TWIST1 and TWIST2 Regulate Glycogen Storage and Inflammatory

J M MUDRY and others TWIST regulation of metabolism 224:3 303–313 Research in muscle

TWIST1 and TWIST2 regulate glycogen storage and inﬂammatory genes in skeletal muscle

Correspondence 1 1 2 1,2 Jonathan M Mudry , Julie Massart , Ferenc L M Szekeres and Anna Krook should be addressed to A Krook 1Section for Integrative Physiology, Department of Molecular Medicine and Surgery, and 2Section for Integrative Email Physiology, Department of Physiology and Pharmacology, Karolinska Institutet, SE-171 77 Stockholm, Sweden [email protected]

Abstract

TWIST proteins are important for development of embryonic skeletal muscle and play a role Key Words in the metabolism of tumor and white adipose tissue. The impact of TWIST on metabolism " TWIST in skeletal muscle is incompletely studied. Our aim was to assess the impact of TWIST1 " metabolism and TWIST2 overexpression on glucose and lipid metabolism. In intact mouse muscle, " glycogen overexpression of Twist reduced total glycogen content without altering glucose uptake. " skeletal muscle Expression of TWIST1 or TWIST2 reduced Pdk4 mRNA, while increasing mRNA levels of Il6, Tnfa, and Il1b. Phosphorylation of AKT was increased and protein abundance of acetyl CoA carboxylase (ACC) was decreased in skeletal muscle overexpressing TWIST1 or TWIST2. Glycogen synthesis and fatty acid oxidation remained stable in C2C12 cells overexpressing TWIST1 or TWIST2. Finally, skeletal muscle mRNA levels remain unaltered in ob/ob mice, type 2 diabetic patients, or in healthy subjects before and after 3 months of exercise training. Journal of Endocrinology Collectively, our results indicate that TWIST1 and TWIST2 are expressed in skeletal muscle. Overexpression of these proteins impacts proteins in metabolic pathways and mRNA level of cytokines. However, skeletal muscle levels of TWIST transcripts are unaltered in

metabolic diseases. Journal of Endocrinology (2015) 224, 303–313

Introduction

The transcription factors TWIST1 and TWIST2 (also TWIST1 and TWIST2 have overlapping but not known as DERMO1) are genes belonging to the basic identical effects, with TWIST1 being the more thoroughly helix–loop–helix (bHLH) transcription factor family, investigated gene. TWIST proteins play important roles in originally described in Drosophila and conserved in tissue differentiation. In skeletal muscle, TWIST1 blocks humans (Thisse et al. 1987). TWIST1 and TWIST2 form myogenesis via inhibition of MYOD transactivation homo- or heterodimers, which together with other (Hamamori et al. 1997), which may lead to myotube bHLH family members bind to the E-box DNA sequence dedifferentiation (Hjiantoniou et al. 2008). TWIST 50-NCANNTGN-30 (Castanon et al. 2001). The resulting proteins have also been implicated in cancer as they transcriptional activity depends on post-transcriptional block p53 and Myc-dependent apoptosis (Maestro et al. modiﬁcations, partner choice, and cellular context, thus 1999). Moreover TWIST1 facilitates the appearance of complicating the characterization of modes of action of metastasis by promoting cell migration (Yang et al. 2004), the TWIST proteins (Laursen et al. 2007). and its expression level correlates with metastasis and poor

http://joe.endocrinology-journals.org Ñ 2015 Society for Endocrinology Published by Bioscientiﬁca Ltd. DOI: 10.1530/JOE-14-0474 Printed in Great Britain Downloaded from Bioscientifica.com at 09/28/2021 11:24:25AM via free access Research J M MUDRY and others TWIST regulation of metabolism 224:3 304 in muscle

prognosis in cancer (Hosono et al. 2007, Ou et al. 2008). Table 1 Anthropometric measurements and metabolic para- Mutations in TWIST1 are responsible for Saethre–Chotzen meters of human volunteers. Data are presented as meansGS.E.M. syndrome (OMIM 101400) characterized by craniosynos- tosis and limb abnormalities. In mice, homozygous NGT T2D deletion of the Twist1 gene results in embryonic lethality, n 10 10 while mice with a deletion of the Twist2 gene die 3 days Sex (F/M) 5/5 4/6 Age (y) 58G263G1* after birth due to cachexia with high levels of pro- Height (cm) 171G3 170G4 inflammatory cytokines and a complete absence of Weight (kg) 84.8G3.6 90.8G5.8 G G glycogen stores (Sosic et al. 2003). Waist circumference (cm) 93.2 2 106.0 4* BMI (kg/m2) 29.1G0.6 31.3G1.2 A role for TWIST proteins in metabolism has been SBP (mmHg) 133G5 140G3 proposed in adipose tissue, where TWIST1 is reported DBP (mmHg) 79G378G2 G G to regulate cytokine expression (Pettersson et al. 2010). FBG (mmol/l) 5.5 0.0 7.9 0.2** 2-h BG (mmol/l) 6.6G0.4 14.5G1.4* In adipose cells, TWIST1 silencing reduces fatty acid HbA1c (%) 4.6G0.1 5.3G0.2* oxidation and modulates pro-inflammatory cytokine Insulin (pmol/l) 51.4G12.5 92.5G16.6* G G expression, in particular IL6 (Dobrian 2012). Furthermore, HDL (mmol/l) 1.45 0.33 1.24 0.05* LDL (mmol/l) 3.24G0.18 2.74G0.28 reduced TWIST1 expression in human white adipose TG (mmol/l) 51.4G12.8 92.5G16.9 tissue has been correlated with insulin-resistance and IL6 (pg/ml) 1.54G0.37 2.23G0.51 G G obesity (Pettersson et al. 2011). TWIST1 is also a negative HOMA-IR 1.97 0.10 3.48 0.30** feed-back regulator of PGC1a/PPARd-mediated signaling NGT, normal-glucose tolerant; T2D, type 2 diabetes; SBP, systolic blood in brown fat (Pan et al. 2009). The role of TWIST proteins pressure; DBP, diastolic blood pressure; FBG, fasting blood glucose; HbA1c, in mature skeletal muscle is less well explored. Based on glycated hemoglobin; TG, triglycerides; HOMA, homeostatic model assessment of insulin resistance. **P!0.01; *P!0.05. reported effects of TWIST1 in adipose cells, we hypothesized that TWIST proteins may be involved in skeletal muscle Mice glucose and lipid metabolism, as well as in the regulation of expression of skeletal muscle-derived cytokines. C57BL/6J mice (12–14 weeks old) were purchased from Charles River (Sulzfeld, Germany) and acclimatized for at least 1 week before use. Mice were housed in a humidity Materials and methods and temperature-controlled environment with 12 h Journal of Endocrinology light:12 h darkness cycle and provided ad libitum access Human subjects to water and standard rodent chow (4% fat, 16.5% Male and female volunteers with type 2 diabetes mellitus protein, 58% carbohydrates, 3.0 kcal/g purchased from (T2D) or normal glucose tolerance (NGT) were matched Lantma¨nnen, Stockholm, Sweden). Tissue collection from C C for weight and BMI. Detailed clinical characteristics of C57BL/6J-ob/ob and lean / female mice at 14–16 weeks the patients are given in Table 1. As expected, fasting and of age was performed after anesthesia using 0.02 ml/g 2 h glucose levels post oral glucose tolerance test were body weight of Avertin (2.5% solution of 99% 2,2,2- increased in T2D patients. Patients on insulin treatment and tribromo ethanol and tertiary amyl alcohol purchased with symptomatic coronary heart disease were excluded. from Sigma–Aldrich). The muscles were immediately A muscle biopsy of the vastus lateralis and anthropomor- frozen in liquid nitrogen and stored at K80 8C until RNA phic measurements were taken at enrolment in the study extraction. The study protocols were approved by the (Barres et al.2012, Kulkarni et al.2012). In a separate cohort, animal ethics committee of Stockholm north. 13 sedentary volunteers participated in an exercise training program consisting of 60 min a day, 5 days/week for 3 weeks. Plasmid construct Biopsies of the vastus lateralis muscle were obtained before the first and 48 h after the last training bout. This exercise pZsGreen1-C1 construct was purchased from Clontech.

