DOCSLIB.ORG

Of 9 Figure 1 Tissue-Specific Transcription Factors Are

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Of 9 Figure 1 Tissue-Specific Transcription Factors Are Page 1 of 9 Figure 1 Tissue-specific transcription factors are upregulated in tissues they are specific to. Each row is a tissue; each column is a tissue-specific transcription factor set; the color of a square denotes the mean expression of the transcription factor set in the tissue, with green denoting upregulation and red denoting down regulation. Page 2 of 9 Figure 2 Tissue-specific transcription factors plotted by their increase in hubness and standardized gene expression in tissues they are specific to. Most tissue-specific transcription factors increase in expression in tissues they are specific to, and those that increase in expression also tend to increase in hubness. Transcription factors that are essential genes are marked in red; the \top" transcription factors that show the largest tissue-specific increases in expression are especially likely to be members of this essential gene set (16/20 top transcription factors as compared to 115/203 transcription factors overall). For clarity, only the top TFs are labeled. Page 3 of 9 Tissue Samples Adipose - Subcutaneous 95 Adipose - Visceral (Omentum) 19 Adrenal Gland 12 Artery - Aorta 24 Artery - Tibial 112 Brain - Amygdala 24 Brain - Anterior cingulate cortex (BA24) 18 Brain - Caudate (basal ganglia) 37 Brain - Cerebellar Hemisphere 25 Brain - Cerebellum 31 Brain - Cortex 24 Brain - Frontal Cortex (BA9) 25 Brain - Hippocampus 25 Brain - Hypothalamus 23 Brain - Nucleus accumbens (basal ganglia) 29 Brain - Putamen (basal ganglia) 21 Brain - Spinal cord (cervical c-1) 16 Brain - Substantia nigra 26 Breast - Mammary Tissue 27 Colon - Transverse 12 Esophagus - Mucosa 18 Esophagus - Muscularis 20 Heart - Atrial Appendage 25 Heart - Left Ventricle 84 Lung 119 Muscle - Skeletal 139 Nerve - Tibial 88 Pancreas 19 Pituitary 13 Skin - Not Sun Exposed (Suprapubic) 23 Skin - Sun Exposed (Lower leg) 97 Stomach 12 Testis 14 Thyroid 106 Whole Blood 157 Total 1,559 Table 1 The number of samples for each tissue in our dataset. Page 4 of 9 Tissue Transcription Factors Adrenal Gland CREBL2, CREM, EGR1, EGR3, ETV1, ETV5, FOSB, FOSL2, GATA6, HOXA5, HOXB2, HOXC6, LEF1, MAFF, MEIS1, NFIC, NFIL3, NR4A1, NR4A2, NR4A3, PBX3, PLAGL1, SREBF1, TBX3, VDR, ZNF331 All Brain Tissues ARNT2, ASCL1, ATF2, BCL11A, CAMTA1, CREB3, CUX2, DEAF1, EGR3, EMX2, ETS2, ETV1, ETV5, FOXG1, HEY1, HIC2, HIVEP2, HLF, LHX2, LHX6, MAFB, MEF2A, MEF2C, MEIS2, MLLT3, MYCN, MYT1L, NEUROD2, NFIB, NPAS2, NR2F1, NR3C2, OLIG2, PKNOX2, PRDM2, SALL2, SATB2, SOX10, SOX12, SOX4, SOX9, TCF4, TCFL5, THRA, ZBTB16, ZEB2, ZIC1, ZNF22, ZNF238, ZNF365, ZNF423 Spinal Cord