Aryl Hydrocarbon Receptor-Mediated Regulation of Gene Expression During Cardiomyocyte Differentiation

Home , AHCTF1, ARID3A, ARID4A, ARNTL2, ASCL1, ASCL2

Aryl Hydrocarbon Receptor-Mediated Regulation of Gene Expression during Cardiomyocyte Differentiation

A dissertation submitted to the

Graduate School of the University of Cincinnati

in partial fulfillment of the

requirement for the degree of

DOCTORATE OF PHILOSOPHY (Ph.D.)

In the Department of Environmental Health of the College of Medicine

2015

Qin Wang

M.S., University of Cincinnati, 2015 M.S., Tsinghua University, 2008 B.S., Jilin University, 2005 B.A., Jilin University, 2005

Committee Chair: Alvaro Puga, Ph.D. Professor Department of Environmental Health University of Cincinnati

Committee: Dr. Susan Kasper Dr. Ying Xia Dr. Michael Borchers Dr. Peter Stambrook ABSTRACT

The focus of this dissertation is on the identification of novel cardiac specific genes regulated by the aryl hydrocarbon receptor (AHR) and the mechanisms through which TCDD exposure induces cardiotoxicity, primarily regarding the dual roles of the receptor in both regulating cardiomyocyte differentiation and in mediating TCDD-caused cardiotoxicity. The AHR is a ligand-activated transcription factor that belongs to the basic-region-helix-loop-helix PER/ARNT/SIM (bHLH-PAS) superfamily of transcription factors.

AHR has a wide range of ligands with the prototypical ligand being the persistent environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Exposure to TCDD causes toxicity in multiple organs and organisms including the heart that is primarily mediated through AHR. The binding of TCDD to AHR leads to the translocation of the receptor from the cytosol to the nucleus where the receptor heterodimerizes with Aryl Hydrocarbon Receptor Translocator (ARNT) and consequently binds as a heterodimer to DNA, resulting the regulation of expression for hundreds of downstream genes. A battery of genes that have been extensively studied function in the metabolism of xenobiotics, i.e. cytochrome

P450, family1 (Cyp1). Beyond the role in xenobiotic metabolism, the Ah receptor has an important role in basic physiologic processes such as cardiovascular development.

The goal of this dissertation is to characterize the developmental role of the receptor as well as the consequences of developmental exposure to TCDD during cardiomyocyte differentiation. Chapter I gives a brief background on the chemical properties and toxicology of TCDD with a focus on the cardiotoxicity.

The structure and molecular action of AHR as well as its role in cardiovascular development and homeostasis are described. In chapter II, we used next generation sequencing to analyze temporal trajectories of TCDD-dependent global gene expression in differentiating cells expressing the Ah receptor.

We found hundreds of genes deregulated by AHR/TCDD axis, including those that regulate multiple signaling pathways involved in cardiac and neural morphogenesis and differentiation. The deregulated genes also include dozens of genes encoding homeobox transcription factors and Polycomb and trithorax group proteins, which are essential regulators of cardiomyogenesis. In chapter III, we investigated

I whether these cardiac specific genes regulated by AHR had a developmental window of sensitivity to

TCDD exposure. Interestingly, we found that cardiomyocyte contractility was an AHR-dependent TCDD target solely during the early period of differentiation between days 0 and 3. Within the critical time window, TCDD disrupted the concerted expression of genes involved in the TGFβ/BMP2/4 and WNT signaling pathways, significantly suppressed the autocrine secretion of upstream regulators including

BMP4, WNT3a and WNT5a, and elevated the secretion of Activin A. TCDD treatment also causes mitochondrial dysfunction, including altered mitochondrial copy number, mitochondria ultrastructural stress, and damage. AHR activation by TCDD during early ES cell differentiation appears to disrupt the expression of signals critical to the ontogeny of cardiac mesoderm and causes the loss of contractility in the resulting cardiomyocyte lineage. The results presented throughout this work show the AHR functions related both to normal cardiomyocyte development and cardiac toxicological endpoints, and illustrate the ability of this important transcription factor to regulate the expression of a large number of genes in the context of cardiomyocyte differentiation.

III

ACKNOWLEDGEMENTS

My sincerest gratitude goes to my supervisor Dr. Alvaro Puga. I am truly grateful to him for the opportunity to study and work in his lab. He has taught me how to think scientifically, critically and independently. He believed in me all those years ago, and always encouraged me to grow as an independent scientist. He has given me tremendous freedom to conduct experiments and to try different ideas and projects. I am forever grateful for his patience and constant guidance over the whole term of my

Ph.D. studies. I would not be here if it wasn’t him.

I am indebted to all of the members of my dissertation committee including Drs. Ying Xia, Michael

Borchers, Susan Kasper, and Peter Stambrook. Every question they brought up in committee meetings was always inspirational to me. Their dedication, insight, criticisms and encouragement have greatly helped me on my road to a Ph.D. Many thanks also go to my Biostatistics supervisor Dr. Marepalli B.

Rao, for his encouragement and tireless assistance in statistical analysis of my research data.

I would like to extend thanks to the classmates and lab members who have helped me in countless ways over those years. Thank you to Dr. Chia-I Ko for both her friendship and willingness to help me in whenever I need her, from experimental techniques and discussions to career pathway suggestions. She is always there to share what she knows with me. Thanks to Vinicius Carreira for his assistance in pathological experiments. Thanks as well to Yunxia Fan, for her logistic assistance over those years, which helped my research keep going smoothly. Many thanks go to Andrew Vonhandorf and Matthew

De Gannes for both their friendship and critical reading of this dissertation. I would also like to thank previous lab members including Ying Wang, Drs. Jerald Lee Ovesen, John Recheid, Hisaka Kurita and Francisco Sanchez-Martin, for their support and the wonderful moment when we worked together.

Many thanks are given to those collaborators who have contributed in obtaining data presented in this dissertation: Saikumar Karyala, Dr. Xiang Zhang for next generation sequencing experiments, Drs.

Mario Medvedovic and Jing Chen for their statistical analysis of the sequencing data.

I would like to acknowledge the contribution of all the faculty members and students in the

Department of Environmental Health. The stimulating and critical environment created by everybody is truly enjoyable to work here. Many thanks for their generous help and kindness.

Thank you to many of my friends, past and present, for their patience to listen to my complains, invaluable perspective, and pertinent suggestions during the hard times of my graduate studies. I really appreciate their accompany and the share of their life experiences.

My deepest gratitude goes to my parents and my sister, for their unconditional love and endless support. My parents made great efforts to give me and my sister good education. They always guide me whenever I lose sight of the goal. When I lost faith and confidence in my ability to carry on, they did not.

They are the driving force for me to bravely keep going forward and pursue my career goals.

TABLE OF CONTENTS

ABSTRACT……………………………………………………………………………..………………….I

ACKNOWLEDGEMENTS………………………………………….……………………………………IV

TABLE OF CONTENTS………………...…………………………………………………………………1

ABBREVIATIONS……………………………………………………………………………………...…3

LIST OF FIGURES………………………………………………………………………………………...6

LIST OF TABLES………………………………………………………………………………………….8

CHAPTER I

Introduction

1.1 TCDD properties, creation, human exposure and pleiotropic toxicity………………………...……….9

1.2 The aryl hydrocarbon receptor signaling pathway…………………………………………..………..13

1.3 Physiological roles of AHR…………………………………………………………………………...15

1.4 The role of AHR in cardiovascular development and disease……………………………………...…19

1.5 Mouse embryonic stem cells and differentiation ………………………………………………..……20

1.6 Cardiomyocyte differentiation from mouse ESCs…………………………………………..……...…22

1.7 Purification and enrichment of ESC-derived cardiomyocytes………………………………………..23

1.8 Characteristics of cardiomyocytes derived from pluripotent ESCs………………………………...…24

1.9 ESCs as an in vitro model for toxicological studies…………………………………………….…….26

CHAPTER II

Disruption of Aryl Hydrocarbon Receptor Homeostatic Levels during Embryonic Stem Cell Differentiation Derails the Expression of Homeobox Transcription Factors that Control Cardiomyogenesis

Abstract……………………………………………………………………………………………………37

2.1 Introduction……………………………………………………...…………………………………….38

2.2 Materials and Methods……………………………………………………………………………..….40

2.3 Results…………………………………………………………………………………………………46

2.4 Discussion……………………………………………………………………………………………..51

2.5 Conclusions…………………...…………………………………………………………………….…55

CHAPTER III

Ah Receptor Activation by Dioxin Disrupts Activin, BMP, and WNT Signals during the Early Differentiation of Mouse Embryonic Stem Cells and Inhibits Cardiomyocyte Functions Abstract……………………………………………………………………………………………………69

3.1 Introduction……………………………………………………………………………………………70

3.2 Materials and Methods…………………………………………………...……………………………72

3.3 Results…………………………………………………………………………………………………76

3.4 Discussion………………………………………………………………………..……………………82

3.5 Conclusions………………………………………………………………………………………..…..85

CHAPTER IV

Conclusions and Perspectives 4.1 Summary of data……………………………………….………………………...……………………95

4.2 Future perspectives………………………………………………………………………………..…..97

REFERENCES………………………………………………………………………...…………………102

APPENDIX…………………………………………………...………………………………………….126

REFERENCES for APPENDIX…………………………………………………………………………195

ABBREVIATIONS

AHR – aryl hydrocarbon receptor

AHRE – Ah receptor response element

AIP – AHR interacting protein

ANP – atrial natriuretic protein

ARNT – AHR nuclear translocator bHLH – basic helix-loop-helix

BMP – bone morphogenetic protein bp – base pair

Ct – cycle threshold cTnT– cardiac Troponin-T

CVD – cardiovascular disease

CX– connexin

CYP – cytochrome P450

DMSO – dimethyl sulfoxide (Me2SO)

EB – embryoid body

ECVAM – European Center of the Validation of Alternative Methods

ED – embryonic day eGFP – enhanced green fluorescence protein

EPA– Environmental Protection Agency

ESC – embryonic stem cell

EST – embryonic stem cell test

EU – European Union

FACS – fluorescence-activated cell soring

FDR – false discovery rate

FGFR – fibroblast growth factor receptor

GD – gestation day

GEO – gene expression omnibus

GO – gene ontology

HIF1β – hypoxia-inducible factor 1β

HSP – heat shock protein

IARC – International Agency for Research on Cancer

ICM – inner cell mass

IHD – ischemic heart disease

IPCS– International Program of Chemical Safety kb – kilobase pair

LIF – leukemia inhibitory factor

MHC– myosin heavy chain

MLC – myosin light chain

NES – nuclear export signal

NFB – nuclear factor kappa B

NLS – nuclear localization signal

NTP – National Toxicology Program

PCB – polychlorinated biphenyl

PCDD – polychlorinated dibenzo-dioxin

PCDF – polychlorinated dibenzo-furan

PWM – position weight matrix

RNA-Seq – RNA sequencing

ROS – reactive oxygen species

RTK – receptor tyrosine kinase

RT-PCR – real-time reverse transcription polymerase chain reaction shRNA– short-hairpin RNA

STAT – signal transducer and activator of transcription

TAD – transactivation domain

TCDD – 2,3,7,8 tetrachlorodibenzo-p-dioxin

TE – trophectoderm

TF – transcription factor

TGFβ – transforming growth factor β

TMF– 6,2,4-trimethoxyflavone

TSS– transcription start site

VEGF – vascular endothelial growth factor

WNT – wingless-type MMTV integration site

LIST OF FIGURES

Figure 1.1 Structures of PCDDs, PCDFs, PCBs, and TCDD………………………………………...29

Figure 1.2 Protein structure of mouse AHR………………………………………………….………30

Figure 1.3 Key events of AHR signaling pathway……………………………………………..…….31

Figure 1.4 Cardiomyocyte differentiation from ESCs………………………………………………..32

Figure 2.1 Detection of AHR in EBs…………………………………………………………..……..56

Figure 2.2 Effect of TCDD treatment, AHR knockdown and AHR antagonists on cardiomyocyte contractility……………………………………………………………………………….57

Figure 2.3 Cardiac marker expression in beating and non-beating differentiated ES cells…………..58

Figure 2.4 Characterization of AHR-positive cardiomyocytes……………………………………….59

Figure 2.5 The GO terms with top 100 z-scores were hierarchically clustered using the GENE-E algorithm………………………………………………………..………………………..61

Figure 2.6 RNA-Seq expression changes of the 100 homeobox transcription factors associated with cardiovascular development deregulated by the AHR/TCDD axis…………………...…62

Figure 2.7 Time-dependent expression changes of PcG and TxG genes deregulated by the AHR/TCDD axis…………………………………………..……………………………..63

Figure 2.8 Functional analyses of gene expression changes induced by TCDD in AHR-positive cardiomyocytes………………………...…………………………………………………64

Figure 3.1 Determination of a window of susceptibility to TCDD-mediated loss of cardiomyocyte contractility……………………………………………………………………………….86

Figure 3.2 z-Scores of upstream transcriptional regulators’ changes induced by TCDD in EBs on day 5 of differentiation…………………………………………………………………….….87

Figure 3.3 Clustering of the expression of genes involved in TGFβ/BMP4 and WNT signaling pathways…………………………………………………………...……………………..88

Figure 3.4 Activin A effect on Ahr+/+ cardiomyocyte contractility…………………………..……….89

Figure 3.5 BMP4 effect on Ahr+/+ cardiomyocyte contractility……………………………..………..90

Figure 3.6 Effect of WNT3a and WNT5a on Ahr+/+ cardiomyocyte contractility………………...….91

Figure 3.7 TCDD treatment disrupts mitochondrial structure and abundance…………………….....93