training program increased VO2 max by 13% (P!0.05; The pZsGreen1 (GFP) sequence was removed and replaced Czepluch et al.2011). The clinical parameters and detailed with Twist1 or Twist2 sequences. The inserted sequences of the exercise protocol are reported elsewhere (Czepluch were species-optimized for mice by Geneart (Regensburg, et al.2011). All studies were performed according to the Germany). The Twist1 and Twist2 DNA sequences were declaration of Helsinki, with informed consent and created by GeneArt using the mice protein sequence for approved by the ethics committee at Karolinska Institute. TWIST1 (Swiss-Prot: P26687.1) and TWIST2 (Swiss-Prot:

Q9D030.1) respectively. The optimization process con- (between passages 9 and 12) were seeded at 2!104 cells/cm2 sisted of DNA sequence adaptation to remove internal in a six-well plate (Corning, New York, NY, USA) for 24 h and TATA-boxes, c-sites and ribosomal entry sites, AT-rich then transfected with 2 mg Twist1 or Twist2 DNA construct or GC-rich sequence stretches, RNA instability motifs, (1 mg/ml) and 6 ml/ml of FuGENE HD (Promega) or FuGENE repeat sequences and RNA secondary structures, cryptic HD only (as control) in DMEM containing 10% FBS but splice donor, and acceptor sites in higher eukaryotes. without antibiotic or antimycotic additions for 24 h. Each condition was performed in triplicate.

Gene transfer by electroporation in intact skeletal muscle and metabolic analysis mRNA extraction and analysis

Male C57BL/6 mice (12–14 weeks old) were purchased from mRNA was extracted from 10 mg of skeletal muscle tissue Charles River and acclimatized for at least 1 week before homogenized in 1 ml of TRIzol reagent (Invitrogen) use. Mice were housed in a humidity- and temperature- and was purified according to the manufacturer’s rec- controlled environment with 12 h light:12 h darkness ommendations. For mRNA extraction from cultured cells, cycle and provided ad libitum access to water and standard myoblasts were washed three times with PBS and RNA was rodent chow. Tibialis anterior muscles of adult C57BL/6J extracted using the RNeasy Mini Kit (Qiagen, Hilden, mice were transfected with either an empty vector or the Germany) and purified with DNAse (Qiagen) according vector encoding for TWIST1 or TWIST2 (Clontech) by elec- to recommendations of the manufacturer. troporation as described previously (Kulkarni et al.2011). RNA concentration was measured with Nanodrop One week after electroporation, mice were fasted for 4 h 1000 (Thermo Scientific) and reverse transcribed using and subjected to a modified oral glucose tolerance test to the High-capacity cDNA RT Kit (Applied Biosystems). assess glucose uptake into skeletal muscle, as described Real-time PCRs were performed in duplicate using (Witczak et al. 2007, Kulkarni et al.2011). Electroporated TaqMan-based probes in a Step One Plus detector (Applied muscle was pulverized on dry ice and separated in three Biosystems). GAPDH (Hs99999905_m1 for human samples fractions. One fraction was assayed for glycogen content using and Mm99999905_m1 for mouse samples) was used as a glycogen assay kit (Abcam), following the manufacturer an endogenous control. For mRNA measurement after instructions. The second fraction was used for RNA extraction. electroporation, results were compared against the The third fraction was homogenized in ice-cold homogeni- geometrical mean of three different housekeeping Journal of Endocrinology

zation buffer (NaCl 137 mmol/l, KCl 2.7 mmol/l, MgCl2 genes: GAPDH, HPRT1 (Mm00446968_m1), and TBP

1mmol/l,Na4O7P2 5 mmol/l, NaF 10 mmol/l, Triton X-100 (Mm00446971_m1). The following TaqMan primer and 1%, glycerol 10%, Tris pH 7.8, 20 mmol/l, EDTA 1 mmol/l, probe sets from Applied Biosystems were used: for mouse

phenylmethylsulfonyl ﬂuoride 0.2 mmol/l, Na3VO4 origin: Il1b: Mm00434228_m1, Tnfa: Mm00443260_g1, 0.5 mmol/l, and protease inhibitor cocktail !1) (Calbiochem, Il6: Mm00446190_m1, myogenin: Mm00446195_g1, San Diego, CA, USA; Merck Millipore, Billerica, MA, USA) for MyoD: Mm01203489_g1, Pax7: Mm01354484_m1, protein extraction. Protein content in the supernatant Twist1: Mm00442036_m1, Twist2: Mm00492147_m1 and was determined using the Pierce BCA Protein Assay Kit for human origin: TWIST1: Hs01675818_s1, TWIST2: (Thermo Scientiﬁc, Waltham, MA, USA). An aliquot of protein Hs02379973_s1. For measurement of plasmid product, lysate was counted in a liquid scintillation counter to custom-made TaqMan primers were designed (Sigma– assess the accumulation of nonmetabolized 3H-deoxyglucose Aldrich) with the following sequence: Twist1: forward: (WinSpectral 1414, Wallac, Perkin Elmer, Waltham, MA, GAACTGCAGACCCAGCGCGT, probe: CCTGAACGAGG- USA), and radioactivity in counts per minute was normalized CCTTCGCCG, and reverse: CCTGAACGAGGCCTTCG- by protein concentration. CCG; Twist2: forward: AGCGCCCAGAGCTTCGAGGA, probe: GCCAACGTGCGCGAGAGACA, and reverse: CGGCGAAGGCCTCGTTCAGG. C2C12 mouse cell line and plasmid transfection

