DOCSLIB.ORG

Supplementary Tables

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Tables Supplement Tspan8-tumor extracellular vesicle-induced endothelial cell and fibroblast remodeling relies on the target cell- selective response Wei Mu1,2, Jan Provaznik3, Thilo Hackert2, Margot Zöller2 1 School of Public Health, Shanghai Jiao Tong University School of Medicine, Shanghai, China, 2 Department of General, Visceral and Transplantation Surgery, Pancreas Section, University of Heidelberg, Germany, 3 EMBL Genomics Core Facility, Heidelberg, Germany Supplementary Tables Table S1 primers and antibodies Table S2 most abundant RNA in endothelial cells, fibroblasts, AS-Tspan8-TEX Table S3 Significant differences in mRNA signal strength between endothelial cells, fibroblasts and AS-Tspan8-TEX Table S4 miRNA recovery in cells and TEX Table S5 The impact of Tspan8 on TEX uptake and potential targets Table S6 TEX coculture-induced distinct mRNA recovery in fibroblasts and endothelial cells Table S7 Altered miRNA recovery in TEX-treated endothelial cells Table S8 Noncoding RNA in rat endothelial cells and fibroblasts Table S9 Annotation of noncoding RNA that expression is altered in TEX-treated rat fibroblasts and endothelial cells and human non-metastasizing tumor cells Table S10 Full names of symbols (protein coding) (alphabetic) Supplementary Figures Figure S1 Functional assignment of mRNA in endothelial cells, fibroblasts and AS-Tspan8-TEX Figure S2 Distinct miRNA recovery in AS, AS-Tspan8-, ASML- and ASML-Tspan8kd-TEX and cells Figure S3 Distinct mRNA recovery in fibroblasts and endothelial cells cocultured with AS-Tspan8-TEX Figure S4 Overview on molecular functions of fibroblast and endothelial cell mRNA after coculture with AS-Tspan8- TEX Figure S5 AS- and AS-TEX-promoted fibroblast modulation Figure S6 Angiogenesis-related mRNA modulation and associated signaling activation in TEX-treated endothelial cells Figure S7 Recovery and functional assignment of predicted target mRNA of downregulated miRNA in TEX-treated endothelial cells Figure S8 Pseudogenes and lncRNA in fibroblasts, endothelial cells and TEX 1 Table S1 Primers and antibodies Table S1A Primers IL-1 Forward CAGGTCTCCTCATGGCTTTGC Reverse CTTCCGAAAAGAAGGCTGTCC IL-1 Forward AAGGCTGGGTGAAGACCCTTA Reverse TGAATGGCCGTTTCTGGAAGT IL-6 Forward CGGTTAGCACACACTCCTTTG Reverse CTTCGACGTGACAGACGCT TNF Forward ACAAACTGGGTAAAGGTGATGG Reverse CAAGTTATCTGTGTCCCCAAAGC VEGF Forward CTCTCCCCCGCAAAAGAAACG Reverse CGGAACATCTCGAAGCGTTTA TIMP1 Forward ATCCACGGCATACTATCAACATC Reverse CAAGGCTCACCATCATCGTAG GAPDH Forward AGAGGGAAATCGTGCGTGAC Reverse CAATAGTGATGACCTGGCCGT Table S1B Antibodies Name Origin Supplier Adam15 rabbit Santa Cruz, HD, G alpha 5 integrin hamster Becton Dickinson, HD, G 64 (B5.5) mouse IgG ref. 1 Areg rabbit Santa Cruz, HD, G beta1 integrin hamster IgG Becton Dickinson, HD, G c-jun mouse Becton Dickinson, HD, G CCR-2 rabbit Cell Signaling, HD, G CCR-7 rabbit Cell Signaling, HD, G CD163 mouse Cell Signaling, HD, G CD36 rabbit Cell Signaling, HD, G CD44 mouse Cell Signaling, HD, G CD86 mouse Santa Cruz, HD, G Cofilin mouse Santa Cruz, HD, G Collagen IV rabbit Rockland, Gilbertsville, USA CXCL1 rabbit Cell Signaling, HD, G