Figure 4.1 ESC differentiation trajectory into cardiomyocyte and impact of TCDD……..…….….100

LIST OF TABLES

Table 1.1 Major TCDD toxic effects in multiple species…………………………………………….33

Table 1.2 Summary of differential AHR expression during developmental period ED4 to ED10 in mice...………………………………………………………………………………………34

Table 2.1 Primer sequences and product size for qPCR analysis of mRNA expression of the indicated genes…………………………………………………………………………………….…65

Table 2.2 Predicted activation state of upstream transcriptional regulators in TCDD-treated AHR- positive differentiating ES cells…………………………………………...……………….66

APPENDIX

Table A1 Cardiac Marker Genes Affected in Their Expression by TCDD Treatment of Differentiating Mouse ES Cells………………………………………………………………………...…126

Table A2 z-Scores of Top 100 GO Terms AHR-Positive vs Unselected Cells……………….…….129

Table A3 z-Scores of Top 100 GO Terms AHR-Positive 48 h TCDD vs Control Cells………...….139

Table A4 Expression levels of transcription factors that show differential expression between TCDD- treated AHR-positive cells and controls…………………………………………...……..152

Table A5 Expression levels of transcription factors that regulate cardiomyocyte differentiation in TCDD-treated AHR-positive cells relative to controls………………………………...…180

Table A6 Summary of PcG and TxG genes affected in their expression by TCDD treatment in AHR- positive cells……………………………………….……………………………………..184

Table A7 Expression levels of genes involved in TGFβ/BMP signal pathways in Day-1 and Day-3 Ahr+/+ EBs treated by TCDD relative to controls…………………………………...……187

Table A8 Expression levels of genes involved in WNT signal pathways in Day-1 and Day-3 Ahr+/+ EBs treated by TCDD relative to controls…………………………………………….….191

CHAPTER I Introduction

1.1 TCDD properties, creation, human exposure and pleiotropic toxicity.

The classification “dioxin” refers to a group of chlorinated organic chemicals that includes 135 polychlorinated dibenzo-furans (PCDFs), 12 polychlorinated biphenyls (PCBs) and 75 polychlorinated dibenzo-dioxins (PCDDs) (Mandal 2005; Environment Australia 1999). These agents share similar chemical structure (Figure 1.1) and possess common features such as aromaticity. PCBs encompass both planar and non-planar compounds consisting of two benzene rings. On the other hand, PCDDs and

PCDFs encompass only planar compounds, and consist of two benzene rings connected by a third oxygenated ring. From the structure point of view, the only difference between PCDD and PCDF is that the benzene rings of the former are connected by a pair of oxygen atoms, while the latter are bonded via a single oxygen atom (Figure 1.1) (U.S. EPA 2007). Except for the oxygen atoms, up to eight chlorine atoms can be attached to different carbon atoms to yield different forms of dioxins, also known as congeners. The positions of chlorine atoms and the level of the chlorination determine the toxicity of dioxins, varying from harmless to extremely toxic (Environment Australia 1999).

The most toxic and potent dioxin currently recognized is 2,3,7,8 tetrachlorodibenzo-p-dioxin (simply called TCDD, Figure 1.1), with four chlorine atoms substituted at positions 2, 3, 7 and 8 (Denison et al.

2002). TCDD is a highly thermal stable compound, with a melting point at 295 °C and decomposition points at 500 °C (Blümler 1999). TCDD is also kinetically stable, resistant to biodegradation. These features together with its chemically inert nature allow TCDD to persist in the environment for a long time after release (di Domenico et al. 1980; Cerlesi et al. 1989). TCDD is slow to evaporate and slightly soluble in water, but highly soluble in fatty substances (lipophilic) (Blümler 1999; U.S. EPA 2007). As

TCDD enters organisms, it adheres to and dissolves in fatty tissue where it bio-accumulates. The bioaccumulation of TCDD in fish and fish-eating birds has been reported (Frakes et al. 1993; Choi et al.

2001). The consumption of these organisms would then pass TCDD up to the food chain (U.S. EPA

2007).

TCDD is synthesized from both natural processes and anthropogenic activities. In nature, it is created as a by-product of incomplete combustion of organic materials. For example, forest fires or volcanic activities may generate TCDD (Pelclova et al. 2006; Blümler 1999). TCDD is also produced as an unwanted by-product of human activities particularly industrial processing. Examples include smelting, chlorine bleaching of paper pulp, herbicide and pesticide manufacturing and low temperature combustion.

Low temperature combustion occurs in municipal hospital and hazards waste incinerators, motor vehicles, wood burning process, tobacco smoking and compost heaps (U.S. EPA 2007). The release of TCDD directly follows its synthesis. For example, TCDD may be emitted from the stack emission of chemical waste combustion, from the exhaust of leaded gasoline-powered automobiles, from wood burning in the presence of chlorine, and from the usage of contaminated pesticide (IPCS 1989; U.S. EPA 2007). After emission into the environment, TCDD is deposited in the water or on the land. Depending on the size of the particle it adheres to, TCDD may be dispersed to varying distances from the emission sources. As a result of this compound’s multiple emission sources and chemical properties, TCDD has been detected virtually everywhere (Blümler 1999).

In humans, there are three ways of exposure to TCDD: background exposure, industrial accident and occupational exposure (IPCS 1989; U.S. EPA 2007). People worldwide are exposed to background levels of TCDD from multiple sources that include air, water, soil and the commercial food supply (U.S. EPA

2007). Dairy products, meat, and fish are specific examples of food products containing small amounts of

TCDD (Svensson et al. 1991; Bocio and Domingo 2005; Chan et al. 2013). According to studies conducted by U.S. Environmental Protection Agency (EPA), background exposure corresponds to approximately 95 % of average human exposure, demonstrated by the concentrations of dioxin-like compound in human tissues (U.S. EPA 2007). These studies showed that tissue levels of dioxin increase with age suggesting bioaccumulation. The trend appears fairly uniform geographically, racially, and sexually (U.S. EPA 2007). Higher levels of human exposure to TCDD have been observed in multiple situations including industrial accidents, chlorophenol/phenoxy herbicide production plants, and the use of Agent Orange during the Vietnam War. A tragic example is an accident occurred in a chemical plant

10 near the town of Seveso, Italy in 1976. The explosion resulted in the release of 1-5 kg of TCDD into the environment, resulting in elevated levels of exposure to a large population in the surrounding regions

(Signorini et al. 2000; Mocarelli 2001). Workers in chlorophenol/phenoxy herbicide chemical plants are exposed to high levels of TCDD due to the synthesis of TCDD as a byproduct (Kelada 1990; Ryan and

Norstrom 1991; Hu et al. 2013). Military personnel were exposed to TCDD because of the heavy use of

TCDD-contaminated defoliant Agent Orange during the Vietnam War (Gough 1991; Dwyer and Flesch-

Janys 1995). TCDD is extensively distributed throughout the body upon exposure followed by primary deposition at liver and adipose tissues (IPCS 1989, U.S. EPA 2007). The metabolism of this chemical is extremely slow with a half-life of 7 to 12 years, resulting in the persistence of TCDD within human tissues, particularly fatty tissues, for extended periods of time (IPCS 1989). The prevalence of daily exposure combined with the chemical’s persistence in the human body has characterized TCDD as a compound that poses potential risks to humans.

The potentially adverse effects to the general public may result from chronic exposure to low levels of TCDD. The concentration within the body gradually accumulates due to daily intake and absorption followed by accumulation and is commonly referred to as body burden: the total amount of dioxin uptake present in the body at any one time (IPCS 1989; U.S. EPA 2007). TCDD concentrations in human fat throughout the world are estimated to be in the range of 5 to 15 parts per trillion, or 2 pg/g body fat

(Steenland et al. 2004; Pelclova et al. 2006). With respect to both source elimination and emission control, evidence shows decreased temporal trends in human TCDD body burden over three decades (Aylward and Hays 2002; U.S. EPA 2007). The immediate effects of TCDD body burden to the general population are not directly observable and remain controversial due to its ubiquitous presence in the environment. By comparing the effects produced by dioxin body burdens in experimental animals to those in humans,

DeVito et al. (1995) suggested that some individuals may respond to dioxin exposure with cancer and non-cancer effects at a concentration within one to two orders of magnitude of the body burdens in the general populations (DeVito et al. 1995).

TCDD was classified as a “human carcinogen” by the National Toxicology Program (NTP) and the

International Agency for Research on Cancer (IARC) in 1997, based on limited evidence in humans and sufficient research conducted in experimental animals (1997; Steenland et al. 2004). In addition, extensive mechanistic investigations suggest that TCDD acts through the transcription factor aryl hydrocarbon receptor (AHR), which is present in both humans and animals (Steenland et al. 2004). The most unusual aspect of TCDD’s toxicity is that it affects multiple organs (Pelclova et al. 2006; Denison et al. 2011). The effects vary greatly and depend on several factors including cell type, tissue, age, sex, species, dose, timing as well as duration of exposure (Mandal 2005). Table 1.1 (Denison et al. 2011;

Pohjanvirta 2011) summarizes almost all the TCDD toxic effects observed in both humans and experimental animal models. There are some points that need to be clarified when discussing TCDD toxicity. First, evidence of its toxic effects in humans mainly comes from studies of high-level, acute human exposure that were discussed previously. The estimated exposures within these groups vary widely, but are significantly higher than current background level, often by as much as 1000-fold (Pelclova et al.

2006). Second, the sensitivity to TCDD toxicity varies greatly among species and therefore the doses used for animal studies are various among different experiments. Finally, an array of evidence tends to suggest that the adverse effects of chronic exposure to dioxins are similar to those following acute exposure in both human and animal studies (Public Health England 2008).

Work in many laboratories has shown that the young are more sensitive to dioxin than adults and that developmental exposure to TCDD results in disease conditions in adult fish (Plavicki et al. 2013), birds (Walker and Catron 2000) and mammals (Kopf and Walker 2009). Bruner-Tran and Osteen (2011) reported that dioxin exposure reduced fertility and negatively affected pregnancy outcomes across multiple generations in mice. The developmental toxicity of TCDD is of greater concern to humans because pregnant women transfer a fraction of their dioxin body burden to the fetus during pregnancy as well as postnatally via breastfeeding (Schecter et al. 2001). Breastfeeding is a major route of dioxin and

PCB exposures for infants with concentrations being up to 50-fold higher than those in formula-fed

12 counterparts (Patandin et al. 1999). In addition, dioxin-like organochlorinated compounds are epidemiologically associated with low birth weight and respiratory distress (Lai et al. 2002) as well as cardiac malformations (Dummer et al. 2003). In their study, Dummer et al. (2003) reported that infants born to mothers living near incinerators emitting complex mixtures of dioxins, furans, particulates and heavy metals exhibited a higher incidence of lethal congenital heart diseases (Dummer et al. 2003). Other studies have shown an epidemiological association between the incidence of hypoplastic left heart syndrome and maternal exposure to halogenated hydrocarbons, dioxins, and PCBs during pregnancy

(Kuehl and Loffredo 2006).

1.2 The aryl hydrocarbon receptor signaling pathway.

TCDD is the prototypical ligand for AHR, a ligand-activated transcription factor and a member of the basic-region-helix-loop-helix PER/ARNT/SIM (bHLH-PAS) superfamily (Hahn 2002; Kewley et al.

2004). The human AHR gene encodes a protein of 848 amino acids and the murine ortholog encodes a protein of 805 amino acids (Abel and Haarmann-Stemmann 2010). Figure 1.2 shows a schematic structure of murine AHR protein. At the N-terminal end, the bHLH domain consists of conserved amino acids that form two amphipathic α-helices separated by a relatively non conserved loop and an adjacent region of basic amino acids (Abel and Haarmann-Stemmann 2010). The bHLH domain is responsible for

DNA binding and protein dimerization (Gu et al. 2000). The PAS domain is immediately adjacent to the bHLH domain, comprised of two subdomains PAS-A and PAS-B (Gu, Hogenesch and Bradfield 2000).

The PAS domain serves as a docking site for protein-protein interactions and ligand binding (Schmidt and

Bradfield 1996). There is an N-terminal nuclear localization signal (NLS) and a nuclear export signal

(NES) in the PAS domain (Ikuta et al. 1998). At the C-terminus, the AHR carries a large glutamine-rich transactivation domain (TAD). TAD is indispensable for target gene activation because it interacts with several transcription co-activators (Rowlands et al. 1996).

Most biological effects of TCDD are mediated by AHR. AHR is absolutely required for the adverse outcomes of TCDD exposure that have been discussed in the previous section. At the heart of these toxicological effects is the AHR signal transduction pathway (Figure 1.3). In the absence of ligand, AHR exists as a cytosolic protein in a complex containing two molecules of the 90 kD heat shock protein

(hsp90), one molecule of the hsp90-associated co-chaperone p23 and one molecule of the immunuophilin homolog hepatitis B virus X-associated protein XAP2 (also termed AIP (AHR interacting protein) or

ARA9 (AHR associated protein 9)) (Denis et al. 1988; Nair et al. 1996; Ma and Whitlock 1997;

Beischlag et al. 2008). Within the AHR complex, hsp90 binds to both the ligand-binding (PAS) domain and the bHLH DNA-binding domain of the receptor (Perdew and Bradfield 1996). The hsp90 binding assists in proper folding and enhances the stability of the receptor (Antonsson et al. 1995). The binding of hsp90 also masks the NLS of AHR (Fujii-Kuriyama and Kawajiri 2010). It is essential to retain AHR in the cytosol. The receptor is further stabilized through the association of XAP2 protein. The binding of

XAP2 prevents dynamic nucleocytoplasmic shuttling of the receptor in the absence of an activating ligand

(Pollenz et al. 2006). Little is known about the significance of ligand-independent AHR shuttling. One hypothesis is that the AHR may have some functions in the nucleus through interactions with other proteins in a ligand-independent way (Ramadoss and Perdew 2005). TCDD binding causes the entire

AHR complex to translocate into the nucleus where the receptor dissociates from its cytosolic complex and heterodimerizes with its partner AHR Nuclear Translocator (ARNT, also termed HIF1β), also a member of the bHLH/PAS superfamily (Reyes et al. 1992). The AHR-ARNT heterodimer binds to the

AHR (or dioxin) response element (AHRE) core consensus 5’-T/NGCGTG-3’ located in the promoters of

AHR target genes (such as xenobiotic metabolizing enzyme CYP1A1 and other AHR-dependent responsive genes) (Denison et al. 1988; Swanson et al. 1995). The binding of the AHR:ARNT heterodimer to AHRE locus results in DNA bending, transcription coactivator and associated chromatin remodeling proteins recruitment, and initiation of gene transcription (Schnekenburger et al. 2007;

Beischlag et al. 2008). Increasing evidence indicates that in addition to the well-known xenobiotic metabolism genes in the Cyp1 family of cytochromes P450, there are other AHR transcriptional targets,

14 including genes involved in cell cycle regulation and morphogenetic processes, which may play a vital function during embryonic development (Sartor et al. 2009).