ARNT2, ASCL1, ATF2, BCL11A, CAMTA1, CREB3, CUX2, DEAF1, EGR3, EMX2, ETS2, ETV1, ETV5, FOXG1, HEY1, HIC2, HIVEP2, HLF, HOXB2, HOXB7, HOXC6, LHX2, LHX6, MAFB, MEF2A, MEF2C, MEIS2, MLLT3, MYCN, MYT1L, NEUROD2, NFIB, NPAS2, NR2F1, NR3C2, OLIG2, PKNOX2, PRDM2, SALL1, SALL2, SATB2, SOX10, SOX12, SOX4, SOX9, TCF4, TCFL5, THRA, TSC22D4, ZBTB16, ZEB2, ZIC1, ZNF22, ZNF238, ZNF365, ZNF423 Heart (Left Ventricle GATA4, GATA6, HIC2, ID1, ID3, IRF7, MEF2D, MLX, NKX2-5, NR1H2, NR2F2, and Atrial Appendage) RARA, SPIB, TCF21, TFEB, ZNF358, ZNF688 Lung ATF3, ATF5, CUX1, ELF3, ELF4, EPAS1, ERG, ETS2, ETV5, FOS, FOSL2, FOXF1, FOXF2, FOXO3, GATA6, HES1, HEY1, HIF3A, HLX, HOXA5, ID1, ID3, IFI16, IRF1, IRF7, IRF8, JUN, JUND, KLF11, KLF13, KLF4, KLF6, KLF9, MAFB, MAFF, MEIS1, MEOX2, MXD4, NFIB, NFIC, NFIL3, NKX2-1, NR1H2, NR2F2, PLAGL1, RUNX3, SNAI2, SOX17, SOX4, SPI1, TBX2, TCF21, TCF7L2, TSC22D3, ZBTB16, ZFP36L2, ZNF22, ZNF395 Muscle - Skeletal BCL6, CSDA, NEUROD2, NFIC, NR4A3, ZBTB16, ZNF7 Pancreas ATF3, EGR1, ELF1, ELF3, ETS2, GRHL2, HOXB7, ID1, JUN, KLF5, KLF6, NR1I2, NR5A2, SOX9, ZKSCAN1, ZNF22 Pituitary CREB3L2, CREBL2, EGR1, ETV5, MEIS2, MSX1, NR1D2, PITX1, PLAGL1, POU1F1, SALL2, STAT4, TBX19, ZBTB20, ZNF331, ZNF91 Skin (Suprapubic and BCL11A, GATA3, HES1, KLF4, KLF5, KLF6, TFAP2A, TFAP2C, TP63, Lower Leg) TWIST1 Testis CREM, CSDA, DPF2, EZH2, FOXG1, FOXM1, GATA4, GMEB2, HIC2, KLF11, LEF1, NR1H3, OSR2, PKNOX1, PLAGL2, SNAPC4, SOX5, SOX9, TCFL5, WHSC1, ZBTB32, ZNF473, ZNF688 Thyroid ATF2, CREB3L2, CREBL2, DBP, EGR2, ETV5, FOS, FOSB, FOXE1, FOXO1, HES1, HHEX, ID1, ID3, JUN, JUND, KLF9, MAFB, MZF1, NFIB, NKX2-1, NR1D2, NR2C1, NR3C2, PAX8, PKNOX1, SALL1, SOX4, SOX9, TBX3, TCFL5, TEAD4, VEZF1, ZFHX3, ZFP36L2, ZNF395 Whole Blood BACH1, BCL6, CBFB, CREB5, E2F3, ELF1, ELF4, FLI1, FOXN3, GATA3, HBP1, HHEX, HLX, IFI16, IRF1, IRF7, IRF8, JUND, KLF2, KLF6, LEF1, MAFB, MYBL1, NFATC3, NFE2, NFIL3, NFKB1, NR3C1, PBX2, RARA, RBPJ, RCOR1, RUNX3, RXRA, SP110, SP3, SPI1, STAT1, STAT4, STAT6, TAL1, TBX21, TFEB, TP53, VEZF1, ZEB2, ZFP36L2, ZNF200, ZNF217, ZNF238, ZNF267, ZNF274 General ARNTL, BMP2, CAMTA2, CASZ1, CEBPB, CIC, CLOCK, CREBZF, CXXC1, DDIT3, ELK1, ERF, ESRRA, ETV7, FOXJ1, FOXJ2, FOXO4, GLI2, GLI3, HOXB3, HOXC4, HSF2, HSF4, ID2, IKZF1, IRF9, JUNB, KLF12, MAZ, MGA, MLXIPL, MNT, MYBL2, MYC, MYT1, NFATC4, NFE2L1, NFE2L2, NFYB, NKRF, NR1D1, ONECUT2, PATZ1, PAX5, PHB2, PITX2, POU2F2, POU6F1, PPARA, PRRX2, SMAD1, SMAD5, SNAI1, SRF, TBX1, TCF20, TCF25, TCF3, TCF7L1, TFAP4, TRPS1, TSC22D1, TUB, USF2, ZBTB11, ZBTB33, ZBTB40, ZBTB7A, ZHX3, ZKSCAN3, ZNF117, ZNF146, ZNF189, ZNF195, ZNF212, ZNF219, ZNF236, ZNF24, ZNF282, ZNF415, ZNF419, ZNF44, ZNF629, ZNF646, ZNF675, ZNF76, ZNF85, ZNF93 Table 2 Specific and General Transcription Factors used in analysis. Specific transcription factors have been found to be specific to one particular tissue or set of tissues; general transcription factors have been found to be active across many tissues. Page 5 of 9 Tissue Number of Tissue- Tissue-Specificity Keywords/Prefixes Specific Genes Stomach 31 Stomach, Digest, Breakdown Thyroid 401 Thyroid, TSH, Thyroxine, Calcium, Cal- citonin