CXCR2 rabbit Cell Signaling, HD, G CXCR4 rabbit Cell Signaling, HD, G CXCR5 rabbit Cell Signaling, HD, G E-cadherin rabbit Santa Cruz, HD, G eLF1 rabbit Cell Signaling, HD, G Fos rabbit Cell Signaling, HD, G Foxo3 rabbit Santa Cruz, HD, G HIF1 mouse IgG Becton Dickinson, HD, G JNK rabbit Santa Cruz, HD, G Keap rabbit Cell Signaling, HD, G MMP-9 mouse Dianova, Hamburg, G NFB p65 mouse Becton Dickinson, HD, G NOX1 rabbit Cell Signaling, HD, G NOX4 rabbit Cell Signaling, HD, G Nrf2 mouse Cell Signaling, HD, G p38 MAPK rabbit Cell Signaling, HD, G Paxillin rabbit Santa Cruz, HD, G, G pERK1/2 mouse Becton Dickinson, HD, G PI3K-p85 mouse Santa Cruz, HD, G PKCA mouse Becton Dickinson, HD, G PPARγ rabbit Cell Signaling, HD, G RhoB rabbit Cell Signaling, HD, G SMAD4 rabbit Santa Cruz, HD, G Tspan5 rabbit Cell Signaling, HD, G VEGF goat Abcam, Cambridge, UK VEGFR2 rabbit Abcam, Cambridge, UK Vimentin rabbit Santa Cruz, HD, G Vinculin rabbit Cell Signaling, HD, G secondary, dye-labeled antibodies Dianova, Hamburg, G reference 1 Matzku S, Wenzel A, Liu S, Zöller M. Antigenic differences between metastatic and nonmetastatic BSp73 rat tumor variants characterized by monoclonal antibodies. Cancer Res. 1989;49:1294-9. Table S1C miRNA inhibitors miR-181a inhibitor: 5’-GTATCGCCTATACGTGTA-3’ miR-146b inhibitor: 5’-GTCACTCGTCTCCGAGA-3’ negative control inhibitor: 5′-GTGTAACACTATACGCCCA-3′ 2 Table S2 Most abundant RNA in endothelial cells, fibroblasts and AS-Tspan8-TEX Table S2A Endothelial cells: 50 most abundant RNA GeneSymbol EC GeneName Actg1 258535 actin, gamma 1 Adm 104998 adrenomedullin Anxa1 100721 annexin A1 Anxa2 162491 annexin A2 Atp5g2 106464 ATP synthase, H+ transporting, subunit C2 Bgn 324982 Biglycan Cdhr1 191901 cadherin-related family member 1 Ceacam9 144429 carcinoembryonic antigen-related cell adhesion molecule 9 Col1a2 146445 collagen, type I, alpha 2 Ctsd 113317 cathepsin D Eef1a1 174154 eukaryotic translation elongation factor 1 alpha 1 Eef1g 165905 eukaryotic translation elongation factor 1 gamma Eno1 174154 enolase 1 Fau 246290 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquit. expressed Fth1 305328 ferritin, heavy polypeptide 1 Ftl 286863 ferritin, light polypeptide Gnas 100721 GNAS complex locus Hspa8 154795 heat shock protein 8 Ints7 160254 integrator complex subunit 7 Ldha 155872 lactate dehydrogenase A Lgals1 132902 lectin, galactoside-binding, soluble, 1 LOC100364138 233005 ferritin light chain 1-like LOC290595 100025 hypothetical gene supported by AF152002 LOC303448 162491 similar to glyceraldehyde-3-phosphate dehydrogenase LOC310926 248003 hypothetical protein LOC310926 LOC687270 217401 similar to glyceraldehyde-3-phosphate dehydrogenase Mapk3 100025 mitogen activated protein kinase 3 Mif 139509 macrophage migration inhibitory factor Myl6 148489 myosin, light chain 6, smooth muscle and non-muscle Myl6l 226633 myosin, light polypeptide 6, smooth muscle and non-muscle-like Pabpc1 120611 poly(A) binding protein, cytoplasmic 1 Pcolce 198668 procollagen C-endopeptidase enhancer Peo1 125733 progressive external ophthalmoplegia 1 Pgam1 194579 phosphoglycerate mutase 1 Pgk1 137588 phosphoglycerate kinase 1 Ppia 163621 peptidylprolyl isomerase A (cyclophilin A) RGD1309537 104998 similar to Myosin regulatory light chain 2-A, smooth muscle isoform RGD1559682 135694 similar to peptidylprolyl isomerase A (cyclophilin A) RGD1562953 215899 similar to Rpl7a protein Rps2 221969 ribosomal protein S2 S100a4 244589 S100 calcium-binding protein A4 S100a6 343512 S100 calcium binding protein A6 Sparc 118129 secreted protein, acidic, cysteine-rich (osteonectin) Stfa2 338783 stefin A2 Timp2 187951 TIMP metallopeptidase inhibitor 2 Tmsb4x 117313 thymosin beta 4, X-linked Tpt1 221969 tumor protein, translationally-controlled 1 Tubb4b 126607 tubulin, beta 4B class IVb Ubb 147464 ubiquitin B Ubc 154795 ubiquitin C 3 Table S2B Lung fibroblasts: 50 most abundant RNA Symbol Fb GeneName Actg1 226633 actin, gamma 1 Anxa1 139509 annexin A1 Anxa2 149522 annexin A2 Atp5g2 109457 ATP synthase, H+ transporting, subunit C2 (subunit 9) Bgn 345901 Biglycan Cdhr1 106464 cadherin-related family member 1 Ceacam9 194579 carcinoembryonic antigen-related cell adhesion molecule 9 Col1a2 172951 collagen, type I, alpha 2 Cox4i1 99334 cytochrome c oxidase subunit IV isoform 1 Cox6a1 98648 cytochrome c oxidase, subunit VIa, polypeptide 1 Ctsb 130167 cathepsin B Cx3cl1 128375 chemokine (C-X3-C motif) ligand 1 Eef1a1 177813 eukaryotic translation elongation factor 1 alpha 1 Eef1g 150562 eukaryotic translation elongation factor 1 gamma Eno1 129267 enolase 1, (alpha) Fau 265803 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquit. expressed Fth1 322737 ferritin, heavy polypeptide 1 Ftl 296979 ferritin, light polypeptide Gnas 108701 GNAS complex locus Hspa8 156956 heat shock protein 8 Ifi27 110985 interferon, alpha-inducible protein 27 Ints7 152664 integrator complex subunit 7 Lgals1 104998 lectin, galactoside-binding, soluble, 1 LOC100364138 233005 ferritin light chain 1-like LOC303448 124864 similar to glyceraldehyde-3-phosphate dehydrogenase LOC310926 301124 hypothetical protein LOC310926 LOC687270 187951 similar to glyceraldehyde-3-phosphate dehydrogenase Mapk3 113317 mitogen activated protein kinase 3 Mt2A 100721 metallothionein 2A Myl6 152664 myosin, light chain 6, alkali, smooth muscle and non-muscle Myl6l 218913 myosin, light polypeptide 6, alkali, smooth muscle and non-muscle-like Pabpc1 164759 poly(A) binding protein, cytoplasmic 1 Pcolce 198668 procollagen C-endopeptidase enhancer Peo1 175365 progressive external ophthalmoplegia 1 Ppia 180295 peptidylprolyl isomerase A (cyclophilin A) RGD1559682 133826 similar to peptidylprolyl isomerase A (cyclophilin A) RGD1562953 184083 similar to ribosomal protein L7a RGD1564839 107204 similar to ribosomal protein L31 Rps2 226633 ribosomal protein S2 S100a4 269514 S100 calcium-binding protein A4 S100a6 269514 S100 calcium binding protein A6 Sparc 150562 secreted protein, acidic, cysteine-rich (osteonectin) Stfa2 358099 stefin A2 Timp2 220436 TIMP metallopeptidase inhibitor 2 Tkt 97966 Transketolase Tmsb4x 127488 thymosin beta 4, X-linked Tpt1 214408 tumor protein, translationally-controlled 1 Ubb 127488 ubiquitin B Ubc 115698 ubiquitin C Vim 110218 vimentin 4 Table S2C AS-Tspan8-TEX: 50 most abundant RNA Symbol Tspan8-TEX GeneName Actg1 242993 actin, gamma 1 Atp5a1 179088 ATP synthase, H+ transporting, alpha subunit 1 Ceacam9