1.3 Physiological roles of AHR.

A general hypothesis has been proposed that the diverse tissue/organ-specific, TCDD-mediated toxicities reported in humans and animals is due to persistent and inappropriate AHR activation, thereby preventing the receptor from performing physiologic functions and maintaining cellular homeostasis (Bock and

Kohle 2006; White and Birnbaum 2009). Thus, the toxicological profile of TCDD as discussed above may hint to the nature of AHR’s physiological functions. Other evidence for the physiological functions of the receptor comes from studies on homologs in invertebrates and vertebrates species. Particularly, the physiological defects observed in AHR null mice provide direct evidence for the physiological roles of the receptor.

The AHR is highly conserved in phylogeny from invertebrates to vertebrates, demonstrating that

AHR may be involved in the regulation of certain xenobiotic-independent functions and physiological processes (Hahn 2002). The invertebrate AHR homologs were found in nematode Caenorhabditis elegans

(Powell-Coffman et al. 1998), fly Drosophila melanogaster (Duncan et al. 1998), chordate Ciona intestinalis (Dehal et al. 2002) and mollusks (Butler et al. 2001; Hahn et al. 2006). The C.elegans orthologs of AHR and ARNT are encoded by the ahr-1 (aryl hydrocarbon receptor-related) and aha-1

(ahr-1 associated) genes, respectively (Powell-Coffman, Bradfield and Wood 1998). The two proteins interact with each other to form a complex that binds to specific DNA fragments containing AHRE (5’-

KNGCGTG) (Powell-Coffman, Bradfield and Wood 1998). AHR-1 can bind to hsp90, but does not bind to the XAP2 chaperone (Bell and Poland 2000). TCDD is not a ligand of AHR-1, and the nuclear translocation of the receptor does not require an exogenous ligand (Powell-Coffman, Bradfield and Wood

1998). AHR-1 is predominantly expressed in neurons (Huang et al. 2004). Mutations of this gene result in defective neuronal development in C. elegans, and deficiency of this gene induced specific defects in

15 neuronal differentiation such as aberrant cell migration and axon branching, suggesting AHR homolog in

C.elegans function as a regulator in differentiation (Qin and Powell-Coffman 2004). In the fruit fly

D.melanogaster, the homologs of mammalian AHR and ARNT are encoded by the spineless and tango genes, respectively (Sonnenfeld et al. 1997; Duncan, Burgess and Duncan 1998). Like the case in

C.elegans, the fly Spineless protein does not bind to TCDD (Butler et al. 2001). The Spineless and Tango proteins interact with each other and bind to specific DNA elements (Emmons et al. 1999) without the requirement of AHR ligands (Emmons et al. 2007). Spineless is involved in neurite morphogenesis (Kim et al. 2006). Gene targeting of the Spineless resulted in the inappropriate arrangement of antennae and legs, suggesting that spineless is involved in antennae and leg development (Emmons et al. 1999).

Together, these studies show that AHR plays an important physiological role during invertebrate development. Interestingly, a common feature in these invertebrate models is AHR’s involvement in neuronal differentiation and functions (Barouki et al. 2007).

In fish, there are at least two AHR genes denoted as AHR1 and AHR2 (Hahn et al. 1997; Hahn

2002). The two forms of AHR may be the result of a gene duplication event during early vertebrate evolution, suggested by the phylogenetic comparisons (Hahn 2002). AHR1 and AHR2 share 40% amino acid identity overall. Linkage group mapping demonstrated that AHR1 is the ortholog of the human AHR

(Hahn 2001; Andreasen et al. 2002). As suggested by both cloning studies and expression analysis,

AHR2 seems to be the predominant form of AHR in fish (Hahn 2002). Both of the receptors share common features specific to mammalian AHR including dioxin binding, interaction with ARNT and

XAP2, AHRE binding, and transcriptional activation of target genes (Roy and Wirgin 1997; Abnet et al.

1999; Karchner et al. 1999; Hahn 2002). However, the two AHRs expressed in fish have distinct features as well. For example, AHR1 differs from AHR2 in tissue-specific expression. Furthermore, AHR1 lacks high-affinity binding of TCDD and a functional transactivation domain, suggesting that AHR1 may have different functions compared with AHR2 (Andreasen et al. 2002).

The study of avian AHR is an active field investigating the dramatic differences among species of birds in their sensitivity to dioxins and PCBs (Brunstrom 1986; Brunstrom 1988; Brunstrom and Lund

1988). At a molecular level, the differences in sensitivity among species can be explained by variability in the TCDD-binding affinity among the respective AHRs (Brunstrom 1986; Brunstrom and Lund 1988;

Kennedy et al. 1996; Lorenzen et al. 1997). As an example, domestic chickens (Gallus gallus) are extremely sensitive to dioxin exposure, while the common terns (Sterna hirundo), an aquatic bird highly exposed to dioxin, are up to 250-fold less sensitive to dioxin (Walker et al. 1997; Walker and Catron

2000; Bruggeman et al. 2003; Karchner et al. 2006). Biochemical studies of the chicken AHR confirmed its high TCDD-binding affinity, supporting the positive association between sensitivity and ligand- binding affinity (Denison et al. 1986; Sanderson and Bellward 1995). Certain avian populations such as piscivorous species can be highly exposed to dioxin-like compounds, providing an environmental rationale for studying their AHR pathways (Giesy et al. 1994; Hahn 2002). In the lower Great Lakes,

TCDD exposure-induced adverse effects include embryo and hatchling mortality, teratogenicity, reduced growth, edema, alternations in thyroid function and hepatic retinoid levels, hepatic porphyria, and the induction of hepatic xenobiotic metabolizing enzymes such as CYP1A1 and associated monooxygenase activities (Hoffman et al. 1987; Kubiak et al. 1989; Janz and Bellward 1996)

In mammals, especially mice, the physiological roles of AHR and its expression during embryonic development have been well documented. The timing and pattern of AHR expression within the developing embryo help to estimate the physiological roles of AHR during development. In studies conducted by Abbott et al. (1995) and Kitajima et al. (2004), mouse uteri were collected daily from GD 4 to GD10 to examine the spatial and temporal expression of the receptor by immunohistochemistry

(Abbott et al. 1995; Kitajima et al. 2004). Their results are summarized in Table 1.2. After GD 10, there is a widespread expansion of AHR into almost all developing organs including brain, heart, liver and somites (Furness and Whelan 2009).

Developmental roles of AHR have been elucidated through various developmental defects observed in AHR null mice. In the 1990s, three different laboratories independently established AHR knockout mice, by either deleting exon 1 (Fernandez-Salguero et al. 1995; Mimura et al. 1997) or exon 2 (Schmidt et al. 1996) of the receptor. Deletion of either exon completely destroyed the reading frame of AHR and negated the expression of the receptor despite the existence of the Ahr alleles in the genome. At the mRNA level, Ahr was not present in the knockout mice from Frank Gonzalez’s laboratory while a predicted size of mRNA was present in the mice of Christopher Bradfield’s laboratory (Lahvis and

Bradfield 1998). The central role of the receptor in mediating the adverse effects of TCDD was be able to be confirmed by those AHR null mice. Evidence includes (1) loss of acute TCDD toxicity (Fernandez-

Salguero et al. 1996); (2) lack of TCDD-induced teratogenic effects such as cleft palate and hydronephrosis (Mimura et al. 1997); (3) loss of BaP-induced carcinogenicity (Shimizu et al. 2000).

AHR knockout mice showed little defects on viability. However these mice exhibited decreased fertility, lower weight and decreased weight gain compared to wild-type controls (Schmidt et al. 1996).

Furthermore, they display abnormal functions in multiple organs/systems including the liver, spleen, vascular system, heart, and reproductive system. Different mouse strains had varied phenotypes. The reasons for the variations include different timing of the observations, different targeting strategies and distinct genetic backgrounds (Lahvis and Bradfield 1998). Both AHR knockout strains showed smaller livers and the persistence of a fetal vascular shunt known as the ductus venuosus (Fernandez-Salguero et al. 1996; Schmidt et al. 1996; Lahvis et al. 2005). The patent ductus venuosus is believed to be a secondary effect resulting from an absolute requirement for AHR in early liver vascular development

(Harstad et al. 2006). Compromised blood perfusion, regional hepatic necrosis, and ultimately liver deformation may be secondary to a common AHR-related defect in early vascular development (Harstad et al. 2006). Both strains showed minor effects in the spleen. Reduced spenic B-lymphocyte numbers were only observed in the mice from Frank Gonzalez’s laboratory (Fernandez-Salguero et al. 1995).

Persistence of fetal vascular structures, including partially penetrant hyaloid artery, altered kidney

18 vasculature and fully penetrant ductus venosus, were reported by Christopher Bradfield’s laboratory

(Lahvis et al. 2000). AHR null mice also exhibit cardiac hypertrophy and fibrosis, characterized by ventricular wall thickening and expression of cardiac hypertrophy markers such as β-MHC, MLC-2V and

ANF (Thackaberry et al. 2002). Characterization of the enlarged heart showed that there is an increase in the size of cardiomyocytes and enhanced expression of vascular endothelial growth factor (VEGF)

(Vasquez et al. 2003). Further investigation showed that the cardiac hypertrophy was associated with high systemic arterial blood pressure as well as increased levels of circulating angiotensin II and plasma endothelin-1 (ET-1) (Lund et al. 2003). In the reproductive system, the AHR appears to play a role in male prostate and seminal vesicle development (Lin et al. 2002). In females, AHR knockout mice showed defective ovarian and uterine functions concomitant with poor reproductive success at a relative young age. The reduced fertility in females may result from the lack of AHR dependent CYP19A1 expression, a key enzyme in estrogen synthesis (Baba et al. 2005).

1.4 The role of AHR in cardiovascular development and disease.

The AHR is a major contributor to cardiovascular homeostasis in all species studied to date. The heart is a target of TCDD toxicity during fetal development in fish, avian embryos, and mice. In zebrafish (Danio rerio), the sensitivity to TCDD-caused toxicity decreases as they mature (Lanham et al. 2012). Heart malformation is an early response to TCDD in embryonic zebrafish (Antkiewicz et al. 2005). TCDD exposure during the first few days of development causes reduced heart size, weakened cardiac contraction, pericardial edema, loss of the epicardium and proepicardium development, decreased cardiomyocyte number, cardiac valve malformation, reduced cardiac ouput, altered looping, and ventricular standstill (Henry et al. 1997; Antkiewicz et al. 2005; Carney et al. 2006; Mehta et al. 2008;

Plavicki et al. 2013). In adult zebrafish, TCDD exposure inhibits ventricle regeneration (Hofsteen et al.

2013). The role of AHR in mediating TCDD-induced cardiotoxicity has also been demonstrated in avian species. Exposure to TCDD during early chick embryo development results in enlarged heart, dilated ventricle cavities, thinning of ventricular walls, ventricular septal defects, increased incidence of

19 arrhythmias, and reduced coronary artery number (Walker, Pollenz and Smith 1997; Walker and Catron

2000; Ivnitski-Steele et al. 2005; Sommer et al. 2005). AHR and ARNT expression during cardiogenesis is consistent with TCDD-induced heart defects (Walker, Pollenz and Smith 1997).

The mouse heart is also a target of TCDD during fetal development. In utero exposure of the developing mouse embryo results in altered fetal heart size and reduced cardiomyocyte proliferation

(Thackaberry et al. 2005). Combination of both in utero and lactional TCDD exposure induced cardiac hypertrophy (Thackaberry et al. 2005). Global gene changes conducted by microarray analysis showed that TCDD exposure significantly altered the expresssion of genes involved in xenobiotic metabolism, cardiac homeostasis, extracellular matrix production/remodelling, and cell cycle regulation (Thackaberry et al. 2005). Those gene expression changes induced by TCDD required the Ah receptor, as expression was not significantly altered in AHR knockout fetuses (Aragon et al. 2008). In utero exposure to TCDD increases the susceptibility to cardiovascular dysfunctions and diseases in adult life (Aragon et al. 2008).

In humans, epidemiologic studies conducted on occupational exposured workers in herbicide plants and Seveso victims have established a strong association between dioxin exposure and heart disease, reviewed in (Puga 2011). All these studies, from animal models to human epidemiology, showed that activation of the receptor by ligand or loss of the receptor by gene targeting resulted in cardiac disease conditions and disturbance of the caridac homeostatis. The dual role of the receptor during cardiogenesis is as a mediator of toxic response to TCDD exposure and the involvement of physiogical development of the heart (Puga 2011).