C2C12 cells were obtained from ATCC (Manassas, VA, USA). Cytokine measurement in C2C12 myoblasts- The cells were grown in high-glucose DMEM (Gibco) with conditioned media 10% fetal bovine serum (FBS) (Sigma–Aldrich), 1% penicil- lin–streptomycin (Gibco), and 1% fungizone (Gibco). The Following 24 h in transfection medium, C2C12 myoblasts medium was changed every second day. C2C12 myoblasts were incubated in a serum-free medium. After 2 h, the

medium was changed to a fresh serum-free medium and for 15 min at 11 000 g, washed once with 70% ethanol, cells were incubated for 16 h. The medium was then and resuspended in 0.3 ml distilled water. [14C]labeled collected and IL6, IL1b,andtheTNFa contents in the glycogen was counted in a liquid scintillation counter conditioned culture media were assessed by ELISA following (WinSpectral 1414, Wallac). Each experiment was per- the manufacturer’s instructions (Life Technologies; catalo- formed in triplicate. Data are average of four independent gue items: KMC0061, KMC0011, and KMC3011). experiments.

Immunoblot analysis Palmitate oxidation in C2C12 myoblasts

Skeletal muscle lysate was diluted in Laemmli buffer Palmitate oxidation was determined in triplicate samples solution and separated by SDS–PAGE. After transfer to as previously described (Rune et al. 2009), including nitrocellulose membranes (Bio-Rad), proteins were nonradioactive palmitate. In brief, 24 h after transfection, blocked in 7.5% nonfat milk, washed with TBST C2C12 myoblasts were serum starved for 2 h in DMEM. (10 mmol/l Tris–HCl, 100 mmol/l NaCl, and 0.02% The medium was changed to 1 ml DMEM containing Tween 20), and incubated with primary antibody over- 25 mM of palmitate including 0.078 mM 3H[9,10-3H(N)] night at 4 8C. The membranes were washed with TBST palmitate (5 mCi/ml and 32.0 Ci/mmol) (Perkin Elmer) and incubated with appropriate HRP-conjugated second- and 0.04% BSA. The medium was collected 6 h later and ary antibodies (Bio-Rad, diluted 1:25 000). Proteins were cells were harvested for protein determination. In brief, visualized by ECL (GE Healthcare, Little Chalfont, UK) and 0.2 ml of collected medium was incubated for 30 min quantified using Quantity One Software (Bio-Rad). in 0.8 ml of charcoal buffer (10% activated charcoal in Primary antibody for glycogen synthase (GS) (catalogue 0.02 M Tris–HCl buffer at pH 7.5) and shaken for 30 min. item: #3893), GS phosphorylated on serine 641 (p-GS) The samples were subjected to centrifugation at 19 000 g (#3891), ACC (#3676), ACC phosphorylated on serine 79 for 15 min and 0.2 ml of the supernatant was counted in (p-ACC) (#3661), AKT (or protein kinase B (PKB)) (#9272), a liquid scintillation counter (WinSpectral 1414, Wallac). and its phosphorylated form on serine 473 (p-AKT) (#9271) were purchased from Cell Signaling (Danvers, Statistical analyses MA, USA), GAPDH (#sc-25778) was purchased from Santa- Cruz Biotechnology and TWIST2 (#ab66031) from Abcam All data are presented as meanGS.E.M. Metabolic data from Journal of Endocrinology (Cambridge, UK). Additional TWIST1 antibodies from the electroporated C57BL/6J mice and skeletal muscle gene Santa-Cruz Biotechnology (#sc-15393 and #sc-6269) and expression from the exercise training cohort were analyzed Sigma–Aldrich (#T6451) were also used. using a paired Student’s t-test. Differences in gene expression in C2C12 cells, lean vs ob/ob mice, and normal glucose tolerant vs type 2 diabetic participants were analyzed using Glycogen synthesis in C2C12 myoblasts Student’s t-test after natural log transformation. Palmitate Glucose incorporation to glycogen was determined in oxidation and glycogen synthesis in C2C12 myoblasts were C2C12 myoblasts as previously described (Al-Khalili et al. analyzed using a two-way ANOVA, followed by Bonferroni’s 2003). In brief, after 24 h in transfection medium, cells correction for multiple comparison. The analyses were per- were serum starved for 2 h. The myoblasts were treated formed using GraphPad version 5.04 (GraphPad Software, 14 with 120 nM insulin for 30 min before adding 1 ml D-[U- C] Inc., La Jolla, CA, USA). Comparisons were considered to be glucose (1 mCi/ml and 289 mCi/mmol; Perkin Elmer, statistically significant at P!0.05. Waltham, MA, USA) for the last 90 min. Following incubation, monolayers were washed with ice-cold PBS and lysed in 0.5 ml 0.03% SDS. The suspension (0.4 ml) was Results transferred to 2-ml tubes and 0.1 ml (2 mg/sample) carrier Overexpression of Twist1 or Twist2 in mouse tibialis glycogen was added. The remaining cell suspension was anterior muscle used for protein concentration determination by the Pierce BCA Protein Assay Kit (Thermo Scientific). The samples Tibialis anterior muscle of C57BL/6J mice was electro- were heated to 99 8C for 1 h. Glycogen was precipitated porated with a vector containing an optimized sequence by addition of 95% ethanol and incubated overnight at for either Twist1 or Twist2, or a control empty plasmid into K20 8C. Glycogen pellets were collected by centrifugation the contralateral leg. While overexpression did not affect

the mRNA level of endogenous Twist, the exogenous Twist2). The early differentiation marker Pax7 was increa- transcript was overexpressed 3.3 times for Twist1 and 3.5 sed following Twist1 overexpression in skeletal muscle times for Twist2 compared with the contralateral muscle (Fig. 1B), and intermediate and late differentiation markers receiving the control plasmid (Fig. 1A). MyoD and myogenin trended in the same direction. mRNA levels of a number of gene targets of Twist were TWIST2 overexpression did not alter the expression of determined using RT-PCR. As expected from previous these genes (Fig. 1B). Pdk4 mRNA was reduced by 26 investigation (Pan et al. 2009), overexpression of Twist1 and 38% following TWIST1 or TWIST2 overexpression and Twist2 tended to reduce PGC1a mRNA expression respectively (P!0.05). mRNA levels of inﬂammatory (K36%G0.06 S.E.M.(PZ0.08) when overexpressing Twist1 cytokines IL6, IL1b, and TNFa were increased by more and K32%G0.05 S.E.M.(PZ0.001) when overexpressing than 60% (Fig. 1B and C, P!0.05). A modiﬁed oral glucose tolerance test including an

A 4 5 injection of radiolabeled 2-deoxy-D-glucose was carried ** *** 4 3 out in mice 1 week after electroporation. Total radio- )

) 3 2 DDCt DDCt (2 activity in tibialis anterior muscle harvested 2 h after a

(2 2 1 1 bolus glucose injection was measured. Glucose uptake Relative mRNA expression Relative Relative mRNA expression Relative 0 0 was unaltered in skeletal muscle overexpressing either TWIST1 or TWIST2 vs the respective contralateral

CTRL endogenous CTRL endogenous Twist1 o.e exogenous Twist2 o.e exogenous control muscle (Fig. 1D). In contrast, total glycogen Twist1 o.e endogenous Twist2 o.e endogenous B Twist1 overexpression content was decreased by 39 and 28% in tibialis anterior 3 ** muscle overexpressing TWIST1 and TWIST2 respectively * ! ) 2 * P=0.07 * (Fig. 1E, P 0.05).