Load more

Recommended publications
  • C8cc08685k1.Pdf
    Electronic Supplementary Material (ESI) for ChemComm. This journal is © The Royal Society of Chemistry 2018 Supporting Information Minimalist Linkers Suitable for Irreversible Inhibitors in Simultaneous Proteome Profiling, Live-Cell Imaging and Drug Screening Cuiping Guo,Yu Chang, Xin Wang, Chengqian Zhang, Piliang Hao*, Ke Ding and Zhengqiu Li* School of Pharmacy, Jinan University, Guangzhou, China 510632 *Corresponding author ([email protected]) 1. General Information All chemicals were purchased from commercial vendors and used without further purification, unless indicated otherwise. All reactions requiring anhydrous conditions were carried out under argon or nitrogen atmosphere using oven-dried glassware. AR-grade solvents were used for all reactions. Reaction progress was monitored by TLC on pre-coated silica plates (Merck 60 F254 nm, 0.25 µm) and spots were visualized by UV, iodine or other suitable stains. Flash column chromatography was carried out using silica gel (Qingdao Ocean). All NMR spectra (1H-NMR, 13C-NMR) were recorded on Bruker 300 MHz/400 MHz NMR spectrometers. Chemical shifts were reported in parts per million (ppm) referenced with respect to appropriate internal standards or residual solvent peaks (CDCl3 = 7.26 ppm, DMSO-d6 = 2.50 ppm). The following abbreviations were used in reporting spectra, br s (broad singlet), s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), dd (doublet of doublets). Mass spectra were obtained on Agilent LC-ESI-MS system. All analytical HPLC were carried out on Agilent system. Water with 0.1% TFA and acetonitrile with 0.1% TFA were used as eluents and the flow rate was 0.5 mL/min.
    [Show full text]
  • The Rise and Fall of the Bovine Corpus Luteum
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
    [Show full text]
  • Reprogramming of Trna Modifications Controls the Oxidative Stress Response by Codon-Biased Translation of Proteins
    Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Chan, Clement T.Y. et al. “Reprogramming of tRNA Modifications Controls the Oxidative Stress Response by Codon-biased Translation of Proteins.” Nature Communications 3 (2012): 937. As Published http://dx.doi.org/10.1038/ncomms1938 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/76775 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins Clement T.Y. Chan,1,2 Yan Ling Joy Pang,1 Wenjun Deng,1 I. Ramesh Babu,1 Madhu Dyavaiah,3 Thomas J. Begley3 and Peter C. Dedon1,4* 1Department of Biological Engineering, 2Department of Chemistry and 4Center for Environmental Health Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139; 3College of Nanoscale Science and Engineering, University at Albany, SUNY, Albany, NY 12203 * Corresponding author: PCD, Department of Biological Engineering, NE47-277, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139; tel 617-253-8017; fax 617-324-7554; email [email protected] 2 ABSTRACT Selective translation of survival proteins is an important facet of cellular stress response. We recently demonstrated that this translational control involves a stress-specific reprogramming of modified ribonucleosides in tRNA.