1.5 Mouse embryonic stem cells and differentiation.

Mouse embryonic stem cells (mESCs) are derived from the inner cell mass (ICM) of ED3.5 preimplanted mouse blastocysts (Evans and Kaufman 1981; Martin 1981). ESCs have two unique features: pluripotency and self-renewal. Pluripotency indicates the capacity a single cell has to give rise to derivatives of all three germ layers, namely mesoderm, endoderm and ectoderm. The three germ layers further develop into essentially every cell type of an embryo and adult (Solter 2006; Young 2011). Self-

20 renewal describes the ability of a cell to proliferate and maintain itself in the same state (Young 2011).

Cultured under proper conditions, ESCs can be maintained and expanded as an undifferentiated pure population for extended periods of time (Keller 2005). ESCs were first established and maintained by co- culturing with mouse embryonic feeder cells (Evans and Kaufman 1981; Martin 1981). Further studies identified that a key growth factor secreted by the feeder cells, namely leukemia inhibitory factor (LIF), plays a pivotal role in maintaining the stemness state of ESCs (Smith et al. 1988; Williams et al. 1988;

Stewart et al. 1992). The function of LIF is to support the self-renewal capabilities and to prevent differentiation of undifferentiated ESCs (Niwa 2007). LIF is a member of interleukin-6 cytokine family.

The binding of LIF to the heterodimeric receptor gp130/LIF-R (LIF receptor) leads to the activation of the cannonical JAK/STAT3 (Janus kinase signal transducer and activator of transcription) pathway (Yoshida et al. 1994; Niwa et al. 1998; Matsuda et al. 1999; Bourillot et al. 2009; Martello et al. 2013). STAT3 is the key mediator of LIF action in ESCs, and is essential and sufficient for maintaining the pluripotency of mESC (Matsuda et al. 1999). LIF is routinely used for in vitro culture of mESCs (Smith 2001).

In addition to LIF, other extrinsic regulators and signalling pathways also participate in the maintainance of pluripotency, such as trnasforming growth factor β (TGFβ), wingless-type MMTV integration sites (WNTs), and growth factors that signal through receptor tyrosine kinases (RTKs) (Pera and Tam 2010). Intrinsic factors that are involved in the control of pluripotency include core transcriptional regulatory circuitry (Chambers and Smith 2004; Boyer et al. 2006; Niwa 2007; Jaenisch and Young 2008; Silva and Smith 2008; Young 2011), epigenetic mechanisms (Boyer, Mathur and

Jaenisch 2006; Niwa 2007; Chambers and Tomlinson 2009; Young 2011), repression of the developmental regulators (Boyer, Mathur and Jaenisch 2006; Jaenisch and Young 2008), regulatory

RNAs (Jaenisch and Young 2008; Young 2011; Rosa and Brivanlou 2013) etc. These mechanisms have been extensively studied and are beyond the scope of this thesis, so they will not be introduced here in detail.

mESCs spontaneously differentiate once the factors maintaining pluripotency are removed. The common way adopted in cell culture is the removal of LIF from culture medium. Under appropriate

21 conditions, ESCs are capable of generating progeny consisting of derivatives of all three germ layers

(Keller 1995; Smith 2001; Keller 2005). Strategies for manipulating ESC differentiation are based on mimicing the in vivo mechanisms by which lineage decisions are made during early embryogenesis

(Loebel et al. 2003).

Three different methods have been developed and are widely used to initiate ESC differentiation

(Keller 2005; Murry and Keller 2008). (1) ESC are allowed to form three-dimensional embryo-like aggregates, known as embryoid bodies (EBs) (Doetschman et al. 1985; Keller 2005); (2) ESCs are co- cultured with supportive stromal layer and direct contact with those cells induces ESCs to differentiate

(Nakano et al. 1994); and (3) differentiation is induced by culturing ESCs as monolayers on extracellular matrix proteins (Nishikawa et al. 1998). All three approaches are effective and have specific advantages and disadvantages (Keller 2005) which need to be taken into account when selecting the appropriate model. Multistep strategies incorporating the addition of soluble factors (those which are known to influence lineage determination during embryogenesis) in culture medium, genetic modifications, coculture with other supportive/secretive cells or tissue, and selection for specific cell types by either flow cytometry or antibiotic resistant property have enabled the production of the desired lineage (Loebel et al.

2003). ESC differentiation by the EB system captures the in vivo development process, consisting of cellular phenotypes derived from the three germ layers which form a complex multicellular arrangement.

Within the EBs, multiple cell types have been identified including cardiomyocytes, skeletal, smooth muscle, neuronal, glial, endothelial, hematopoietic, and glandular cells among others (Hescheler et al.

1997).

1.6 Cardiomyocyte differentiation from mESCs.

Pluripotent mESCs have the capacity to differentiate into most cell lineages (Doetschman et al. 1985), including cardiomyocytes (Yamashita et al. 2005). The formation of the cardiac lineage in ESC differentiaiton cultures is readily identifiable by visual examination of contracting cells that characterize the nature of cardiomyocytes (Keller 2005). Cardiac differentiation from ESCs in vitro closely mimic

22 cardiac development in the embryo (Laflamme and Murry 2011) which is completed through multiple highly controlled steps. The current knowledge about how cardiomyocytes arise from ESCs through distinct stages is shown in Figure 1.4. The specification of the cardiomyocytes starts from a pluripotent state and follows a sequential transition through mesoderm, cardiac mesoderm, and cardiac progenitors to immature and mature cardiomyocytes. The result is a process that gradually restricts progenitor differential capabilities from pluripotent ESCs to cells committed to cardiac fate. The differentiation of cardiomyocytes requires the proper integration, both temporally and spatially, of multiple signaling pathways (Liu and Foley 2011). It also requires the sequential activation of multiple transcription factors, which form a large transcriptional network within the developing myocardium (Fishman and Chien 1997;

Hiroi et al. 2001; Plageman and Yutzey 2004; Watt et al. 2004; Bondue et al. 2008; Laflamme and Murry

2011; Rajala et al. 2011). The growth factors which determine cell fate choices are very helpful for directing the differentiation of ESCs and the surface markers are of great help for selecting cells at a specific stage (Laflamme and Murry 2011). Maturing cardiomyocytes derived from ESC, like the cardiomyocytes in the developing heart, are characterized by the expression of ion channels and cardiac structural proteins such as α-myosin heavy chain (α-MHC), β-myosin heavy chain (β-MHC), sarcomeric proteins like cardiac troponin-T (cTnT), connexins, and calcium handling proteins (Boheler et al. 2002;

Rajala, Pekkanen-Mattila and Aalto-Setala 2011). The ESC-derivied cardiomyocytes also undergo comparable mechanisms of excitation-contraction coupling and neurohormonal signaling (Laflamme and

Murry 2011).

1.7 Purification and enrichment of ESC-derived cardiomyocytes.

Pluripotent ESCs differentiate into a mixture of cell types in the EB formation system. Cardiomyocyte is one cell types among others within this mixture. To develop robust isolation techniques that enable the purification of cardiomyocytes and specific cardiac subtypes from a hetergeneous population is promising for clinical medicine (Rajala, Pekkanen-Mattila and Aalto-Setala 2011). A straightforward method to isolate the beating cardiomyocyte can be performed through the manual dissection of spontaneously

23 contracting cardiac cells under the microscope. The microdissected cells contain up to 70 % cardiomyocytes (Kehat et al. 2001; Mummery et al. 2003; Caspi et al. 2007). Hattori et al (2010) discovered that a fluorescent dye labeling mitochondria could be used to selectively mark pluripotent

ESCs derived cardiomyocytes and be subsequently enriched by fluorescence-activated cell sorting

(FACS). The puriy of this fraction is up to > 99 % (Hattori et al. 2010). Another non-genetic approach published by their group is based on the principle that cardiomyocytes are the only cell type able to survive in glucose-depleted and lactate-enriched culture medium while other ESC derivatives die due to their absolute dependence on glucose metabolism. The marked biochemical difference on glucose and lactate metabolism between cardiomyocytes and noncardiomyocytes enable the enrichment of up to 99 % purity for cardiomyocytes (Tohyama et al. 2013). ESCs are highly permissive to exogenous DNA.

Genetic manipulation combined with antibiotic selection techniques have also been developed (Sachinidis et al. 2003; Kumar et al. 2005; Rajala, Pekkanen-Mattila and Aalto-Setala 2011). A plasmid carrying a reporter gene, green fluorescence protein (GFP), and antibiotic resistance gene under the transcriptional control of a cardiac-specific promoter can be inserted into the genome of undifferentiated ESCs. Selection of cardiac cells based on activation of α-MHC (Klug et al. 1996; Anderson et al. 2007; Doss et al. 2007;

Xu et al. 2008) and MLC2v (Huber et al. 2007; Fu et al. 2010) promoters enriched the cardiomyocyte population by more than 90 % in terms of purity. Using a similar strategy, cardiac progenitors were also isolated. Wu et al. (2006) identified cardiac progenitors based on the promoter activity of homeobox TF

Nkx2-5, the earliest known marker of the cardiac lineages. These progenitors, isolated from both developing transgenic mouse embryos and differentiating ESCs, showed bipotential, the capacity for both cardiac and smooth muscle differentiation (Wu et al. 2006). Using the promoter of the secondary heart field marker Isl-1, Moretti et al. (2006) isolated cardiac progenitors from mouse embryos and differentiating ESCs. They demonstrated that these progenitors could give rise to cardiomyocytes, endothelial cells, and smooth muscle cells (tripotential) (Moretti et al. 2006).

1.8 Characteristics of cardiomyocytes derived from pluripotent ESCs.

A number of studies have investigated the property of ESC-derived cardiomyocytes based on the comparison of gene expression profiles as well as the structural, electrophysiological and pharmacological characteristics to adult cardiomyocytes (Rajala, Pekkanen-Mattila and Aalto-Setala

2011). ESC derived cardiomyocytes are similar to the adult cardiomyocytes. For example, at the gene expression level, both cell populations express cardiac transcription factors, structural proteins, hormones, ion-channels, and tight junction proteins during development. Developmentally controlled expression pattern of cardiac-specific transcription factors Nkx2-5, Gata4, Isl-1, Tbx-5, Tbx-20, and Mef2c always precede the expression of structural proteins including α-actinin, cTnT, MHCs, MLC-2a and MLC-2v, desmin, and gap junction proteins CX40 and CX43. The cardiac and muscle specific peptide ANP is present in both adult and pluripotent ESC derived cardiomyocytes (Laflamme and Murry 2011; Rajala et al. 2011).

At the ultrastructure level, pluripotent ESC-derived cardiomyocytes show similarity with the adult cardiomyocytes. Specifically, they exhibit sarcomeres with A, I, and Z bands as well as intercalated discs with gap junctions and desmosomes (Hescheler et al. 1997; Westfall et al. 1997). Undifferentiated ESCs do not generate action potentials and show no electrical activity (Hescheler et al. 1997).

Electrophysiological recordings performed in ESC-derived beating cardiomyocytes indicate that these cells perform in a physiologically similar manner to adult cardiomyocytes. ESC-derived cardiomyocytes in early stages of differentiation showed pacemaker-like action potentials, similar to the properies of embryonic cardiomyocytes (Maltsev et al. 1994; Westfall et al. 1997). As differentiation continues, a heterogeneous population of cardiomyocytes was found (Hescheler et al. 1997). Action potentials recorded at the terminal differentiation stage of cardiomyocytes demonstrated atrial-like, ventricle-like, and sinusnode-like potentials similar to those observed in the respective regions of the heart (Maltsev et al.

1993; Maltsev et al. 1994; Hescheler et al. 1997). ESC-derived cardiomyocytes express all major cardiac- specific ion channels and the pharmacological properties of the ionic currents in ESC-derived cardiomyocytes demonstrate similarities to those of adult-derived cardiomyocytes (Hescheler et al. 1997).

1.9 ESCs as an in vitro model for toxicological studies.

Toxicology has long been dependent on animal models in a tedious approach to investigate the potential risks of exposure to an uncharacterized molecule (Kolaja 2014). European Union (EU) legislations have required the use of in vitro tests for toxicological evaluations in order to increase the safety of consumers and patients while working to reduce the number of experimental animals (EU 1986; Vojnits and Bremer

2010). An alternative and promising approach to the future of in vitro studies in toxicological profiles is the use of ESC-derived tissues. Genetically, ESCs have normal diploid karyotype. Developmentally, they have unlimited proliferation ability which enables high-throughput assays and plasticity to generate all cell types of the mammalian organism (Stummann and Bremer 2012; Kolaja 2014). ESC-based systems are able to provide large numbers of cells for early efficacy and higher toxicity screening, allowing scientists to improve the selection of lead candidates and reduce the number of adverse outcomes in later stages of drug development (Davila et al. 2004). The in vitro differentiation of ESCs, to a large extent, mimics the in vivo development of the embryo, providing the scientific rationale for the use of these cells in establishing in vitro tests for teratogenicity and early embryo toxicity (Stummann and Bremer 2012).

At molecular level, the in vitro ESC differentiation capitulates the cellular developmental processes and gene expression patterns of early embryogenesis. In vitro differentiation of ESCs has been validated as a reliable system for developmental toxicology studies (Genschow et al. 2000; Rohwedel et al. 2001;

Spielmann et al. 2001; Davila et al. 2004). The validation study using pluriputent ESCs under differentiation conditions supports the idea that ESCs are a valuable tool for investigating the embryotoxic potential of environmental factors in vitro.

The embryonic stem cell test (EST) is an in vitro embryotoxicity assay that assesses the ability of chemical compounds to inhibit differentiation of ES cells into caridomyocytes as well as other properties.