DDCt P=0.09 (2 Overexpression of TWIST2 was conﬁrmed at the 1 * protein level in the leg electroporated with Twist2 plasmid Relative mRNA expression Relative 0 as compared with the control leg (Fig. 2). We were unable Pax7 MyoD MyoG Pdk4 Il6 Il1β Tnfα

C Twist2 overexpression to obtain an antibody to reliably detect TWIST1 protein

3 ** by western blot analysis, despite trying three different

* * sources (see section Materials and methods). As TWIST1 ) 2 DDCt

(2 and TWIST2 overexpression reduced skeletal muscle Journal of Endocrinology 1 * glycogen content, despite similar rates of glucose uptake, Relative mRNA expression Relative 0 we measured GS and its inactive phosphorylated fraction Pax7 MyoD MyoG Pdk4 Il6 Il1β Tnfα (serine 641). However, GS and phospho-GS were unaltered

DEGlucose uptake Glycogen contentGlucose uptake Glycogen content in the skeletal muscle overexpressing TWIST2. In contrast, 2.0 0.15 2.0 0.10

0.08 both total GS protein and its phosphorylated fraction 1.5 1.5 * 0.10 g of protein g of protein 0.06 µ µ were reduced by 40% by overexpression of TWIST1 (Fig. 2). 1.0 * 1.0 0.04 0.05 We determined ACC content and ACC phosphorylation Arbitrary units Arbitrary units 0.5 0.5 0.02 g of glycogen/ 0.0 g of glycogen/ on serine 79. Overexpression of TWIST1 or TWIST2 in

0.0 µ

0.00 µ 0.00 Control Twist1 o.e Control Twist1 o.e Control Twist2 o.e Control Twist2 o.e skeletal muscle resulted in a reduction in total ACC, without altering the level of phosphorylated protein, Figure 1 suggesting a larger fraction of total ACC in an inactive mRNA expression, in vivo glucose uptake, and total glycogen content in mice paired tibialis anterior skeletal muscle electroporated with TWIST1 state (Fig. 2). We also measured AKT and AKT phosphoryl- (nZ5) or TWIST2 (nZ6). (A) TWIST1 and TWIST2 relative overexpression ation on serine 473. Total AKT protein levels were were measured with primers speciﬁc for the endogenous or the plasmid unchanged by TWIST overexpression, whereas AKT (exogenous) transcript. Black bars: expression of the endogenous TWIST transcript in the control leg. White bars: expression of TWIST endogenous phosphorylation was increased by 2.5-fold by TWIST1 transcript in the leg overexpressing the TWIST plasmid. Striped bars: and 1.9-fold by TWIST2 overexpression. expression of TWIST exogenous transcript (originating from transcription of the plasmid) in the leg overexpressing the TWIST plasmid. (B and C) Pax7, MyoD, Myogenin (MyoG), PDK4, IL6, IL1b, TNFa mRNA levels in skeletal Effect of TWIST1 or TWIST2 overexpression in muscles overexpressing (B) TWIST1 (nZ5) or (C) TWIST2 (nZ6). (D and E) Glucose uptake and glycogen content in mice paired tibialis anterior C2C12 myoblasts skeletal muscle electroporated with (C) TWIST1 (nZ5) or (D) TWIST2 (nZ6). Results are meanGS.E.M. of fold of control. ***P!0.001; **P!0.01; Overexpression of TWIST1 or TWIST2 was observed in *P!0.05. o.e., overexpression. cultured C2C12 mouse myoblasts. The experiments were

ABGS p-GS p-GS/GS 0.8 0.4 3

C T1 C T1 0.6 0.3 2 * * GS 0.4 0.2 1 Arbitrary units Arbitrary units Arbitrary units 0.2 0.1

0.0 0.0 0 p-GS Control Twist1 o.e Control Twist1 o.e Control Twist2 o.e

ACC p-ACC p-ACC/ACC 0.8 0.8 2.0 ACC 0.6 0.6 1.5 ** 0.4 0.4 1.0 Arbitrary units Arbitrary units p-ACC Arbitrary units 0.2 0.2 0.5

0.0 0.0 0.0 Control Twist1 o.e Control Twist1 o.e Control Twist1 o.e AKT AKT p-AKT p-AKT/AKT 1.5 0.8 0.8 * * p-AKT 0.6 0.6 1.0

0.4 0.4

0.5 Arbitrary units Arbitrary units GAPDH 0.2 Arbitrary units 0.2

0.0 0.0 0.0 Control Twist1 o.e Control Twist1 o.e Control Twist1 o.e

CDGS p-GS p-GS/GS 1.0 1.0 3

CT2CT2 0.8 0.8 2 Twist2 0.6 0.6 0.4 0.4 1 Arbitrary units Arbitrary units Arbitrary units Journal of Endocrinology GS 0.2 0.2 0.0 0.0 0 Control Twist2 o.e Control Twist2 o.e Control Twist2 o.e

p-GS ACC p-ACC p-ACC/ACC 2.0 2.5 3 *

2.0 ACC 1.5 2 1.5 1.0 ** 1.0 p-ACC 1 Arbitrary units Arbitrary units 0.5 Arbitrary units 0.5

0.0 0.0 0 AKT Control Twist2 o.e Control Twist2 o.e Control Twist2 o.e AKT p-AKT p-AKT/AKT 1.5 1.5 1.5 p-AKT P=0.08

1.0 1.0 1.0 ** GAPDH 0.5 0.5 0.5 Arbitrary units Arbitrary units Arbitrary units

0.0 0.0 0.0 Control Twist2 o.e Control Twist2 o.e Control Twist2 o.e

Figure 2 Western blotting analysis carried out in paired mouse skeletal muscle protein level and phosphorylation ratio for samples electroporated with overexpressing TWIST1 (nZ5) or TWIST2 (nZ6). TWIST2, GS, p-GS, ACC, TWIST1. (C) Representative blots of samples electroporated with TWIST2. p-ACC, AKT, p-AKT levels were measured. Their respective phosphorylation (D) Relative protein level and phosphorylation ratio for samples electro- ratio was calculated. Protein levels were normalized for GAPDH. (A) porated with TWIST2. Results are meanGS.E.M.**P!0.01; *P!0.05. o.e., Representative blots of samples electroporated with TWIST1. (B) Relative overexpression.

