reverse

Mouse TonEBP NM_133957 AAGCAGCCACCACCAAACATGA AAATTGCATGGGCTGCTGCT

Mouse TNFa NM_013693.2 TGGGACAGTGACCTGGACTGT TTCGGAAAGCCCATTTGAGT

Mouse TLR4 NM_021297.2 TGCTGCCAACATCATCCAGGAA AGGCGATACAATTCCACCTGCT

Mouse iNOS NM_010927 TATGCTGTGTTTGGCCTTGGCT TGTGGCTCCCATGTTGCATT

Mouse COX-2 NM_011198.3 TGCTGTACAAGCAGTGGCAA AGGGCTTTCAATTCTGCAGCCA

Mouse CypA NM_008907.1 CAGCCATGGTCAACCCCACCG CTGCTGTCTTTGGAACTTTGTCTG

Mouse F4/80 NM_010130.4 CTTTGGCTATGGGCTTCCAGTC GCAAGGAGGACAGAGTTTATCGTG

Mouse IL-6 NM_031168.1 ATCCAGTTGCCTTCTTGGGACTGA TAAGCCTCCGACTTGTGAAGTGGT

Mouse MCP-1 NM_011333.3 AACTGCATCTGCCCTAAGGT AGTGCTTGAGGTGGTTGTGGAA

Mouse IP-10 NM_021274.2 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA

Mouse IL-8 NM_011339.2 GACAGGCAGTGATGCCTAAA GACTAACGCGGGAATAGAGTATAAG

Mouse IL-1β NM_008361.3 AGGGCTGCTTCCAAACCTTTGAC ATACTGCCTGCCTGAAGCTCTTGT

Mouse RANTES NM_013653.3 ATATGGCTCGGACACCACTC CCCACTTCTTCTCTGGGTTG

Mouse IL-18 NM_008360.1 CAGCCTGTGTTCGAGGATATG TCACAGCCAGTCCTCTTACT

Mouse IFN-γ NM_008337.3 TCAAGTGGCATAGATGTGGAAGAA TGGCTCTGCAGGATTTTCATG

Supplementary Fig 1. D’based haploview for all haplotype tagged SNPs across TonEBP.

Supplementary Fig 2. Box plot graphs showing the mean values and distribution of phenotypes (MMP1, Monocytes, DBP, and eGFR; see Table 1) across genotypes.

t = log transformed variable

Supplementary Figure 3. Locus zoom plots showing location of all SNPs associated significantly with the phenotypes shown in Supplementary Figure 2

t = log transformed variable

Supplementary References

1. Nakagawa T, Sato W, Glushakova O, Heinig M, Clarke T, Campbell-Thompson M,

Yuzawa Y, Atkinson MA, Johnson RJ, Croker B. (2007) Diabetic endothelial nitric oxide

synthase knockout mice develop advanced diabetic nephropathy. J Am Soc Nephrol

18(2):539–550.

2. Kanetsuna Y, Takahashi K, Nagata M, Gannon MA, Breyer MD, Harris RC, Takahashi

T. (2007) Deficiency of endothelial nitric-oxide synthase confers susceptibility to diabetic

nephropathy in nephropathy-resistant inbred mice. Am J Pathol 170(5):1473-1484.

3. Zhao HJ, Wang S, Cheng H, Zhang MZ, Takahashi T, Fogo AB, Breyer MD, Harris RC.

(2006) Endothelial nitric oxide synthase deficiency produces accelerated nephropathy in

diabetic mice. J Am Soc Nephrol 17(10):2664–2669.

4. Mohan S, Reddick RL, Musi N, Horn DA, Yan B, Prihoda TJ, Natarajan M, Abboud-

Werner SL. (2008) Diabetic eNOS knockout mice develop distinct macro- and

microvascular complications. Lab Invest 88(5):515–528.

5. Lee HH, Sanada S, An SM, Ye BJ, Lee JH, Seo YK, Lee C, Lee-Kwon W, Küper C,

Neuhofer W, Choi SY, Kwon HM. (2016) LPS-induced NFκB enhanceosome requires

TonEBP/NFAT5 without DNA binding. Sci Rep 6:24921.

