
Supplement Tspan8-tumor extracellular vesicle-induced endothelial cell and fibroblast remodeling relies on the target cell- selective response Wei Mu1,2, Jan Provaznik3, Thilo Hackert2, Margot Zöller2 1 School of Public Health, Shanghai Jiao Tong University School of Medicine, Shanghai, China, 2 Department of General, Visceral and Transplantation Surgery, Pancreas Section, University of Heidelberg, Germany, 3 EMBL Genomics Core Facility, Heidelberg, Germany Supplementary Tables Table S1 primers and antibodies Table S2 most abundant RNA in endothelial cells, fibroblasts, AS-Tspan8-TEX Table S3 Significant differences in mRNA signal strength between endothelial cells, fibroblasts and AS-Tspan8-TEX Table S4 miRNA recovery in cells and TEX Table S5 The impact of Tspan8 on TEX uptake and potential targets Table S6 TEX coculture-induced distinct mRNA recovery in fibroblasts and endothelial cells Table S7 Altered miRNA recovery in TEX-treated endothelial cells Table S8 Noncoding RNA in rat endothelial cells and fibroblasts Table S9 Annotation of noncoding RNA that expression is altered in TEX-treated rat fibroblasts and endothelial cells and human non-metastasizing tumor cells Table S10 Full names of symbols (protein coding) (alphabetic) Supplementary Figures Figure S1 Functional assignment of mRNA in endothelial cells, fibroblasts and AS-Tspan8-TEX Figure S2 Distinct miRNA recovery in AS, AS-Tspan8-, ASML- and ASML-Tspan8kd-TEX and cells Figure S3 Distinct mRNA recovery in fibroblasts and endothelial cells cocultured with AS-Tspan8-TEX Figure S4 Overview on molecular functions of fibroblast and endothelial cell mRNA after coculture with AS-Tspan8- TEX Figure S5 AS- and AS-TEX-promoted fibroblast modulation Figure S6 Angiogenesis-related mRNA modulation and associated signaling activation in TEX-treated endothelial cells Figure S7 Recovery and functional assignment of predicted target mRNA of downregulated miRNA in TEX-treated endothelial cells Figure S8 Pseudogenes and lncRNA in fibroblasts, endothelial cells and TEX 1 Table S1 Primers and antibodies Table S1A Primers IL-1 Forward CAGGTCTCCTCATGGCTTTGC Reverse CTTCCGAAAAGAAGGCTGTCC IL-1 Forward AAGGCTGGGTGAAGACCCTTA Reverse TGAATGGCCGTTTCTGGAAGT IL-6 Forward CGGTTAGCACACACTCCTTTG Reverse CTTCGACGTGACAGACGCT TNF Forward ACAAACTGGGTAAAGGTGATGG Reverse CAAGTTATCTGTGTCCCCAAAGC VEGF Forward CTCTCCCCCGCAAAAGAAACG Reverse CGGAACATCTCGAAGCGTTTA TIMP1 Forward ATCCACGGCATACTATCAACATC Reverse CAAGGCTCACCATCATCGTAG GAPDH Forward AGAGGGAAATCGTGCGTGAC Reverse CAATAGTGATGACCTGGCCGT Table S1B Antibodies Name Origin Supplier Adam15 rabbit Santa Cruz, HD, G alpha 5 integrin hamster Becton Dickinson, HD, G 64 (B5.5) mouse IgG ref. 1 Areg rabbit Santa Cruz, HD, G beta1 integrin hamster IgG Becton Dickinson, HD, G c-jun mouse Becton Dickinson, HD, G CCR-2 rabbit Cell Signaling, HD, G CCR-7 rabbit Cell Signaling, HD, G CD163 mouse Cell Signaling, HD, G CD36 rabbit Cell Signaling, HD, G CD44 mouse Cell Signaling, HD, G CD86 mouse Santa Cruz, HD, G Cofilin mouse Santa Cruz, HD, G Collagen IV rabbit Rockland, Gilbertsville, USA CXCL1 rabbit Cell Signaling, HD, G CXCR2 rabbit Cell Signaling, HD, G CXCR4 rabbit Cell Signaling, HD, G CXCR5 rabbit Cell