Blood 730 T cell, interleukin, erythrocyte, oxygen, respiratory burst, B cell, antigen, im- mune, blood, chemokine, killer, MHC Skin 84 keratinocyte, skin, epidermis, hemidesmosome, melanin Testis 136 gamete, sperm, meiosis, meiot, fertiliza- tion, sexual, testis Pancreas 258 insulin, pancrea, digest, glucagon Artery 11 artery, arteri Pituitary 19 pituitary, adrenocortico, TSH, HGH, PRL, FSH, MSH, Luteinizing hormone, Prolactin, Growth hormone, Thyroid- stimulating hormone Lung 195 Lung, Oxygen, Hemoglobin, Respiratory Muscle 561 Muscle, Actin, Myosin, Muscul, Tro- ponin, Myofibril, Sarcomere, Contraction Adipose 459 Fat, Trigylcer, Adipo, Lipid Heart 679 Cardia, Heart, Muscle, Actin, Myosin, Troponin, Myofibril, Myocyte, Potas- sium, Ventricular Brain* 1618 Axon guidance, nervous system de- velopment, ion transport, transmem- brane signaling receptor activity, glu- cose metabolic process, central nervous system development, brain development, dendrite, calcium ion transport, visual perception Table 3 Genes with tissue-specific functions, as identified by GO keyword. We defined 13 sets of tissue-specific genes; for all sets except for brain tissues, we used keyword search to identify genes with tissue-specific GO functions. Because of the importance of brain tissues to the analysis, we identified brain-specific genes by individually examining all 1618 GO functions and identifying 109 brain-related ones; the large number of brain genes is due to the fact that we selected genes which were highly expressed in our tissues. We provide the most common brain-related GO functions in the table above. Page 6 of 9 Tissue TF Genes of Interest Linked To/ p Total Genes Linked To Heart - Atrial Ap- NR2F2 8/35 4.915e-03 pendage Heart - Atrial Ap- ID1 6/22 5.778e-03 pendage Heart - Left Ventricle GATA6 7/30 7.411e-03 Heart - Left Ventricle ID1 4/15 2.558e-02 Lung HOXA5 5/33 4.934e-03 Lung NR2F2 7/36 1.873e-04 Lung NFIL3 5/28 2.352e-03 Lung FOSL2 8/29 4.128e-06 Lung JUND 5/35 6.380e-03 Lung KLF6 3/20 2.930e-02 Lung JUN 5/36 7.204e-03 Lung TBX2 6/34 9.294e-04 Lung ETS2 5/34 5.624e-03 Lung MAFF 4/35 3.054e-02 Muscle - Skeletal BCL6 6/34 2.188e-02 Muscle - Skeletal ZBTB16 7/39 1.254e-02 Pancreas ZKSCAN1 4/31 2.479e-02 Skin - Not Sun Exposed TFAP2A 3/26 1.147e-02 (Suprapubic) Skin - Not Sun Exposed KLF4 4/36 4.064e-03 (Suprapubic) Skin - Not Sun Exposed KLF6 3/31 1.854e-02 (Suprapubic) Skin - Sun Exposed TFAP2A 3/22 7.170e-03 (Lower leg) Skin - Sun Exposed HES1 3/34 2.372e-02 (Lower leg) Testis SNAPC4 3/27 2.834e-02 Testis KLF11 3/31 4.052e-02 Testis ZBTB32 4/37 1.285e-02 Testis ZNF473 3/28 3.118e-02 Thyroid SOX9 7/41 5.115e-03 Thyroid SALL1 10/46 1.133e-04 Thyroid FOSB 5/24 7.330e-03 Thyroid JUND 5/31 2.164e-02 Whole Blood IFI16 6/25 1.808e-02 Whole Blood GATA3 14/34 3.677e-07 Whole Blood STAT4 11/35 1.249e-04 Whole Blood LEF1 6/21 7.478e-03 Whole Blood BACH1 6/28 3.076e-02 Whole Blood IRF8 6/24 1.481e-02 Whole Blood NFKB1 