6. Choi SY, Lee HH, Lee JH, Ye BJ, Yoo EJ, Kang HJ, Jung GW, An SM, Lee-Kwon W,

Chiong M, Lavandero S, Kwon HM. (2016) TonEBP suppresses IL-10-mediated

immunomodulation. Sci Rep 6:25726.

7. Yoon HJ, You S, Yoo SA, Kim NH, Kwon HM, Yoon CH, Cho CS, Hwang D, Kim WU.

(2011) NFAT5 is a critical regulator of inflammatory arthritis. Arthritis Rheum 63(7):1843-

1852.

8. Choi S, You S, Kim D, Choi SY, Kwon HM, Kim HS, Hwang D, Park YJ, Cho CS, Kim

WU. (2017) Transcription factor NFAT5 promotes macrophage survival in rheumatoid

arthritis. J Clin Invest 127(3):954-969. 9. Halterman JA, Kwon HM, Leitinger N, Wamhoff BR. (2012) NFAT5 expression in bone

marrow-derived cells enhances atherosclerosis and drives macrophage migration. Front

Physiol 3:313.

10. Yang B, Hodgkinson AD, Oates PJ, Kwon HM, Millward BA, Demaine AG. (2006)

Elevated activity of transcription factor nuclear factor of activated T-cells 5 (NFAT5) and

diabetic nephropathy. Diabetes 55(5):1450-1455.

11. Mitchell BD, McArdle PF, Shen H, Rampersaud E, Pollin TI, Bielak LF, Jaquish C,

Douglas JA, Roy-Gagnon MH, Sack P, Naglieri R, Hines S, Horenstein RB, Chang YP,

Post W, Ryan KA, Brereton NH, Pakyz RE, Sorkin J, Damcott CM, O'Connell JR,

Mangano C, Corretti M, Vogel R, Herzog W, Weir MR, Peyser PA, Shuldiner AR. (2008)

The genetic response to short-term interventions affecting cardiovascular function:

Rationale and design of the Heredity and Phenotype Intervention (HAPI) Heart Study.

Am Heart J 155(5):823–828.

12. Cheng YC, Kao WH, Mitchell BD, Sharrett AR, Ryan KA, Vogel RA, Shuldiner AR, Pollin

TI. (2010) Genetic effects of postprandial variations of inflammatory markers in healthy

individuals. Obesity (Silver Spring) 18(7):1417-1422.

13. Keyszer G, Lambiri I, Nagel R, Keysser C, Keysser M, Gromnica-Ihle E, Franz J,

Burmester GR, Jung K. (1999) Circulating levels of matrix metalloproteinases MMP-3

and MMP-1, tissue inhibitor of metalloproteinases 1 (TIMP-1), and MMP-1/TIMP-1

complex in rheumatic disease. Correlation with clinical activity of rheumatoid arthritis

versus other surrogate markers. J Rheumatol 26(2):251-258.

14. Barrett JC, Fry B, Maller J, Daly MJ. (2005) Haploview: analysis and visualization of LD

and haplotype maps. Bioinformatics 21(2):263-265.

15. Köttgen A, Albrecht E, Teumer A, Vitart V, Krumsiek J, Hundertmark C, Pistis G,

Ruggiero D, O'Seaghdha CM, Haller T, Yang Q, Tanaka T, Johnson AD, Kutalik Z,

Smith AV, Shi J, Struchalin M, Middelberg RP, Brown MJ, Gaffo AL, Pirastu N, Li G,

Hayward C, Zemunik T, Huffman J, Yengo L, Zhao JH, Demirkan A, Feitosa MF, Liu X, Malerba G, Lopez LM, van der Harst P, Li X, Kleber ME, Hicks AA, Nolte IM, Johansson

A, Murgia F, Wild SH, Bakker SJ, Peden JF, Dehghan A, Steri M, Tenesa A, Lagou V,