The EST has been validated for in vitro embryotoxicity test in a study coordinated by the European

Center of the Validation of Alternative Methods (ECVAM) (Genschow et al. 2000). The use of EST enables the investigation of the potential teratogens and their ability to hinder normal differentiation along

26 with their cytotoxic effects (Scholz et al. 1999). The classical EST assesses three end points: (1) cytotoxic effects of the test substance on differentiated 3T3 fibroblasts, (2) cytotoxic effects of the test molecules on undifferentiated ES cells, and (3) the influence of test compounds on ESC-derived cardiac differentiation

(Scholz et al. 1999; Rohwedel et al. 2001). The embryotoxic potential of a given substance can then be evaluated by following a statistical analysis (Miller et al. 1994; Kuske et al. 2012). Efforts have been made to increase the predictivity of classical EST by extending the assessments to more endpoints.

Examples of improvements include the employment of toxicogenomic analysis to the standard cardiomyocyte differentiation protocol (Seiler et al. 2004; Hewitt et al. 2010; van Dartel et al. 2010;

Pennings et al. 2011) and adding more differentiated cell types (i.e endothelial cells or bone cells) to the assay (Festag et al. 2007; Buesen et al. 2009; zur Nieden et al. 2010). The EST has been developed from testing upon a single cell type into several cell types such as osteoblasts, hepatocytes and neurons (Barrier et al. 2012; Stummann and Bremer 2012; Kolaja 2014). When compared to in vivo studies, EST is highly accurate in predicting cellular toxicity and outperforms classical assays such as fetal limb micromass and postimplantation whole rat embryo cultures (Scholz et al. 1999). The screening for dermal, hepatic, cardiac, neuronal, genetic, and reproductive toxicity can be easily implemented in cell types derived from

ESCs at a large scale due to extensively characterized culture systems and their indefinite in vitro replication and proliferation ability (Davila et al. 2004). Excellent reviews can be found in references

(Rohwedel et al. 2001; Davila et al. 2004; Stummann and Bremer 2012; Kolaja 2014).

The goal of this dissertation is to characterize the developmental functions of the AHR, specifically cardiomyocyte differentiation, in order to address possible mechanisms by which the AHR regulates cardiomyocyte differentiaiton and mediates TCDD-induced cardiotoxicity. Specifically, the following chapters aim to characterize the developmental function of the AHR in cardiomyocyte differentiation through regulating the expression of genes involving in cardiomyogenesis and its interaction with cell signaling pathways that control cardiomyocyte differentiation. Chapter 2 explores the effects of disruption of the AHR homeostatic levels during mESC differentiation on the expression of homeobox transcription factors that control cardiomyocgenesis. Chapter 3 aims to explore the interaction between AHR and the

27 early Activin, BMP and WNT signals that are essential for cardiomyocyte differentiation, and the activation of the receptor caused mitochondrial dysfunction in cardiomyocytes. Chapter IV summarizes the results of present study and gives the fututure perspectives.

Chapter I Figures and Tables

PCDDs

PCDFs

PCBs

TCDD

Figure 1.1 Structures of polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs), polychlorinated biphenyls (PCBs), and 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD), a member of PCDDs group. Adopted from (Inui et al. 2014).

Figure 1.2 Protein structure of mouse AHR. The scheme was adapted from (Fukunaga et al. 1995).

Figure 1.3 Key events of AHR signaling transduction pathway, adopted from (Puga et al. 2005).

Figure 1.4 Cardiomyocyte differentiation from ESC, modified from (Laflamme and Murry 2011;

Rajala, Pekkanen-Mattila and Aalto-Setala 2011). The specification of the cardiomyocyte lineage involves a transition through a sequence of increasingly restricted progenitor cells, proceeding from pluripotent ESCs to mesoderm and to cells committed to cardiac fates. Growth factors that regulate cell fate choices are listed at branch points (blue). Antagonists for each growth factor are listed in black. Key cardiac TFs and surface markers for each cell state are listed under the corresponding cell types in purple.

BMPs, bone morphogenetic proteins; CX, connexin; HCN4, potassium/sodium hyperpolarization- activated cyclic nucleotide-gated channel 4; MESP, mesoderm posterior protein; MLC2a/v, myosin light chain 2a and/or 2v; MYH, myosin heavy chain; ANP (NPPA), natriuretic peptide precursor A; TBX, T- box transcription factor; WNT, wingless-type MMTV integration site.

Table 1.1 Major TCDD toxic effects in multiple species, adopted from Denison et al. 2011 and Pohjanvirta 2011. Impact Description of the Impact Target cell/ tissue, or mechanisms; species affected Acute lethality Pathogenesis not well understood; Guinea pig, rat, mouse Carcinogenesis Tumor promotion; Liver; Rat, mouse Cardiotoxicity Cardiovascular disease; hypertension; Cardiomyocytes; Rat atherosclerosis; ischemic heart disease; Dermal toxicity Chloracne; Keratinocytes and sebacdous glands; Human, monkey, rabbit, mouse Developmental Exposure during development Hard palate and Kidney; reproductive tissue and sexual Mouse, Rat; toxicity behavior; glutamatergic neurons and learning; molar teeth; monkey; heart; Diabetes Hyperinsulinemia and Insulin Resistance Human Endocrine disruption Testosterone, thyroxine, insulin, Impeded testicular biosynthesis; accelerated hepatic Rat, mouse corticosterone, ACTH, TSH, melatonin; metabolism; impaired pancreatic secretion diurnal phase- dependent modulation; accelerated extrahepatic metabolism; Hepatotoxicity Hyperplasia; hypertrophy; mitochondrial Hepatocytes and bile ducts; Mouse, rat, rabbit dysfunction; pro-apoptotic effects; anti- apoptotic effects; Immunotoxicity Thymic involution; immune suppression; B and T cells, NK cells, dendritic cells, Thymus atrophy; Mouse, rat thymocyte and T-cell apoptosis; splenic atrophy; Neurotoxicity Headaches, weakness, muscular pains and human peripheral neuropathy; Porphyria Inhibition of uroporphyrinogen decarboxylase; Mouse, rat, human Reproductive toxicity Testis lesions Spermatozoa, Leydig cells, Sertoli cells Rat, mouse, guinea pig, monkey Teratogenesis Cleft palate; hydronephrosis; mouse Wasting syndrom Significant reduction of body weight Central regulation of body weidght? Rat, guinea pig, mouse

Table 1.2 Summary of differential AHR expression during developmental period ED4 to ED10 in mice (Abbott, Birnbaum and Perdew 1995; Kitajima et al. 2004).

Timing Expression region ED4 Blood vessels of the stroma and smooth muscle cells ED5 Cytoplasm of uterine luminal epithelial cells surrounding the site of blastocyst implantation ED6 Transitional part of uterus from the luminal epithelial gland to the decidua ED7-8 Wall of dilated blood vessels in the outer primary decidualizing zone ED9-10 Wall of dilated blood vessels in the labyrinthine and peripheral regions of placenta ED9.5-10 Neuroepithelia, brain, hindbrain, branchial arches, large blood vessels

CHAPTER II

Disruption of Aryl Hydrocarbon Receptor Homeostatic Levels during Embryonic Stem

Cell Differentiation Derails the Expression of Homeobox Transcription Factors that

Control Cardiomyogenesis

Qin Wang, Jing Chen, Chia-I Ko, Yunxia Fan,

Vinicius Carreira, Yinglei Chen, Ying Xia, Mario Medvedovic and Alvaro Puga¶

Department of Environmental Health and Center for Environmental Genetics

University of Cincinnati College of Medicine

3223 Eden Avenue, Cincinnati, Ohio, 45267

¶To whom correspondence should be addressed

Phone: 513.558.0916 Fax: 513.558.0925 E-mail: [email protected]

Running Title: The AHR Regulates Cardiomyogenesis

Keywords: Aryl hydrocarbon receptor; Dioxin; Embryonic stem cells; Differentiation; Homeobox transcription factors; Polycomb Group: Trithorax Group; Cardiomyogenesis.

Article descriptor: Genetic regulation/Gene expression

Acknowledgments: We thank Miral Patel and Saikumar Karyala for their excellent help with RNA.seq.

We thank Drs. Andras Nagy and Marina Gertsenstein, Mount Sinai Hospital and Samuel Lunenfeld

Research Institute, Toronto, Canada for the C57BL/6N-C2 ES cells, and Drs. Agapios Sachinidis and

Michael Jesudoss, Institute of Neurophysiology, University of Cologne, Germany, for the PuroIRESeGFP vector for promoter sorting cell selection. We also thank Drs. Hisaka Kurita, Francisco-Javier Sánchez-

Martín and Jerry Ovesen for a critical reading of the manuscript. Genome-wide RNA.seq data has been submitted to the GEO database with access URL http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE47964

This research was supported by NIEHS grants R01 ES06273, R01 ES10807, the NIEHS Center for

Environmental Genetics grant P30 ES06096. V.C. was supported by NIEHS T32 ES016646 Gene-

Environment Interactions Training Grant. The authors declare that they have no competing financial interests.

Abstract

Aryl hydrocarbon receptor (AHR) is a ligand activated transcription factor that regulates the expression of xenobiotic detoxification genes and is a critical mediator of gene-environment interactions. Many AHR target genes identified by genome-wide gene expression profiling have morphogenetic functions, suggesting that AHR may play a role in embryonic development. To characterize the developmental functions of the AHR, we studied the consequences of AHR activation by the agonist TCDD, and the results of its repression by the antagonists 6,2,4-trimethoxyflavone (TMF) and CH223191 or by short- hairpin RNA (shRNA)-mediated Ahr knockdown during spontaneous differentiation of mESCs into cardiomyocytes. We generated an AHR-positive cardiomyocyte lineage differentiated from mESCs that expresses puromycin resistance and enhanced green fluorescent protein (eGFP) under the control of the

Cyp1a1 (cytochrome P450 1a1) promoter. We used RNA sequencing (RNA-Seq) to analyze temporal trajectories of TCDD-dependent global gene expression in these cells during differentiation. Activation, inhibition and knockdown of Ahr significantly inhibited the formation of contractile cardiomyocyte nodes.

Global expression analysis of AHR-positive cells showed that activation of the AHR/TCDD axis disrupts the concerted expression of genes that regulate multiple signaling pathways involved in cardiac and neural morphogenesis and differentiation, including dozens of genes encoding homeobox transcription factors and Polycomb and trithorax group proteins. Disruption of AHR expression levels results in gene expression changes that perturbed cardiomyocyte differentiation. The main function of the AHR during development appears to be the coordination of a complex regulatory network responsible for attainment and maintenance of cardiovascular homeostasis.

2.1 Introduction

The theory of the developmental origins of adult disease proposes that the environment encountered during fetal life and infancy permanently changes the body's structure, function, and metabolism and shapes the long-term control of tissue physiology and homeostasis (Barker 2007). Accordingly, damage during fetal life or infancy resulting from maternal stress, poor nutrition or exposure to environmental pollutants, such as dioxin, may be at the heart of adult onset disease. Work in many laboratories has shown that the young are more sensitive to dioxin than the adult and that exposure to TCDD, the prototypical dioxin, during development results in disease conditions in adult fish (Plavicki et al. 2013), birds (Walker and Catron 2000) and mammals (Kopf and Walker 2009). Bruner-Tran and Osteen (2011) reported that dioxin exposure reduced fertility and negatively affected pregnancy outcomes across multiple generations (Bruner-Tran and Osteen 2011). The developmental toxicity of TCDD is of greater concern for humans because pregnant women transfer a fraction of their dioxin body burden to the fetus during pregnancy and to the infant via breastfeeding (Schecter et al. 2001). In addition, dioxin-like organochlorinated compounds are epidemiologically associated with low birth weight and respiratory distress (Lai et al. 2002) as well as cardiac malformations (Dummer et al. 2003). In their study, Dummer et al. (2003) reported that infants born to mothers living near incinerators that emitted complex mixtures of dioxins, furans, particulates and heavy metals exhibited a higher incidence of lethal congenital heart diseases (Dummer, Dickinson and Parker 2003). Other studies have shown an epidemiological association between the incidence of hypoplastic left heart syndrome and maternal exposure to halogenated hydrocarbons, dioxins and PCBs during pregnancy (Kuehl and Loffredo 2006).

Most biological effects of TCDD are mediated by the AHR, a ligand activated transcription factor and a member of the basic-region-helix-loop-helix PER/ARNT/SIM (bHLH-PAS) superfamily of transcription factors. Members of this superfamily function as sensors of extracellular signals and environmental stresses that may affect growth and development (Gu et al. 2000). Activation by TCDD causes receptor translocation to the nucleus, dissociation from its cytosolic chaperones and heterodimerization with its AHR nuclear translocator (ARNT) partner, also a member of the bHLH/PAS

38 superfamily (Reyes et al. 1992). Binding of AHR-ARNT complexes to AHR binding sites in the promoters of target genes (a) recruits transcription cofactors and associated chromatin remodeling proteins and (b) signals initiation of gene transcription (Schnekenburger, Peng and Puga 2007). Increasing evidence indicates that in addition to the well-known xenobiotic metabolism genes in cytochrome P450, family 1 (Cyp1), there are other AHR transcriptional targets, including genes involved in cell cycle regulation and morphogenetic processes, that may play a vital function during embryonic development

(Sartor et al. 2009). In this context, following a complex alternating pattern of activation and repression in the preimplantation mouse embryo (Wu et al. 2002), AHR expression can be demonstrated in the postimplantation embryo as early as gestation day (GD) 9.5, followed by widespread expansion into almost all developing organs including brain, heart, liver, somites and branchial arches (Abbott et al. 1995).