carried out in myoblast cultures because TWIST1 has been A 25 * shown to lead to dedifferentiation in C2C12 myotubes 20 (Hjiantoniou et al. 2008). Overexpression of TWIST2 increased mRNA levels by more than tenfold (P!0.05, ) 15 Fig. 3A). Conﬁrming studies reported by other investi- DDCt

gators (Hebrok et al. 1997, Murakami et al. 2008), Twist1 (2 10

mRNA was undetected in cultured C2C12, and thus 5 the overexpression that Twist1 achieved could not be Relative mRNA expression Relative related with endogenous levels. Nevertheless, the over- 0 expression Ct values achieved were similar for Twist1 and Twist2 (24.2 CtforTwist1 and 25.0 CtforTwist2 respectively). Similar to the results achieved following CTRL endogenous the in vivo overexpression, we noted a 30% reduction Twist2 o.e exogenous Twist2 o.e endogenous in Pdk4 mRNA levels and an increase of more than 60% B Pdk4 Il6 in Il6 mRNA levels (Fig. 3B and C) in cultured myoblasts 1.5 2.0 24 h after transfection. * We determined the media appearance of Il6, Il1b, and 1.5 Tnfa in 16-h conditioned media from C2C12 myoblasts. 1.0 ) a ) IL6 and TNF were not detectable under any conditions *** 1.0 DDCt DDCt (2 investigated. The media content levels of IL1b were not (2 0.5 signiﬁcantly altered by overexpression of TWIST1 or 0.5 TWIST2 (29G7 pg/ml for control, 22G4pg/ml for Relative mRNA expression Relative G mRNA expression Relative TWIST1, and 27 8 pg/ml for TWIST2 respectively, NS) 0.0 0.0 Glucose incorporation into glycogen and lipid oxi- Control Twist1 o.e Control Twist1 o.e dation was determined in myoblasts overexpressing C Pdk4 Il6 TWIST1 or TWIST2. Insulin increased glucose incorpor- 1.5 2.0 ation by 40% in control myoblasts. However, overexpres- ** sion of either TWIST1 or TWIST2 did not alter either basal 1.5 Journal of Endocrinology 1.0 ) or insulin-stimulated glycogen synthesis (Fig. 4A). More- ) *** 1.0 DDCt over, palmitate oxidation was unaltered in the myoblasts DDCt (2 (2 overexpressing either TWIST1 or TWIST2 (Fig. 4B). 0.5 0.5 Relative mRNA expression Relative Relative mRNA expression Relative Effects of obesity, T2D, or exercise training on 0.0 0.0 Twist expression Control Twist2 o.e Control Twist2 o.e

The mRNA levels of Twist1 and Twist2 were determined Figure 3 in tibialis anterior muscle from insulin resistant ob/ob mRNA expression in C2C12 mouse myoblasts triplicates transfected with mice and lean WT mice. As expected ob/ob mice were TWIST1 or TWIST2. (A) TWIST2 relative overexpression measured with heavier than their lean counterparts (55.5 gG2.2 for ob/ob primers specific for the endogenous or the plasmid (exogenous) transcript. Black bars: expression of TWIST endogenous transcript in the control leg. vs 20.7G0.5 for WT, meanGS.E.M., P!0.001) but had not White bars: expression of TWIST endogenous transcript in the leg significantly different levels of blood glucose level overexpressing the TWIST plasmid. Striped bars: expression of TWIST (13.0G4.5 S.E.M. for the ob/ob vs 7.9G0.3 S.E.M.fortheWT, exogenous transcript (from the transcription of the plasmid) in the leg overexpressing the TWIST plasmid. (B) PDK4 and IL6 mRNA levels in samples PZ0.27). Although a tendency for reduced Twist1 mRNA overexpressing TWIST1. (C) PDK4 and IL6 mRNA levels in samples over- was noted in tibialis anterior muscle from ob/ob mice expressing TWIST2. Results are meanGS.E.M. of fold of control. ***P!0.001; (PZ0.085), mRNA levels of either Twist1 or Twist2 tibialis **P!0.01; *P!0.05. o.e., overexpression. anterior were not significantly altered (Fig. 5A). Likewise, TWIST1 mRNA was unaltered in the skeletal muscle from before and after a 3-week exercise training program. type 2 diabetic patients vs normal glucose tolerant control Although exercise training improved maximal oxygen uptake subjects (Fig. 5B). Finally, the mRNA level was determined and other clinical features (Czepluch et al. 2011), mRNA in skeletal muscle biopsies from young healthy people expression of TWIST1 or TWIST2 was unaltered (Fig. 5B).

ABGlycogen synthesis Palmitate oxidation to the de-differentiation stimulus induced by TWIST1 2.0 1.5 ** * ** (Hjiantoniou et al. 2008). The lack of change in Pax7 in 1.5 1.0 response to TWIST2 overexpression could reﬂect the fact 1.0 that TWIST2 is not critical in the differentiation process 0.5 Fold of control Fold Fold of control Fold 0.5 of skeletal muscle cells as whole-body knock-out mice

0.0 0.0 are born with similar skeletal muscle mass as WT animals Control Twist1 o.e Twist2 o.e Control Twist1 o.e Twist2 o.e (Sosic et al. 2003). We determined mRNA expression of several inflam- Figure 4 Glycogen synthesis and palmitate oxidation in C2C12 mouse myoblasts matory cytokines. Our findings were consistent with overexpressing TWIST1 or TWIST2. (A) Glycogen synthesis; white bars: previous results in human primary white adipocytes basal. Black bars: after 2 h stimulation with 120 nM insulin. Data are whereby TWIST1 silencing reduces mRNA expression of representative of four independent experiments. (B) Palmitate oxidation. Data are representative of three independent experiments. Results are IL6 and TNFa (Pettersson et al. 2010). In contrast, both meanGS.E.M. of fold of control. **P!0.01; *P!0.05. o.e., overexpression. whole-body knock-out of TWIST2 or siRNA gene silencing of TWIST1 when coupled with TNFa stimulation in cultured adipocytes increases the expression of inflam- Discussion matory cytokines (Sosic et al. 2003, Pettersson et al. 2011). TWIST1 and TWIST2 expression is altered in adipose tissue Thus overexpression and ablation have similar effects, in the context of metabolic disease and implicated in the which may initially appear contradictory. However, as regulation of cytokine expression (Sosic et al. 2003, Pan TWIST is a bHLH transcription factor, overexpression et al. 2009, Pettersson et al. 2010, 2011). We hypothesized could have similar effects to silencing where homodimers that TWIST proteins play a similar role in skeletal muscle. have opposing effects to those mediated by heterodimers To this end, we induced overexpression of TWIST1 or (Firulli et al. 2007, Connerney et al. 2008). Thus, the effects TWIST2 in tibialis anterior muscle of C57BL/6J mice and of TWIST proteins on cytokine expression appear to cultured mouse C2C12 skeletal muscle myoblast cells. have a U-shaped curve with both extremes triggering a We also determined the effects of obesity, T2D, and pro-inflammatory response. exercise training on mRNA levels of TWIST1 and We attempted to quantitate media appearance of TWIST2 in skeletal muscle from different cohorts. Taken IL-6 and TNFa secretion in C2C12 myoblasts, but these Journal of Endocrinology together, while our data support a role for TWIST proteins were below the assay detection limit. Secretion of TNFa in metabolic processes, TWIST1 or TWIST2 levels in and IL6 in C2C12 myoblasts has previously been reported skeletal muscle are not altered in metabolic disease. to be close to the detection limit (Chen et al. 2007)or We determined the effect of TWIST1 or TWIST2 only detectable after 10 ng/ml epinephrine stimulation overexpression in intact mouse muscle and C2C12 (Frost et al. 2004). While media content of IL1b was myoblasts. As revealed by RT-PCR, TWIST1 overexpression detectable, no significant difference was noted in the in differentiated muscle increased the expression of expression of this cytokine following overexpression Pax7, a gene involved in early-stage differentiation and of either TWIST1 or TWIST2. Whether the increased mRNA an inducer of MyoD transcription (Hu et al. 2008). In levels of these cytokines following overexpression of line with the increase in Pax7, MyoD mRNA expression Z ABCTwist1 Twist2 TWIST1TWIST2 TWIST1 displayed a similar trend (P 0.07). Nevertheless, TWIST1 1.5 1.5 1.5