    [Show full text]
  • The Impact of Endogenous Annexin A1 on Glucocorticoid Control of Infl Ammatory Arthritis
    Basic and translational research Ann Rheum Dis: first published as 10.1136/annrheumdis-2011-201180 on 5 May 2012. Downloaded from EXTENDED REPORT The impact of endogenous annexin A1 on glucocorticoid control of inß ammatory arthritis Hetal B Patel,1 Kristin N Kornerup,1 AndreÕ LF Sampaio,1 Fulvio DÕAcquisto,1 Michael P Seed,1 Ana Paula Girol,2 Mohini Gray,3 Costantino Pitzalis,1 Sonia M Oliani,2 Mauro Perretti1 ▶ Additional (Þ gures and tables) ABSTRACT Annexin A1 (AnxA1) is an effector of resolution.4 are published online only. To view Objectives To establish the role and effect of Highly expressed in immune cells (eg, polymorpho- these Þ les please visit the journal nuclear cells and macrophages), this protein is exter- online (http://ard.bmj.com/ glucocorticoids and the endogenous annexin A1 (AnxA1) content/early/recent). pathway in inß ammatory arthritis. nalised to exert paracrine and juxtacrine effects, the vast majority of which are mediated by the formyl- 1William Harvey Research Methods Ankle joint mRNA and protein expression Institute, Barts and The London of AnxA1 and its receptors were analysed in peptide receptor type 2 (FPR2/ALX ([Lipoxin A4 School of Medicine, London UK naive and arthritic mice by real-time PCR and receptor]) or FPR2, in rodents).5 Intriguingly, FPR2/ 2Department of Biology; 6 immunohistochemistry. Inß ammatory arthritis was ALX is also the lipoxin A4 receptor indicating the Instituto de Bioci•ncias, Letras +/+ existence of important – yet not fully appreci- e Ci•ncias Exatas (IBILCE), S‹o induced with the K/BxN arthritogenic serum in AnxA1 −/− ated – networks in resolution.7 Paulo State University, S‹o JosŽ and AnxA1 mice; in some experiments, animals Another receptor do Rio Preto, Brazil were treated with dexamethasone (Dex) or with human is also advocated to mediate the effects of AnxA1, 3Medical Research Council recombinant AnxA1 or a protease-resistant mutant the formyl-peptide receptor type 1 or FPR1 (FPR1 Centre for Inß ammation, (termed SuperAnxA1).
    [Show full text]
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Annexin A1 Expression Is Associated with Epithelial–Mesenchymal Transition (EMT), Cell Proliferation, Prognosis, and Drug Response in Pancreatic Cancer
    cells Article Annexin A1 Expression Is Associated with Epithelial–Mesenchymal Transition (EMT), Cell Proliferation, Prognosis, and Drug Response in Pancreatic Cancer Masanori Oshi 1,2 , Yoshihisa Tokumaru 1,3 , Swagoto Mukhopadhyay 1, Li Yan 4, Ryusei Matsuyama 2, Itaru Endo 2 and Kazuaki Takabe 1,2,5,6,7,8,* 1 Department of Surgical Oncology, Roswell Park Comprehensive Cancer Center, Buffalo, NY 14263, USA; [email protected] (M.O.); [email protected] (Y.T.); [email protected] (S.M.) 2 Department of Gastroenterological Surgery, Yokohama City University School of Medicine, Yokohama, Kanagawa 236-0004, Japan; [email protected] (R.M.); [email protected] (I.E.) 3 Department of Surgical Oncology, Graduate School of Medicine, Gifu University, 1-1 Yanagido, Gifu 501-1194, Japan 4 Department of Biostatistics & Bioinformatics, Roswell Park Comprehensive Cancer Center, Buffalo, NY 14263, USA; [email protected] 5 Department of Gastrointestinal Tract Surgery, Fukushima Medical University School of Medicine, Fukushima 960-1295, Japan 6 Department of Surgery, Jacobs School of Medicine and Biomedical Sciences, University at Buffalo the State University of New York, Buffalo, NY 14263, USA 7 Department of Surgery, Niigata University Graduate School of Medical and Dental Sciences, Niigata 951-8510, Japan Citation: Oshi, M.; Tokumaru, Y.; 8 Department of Breast Surgery and Oncology, Tokyo Medical University, Tokyo 160-8402, Japan Mukhopadhyay, S.; Yan, L.; * Correspondence: [email protected]; Tel.: +1-716-8-455-540; Fax: +1-716-8-451-668 Matsuyama, R.; Endo, I.; Takabe, K. Annexin A1 Expression Is Associated Abstract: Annexin A1 (ANXA1) is a calcium-dependent phospholipid-binding protein overexpressed with Epithelial–Mesenchymal in pancreatic cancer (PC).