The AHR is a major contributor to cardiovascular homeostasis in all species studied to date. In mice, fish and avian embryos, the heart is a TCDD target during fetal development, which results in reduced cardiomyocyte proliferation, altered fetal heart size and disruptions in neovascularization (Ivnitski-Steele and Walker 2005). In utero exposure to TCDD increases the susceptibility to cardiovascular dysfunction in adult life (Aragon et al. 2008). Consistent with the concept that the AHR is a major player in cardiac function, knockout of the Ahr gene in mice disrupts cardiovascular homeostasis, causing pathological cardiac hypertrophy (Lund et al. 2003).

To address the hypothesis that AHR activation by TCDD during embryonic development disrupts expression of genes critical to cardiac differentiation, we generated an AHR-positive embryonic stem cell lineage that expresses puromycin resistance and eGFP under the control of the AHR-responsive Cyp1a1 promoter. Activation of the AHR/TCDD axis in these cells disrupts the concerted expression of genes that regulate multiple signaling pathways involved in cardiac and neural morphogenesis and differentiation, including dozens of genes encoding homeobox transcription factors and Polycomb and trithorax group genes. Functional analysis of those genes suggests that homeostatic levels of AHR establish a complex regulatory network that controls various aspects of embryonic development, including cardiomyocyte differentiation.

2.2 Materials and Methods

2.2.1 Culture of embryonic stem cells and in vitro differentiation.

Undifferentiated C57BL/6N-C2 ES cells (Gertsenstein et al. 2010) were maintained in ES medium, consisting of high-glucose Dulbecco’s minimal essential medium (DMEM; Gibco; Carlsbad, CA) supplemented with 15% ES cell qualified serum (Knockout Serum Replacement; Gibco), 2 mM glutamine, 1% nonessential amino acids, 100 U/ml penicillin, 100 µg/mL streptomycin, 0.1 mM β- mercaptoethanol, and 1,000 U/mL ESGRO leukemia inhibitory factor (LIF, Bioscience Research

Reagents, Temecula, CA). Cells were seeded in 0.1% gelatin-coated plates at 37°C (95% humidity with 5%

CO2), and passaged every second or third day. Cell differentiation was initiated on day 0 by first forming

EBs in hanging drops. Cells were transferred to LIF-free DMEM supplemented with 15% non-ES qualified fetal bovine serum and suspended at a concentration of 40,000 - 70,000 cells/mL. Sixty 20-µL aliquots were pipetted onto the inner surface of a bacterial Petri dish lid and the lid was inverted over the bottom plate containing 15 mL phosphate-buffered saline (PBS) to provide humidity. Plates were incubated at 37°C for 3 days, after which the EBs were flushed with differentiation medium and incubated in 24-well or 10-cm plates for varying periods of time.

2.2.2 EB treatment.

Cultured EBs were treated for various lengths of time with TCDD at concentrations of 10 pM to 1 nM

(doses commonly used for tissue culture studies of the high-affinity AHR of C57BL/6 mice). TCDD was dissolved in DMSO and diluted in DMEM to reach the desired concentration. DMSO in DMEM served as the vehicle control. For both TCDD and vehicle control, the final concentration of DMSO was ≤ 0.05% of the final volume.

2.2.3 Cardiomyocyte contractility.

EBs were individually plated on wells of 24-well plates, allowed to differentiate in the presence of the indicated concentrations of TCDD or vehicle, and visually scored daily for the presence of beating cell

(cardiomyocyte) clusters. Beating became evident starting on days 6-7 and became maximal by days 10-

11. If a well had more than one beating cluster, it was scored as a single beating EB. Beating and non-

40 beating areas of differentiated EBs were manually dissected under a dissecting microscope. In some experiments, differentiating cells were treated with varying concentrations of the AHR antagonists 6,2,4- trimethoxyflavone (TMF, Indofine Chemical Co., Hillsborough, NJ), or CH223191 (Chembridge, San

Diego, CA) to study the role of AHR activation suppression in the beating phenotype.

2.2.4 Short-hairpin RNA (shRNA) knockdown of Ahr expression.

We purchased the validated lentiviral shRNA construct targeting Ahr transcripts TRCN0000055410 from the Mission ShRNA Lentiviral Collection (Sigma-Aldrich, St. Louis, MO) and a non-silencing control construct from the Lentivirus-shRNA Core of the Cincinnati Children’s Hospital Medical Center

(Cincinnati, OH). mESCs were infected with these viruses in the presence of 8 μg/mL polybrene and stable Ahr-knockdown ESCs were selected for resistance to 3 μg/mL of puromycin. The efficiency of knockdown was determined by immunoblotting.

2.2.5 Preparation of whole cell extracts for immunoblotting.

Cells were washed and harvested in PBS containing 1× complete protease inhibitor and lysed in 300 μL

NETN (100 mM NaCl, 20 mM Tris pH 8.0, 1 mM EDTA, 0.5% NP-40, and 1× complete protease inhibitor). After lysis, cells were sonicated on ice three times for 10 seconds each with a Fisher Scientific

Sonic Dismembrator 60. Protein concentrations were measured using the Pierce BCA protein assay

(Thermo Scientific, Florence, KY). Protein extract aliquots (50 μg) were analyzed by SDS- polyacrylamide gel electrophoresis, transferred to polyvinylidene fluoride membranes and probed for

AHR (Enzo Life Sciences Inc., Farmingdale, NY) and β-actin (Sigma-Aldrich).

2.2.6 Immunofluorescence.

For immunofluorescence studies, cells were seeded on 10-mm glass coverslips, fixed with 4% paraformaldehyde in PBS for 20 min, permeabilized with 0.1% triton X-100 for 20 min, blocked with 5% bovine serum albumin (BSA) for 0.5 hours, and incubated with first antibody at 4°C overnight. After washing, coverslips were stained with Alexa 488- or Alexa 567-labeled secondary antibodies and Hoechst solution. We examined the cells and captured the images using a Zeiss Axio microscope (Carl Zeiss

Microscopy, Thornwood, NY). At least five fields were evaluated for each treatment group.

For the analysis of AHR localization by immunofluorescence, 3-day-old EBs were collected by low- speed centrifugation, rinsed once with PBS; the pellet was fixed in 4% paraformaldehyde (Sigma-

Aldrich), and embedded in HistoGel (Thermo Scientific). Samples were then routinely processed for histopathology, that is, dehydrated, clarified, embedded in paraffin, and 5-μm sections prepared.

Deparaffinized and rehydrated sections were boiled in 10 mM citrate, pH 6.0, for 10 min and allowed to cool to room temperature. Sections were blocked in 5% BSA in PBS pH 7.4 for 30 min at room temperature. Blocked sections were incubated overnight with primary antibody at 4°C, washed 3 times with PBS, incubated for 1 hour at room temperature with the appropriate fluorescently-labeled secondary antibody (Invitrogen, Carlsbad, CA) diluted in 5% BSA in PBS, washed again, and a coverslip was affixed with DAPI-containing mounting medium. Micrographs were taken using a Zeiss Axio Scope.A1 microscope equipped with an AxioCam ICm1 and Zeiss Zen software (all from Carl Zeiss Microscopy).

For analysis, the following antibodies were used: GATA4 (Santa Cruz Biotechnology, Santa Cruz, CA), cardiomyocytes (MF20; Developmental Studies Hybridoma Bank at the University of Iowa, Iowa City,

IA), keratin-18 (Thermo Scientific), AHR (Enzo Life Sciences Inc.), cardiac troponin T (Thermo

Scientific), SHOX2 (Santa Cruz Biotechnology), and NKX2-5 (Santa Cruz Biotechnology).

2.2.7 Total RNA isolation, reverse transcription, and real-time reverse transcription polymerase chain reaction (RT-PCR).

Total RNA was extracted with the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s specifications. First-strand complementary DNAs (cDNAs) were synthesized from 10 μg of total RNA in a volume of 15 μL containing 1× reverse transcriptase buffer, 7 mM random hexamers primer, 0.5 mM dNTP mix, 10 mM dithiothreitol, 5 mM magnesium chloride, 20 U RNase inhibitor

(RNasin; Promega, Madison, WI), and 100 U SuperScript III reverse transcriptase (Invitrogen). Samples were denatured and annealed to the primer for 10 min at 70°C and reverse transcribed for 3 hr at 42°C.

Before amplification, the reverse transcriptase was inactivated by heating to 70°C for 15 min; RNA was hydrolyzed by incubation with 0.05 N sodium hydroxide at 70°C for 10 min and neutralized with 0.05 N hydrochloric acid (HCl); and the cDNA was precipitated with ethanol. The resulting cDNA products were

42 dissolved in a final volume of 200 μL, and a 2-μL aliquot was used as template for subsequent quantification by real-time PCR amplification. PCR reactions were conducted in duplicate or triplicate in a total volume of 25 μL containing SYBR Green PCR Master Mix (Applied Biosystems, Grand Island,

NY) and 0.1 μM of each primer. Primers for the genes tested [Ahr, Cx40 (connexin 40), Cyp1a1

(cytochrome P450 1A1), Ece1 (endothelin converting enzyme 1), Gata4 (GATA-binding protein 4),

Gata6 (GATA-binding protein 6), Hcn4 (hyperpolarization-activated, cyclic nucleotide-gated K+ 4), Kdr

(kinase insert domain protein receptor), Mef2c (myocyte enhancer factor 2C), Mlc2v (myosin, light polypeptide 2, regulatory, cardiac, slow), Myh6 (myosin, heavy polypeptide 6, cardiac muscle, alpha),

Myh7 (myosin, heavy polypeptide 7, cardiac muscle, beta), Nanog (Nanog homeobox), Nkx2-5 (NK2 homeobox 5), Nppa (natriuretic peptide type A; Anf ), Oct4 (POU domain, class 5, transcription factor 1;

Pou5f1), Pgp9.5 (ubiquitin carboxy-terminal hydrolase L1; Uchl1), Shox2 (short stature homeobox 2),

Tbx3 (T-box 3), and Tbx5 (T-box 5)] are shown in Table 2.1.

Amplification was performed in an ABI 7500 real-time PCR system (Applied Biosystems); the reaction was heated to 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing elongation at 60°C for 60 sec. Detection of the fluorescent product was carried out during the

72°C extension period, and emission data were quantified using threshold cycle (Ct) values. Ct values for all genes analyzed were determined in biological duplicates or triplicates, and means were determined from the average Ct values for each biological duplicate. All means were then normalized to values for

Gapdh mRNA. PCR product specificity from each primer pair was confirmed using melting curve analysis and subsequent polyacrylamide gel electrophoresis.

2.2.8 Selection of ESCs expressing AHR.

A 2-kb fragment of the mouse Cyp1a1 promoter bearing the AHR-responsive enhancer and proximal promoter domains was inserted upstream of the puromycin resistance-eGFP gene complex in the

PuroIRESeGFP vector for promoter sorting cell selection, a kind gift from A. Sachinidis and M. Jesudoss

(Institute of Neurophysiology, University of Cologne, Cologne, Germany). This construct was transfected into the C2 ESCs using lipofectamine (Invitrogen) and used to generate an immortalized mESC line

43 containing the stably integrated pAHRPuroIRESeGFP plasmid by selection with 600 μg/mL G418. Single colonies were picked up after selection and used for the analysis of AHR-dependent growth and differentiation by treatment with 100 pM TCDD for 4 hr, followed by removal of the drug and selection for 2–3 days in the presence of 3 μg/mL puromycin, during which time AHR-negative cells died because of their failure to activate the Cyp1a1 promoter. As determined by RNA-seq analyses, this low-dose, short

TCDD treatment was sufficient to activate the Cyp1a1 promoter but did not result in the induction or repression of any other genes.

2.2.9 RNA-Seq data analysis.

All steps of library construction, cluster generation, and HiSeq (Illumina, San Diego, CA) sequencing were performed with biological duplicate samples by the Genomics Sequencing Core of the Department of Environmental Health, University of Cincinnati. Library construction was done with the TruSeq RNA sample preparation kit (Illumina) using 1 μg of total RNA, with RNA integrity number ≥ 7.0 (Agilent

2100 Bioanalyzer; Agilent Technologies, Santa Clara, CA) to purify poly-A–containing mRNA with oligo-dT– attached magnetic beads. The purified mRNA was enzymatically fragmented, with random hexamers primed for first and second strand cDNA synthesis, followed by purification using Agencourt

AMPure XP beads (Beckman Coulter, Florence, KY). Overhangs in the double-strand cDNA were blunt- ended by end repair and adenylated with a single A-nucleotide at the 3´ end to prevent self-ligation in the following ligation step. AMPure XP bead-purified fragments were ligated to sample-specific indexing adapters and enriched by 10 cycles of PCR using adapter-specific primers. A 1-μL aliquot of purified

PCR product (from a total sequencing library of 30 μL) was analyzed in an Agilent bioanalyzer using a

DNA 1000 chip to check DNA size (~ 260 bp) and yield. To quantify the library concentration for clustering, the library was diluted 1:100 in a buffer containing 10 mM Tris-HCl, pH 8.0, and 0.05%

Tween 20, and analyzed by quantitative PCR (qPCR) with a KAPA Library Quantification kit

(KapaBiosystems, Woburn, MA) using an ABI 9700HT real-time PCR machine (Applied Biosystems).

Equal amounts of six individually indexed cDNA libraries were pooled for clustering in an Illumina cBot system flow cell at a concentration of 8 pM using Illumina’s TruSeq SR Cluster Kit v3, and sequenced for

50 cycles using a TruSeq SBS kit on the Illumina HiSeq system. Each sample generated approximately 30 million sequence reads.