Signaling, HD, G E-cadherin rabbit Santa Cruz, HD, G eLF1 rabbit Cell Signaling, HD, G Fos rabbit Cell Signaling, HD, G Foxo3 rabbit Santa Cruz, HD, G HIF1 mouse IgG Becton Dickinson, HD, G JNK rabbit Santa Cruz, HD, G Keap rabbit Cell Signaling, HD, G MMP-9 mouse Dianova, Hamburg, G NFB p65 mouse Becton Dickinson, HD, G NOX1 rabbit Cell Signaling, HD, G NOX4 rabbit Cell Signaling, HD, G Nrf2 mouse Cell Signaling, HD, G p38 MAPK rabbit Cell Signaling, HD, G Paxillin rabbit Santa Cruz, HD, G, G pERK1/2 mouse Becton Dickinson, HD, G PI3K-p85 mouse Santa Cruz, HD, G PKCA mouse Becton Dickinson, HD, G PPARγ rabbit Cell Signaling, HD, G RhoB rabbit Cell Signaling, HD, G SMAD4 rabbit Santa Cruz, HD, G Tspan5 rabbit Cell Signaling, HD, G VEGF goat Abcam, Cambridge, UK VEGFR2 rabbit Abcam, Cambridge, UK Vimentin rabbit Santa Cruz, HD, G Vinculin rabbit Cell Signaling, HD, G secondary, dye-labeled antibodies Dianova, Hamburg, G reference 1 Matzku S, Wenzel A, Liu S, Zöller M. Antigenic differences between metastatic and nonmetastatic BSp73 rat tumor variants characterized by monoclonal antibodies. Cancer Res. 1989;49:1294-9. Table S1C miRNA inhibitors miR-181a inhibitor: 5’-GTATCGCCTATACGTGTA-3’ miR-146b inhibitor: 5’-GTCACTCGTCTCCGAGA-3’ negative control inhibitor: 5′-GTGTAACACTATACGCCCA-3′ 2 Table S2 Most abundant RNA in endothelial cells, fibroblasts and AS-Tspan8-TEX Table S2A Endothelial cells: 50 most abundant RNA GeneSymbol EC GeneName Actg1 258535 actin, gamma 1 Adm 104998 adrenomedullin Anxa1 100721 annexin A1 Anxa2 162491 annexin A2 Atp5g2 106464 ATP synthase, H+ transporting, subunit C2 Bgn 324982 Biglycan Cdhr1 191901 cadherin-related family member 1 Ceacam9 144429 carcinoembryonic antigen-related cell adhesion molecule 9 Col1a2 146445 collagen, type I, alpha 2 Ctsd 113317 cathepsin D Eef1a1 174154 eukaryotic translation elongation factor 1 alpha 1 Eef1g 165905 eukaryotic translation elongation factor 1 gamma Eno1 174154 enolase 1 Fau 246290 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquit. expressed Fth1 305328 ferritin, heavy polypeptide 1 Ftl 286863 ferritin, light polypeptide Gnas 100721 GNAS complex locus Hspa8 154795 heat shock protein 8 Ints7 160254 integrator complex subunit 7 Ldha 155872 lactate dehydrogenase A Lgals1 132902 lectin, galactoside-binding, soluble, 1 LOC100364138 233005 ferritin light chain 1-like LOC290595 100025 hypothetical gene supported by AF152002 LOC303448 162491 similar to glyceraldehyde-3-phosphate dehydrogenase LOC310926 248003 hypothetical protein LOC310926 LOC687270 217401 similar to glyceraldehyde-3-phosphate dehydrogenase Mapk3 100025 mitogen activated protein kinase 3 Mif 139509 macrophage migration inhibitory factor Myl6 148489 myosin, light chain 6, smooth muscle and non-muscle Myl6l 226633 myosin, light polypeptide 6, smooth muscle and non-muscle-like Pabpc1 120611 poly(A) binding protein, cytoplasmic 1 Pcolce 198668 procollagen C-endopeptidase enhancer Peo1 125733 progressive external ophthalmoplegia 1 Pgam1 194579 phosphoglycerate mutase 1 Pgk1 137588 phosphoglycerate kinase 1 Ppia 163621 peptidylprolyl isomerase A (cyclophilin A) RGD1309537 104998 similar to Myosin regulatory light chain 2-A, smooth muscle isoform