is a known inhibitor of MYOD transactivation (Hamamori 1.0 1.0 1.0 ) ) ) P=0.08 DDCt DDCt et al. 1997) and its overexpression is likely to block any DDCt (2 (2 0.5 0.5 (2 0.5 possible effect of an increase in MYOD. Furthermore, 0.0 0.0 0.0 Relative mRNA expression Relative Relative mRNA expression Relative Relative mRNA expression Relative mRNA levels of Myogenin revealed a similar trend to MyoD. Control ob/ob Control ob/ob Pre-Post- Pre- Post- NGT T2D Exercise training Interestingly, these three mRNA levels were not altered in skeletal muscle following TWIST2 overexpression, Figure 5 highlighting a speciﬁc difference in gene regulation bet- TWIST1 and TWIST2 mRNA expression in obesity, T2D, or following exercise ween TWIST1 and TWIST2. The noted changes in mRNA training. (A) TWIST1 and TWIST2 expression in ob/ob mice skeletal muscle levels of genes important for differentiation in TWIST1- (nZ10). (B) TWIST1 expression in human vastus lateralis muscle from NGT and T2D subjects. (C) TWIST1 and TWIST2 expression in human vastus overexpressing skeletal muscle could be due to an lateralis muscle of healthy subjects before and after 3 weeks of endurance increase in cells (re)-entering cell-cycle as a compensation training (nZ13). Results are meanGS.E.M. of fold of control.

either TWIST1 or TWIST2 would modulate the secretion et al.2006), two energy-demanding processes. Thus, of differentiated or TNFa-stimulated cells remains to be overexpression of TWIST1 in skeletal muscle reduces determined. In a previous study in adipocytes, TWIST1 glycogen content, while glucose uptake and glycogen affected MCP1 but not IL6 secretion following stimulation synthesis appear unaffected. As fatty acid oxidation is also with TNFa (Pettersson et al. 2011). unchanged, glycogen stores may be utilized for energy- Whole-body-targeted ablation of Twist2 in mouse dependent processes partly induced by AKT activation. models decreases glycogen stores (Sosic et al. 2003). These results underpin a role of TWIST in facilitation of However, using electroporation-mediated gene transfer, glucose utilization, which is a key feature in cancer we note that overexpression of TWIST2 depleted muscle development (Warburg 1956). glycogen content. These results, although paradoxical, are We also determined whether TWIST expression in consistent with the hypothesis that TWIST has analogous skeletal muscle is altered due to obesity, T2D, or exercise effects when ablated or overexpressed. Despite reduced training. While TWIST1 has been previously reported to glycogen stores in muscle overexpressing Twist, glucose be undetectable in skeletal muscle (Pettersson et al. 2010), uptake was unaltered. Based on this observation, we our analysis in human as well as mouse skeletal muscles hypothesized that the glucose flux into the cell may be indicates that there is a consistent and detectable amount shifted toward the Krebs cycle. Thus, we determined Pdk4 of the transcript, which is in agreement with other expression because this enzyme is the master regulator of available expression data (Roth et al. 2006, Hagg et al. pyruvate dehydrogenase in skeletal muscle (Sugden & 2009). Nevertheless, skeletal muscle TWIST mRNA levels Holness 2006). The reduced Pdk4 mRNA expression noted were unaltered by obesity in ob/ob mice, as well as in following TWIST overexpression is consistent with an patients with T2D or after exercise training in healthy activation of pyruvate dehydrogenase and increased people. Thus, alterations in TWIST expression in skeletal glucose flux into the Krebs cycle, rather than glycogen muscle do not account for changes in insulin sensitivity synthesis. Our results are further supported by a reduction in obesity, T2D, or exercise training. in the total and active (nonphosphorylated) GS in TWIST1 has been implicated in the regulation of IL6 TWIST1-overexpressing skeletal muscle. Whether glyco- in adipose tissue. As skeletal muscle is also a source of gen phosphorylase or de-branching enzyme activity IL6 (Steensberg et al. 2000), we reasoned that TWIST1 may was altered in TWIST-overexpressing muscle was not impact IL6 expression in skeletal muscle. ob/ob mice assessed in the current study; however, neither basal present an extreme obesity phenotype and have higher Journal of Endocrinology nor insulin-stimulated glycogen synthesis was altered in circulatory levels of IL6 (Harkins et al. 2004). However, as TWIST-overexpressing myoblasts. Taken together, our noted above, if anything, Twist1 expression tended to be data suggest that overexpression of TWIST1 or TWIST2 reduced in skeletal muscle from obese mice, consistent results in an increased rate of glycogen utilization. with data associating a reduced Twist1 expression with Overexpression of TWIST1 or TWIST2 in intact mouse an increased Il6 expression in adipose tissue (Pettersson muscle resulted in a reduced ACC protein content, which et al. 2011). Furthermore, an endurance exercise bout is could indicate a decreased fatty acid synthesis capacity. associated with acute IL6 production (Drenth et al. 1995). Furthermore, the total level of the phosphorylated form While TWIST1 and TWIST2 mRNA levels were unaltered of ACC was unchanged, leading to a larger ratio of following exercise training, the biopsy was obtained inactivated ACC. In cultured C2C12 cells overexpressing 48 h after the last bout of exercise, when the plasma TWIST1 or TWIST2, fatty acid oxidation in vitro was IL6 concentration returns to baseline level (Ostrowski unchanged. Thus if glucose utilization is increased while et al. 1998). Whether exercise training leads to an acute fatty acid oxidation is unaffected, total energy probably and transient change in TWIST expression remains to increased. This for example could be reflected by an be determined. Taken together, the data presented in this increase in inflammation, as suggested by the increase in study provide evidence that IL6 expression in skeletal inflammatory cytokine transcripts. Cell growth is also muscle is regulated via TWIST1 and TWIST2, but whether an energy-requiring process in which a role for TWIST acute changes in IL6 expression are dependent on TWIST proteins has been implicated (Shiota et al. 2008, Isenmann is currently not known. et al. 2009). In line with this, AKT Ser473 phosphorylation In summary, we show that overexpression of TWIST1 was increased in TWIST1 or TWIST2-overexpressing or TWIST2 in skeletal muscle increases inflammatory gene muscles 2 h after a glucose challenge. Activation of AKT expression, reduces glycogen content, promotes glucose is closely linked to cell growth and cell survival (Jacinto utilization and cell growth pathways while reducing cell