Sequence reads were demultiplexed and exported to fastq files using CASAVA 1.8 software

(Illumina). The reads were then aligned to the reference genome (mm10) using TopHat aligner (Trapnell et al. 2009). The counts of reads aligning to each gene’s coding region were summarized using ShortRead

(Morgan et al. 2009) and associated Bioconductor packages (GenomicFeatures, IRanges, GenomicRanges,

Biostrings, Rsamtools; http://www.bioconductor.org/packages/ release/BiocViews.html#_Software) for manipulating and analysis of next-generation sequencing data and custom-written R programs (Ihaka and

Gentleman 1996). Differential gene expression analysis between AHR-positive and unselected cells was performed separately at each of the four different time points (day 5, day 8, day 11, and day 14). We performed statistical analysis to identify differentially expressed genes for each comparison using the negative-binomial model of read counts as implemented in the Biocondoctor DESeq package (Anders and

Huber 2010). The same analysis was performed to compare TCDD-treated to control-treated AHR- positive cells at the same time points.

We used differential expression p-values in LRpath (http://lrpath.ncibi.org/) gene set enrichment analyses (Sartor et al. 2009) to identify the top 100 Gene Ontology (GO)- affected categories in each group. These gene ontologies (The Gene Ontology; http:// www.geneontology.org/) were hierarchically clustered based on the LRpath enrichment z-score, with positive values denoting up-regulation and negative values denoting down-regulation. Clustering was performed using the GENE-E algorithm

(http://www. broadinstitute.org/cancer/software/GENE-E/). The gene expression data and results (Wang et al. 2013) have been deposited in the Gene Expression Omnibus (GEO) (Barrett et al. 2009) and can be accessed through Genomics Portals (http://GenomicsPortals.org) (Shinde et al. 2010) or the GEO.

To better understand our findings, we analyzed some RNA-seq data using Ingenuity Pathway

Analysis (IPA; Ingenuity® Systems, http://www.ingenuity.com).

2.2.10 Statistical Analysis.

Significant genes were selected by fdr- (false-discovery rate)-adjusted p-value<0.0001. Statistical comparisons were conducted with Student’s two-paired t test and ANOVA. Values of *p < 0.05, ** p <

0.01, and *** p < 0.001 were considered as statistically significant.

2.3 Results

2.3.1 The AHR is expressed in mesendoderm of ESC embryoid bodies.

AHR expression in the developing mouse embryo has been detected as early as GD 7.5 (Wang et al.

2013). By this time, AHR is already clearly expressed in all three embryonic germ layers (ectoderm, mesoderm and endoderm) and in the surrounding decidual cells. We examined AHR expression at earlier developmental times using pluripotent ESCs differentiated in vitro for which temporal expression patterns of markers of all three germ layers can readily be followed (Beddington and Robertson 1989). To assess

AHR expression, we used immunofluorescence of 3-day-old embryoid bodies (EBs) treated with TCDD or control vehicle. We observed that endodermal cells comprise the outer cell layers of the EB, as shown by the presence of the endodermal marker GATA4. The inner cell mass of the EB consists of mesodermal and ectodermal cells, as shown by positive immunofluorescence with MF20 and keratin-18 antibodies, respectively. Control and TCDD-treated EBs show colocalization of AHR with GATA4 and MF20, and to a much lesser extent with keratin-18 (Figure 2.1A), suggesting that mesoderm and endoderm are the earliest cell lineages to express AHR.

We observed no expression of Ahr mRNA in ESCs, but it was detectable in 2-day-old EBs; Ahr expression gradually increased to a maximum by 6 days of differentiation, and maintained a constant level for the next 8-9 days (Figure 2.1B). Expression of Cyp1a1 mRNA follows a similar pattern, gradually increasing until differentiation day 6, when it reaches a maximum, and then slowly decreasing to a minimum by day 12 and maintaining a similar level until day 15 (Figure 2.1B). Interestingly, Cyp1a1 expression is independent of treatment with an exogenous AHR ligand, suggesting that during this period of early development, the AHR transcriptional functions are ligand-independent or are regulated by an endogenous ligand. This finding is in good agreement with observations of constitutive Cyp1a1 expression during early embryonic development in the mouse (Campbell et al. 2005). As we expected,

46 expression of the pluripotency markers Oct4(Pou5f1) and Nanog declined gradually as the cells differentiate, down to their lowest level of expression on differentiation day 9 (Figure 2.1B).

2.3.2 AHR activation, knockdown, and inhibition all block cardiomyocyte lineage differentiation.

Pluripotent ES cells have the potential to generate most embryonic cell lineages (Doetschman et al.

1985), including cardiomyocytes (Yamashita et al. 2005). Differentiation of ES cells into cardiomyocytes can be traced microscopically by visual examination of differentiating EBs that spontaneously develop a contractile phenotype. Importantly, beating cardiomyocytes derived from ESC EBs function in all manner as cardiac cells, forming stable intracardiac grafts when injected into mice (Klug et al. 1996). Our previous work showed that treatment with 1 nM TCDD disrupted the beating phenotype (Wang et al.

2010). In the present study, we extended this observation by further characterizing the consequences of treatment with AHR antagonists or molecular inhibitors on cardiomyocyte development. Continuous exposure of differentiating cells to TCDD led to a dose- dependent inhibition of beating, which at 100 pM and 1 nM was significantly different from the control (Figure 2.2A). Knockdown of >80% AHR expression with a lentivirus expressing Ahr shRNA (Figure 2.2D), or treatment with the AHR antagonists

TMF or CH223191 also significantly decreased the number of beating EB-derived cultures (Figure 2.2 B and C) without affecting cell survival. These results are a good indication that endogenous AHR signaling underlies homeostasis in cardiomyocyte differentiation and function independently of the potential toxicity of its exogenous agonist. Because this critical role can be disrupted by the opposing effects of

AHR repression, inhibition or ligand-mediated activation, it is reasonable to conclude that the level of functional AHR during cardiomyogenesis is a critical determinant of differentiation. That is, too little or too much of this protein adversely affects mesodermal lineage differentiation programs.

2.3.3 TCDD treatment disrupts the gene expression trajectories of cardiac markers.

We previously observed that a 4-day treatment with TCDD after the completion of EB formation deregulated the expression of more than 50 homeobox genes, many by as much as 50- to 100-fold above or below control (Wang et al. 2010). To determine whether any of these changes were responsible for the effect of TCDD on the beating phenotype, we dissected beating and non-beating regions of differentiating

47 cultures treated with 1 nM TCDD or vehicle, and used qPCR to measure the gene expression levels of several markers relevant to cardiac function (Figure 2.3; Appendix Table A1). TCDD-treated cells that continued to beat showed no change in the expression of the markers tested relative to control vehicle.

However, TCDD treatment significantly repressed the expression of Nkx2-5, Shox2, Myh6, Myh7, Cx40,

Mlc2v, Hcn4 and Nppa in non-beating cells and induced Cyp1a1 expression in both beating and non- beating cells (Figure 2.3). Interestingly, expression of Pgp9.5, a neuroendocrine marker and component of the cardiac conduction system (El Sharaby et al. 2001), was repressed under all conditions tested, indicating that cell of ectoderm lineage are not present in the beating or non-beating nodes selected. These data suggest that TCDD inhibition of the beating phenotype is independent of its role in xenobiotic metabolism and likely to be the consequence of silencing the expression of genes critical for the contractile phenotype.

2.3.4 Gene ontology annotations of genes differentially expressed in AHR positive cardiomyocytes.

Two major caveats must be considered when interpreting the data described above in the context of

AHR-dependent gene expression. First, the differentiating cell population is a combination of cells of various lineages, where ≤ 30–40% of all cells are cardiomyocytes (Wang et al. 2010); second, not all cells in the population express AHR. To insure that we track only cells positive for a functional AHR, we established pAHRPuroIRESeGFP cell line, a stable ESC line that expresses the selection markers puromycin resistance and eGFP under control of the Cyp1a1 promoter, and therefore responds to TCDD treatment (Figure 2.4A). These cells were > 90% pure (Figure 2.4B) and did not over-express AHR relative to the parental ESCs (see Figure 2.4C), but expressed mesodermal markers characteristic of cardiomyocyte cells (Figure 2.4D).

We used global gene expression profiling at different times of differentiation to characterize the effect of TCDD-dependent AHR activation on gene expression in AHR-positive pAHRPuroIRESeGFP cardiomyocytes. Cells were allowed to differentiate for 2 days as hanging-drop EBs and then collected differentiated cells on days 5, 8, 11 and 14. To enrich for cells expressing AHR, we treated cells with 3

µg/ml puromycin for 3 days prior to collection in order to select for resistance. A population of

48 untransfected and unselected ESCs was grown and sampled in parallel. To analyze gene expression changes across time, we compare (1) AHR-positive cells with unselected cells, and (2) AHR-positive cells treated with 1 nM TCDD with vehicle-treated AHR-positive cells. In each comparison, several thousand genes had significant expression differences with false-discovery rate-adjusted p-value<0.0001.

We used these genes to identify the top 100 Gene Ontology (GO) affected categories in each group, which were hierarchically clustered by z-score using the GENE-E algorithm

(http://www.broadinstitute.org/cancer/software/GENE-E/) developed by the Broad Institute Cancer Group.

Relative to unselected cells, AHR-positive cells showed a time-dependent decrease of expression of GO categories involved in (a) cardiac differentiation and morphogenesis, (b) increasingly lower expression of categories involved in WNT (wingless-related MMTV integration site 3A) signaling and regulation of gastrulation, (c) gametogenesis, and (d) high levels of expression of genes involved in drug and xenobiotic metabolism (Figure 2.5A; Appendix Table A2). TCDD treatment of AHR-positive cells identified three clusters of GO categories (Figure 2.5B). Cluster A includes categories involved in WNT and BMP signaling, cell adhesion and organ morphogenesis that are highly induced by TCDD-driven

AHR activation at early time points but become repressed as differentiation proceeds. The opposite pattern is seen in cluster B, which includes genes involved in drug and xenobiotic metabolism. Cluster C includes genes with cardiac and neural differentiation functions, which are repressed by TCDD treatment

(Figure 2.5B; Appendix Table A3). Two prominent pathways appear to be targeted by early AHR functions: the regulation of gastrulation and WNT signaling during embryogenesis, both of which are disrupted by TCDD treatment at the earlier time points. Cardiac and neural differentiation, extracellular matrix formation and cell adhesion and migration are also early targets of TCDD in AHR positive cells.

These data clearly illustrate the intricacy of the AHR’s role during differentiation and the multiplicity of pathways triggered by TCDD-driven AHR activation responses.

2.3.5 The AHR/TCDD axis disrupts the expression of homeobox transcription factors and

Polycomb and trithorax group (PcG and TxG, respectively) genes.

Our RNA-seq results indicated that a few thousand genes, comprising a significant fraction of the genome, were responsive to AHR/TCDD-mediated regulation. The most reasonable explanation for this finding is that the AHR is a master upstream regulator that controls the expression of homeobox transcription factors, which are responsible for the regulation of developmental gene expression in a tissue- and time-dependent fashion (Moreland et al. 2009). In agreement with this hypothesis, we found that 729 transcription factors, most homeodomain factors, were differentially expressed in TCDD-treated

AHR-positive cells relative to control (see Appendix Table A4). From this group, 100 factors with p- value < 0.05 were specifically associated with cardiovascular development. To determine whether the

AHR binding motif was present in the promoters of the genes coding for these factors, we used the

TRANSFAC algorithm (Wingender 2008) to search for the presence of AHR position weight matrix

(PWM) motifs anywhere between -10,000 and +1,000 nucleotides from the transcription start site (TSS).

Approximately 50% of the genes with log2 fold change ≤ -0.5 or > 0.5 had at least one, but often more than one, AHR binding sites in this domain, whereas the other 50% did not. No significant difference was observed between these two groups in either the level or the timing of differential expression (Figure 2.6

A and B; Appendix Table A5).

PcG and TxG proteins constitute a group of critical regulators of epigenetic modifications affecting differentiation during development. They act coordinately or antagonistically to repress or promote transcription, respectively, throughout embryonic development (Schuettengruber et al. 2007). In agreement with the master regulatory role consistently shown by the AHR, our RNA-seq gene expression profiles detected the AHR/TCDD-dependent altered expression of 22 PcG and TxG genes in AHR positive cells (Figure 2.7; Appendix Table A6).

2.3.6 Functional analyses of gene expression changes resulting from activation of the AHR/TCDD axis.

To better understand the molecular and chemical interactions elicited by TCDD treatment and their phenotypic effects on AHR-positive cells, we input the RNA-Seq data for the 729 transcription factors into the Ingenuity Knowledge Base (IPA; Ingenuity®Systems, http://www.ingenuity.com) to analyze the

AHR/TCDD axis-driven effects on biological, canonical, and toxicological functions. The most significant change in biological functions took place in gene expression functions, as could be expected from the effects observed on homeobox transcription factors. Other biological changes affected several aspects of embryonic, cardiovascular system, and tissue development; morphology; cell growth; and cell proliferation. These changes were more significant at early stages of differentiation: in all cases, the – log(p-value) was in all cases greater at day 5 than at day 11 (Figure 2.7A). Several canonical functions were also significantly affected by TCDD treatment, including transcriptional regulation and various signaling pathways, such as WNT, TGFβ (transforming growth factor β), AHR, and cardiomyocyte differentiation via BMP receptors. As in the case of biological functions, these effects were more significant at early day 5 (Figure 2.8B). The toxicological functions significantly affected by TCDD comprised a variety of cardiac endpoints, including congenital heart anomalies, cardiac dysfunction and proliferation, valvular stenosis, hypertrophy and heart failure, as well as cardiac, liver and renal hypoplasia (Figure 2.8C). These analyses indicate only that the pathways or functions are affected, but do not provide the direction, activation, or inhibition of the effect. We searched the Ingenuity Knowledge

Base for upstream regulatory molecules of the transcription factors involved in these functions and found close to 200 such regulators, of which 18-20 had significant p-values. When these were ranked by z- score, two groups were evident (Table 2.2). One group comprised regulators that were predicted to be inhibited, including TGFβ, BMP2/4, WNT1/3A, FGFR2 (fibroblast growth factor receptor 2), NFκB

(nuclear factor kappa B), NKX2-5, Hedgehog, and a few others that regulate differentiation pathways.