RGD1559682 135694 similar to peptidylprolyl isomerase A (cyclophilin A) RGD1562953 215899 similar to Rpl7a protein Rps2 221969 ribosomal protein S2 S100a4 244589 S100 calcium-binding protein A4 S100a6 343512 S100 calcium binding protein A6 Sparc 118129 secreted protein, acidic, cysteine-rich (osteonectin) Stfa2 338783 stefin A2 Timp2 187951 TIMP metallopeptidase inhibitor 2 Tmsb4x 117313 thymosin beta 4, X-linked Tpt1 221969 tumor protein, translationally-controlled 1 Tubb4b 126607 tubulin, beta 4B class IVb Ubb 147464 ubiquitin B Ubc 154795 ubiquitin C 3 Table S2B Lung fibroblasts: 50 most abundant RNA Symbol Fb GeneName Actg1 226633 actin, gamma 1 Anxa1 139509 annexin A1 Anxa2 149522 annexin A2 Atp5g2 109457 ATP synthase, H+ transporting, subunit C2 (subunit 9) Bgn 345901 Biglycan Cdhr1 106464 cadherin-related family member 1 Ceacam9 194579 carcinoembryonic antigen-related cell adhesion molecule 9 Col1a2 172951 collagen, type I, alpha 2 Cox4i1 99334 cytochrome c oxidase subunit IV isoform 1 Cox6a1 98648 cytochrome c oxidase, subunit VIa, polypeptide 1 Ctsb 130167 cathepsin B Cx3cl1 128375 chemokine (C-X3-C motif) ligand 1 Eef1a1 177813 eukaryotic translation elongation factor 1 alpha 1 Eef1g 150562 eukaryotic translation elongation factor 1 gamma Eno1 129267 enolase 1, (alpha) Fau 265803 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquit. expressed Fth1 322737 ferritin, heavy polypeptide 1 Ftl 296979 ferritin, light polypeptide Gnas 108701 GNAS complex locus Hspa8 156956 heat shock protein 8 Ifi27 110985 interferon, alpha-inducible protein 27 Ints7 152664 integrator complex subunit 7 Lgals1 104998 lectin, galactoside-binding, soluble, 1 LOC100364138 233005 ferritin light chain 1-like LOC303448 124864 similar to glyceraldehyde-3-phosphate dehydrogenase LOC310926 301124 hypothetical protein LOC310926 LOC687270 187951 similar to glyceraldehyde-3-phosphate dehydrogenase Mapk3 113317 mitogen activated protein kinase 3 Mt2A 100721 metallothionein 2A Myl6 152664 myosin, light chain 6, alkali, smooth muscle and non-muscle Myl6l 218913 myosin, light polypeptide 6, alkali, smooth muscle and non-muscle-like Pabpc1 164759 poly(A) binding protein, cytoplasmic 1 Pcolce 198668 procollagen C-endopeptidase enhancer Peo1 175365 progressive external ophthalmoplegia 1 Ppia 180295 peptidylprolyl isomerase A (cyclophilin A) RGD1559682 133826 similar to peptidylprolyl isomerase A (cyclophilin A) RGD1562953 184083 similar to ribosomal protein L7a RGD1564839 107204 similar to ribosomal protein L31 Rps2 226633 ribosomal protein S2 S100a4 269514 S100 calcium-binding protein A4 S100a6 269514 S100 calcium binding protein A6 Sparc 150562 secreted protein, acidic, cysteine-rich (osteonectin) Stfa2 358099 stefin A2 Timp2 220436 TIMP metallopeptidase inhibitor 2 Tkt 97966 Transketolase Tmsb4x 127488 thymosin beta 4, X-linked Tpt1 214408 tumor protein, translationally-controlled 1 Ubb 127488 ubiquitin B Ubc 115698 ubiquitin C Vim 110218 vimentin 4 Table S2C AS-Tspan8-TEX: 50 most abundant RNA Symbol Tspan8-TEX GeneName Actg1 242993 actin, gamma 1 Atp5a1 179088 ATP synthase, H+ transporting, alpha subunit 1 Ceacam9
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages116 Page
-
File Size-