6/28 3.076e-02 Whole Blood FLI1 7/29 1.061e-02 Whole Blood JUND 7/33 2.141e-02 Whole Blood VEZF1 7/30 1.282e-02 Whole Blood TBX21 8/21 2.366e-04 Whole Blood MAFB 13/36 5.517e-06 Whole Blood RUNX3 12/31 5.464e-06 Whole Blood SPI1 8/24 6.744e-04 Whole Blood ZNF217 9/30 7.507e-04 Whole Blood ZNF238 7/34 2.499e-02 Table 4 Tissue-specific transcription factors which were linked to an especially large number of genes of interest { tissue-specific genes, tissue-specific transcription factors, or general transcription factors. We filtered for transcription factors which were a) linked to at least three genes of interest and b) linked to at least twice as many genes of interest as random chance would predict. We include the binomial probability that each transcription factor would be linked to at least that many genes of interest by chance. Page 7 of 9 TF Brain Tissues Tissue Where Most Linked Genes of In- p to Tissue-Specific Genes
Load more

Recommended publications
  • Implications of Zonal Architecture on Differential Gene Expression
    www.nature.com/scientificreports OPEN Implications of zonal architecture on diferential gene expression profling and altered pathway expressions in mandibular condylar cartilage Aisha M. Basudan1*, Mohammad Azhar Aziz2 & Yanqi Yang3 Mandibular condylar cartilage (MCC) is a multi-zonal heterogeneous fbrocartilage containing diferent types of cells, but the factors/mechanisms governing the phenotypic transition across the zones have not been fully understood. The reliability of molecular studies heavily rely on the procurement of pure cell populations from the heterogeneous tissue. We used a combined laser-capture microdissection and microarray analysis approach which allowed identifcation of diferential zone-specifc gene expression profling and altered pathways in the MCC of 5-week-old rats. The bioinformatics analysis demonstrated that the MCC cells clearly exhibited distinguishable phenotypes from the articular chondrocytes. Additionally, a set of genes has been determined as potential markers to identify each MCC zone individually; Crab1 gene showed the highest enrichment while Clec3a was the most downregulated gene at the superfcial layer, which consists of fbrous (FZ) and proliferative zones (PZ). Ingenuity Pathway Analysis revealed numerous altered signaling pathways; Leukocyte extravasation signaling pathway was predicted to be activated at all MCC zones, in particular mature and hypertrophic chondrocytes zones (MZ&HZ), when compared with femoral condylar cartilage (FCC). Whereas Superpathway of Cholesterol Biosynthesis showed predicted activation in both FZ and PZ as compared with deep MCC zones and FCC. Determining novel zone-specifc diferences of large group of potential genes, upstream regulators and pathways in healthy MCC would improve our understanding of molecular mechanisms on regional (zonal) basis, and provide new insights for future therapeutic strategies.