Salo P, Mangino M, Rose LM, Lehtimäki T, Woodward OM, Okada Y, Tin A, Müller C,

Oldmeadow C, Putku M, Czamara D, Kraft P, Frogheri L, Thun GA, Grotevendt A,

Gislason GK, Harris TB, Launer LJ, McArdle P, Shuldiner AR, Boerwinkle E, Coresh J,

Schmidt H, Schallert M, Martin NG, Montgomery GW, Kubo M, Nakamura Y, Tanaka T,

Munroe PB, Samani NJ, Jacobs DR Jr, Liu K, D'Adamo P, Ulivi S, Rotter JI, Psaty BM,

Vollenweider P, Waeber G, Campbell S, Devuyst O, Navarro P, Kolcic I, Hastie N,

Balkau B, Froguel P, Esko T, Salumets A, Khaw KT, Langenberg C, Wareham NJ,

Isaacs A, Kraja A, Zhang Q, Wild PS, Scott RJ, Holliday EG, Org E, Viigimaa M,

Bandinelli S, Metter JE, Lupo A, Trabetti E, Sorice R, Döring A, Lattka E, Strauch K,

Theis F, Waldenberger M, Wichmann HE, Davies G, Gow AJ, Bruinenberg M; LifeLines

Cohort Study, Stolk RP, Kooner JS, Zhang W, Winkelmann BR, Boehm BO, Lucae S,

Penninx BW, Smit JH, Curhan G, Mudgal P, Plenge RM, Portas L, Persico I, Kirin M,

Wilson JF, Mateo Leach I, van Gilst WH, Goel A, Ongen H, Hofman A, Rivadeneira F,

Uitterlinden AG, Imboden M, von Eckardstein A, Cucca F, Nagaraja R, Piras MG, Nauck

M, Schurmann C, Budde K, Ernst F, Farrington SM, Theodoratou E, Prokopenko I,

Stumvoll M, Jula A, Perola M, Salomaa V, Shin SY, Spector TD, Sala C, Ridker PM,

Kähönen M, Viikari J, Hengstenberg C, Nelson CP; CARDIoGRAM Consortium;

DIAGRAM Consortium; ICBP Consortium; MAGIC Consortium, Meschia JF, Nalls MA,

Sharma P, Singleton AB, Kamatani N, Zeller T, Burnier M, Attia J, Laan M, Klopp N,

Hillege HL, Kloiber S, Choi H, Pirastu M, Tore S, Probst-Hensch NM, Völzke H,

Gudnason V, Parsa A, Schmidt R, Whitfield JB, Fornage M, Gasparini P, Siscovick DS,

Polašek O, Campbell H, Rudan I, Bouatia-Naji N, Metspalu A, Loos RJ, van Duijn CM,

Borecki IB, Ferrucci L, Gambaro G, Deary IJ, Wolffenbuttel BH, Chambers JC, März W,

Pramstaller PP, Snieder H, Gyllensten U, Wright AF, Navis G, Watkins H, Witteman JC,

Sanna S, Schipf S, Dunlop MG, Tönjes A, Ripatti S, Soranzo N, Toniolo D, Chasman DI, Raitakari O, Kao WH, Ciullo M, Fox CS, Caulfield M, Bochud M, Gieger C. (2013)

Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. Nat Genet 45(2):145-154.

SIGNIFICANCE STATEMENT

TonEBP (tonicity-responsive enhancer-binding protein), also known as Nfat5, is a transcription factor with a physiologic role in the response to osmotic stress in epithelial cells of the renal medulla. Recent evidence points to additional functions in macrophages. This study provides evidence that TonEBP constitutes a causal link between hyperglycemia and induction of proinflammatory gene expression in macrophages, renal infiltration by macrophages, and macrophage-mediated renal injury. Beyond this, the investigators find in a cohort of healthy humans that genetic variations in the TonEBP gene are associated with systemic inflammation and renal function. TonEBP is a novel target for therapy development for diabetic complications including diabetic nephropathy.