capacity for fatty acid synthesis but not for fatty acid Dobrian AD 2012 A tale with a Twist: a developmental gene with potential oxidation. Skeletal muscle expression of TWIST was relevance for metabolic dysfunction and inflammation in adipose tissue. Frontiers in Endocrinology 3 108. (doi:10.3389/fendo.2012.00108) unaffected by altered metabolic contexts, such as obesity, Drenth JP, Van Uum SH, Van Deuren M, Pesman GJ, Van der Ven- T2D, or exercise training. Thus, while TWIST proteins are Jongekrijg J & Van der Meer JW 1995 Endurance run increases ex vivo a b important for skeletal muscle development and alter circulating IL-6 and IL-1ra but downregulates TNF- and IL-1 production. Journal of Applied Physiology 79 1497–1503. glucose utilization and glycogen stores in differentiated Firulli BA, Redick BA, Conway SJ & Firulli AB 2007 Mutations within helix I mature muscle, our data indicate that TWIST expression in of Twist1 result in distinct limb defects and variation of DNA binding affinities. Journal of Biological Chemistry 282 27536–27546. skeletal muscle is not altered with metabolic disease, (doi:10.1074/jbc.M702613200) underlining that the role of TWIST is differentiation, Frost RA, Nystrom GJ & Lang CH 2004 Epinephrine stimulates IL-6 tissue, and context dependent. expression in skeletal muscle and C2C12 myoblasts: role of c-Jun NH2-terminal kinase and histone deacetylase activity. American Journal of Physiology. Endocrinology and Metabolism 286 E809–E817. (doi:10.1152/ajpendo.00560.2003) Declaration of interest Hagg S, Skogsberg J, Lundstrom J, Noori P, Nilsson R, Zhong H, Maleki S, The authors declare that there is no conflict of interest that could be Shang MM, Brinne B, Bradshaw M et al. 2009 Multi-organ expression perceived as prejudicing the impartiality of the research reported. profiling uncovers a gene module in coronary artery disease involving transendothelial migration of leukocytes and LIM domain binding 2: the Stockholm Atherosclerosis Gene Expression (STAGE) study. PLoS Genetics 5 e1000754. (doi:10.1371/journal.pgen.1000754) Funding Hamamori Y, Wu HY, Sartorelli V & Kedes L 1997 The basic domain of The work presented in this paper was supported by the Swedish Institute, myogenic basic helix–loop–helix (bHLH) proteins is the novel target for the Swedish Research Council, the European Foundation for the Study of direct inhibition by another bHLH protein, Twist. Molecular and Cellular Diabetes, Swedish Diabetes Association, Novo Nordisk Research Foun- Biology 17 6563–6573. dation, Johan and Jakob So¨ derbergs Foundation, Diabetes Wellness Harkins JM, Moustaid-Moussa N, Chung YJ, Penner KM, Pestka JJ, North CM Foundation, Stockholm County Council, the Diabetes Research Program & Claycombe KJ 2004 Expression of interleukin-6 is greater in pre- at Karolinska Institute, and the Swedish Society of Medicine. adipocytes than in adipocytes of 3T3-L1 cells and C57BL/6J and ob/ob mice. Journal of Nutrition 134 2673–2677. Hebrok M, Fuchtbauer A & Fuchtbauer EM 1997 Repression of muscle- specific gene activation by the murine Twist protein. Experimental Cell Author contribution statement Research 232 295–303. (doi:10.1006/excr.1997.3541) J M M performed the experiments, analyzed and researched data, and Hjiantoniou E, Anayasa M, Nicolaou P, Bantounas I, Saito M, Iseki S, wrote the manuscript. F L M S and J M analyzed and researched data, Uney JB & Phylactou LA 2008 Twist induces reversal of myotube contributed to discussion, reviewed and edited the manuscript. A K formation. Differentiation 76 182–192. (doi:10.1111/j.1432-0436.2007. 00195.x) Journal of Endocrinology designed the study, analyzed data, contributed to discussion, wrote manuscript, and reviewed and edited the manuscript. Hosono S, Kajiyama H, Terauchi M, Shibata K, Ino K, Nawa A & Kikkawa F 2007 Expression of Twist increases the risk for recurrence and for poor survival in epithelial ovarian carcinoma patients. British Journal of Cancer 96 314–320. (doi:10.1038/sj.bjc.6603533) References Hu P, Geles KG, Paik JH, DePinho RA & Tjian R 2008 Codependent activators direct myoblast-specific MyoD transcription. Developmental Al-Khalili L, Chibalin AV, Kannisto K, Zhang BB, Permert J, Holman GD, Cell 15 534–546. (doi:10.1016/j.devcel.2008.08.018) Ehrenborg E, Ding VD, Zierath JR & Krook A 2003 Insulin action in Isenmann S, Arthur A, Zannettino AC, Turner JL, Shi S, Glackin CA & cultured human skeletal muscle cells during differentiation: assessment Gronthos S 2009 TWIST family of basic helix–loop–helix transcription of cell surface GLUT4 and GLUT1 content. Cellular and Molecular Life factors mediate human mesenchymal stem cell growth and commit- Sciences 60 991–998. (doi:10.1007/s00018-003-3001-3) ment. Stem Cells 27 2457–2468. (doi:10.1002/stem.181) Barres R, Yan J, Egan B, Treebak JT, Rasmussen M, Fritz T, Caidahl K, Jacinto E, Facchinetti V, Liu D, Soto N, Wei S, Jung SY, Huang Q, Qin J & Krook A, O’Gorman DJ & Zierath JR 2012 Acute exercise remodels Su B 2006 SIN1/MIP1 maintains rictor-mTOR complex integrity and promoter methylation in human skeletal muscle. Cell Metabolism 15 regulates Akt phosphorylation and substrate specificity. Cell 127 405–411. (doi:10.1016/j.cmet.2012.01.001) 125–137. (doi:10.1016/j.cell.2006.08.033) Castanon I, Von Stetina S, Kass J & Baylies MK 2001 Dimerization partners Kulkarni SS, Karlsson HK, Szekeres F, Chibalin AV, Krook A & Zierath JR determine the activity of the Twist bHLH protein during Drosophila 2011 Suppression of 5’-nucleotidase enzymes promotes AMP-activated mesoderm development. Development 128 3145–3159. protein kinase (AMPK) phosphorylation and metabolism in human and Chen SE, Jin B & Li YP 2007 TNF-a regulates myogenesis and muscle mouse skeletal muscle. Journal of Biological Chemistry 286 34567–34574. regeneration by activating p38 MAPK. American Journal of Physiology. (doi:10.1074/jbc.M111.268292) Cell Physiology 292 C1660–C1671. (doi:10.1152/ajpcell.00486.2006) Kulkarni SS, Salehzadeh F, Fritz T, Zierath JR, Krook A & Osler ME 2012 Connerney J, Andreeva V, Leshem Y, Mercado MA, Dowell K, Yang X, Mitochondrial regulators of fatty acid metabolism reflect metabolic Lindner V, Friesel RE & Spicer DB 2008 Twist1 homodimers enhance dysfunction in type 2 diabetes mellitus. Metabolism 61 175–185. FGF responsiveness of the cranial sutures and promote suture closure. (doi:10.1016/j.metabol.2011.06.014) Developmental Biology 318 323–334. (doi:10.1016/j.ydbio.2008.03.037) Laursen KB, Mielke E, Iannaccone P & Fuchtbauer EM 2007 Mechanism of Czepluch FS, Barres R, Caidahl K, Olieslagers S, Krook A, Rickenlund A, transcriptional activation by the proto-oncogene Twist1. Journal of Zierath JR & Waltenberger J 2011 Strenuous physical exercise adversely Biological Chemistry 282 34623–34633. (doi:10.1074/jbc.M707085200) affects monocyte chemotaxis. Thrombosis and Haemostasis 105 Maestro R, Dei Tos AP, Hamamori Y, Krasnokutsky S, Sartorelli V, Kedes L, 122–130. (doi:10.1160/TH10-06-0363) Doglioni C, Beach DH & Hannon GJ 1999 Twist is a potential oncogene