    [Show full text]
  • Table S1. List of Proteins in the BAHD1 Interactome
    Table S1. List of proteins in the BAHD1 interactome BAHD1 nuclear partners found in this work yeast two-hybrid screen Name Description Function Reference (a) Chromatin adapters HP1α (CBX5) chromobox homolog 5 (HP1 alpha) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins (20-23) HP1β (CBX1) chromobox homolog 1 (HP1 beta) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins HP1γ (CBX3) chromobox homolog 3 (HP1 gamma) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins MBD1 methyl-CpG binding domain protein 1 Binds methylated CpG dinucleotide and chromatin-associated proteins (22, 24-26) Chromatin modification enzymes CHD1 chromodomain helicase DNA binding protein 1 ATP-dependent chromatin remodeling activity (27-28) HDAC5 histone deacetylase 5 Histone deacetylase activity (23,29,30) SETDB1 (ESET;KMT1E) SET domain, bifurcated 1 Histone-lysine N-methyltransferase activity (31-34) Transcription factors GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa Required for RNA polymerase III-mediated transcription HEYL (Hey3) hairy/enhancer-of-split related with YRPW motif-like DNA-binding transcription factor with basic helix-loop-helix domain (35) KLF10 (TIEG1) Kruppel-like factor 10 DNA-binding transcription factor with C2H2 zinc finger domain (36) NR2F1 (COUP-TFI) nuclear receptor subfamily 2, group F, member 1 DNA-binding transcription factor with C4 type zinc finger domain (ligand-regulated) (36) PEG3 paternally expressed 3 DNA-binding transcription factor with
    [Show full text]
  • Activated Peripheral-Blood-Derived Mononuclear Cells
    Transcription factor expression in lipopolysaccharide- activated peripheral-blood-derived mononuclear cells Jared C. Roach*†, Kelly D. Smith*‡, Katie L. Strobe*, Stephanie M. Nissen*, Christian D. Haudenschild§, Daixing Zhou§, Thomas J. Vasicek¶, G. A. Heldʈ, Gustavo A. Stolovitzkyʈ, Leroy E. Hood*†, and Alan Aderem* *Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103; ‡Department of Pathology, University of Washington, Seattle, WA 98195; §Illumina, 25861 Industrial Boulevard, Hayward, CA 94545; ¶Medtronic, 710 Medtronic Parkway, Minneapolis, MN 55432; and ʈIBM Computational Biology Center, P.O. Box 218, Yorktown Heights, NY 10598 Contributed by Leroy E. Hood, August 21, 2007 (sent for review January 7, 2007) Transcription factors play a key role in integrating and modulating system. In this model system, we activated peripheral-blood-derived biological information. In this study, we comprehensively measured mononuclear cells, which can be loosely termed ‘‘macrophages,’’ the changing abundances of mRNAs over a time course of activation with lipopolysaccharide (LPS). We focused on the precise mea- of human peripheral-blood-derived mononuclear cells (‘‘macro- surement of mRNA concentrations. There is currently no high- phages’’) with lipopolysaccharide. Global and dynamic analysis of throughput technology that can precisely and sensitively measure all transcription factors in response to a physiological stimulus has yet to mRNAs in a system, although such technologies are likely to be be achieved in a human system, and our efforts significantly available in the near future. To demonstrate the potential utility of advanced this goal. We used multiple global high-throughput tech- such technologies, and to motivate their development and encour- nologies for measuring mRNA levels, including massively parallel age their use, we produced data from a combination of two distinct signature sequencing and GeneChip microarrays.
    [Show full text]
  • Specific Functions of the Wnt Signaling System in Gene Regulatory Networks
    Specific functions of the Wnt signaling system in PNAS PLUS gene regulatory networks throughout the early sea urchin embryo Miao Cui, Natnaree Siriwon1, Enhu Li2, Eric H. Davidson3, and Isabelle S. Peter3 Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA 91125 Contributed by Eric H. Davidson, October 9, 2014 (sent for review September 12, 2014; reviewed by Robert D. Burke and Randall T. Moon) Wnt signaling affects cell-fate specification processes throughout Fig. 1A. Cells located at the vegetal pole will become skeleto- embryonic development. Here we take advantage of the well-studied genic mesodermal cells. These cells are surrounded by the veg2 gene regulatory networks (GRNs) that control pregastrular sea urchin cell lineage. This lineage consists of veg2 mesodermal cells, lo- embryogenesis to reveal the gene regulatory functions of the entire cated adjacent to skeletogenic cells and giving rise to all other Wnt-signaling system. Five wnt genes, three frizzled genes, two se- mesodermal cell fates such as esophageal muscle cells, blasto- creted frizzled-related protein 1 genes, and two Dickkopf genes are coelar cells, and pigment cells, and of veg2 endoderm cells, expressed in dynamic spatial patterns in the pregastrular embryo of which will form the foregut and parts of the midgut. At a further Strongylocentrotus purpuratus. We present a comprehensive analysis distance from the vegetal pole, but still within the vegetal half of of these genes in each embryonic domain. Total functions of the the embryo, is the veg1 lineage, consisting of veg1 endoderm, Wnt-signaling system in regulatory gene expression throughout the located adjacent to veg2 endoderm and giving rise to the other embryo were studied by use of the Porcupine inhibitor C59, which parts of the midgut and the hindgut, and of veg1 ectoderm, the interferes with zygotic Wnt ligand secretion.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • The Title of the Dissertation