    [Show full text]
  • An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Netwo
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis Sriram Devanathan Washington University School of Medicine in St. Louis Timothy Whitehead Washington University School of Medicine in St. Louis George G. Schweitzer Washington University School of Medicine in St. Louis Nicole Fettig Washington University School of Medicine in St. Louis Attila Kovacs Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Devanathan, Sriram; Whitehead, Timothy; Schweitzer, George G.; Fettig, Nicole; Kovacs, Attila; Korach, Kenneth S.; Finck, Brian N.; and Shoghi, Kooresh I., ,"An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis." PLoS One.9,7. e101900. (2014). https://digitalcommons.wustl.edu/open_access_pubs/3326 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Sriram Devanathan, Timothy Whitehead, George G. Schweitzer, Nicole Fettig, Attila Kovacs, Kenneth S. Korach, Brian N. Finck, and Kooresh I. Shoghi This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/3326 An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Network Analysis Sriram Devanathan1, Timothy Whitehead1, George G. Schweitzer2, Nicole Fettig1, Attila Kovacs3, Kenneth S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • ) (51) International Patent Classification: Columbia V5G 1G3
    ) ( (51) International Patent Classification: Columbia V5G 1G3 (CA). PANDEY, Nihar R.; 10209 A 61K 31/4525 (2006.01) C07C 39/23 (2006.01) 128A St, Surrey, British Columbia V3T 3E7 (CA). A61K 31/05 (2006.01) C07D 405/06 (2006.01) (74) Agent: ZIESCHE, Sonia et al.; Gowling WLG (Canada) A61P25/22 (2006.01) LLP, 2300 - 550 Burrard Street, Vancouver, British Colum¬ (21) International Application Number: bia V6C 2B5 (CA). PCT/CA2020/050165 (81) Designated States (unless otherwise indicated, for every (22) International Filing Date: kind of national protection av ailable) . AE, AG, AL, AM, 07 February 2020 (07.02.2020) AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (25) Filing Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, (26) Publication Language: English HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (30) Priority Data: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 16/270,389 07 February 2019 (07.02.2019) US OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (63) Related by continuation (CON) or continuation-in-part SC, SD, SE, SG, SK, SL, ST, SV, SY, TH, TJ, TM, TN, TR, (CIP) to earlier application: TT, TZ, UA, UG, US, UZ, VC, VN, WS, ZA, ZM, ZW. US 16/270,389 (CON) (84) Designated States (unless otherwise indicated, for every Filed on 07 Februaiy 2019 (07.02.2019) kind of regional protection available) .
    [Show full text]
  • Figure S1. Quality Control Validation of MS Data. (A‑C) Mass Error Distribution of All Peptides Identified in the Acetylome
    Figure S1. Quality control validation of MS data. (A‑C) Mass error distribution of all peptides identified in the acetylome, succi- nylome and quantitative proteome, respectively. (D‑F) Length distribution of peptides identified in the acetylome, succinylome and quantitative proteome, respectively. Figure S2. Comparison of modification level between breast cancer tissue and normal tissue. Comparison of acetylation level (A) and succinylation level (B) between breast cancer tissue and normal tissue. Data are medians and were analyzed using Wilcoxon Signed Rank Test. **P<0.01. Table SI. Protein sites whose acetylation and succinylation levels were both significantly upregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein name Modification site P54868 HMCS2 310K Q15063 POSTN 549K Q99715 COCA1 1601K P51572 BAP31 72K P07237 PDLA1 328K Q06830 PRDX1 192K P48735 IDHP 180K P30101 PDIA3 417K P0DMV9 HS71B 526K Q01995 TAGL 21K P06748 NPM1 27K Q00325 MPCP 209K P00488 F13A 69K P02545 LMNA 260K P08133 ANXA6 478K P02452 CO1A1 751K Table SII. Protein sites whose acetylation and succinylation levels were both significantly downregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein name Modification site RET4 P02753 30K PSG2 P07585 142K HBA P69905 12K IGKC P01834 80K HBA P69905 8K Table SIII. All proteins whose expression level were significantly upregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein description
    [Show full text]