that inhibits apoptosis. Genes and Development 13 2207–2217. Shiota M, Izumi H, Onitsuka T, Miyamoto N, Kashiwagi E, Kidani A, (doi:10.1101/gad.13.17.2207) Yokomizo A, Naito S & Kohno K 2008 Twist promotes tumor cell Murakami M, Ohkuma M & Nakamura M 2008 Molecular mechanism of growth through YB-1 expression. Cancer Research 68 98–105. transforming growth factor-b-mediated inhibition of growth arrest (doi:10.1158/0008-5472.CAN-07-2981) and differentiation in a myoblast cell line. Development, Growth & Sosic D, Richardson JA, Yu K, Ornitz DM & Olson EN 2003 Twist regulates Differentiation 50 121–130. (doi:10.1111/j.1440-169X.2007.00982.x) cytokine gene expression through a negative feedback loop that Ostrowski K, Hermann C, Bangash A, Schjerling P, Nielsen JN & Pedersen BK represses NF-kB activity. Cell 112 169–180. (doi:10.1016/ 1998 A trauma-like elevation of plasma cytokines in humans in response S0092-8674(03)00002-3) to treadmill running. Journal of Physiology 513 889–894. (doi:10.1111/ Steensberg A, van Hall G, Osada T, Sacchetti M, Saltin B & Klarlund j.1469-7793.1998.889ba.x) Pedersen B 2000 Production of interleukin-6 in contracting human Ou DL, Chien HF, Chen CL, Lin TC & Lin LI 2008 Role of Twist in head and skeletal muscles can account for the exercise-induced increase in Anticancer Research neck carcinoma with lymph node metastasis. 28 plasma interleukin-6. Journal of Physiology 529 237–242. 1355–1359. (doi:10.1111/j.1469-7793.2000.00237.x) Pan D, Fujimoto M, Lopes A & Wang YX 2009 Twist-1 is a PPARd-inducible, Sugden MC & Holness MJ 2006 Mechanisms underlying regulation of negative-feedback regulator of PGC-1a in brown fat metabolism. Cell the expression and activities of the mammalian pyruvate dehydro- 137 73–86. (doi:10.1016/j.cell.2009.01.051) genase kinases. Archives of Physiology and Biochemistry 112 139–149. Pettersson AT, Laurencikiene J, Mejhert N, Naslund E, Bouloumie A, (doi:10.1080/13813450600935263) Dahlman I, Arner P & Ryden M 2010 A possible inﬂammatory role Thisse B, el Messal M & Perrin-Schmitt F 1987 The twist gene: isolation of a of twist1 in human white adipocytes. Diabetes 59 564–571. Drosophila zygotic gene necessary for the establishment of dorsoventral (doi:10.2337/db09-0997) pattern. Nucleic Acids Research 15 3439–3453. (doi:10.1093/nar/15.8. Pettersson AT, Mejhert N, Jernas M, Carlsson LM, Dahlman I, Laurencikiene J, Arner P & Ryden M 2011 Twist1 in human white 3439) adipose tissue and obesity. Journal of Clinical Endocrinology and Warburg O 1956 On the origin of cancer cells. Science 123 309–314. Metabolism 96 133–141. (doi:10.1210/jc.2010-0929) (doi:10.1126/science.123.3191.309) 2C Roth RB, Hevezi P, Lee J, Willhite D, Lechner SM, Foster AC & Zlotnik A Witczak CA, Fujii N, Hirshman MF & Goodyear LJ 2007 Ca /calmodulin- 2006 Gene expression analyses reveal molecular relationships among dependent protein kinase kinase-a regulates skeletal muscle glucose 20 regions of the human CNS. Neurogenetics 7 67–80. (doi:10.1007/ uptake independent of AMP-activated protein kinase and Akt s10048-006-0032-6) activation. Diabetes 56 1403–1409. (doi:10.2337/db06-1230) Rune A, Osler ME, Fritz T & Zierath JR 2009 Regulation of skeletal muscle Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, sucrose, non-fermenting 1/AMP-activated protein kinase-related kinase Savagner P, Gitelman I, Richardson A & Weinberg RA 2004 Twist, a (SNARK) by metabolic stress and diabetes. Diabetologia 52 2182–2189. master regulator of morphogenesis, plays an essential role in tumor (doi:10.1007/s00125-009-1465-x) metastasis. Cell 117 927–939. (doi:10.1016/j.cell.2004.06.006)

Received in ﬁnal form 18 December 2014 Accepted 23 December 2014 Journal of Endocrinology