    UNIVERSITY OF CALIFORNIA SAN DIEGO Novel network-based integrated analyses of multi-omics data reveal new insights into CD8+ T cell differentiation and mouse embryogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Kai Zhang Committee in charge: Professor Wei Wang, Chair Professor Pavel Arkadjevich Pevzner, Co-Chair Professor Vineet Bafna Professor Cornelis Murre Professor Bing Ren 2018 Copyright Kai Zhang, 2018 All rights reserved. The dissertation of Kai Zhang is approved, and it is accept- able in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California San Diego 2018 iii EPIGRAPH The only true wisdom is in knowing you know nothing. —Socrates iv TABLE OF CONTENTS Signature Page ....................................... iii Epigraph ........................................... iv Table of Contents ...................................... v List of Figures ........................................ viii List of Tables ........................................ ix Acknowledgements ..................................... x Vita ............................................. xi Abstract of the Dissertation ................................. xii Chapter 1 General introduction ............................ 1 1.1 The applications of graph theory in bioinformatics ......... 1 1.2 Leveraging graphs to conduct integrated analyses .......... 4 1.3 References .............................. 6 Chapter 2 Systematic
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • Histone-Binding of DPF2 Mediates Its Repressive Role in Myeloid Differentiation
    Histone-binding of DPF2 mediates its repressive role in myeloid differentiation Ferdinand M. Hubera,1, Sarah M. Greenblattb,1, Andrew M. Davenporta,1, Concepcion Martinezb,YeXub,LyP.Vuc, Stephen D. Nimerb,2, and André Hoelza,2 aDivision of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125; bSylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL 33136; and cMolecular Pharmacology Program, Memorial Sloan Kettering Cancer Center, New York, NY 10065 Edited by Douglas C. Rees, Howard Hughes Medical Institute, California Institute of Technology, Pasadena, CA, and approved April 26, 2017 (received for review January 6, 2017) Double plant homeodomain finger 2 (DPF2) is a highly evolution- RUNX1 form a methylation-dependent repressive complex in arily conserved member of the d4 protein family that is ubiqui- AML, although it remains unclear whether the two proteins bind tously expressed in human tissues and was recently shown to each other directly or act concertedly as part of a larger complex. inhibit the myeloid differentiation of hematopoietic stem/progen- Here, we present the crystal structure of the human DPF2 itor and acute myelogenous leukemia cells. Here, we present the tandem PHD finger domain at a 1.6-Å resolution. We demon- crystal structure of the tandem plant homeodomain finger domain strate that the DPF2 tandem PHD finger domain binds acetylated of human DPF2 at 1.6-Å resolution. We show that DPF2 interacts H3 and H4 histone tails, identify the primary determinants of with the acetylated tails of both histones 3 and 4 via bipartite histone recognition, and confirm these interactions in vivo.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • The Role of Gli3 in Inflammation
    University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Winter 2020 THE ROLE OF GLI3 IN INFLAMMATION Stephan Josef Matissek University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Matissek, Stephan Josef, "THE ROLE OF GLI3 IN INFLAMMATION" (2020). Doctoral Dissertations. 2552. https://scholars.unh.edu/dissertation/2552 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. THE ROLE OF GLI3 IN INFLAMMATION BY STEPHAN JOSEF MATISSEK B.S. in Pharmaceutical Biotechnology, Biberach University of Applied Sciences, Germany, 2014 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Biochemistry December 2020 This dissertation was examined and approved in partial fulfillment of the requirement for the degree of Doctor of Philosophy in Biochemistry by: Dissertation Director, Sherine F. Elsawa, Associate Professor Linda S. Yasui, Associate Professor, Northern Illinois University Paul Tsang, Professor Xuanmao Chen, Assistant Professor Don Wojchowski, Professor On October 14th, 2020 ii ACKNOWLEDGEMENTS First, I want to express my absolute gratitude to my advisor Dr. Sherine Elsawa. Without her help, incredible scientific knowledge and amazing guidance I would not have been able to achieve what I did. It was her encouragement and believe in me that made me overcome any scientific struggles and strengthened my self-esteem as a human being and as a scientist.
    [Show full text]