The second group included regulators of pluripotency pathways were predicted to be activated, such as

SOX2 (SRY-box containing gene 2), NANOG, KLF4 (Kruppel-like factor 4), and OCT4. The overall effect of TCDD-driven AHR activation during the early stages of differentiation appears to be to maintain the pro-proliferative state of the ES cells and inhibit their differentiation.

2.4 Discussion

Our results show that AHR activation by TCDD during differentiation of AHR-positive ES cells suppresses the development of the contractile cardiomyocyte phenotype. Concomitantly, activation of the

AHR/TCDD axis disrupted the concerted expression of genes that regulate multiple differentiation pathways, including WNT and BMP; genes coding for developmental processes such as gametogenesis, cardiac and neural differentiation, extracellular matrix formation, and cell adhesion and migration; and genes encoding chromatin remodeling factors. Remarkably, a similar pattern of TCDD regulatory effects have been described in the regeneration of adult zebrafish hearts (Hofsteen et al. 2013). In the present study, the pattern of TCDD-induced regulatory effects seemed to be more pronounced in the early stages of development (i.e. during days 5 and 8 of ES cell differentiation), similar to the pattern reported in zebrafish (Lanham, Peterson and Heideman 2012), and was accompanied by parallel changes in the expression of genes encoding homeobox transcription factors and PcG and TxG proteins. Furthermore, when beating and non-beating cardiomyocytes were analyzed separately after TCDD treatment, beating cardiomyocytes retained the expression of the cardiac markers Nkx2-5, Shox2, Myh6, Myh7, Mlc2v, and

Cx40 regardless of treatment, whereas non-beating cells treated with TCDD did not express these markers.

These results strongly indicate a causal connection between AHR function, TCDD treatment and disruption of cardiomyocyte function. Moreover, because both AHR knockdown and its functional inhibition by antagonists suppress the beating phenotype just as efficiently as TCDD-dependent AHR activation, it is reasonable to conclude that too much or too little functional AHR is equally deleterious to cardiomyocyte function and that the amount of AHR protein itself is a determinant of cardiomyocyte homeostasis.

In addition to metabolic xenobiotic detoxification, the AHR plays an important role in maintenance of cellular homeostasis, often in the absence of a xenobiotic ligand (Bock and Kohle 2006). A physiological role for the receptor independent of xenobiotic ligand has been recognized in AHR null mice (Gonzalez and Fernandez-Salguero 1998), which show, among others, an impaired cardiovascular phenotype with retained fetal vascular structures in the liver and eye that fail to undergo apoptosis (Lahvis et al. 2005). Comparing gene expression profiles of AHR-positive and unselected cells allowed us to assess which developmental AHR functions may be independent of an exogenous ligand. Expression of genes controlling functions such as cardiac differentiation, regulation of WNT signaling, gametogenesis

52 and gastrulation were enriched in AHR-positive cells relative to unselected cells. In contrast, genes regulating extracellular matrix formation, cell adhesion and migration, neural differentiation, and chromatin remodeling were deregulated only after TCDD treatment of AHR-positive cells. These two groups of functions may respond to activation by endogenous and exogenous ligands, respectively, segregating physiological processes regulated by an endogenous ligand-activated AHR from toxicological or adaptive responses dependent on AHR activated by a xenobiotic ligand. In this context, it is significant that constitutive expression of Cyp1a1, a gene that is normally silent in the absence of ligand, is significantly derepressed during differentiation in the absence of TCDD, suggesting a response to either ligand-independent AHR activation or to activation by an endogenous ligand. Elevated constitutive

Cyp1a1 mRNA levels have also been found in vivo in studies of fertilized mouse ova, and were attributed to the need for catalytically active CYP1A1 that might ensure rapid metabolism of unwanted CYP1A1 substrates during critical moments of early development (Dey and Nebert 1998).

A major problem in the interpretation of data pertaining to individual regulatory networks in a mixed-lineage cell population, such as differentiating ES cells, is the lineage diversity. We adopted a promoter-mediated dominant selection system, previously established for the characterization of the cardiomyocyte transcriptome (Doss et al. 2007), in order to enrich for a population of AHR-positive cells.

These cells, when established as a continuously growing cell line, expressed mesodermal markers specific of the cardiomyocyte lineage. In cells treated with TCDD, global gene expression changes showed the disruption of developmental WNT and BMP signaling pathways. BMP and WNT signaling during pre- and post-implantation embryonic development and their role during cardiomyocyte differentiation have long been recognized (Wang and Dey 2006). In mice, cooperative control of SMAD and WNT signaling pathways activates multiple transcription factors including Gata4, Nkx2-5 and Mef2c, which control cardiac differentiation (Pal and Khanna 2006). Similarly, temporal modulation of canonical WNT signaling in human pluripotent stem cells results in robust cardiomyocyte differentiation (Lian et al.

2013). Importantly, extensive work in zebrafish has demonstrated the disruption of WNT signaling by

TCDD (Mathew et al. 2009; Lanham, Peterson and Heideman 2012; Hofsteen et al. 2013).

Homeodomain transcription factors specify the progression of tissue differentiation and embryonic identity during development (Wang et al. 2009). They encode transcription factors that control the expression of multiple developmental gene batteries. Disrupted expression or mutations in these genes result in severe to lethal outcomes for the organism (Wang and Dey 2006). In humans, mutations in 25 different homeobox transcription factors have been found in patients with congenital heart disease

(McCulley and Black 2012); expression of 14 of these, (Cited2, Ets1, Foxh1, Gata4, Gata6, Hand1,

Hand2, Hoxa1, Irx1, Nkx2-5, Nkx2-6, Pitx2 and Tbx1) was disrupted by TCDD in our mouse ES cell differentiation experiments. Two of these, Nkx2-5 and Gata4, play a central role in cardiac development.

Nkx2-5 is genetically upstream of multiple genes essential for heart development; 33 heterozygous loss- of-function mutations in this gene have been reported to cause heart malformations in humans, including conduction delay and atrial septal dysmorphogenesis (Biben et al. 2000). In mice, homozygous Nkx2-5 null embryos show arrested cardiac development after looping, poor development of blood vessels and disturbed expression of cardiac genes (Tanaka et al. 1999). Mutations in Gata4 have been associated with cardiac septal defects (Tomita-Mitchell et al. 2007). These transcription factors do not act alone; their cooperation and interdependent regulation is essential for cardiac development, such that disruption of the expression of any one gene leads to the imbalance of the overall transcriptional network. Nkx2-5 and

Gata4 are mutual cofactors for each other; their co-expression leads to synergistic, rather than additive activation of target genes (Riazi et al. 2009) and promotion of cardiomyocyte differentiation (Hiroi et al.

2001). Hence, disruption of homeobox gene expression, a downstream target of the AHR/TCDD axis, is potentially a major component of the inhibition of cardiomyocyte function by TCDD. Interestingly, more than 50% of the homeobox genes regulated by the AHR do not have canonical AHR response sites in their promoters, suggesting that their regulation by the AHR may result from a complex combinatorial network of regulatory interactions that reaches beyond direct AHR signaling. Some of these interactions are likely to include epigenetic modifications of histone marks because TCDD induces deregulation of

PcG and TxG genes.

2.5 Conclusions

Research of the present study add to the growing body of evidence in all experimental systems tested to date that the AHR is a major contributor to cardiovascular homeostasis. Changes in the homeostatic gene expression levels regulated by the AHR pathway disrupt cardiomyocyte differentiation, whether the

AHR is in increased (if further activated by TCDD) or decreased (if inhibited by antagonists or shRNA).

The significant role that the AHR plays in cardiovascular development makes the heart a most sensitive target of fetal environmental injury.

Chapter II Figures and Tables

AHR Marker Merge Merge + DAPI A

Figure 2.1 Detection of AHR in EBs. (A) Immunofluorescence detection of lineage markers [AHR, GATA4, MF20 (cardiomyocytes), and keratin-18] in 3-day-old EBs treated with TCDD (1 nM) or DMSO vehicle (≤0.05% in media). Columns 1 and 2 show immunofluorescence with AHR or the individual marker antibody, respectively; column 3 shows the merge of columns 1 and 2; and column 4 shows the merge of column 3 with DAPI nuclear stain. Magnification for (A) 20×; bars= 20 μm. (B) Expression pattern of Ahr, Cyp1a1, Oct4/Pou5f1, and Nanog in differentiating EBs presented as the ratio of Log2 qPCR mRNA level for each day of differentiation (normalized to Gapdh) to the corresponding level in ES cells (Differentiation day 0).

AHR

β-actin

Figure 2.2 Effect of TCDD treatment (A), AHR knockdown (B) and AHR antagonists (C) on cardiomyocyte contractility. Three-day-old EBs were allowed to differentiate and examined daily under the microscope for the presence of a rhythmic beating phenotype. (*) p<0.05; (**) p<0.01; (***) p<0.001.

(D) Stable integration of an Ahr ShRNA lentivirus inhibits AHR expression. ES cells were infected with a lentivirus control (ShCTRL) or a lentivirus expressing Ahr ShRNA (shAhr) and subjected to EB differentiation. Cell lysates were prepared on differentiation day 7 and used for Western immunoblotting using AHR antibodies. ES: ES cell lysate; Untreated: lysate from ES cells allowed to differentiate for 7 days.

Figure 2.3 Cardiac marker expression in beating and non-beating differentiated ES cells. Beating and non-beating areas from 12-day-old EBs treated with 1 nM TCDD or untreated were separated under a dissecting microscope. Relative mRNA expression levels were normalized as in Figure 2.1B and shown as means ± SD. BC, beating control; B, beating; NB, non-beating; T, TCDD treated; C, DMSO control.

(#): NBC or NBT significantly different (p<0.05) from BC or BT, respectively; (*) BT or NBT significantly different (p<0.05) from BC or NBC, respectively.

TCDD+Puromycin A B Control

Control TCDD+Puromycin

C D DAPI Merge

AHR

β-Actin

Ratio AHR/β-Actin

Figure 2.4. Characterization of AHR-positive cardiomyocytes. (A) Map of the pAHRPuroIRESeGFP vector used for promoter sorting cell selection. (B) EGFP fluorescence increased significantly in puromycin-resistant differentiating cells and the eGFP-expressing cells were detectable microscopically

(Top panels). Fluorescence-activated cell sorting analysis demonstrated an obvious fluorescent shift

(Bottom panel). We estimate the purity of these cells at greater than 90%. (C) Western blot immunodetection of AHR expression in the pAHRPuroIRESeGFP cells. AHR expression is undetectable in both the undifferentiated pAHRPuroIRESeGFP ES cells and the parent C2-ES cells. After

59 differentiation, the pAHRPuroIRESeGFP cells show some 30% increase in AHR levels relative to β-actin in comparison to the AHR levels in differentiated C2-ES cells, probably due to the selection against

AHR-negative cells. (D) A pAHRPuroIRESeGFP clone, termed C5, was further expanded, allowed to differentiate for several passages and characterized for expression of developmental markers by immunofluorescence. All survivors of puromycin selection expressed AHR, the mesodermal marker

MF20, and the mesendodermal marker GATA4, but lacked expression of the ectodermal marker keratin

18. DAPI: nuclear staining; Merge: merge of all three images in columns 1–3. These cells also expressed

NKX2-5, a cardiac homeobox transcription factor and marker of mesoderm, and the cardiac markers connexin 40 and troponin T, strongly suggesting that the selected cells are cardiomycytes.

Figure 2.5 The GO terms with top 100 z-scores were hierarchically clustered using the GENE-E algorithm. (A) AHR-positive differentiated cells compared to unselected differentiated cells. (B) AHR- positive differentiated cells treated with 1 nM TCDD compared to the same cells treated with control vehicle.

A B

Figure 2.6 RNA-Seq expression changes of the 100 homeobox transcription factors associated with cardiovascular development deregulated by the AHR/TCDD axis. Genes positive (A) or negative (B) for AHR PWM anywhere between coordinates -10,000 and +1,000 NT from the TSS.

Figure 2.7 Time-dependent expression changes of PcG and TxG genes deregulated by the

AHR/TCDD axis. PcG and TxG genes that show altered expression in AHR positive cells treated with

TCDD.

Figure 2.8 Functional analyses of gene expression changes induced by TCDD in AHR-positive cardiomyocytes. The Ingenuity Knowledge Base (IPA; Ingenuity®Systems, http://www.ingenuity.com) was used to analyze the TCDD effects on (A) biological; (B) canonical; and (C) toxicological functions on day-5 and -11 of differentiation.

Table 2.1 Primer sequences and product size for qPCR analysis of mRNA expression of the indicated genes.

Gene Forward primer sequence (5’-> 3’) Reverse primer sequence (5’-> 3’) PCR product size (bp) Ahr GGCCAAGAGCTTCTTTGATG TGCCAGTCTCTGATTTGTGC 93 Cx40 AAGGCTCGGCCTCGGTCTCC CCCAGGACCAGCATGCGGAA 146 CTGGCCACTGGGGAAGTGCC TAGCCCTGAGGAAGGCGGTGG 125 Cyp1a1 GTGTCTGGTTACTTTGACAAGTGG AACATGGACATGCAAGGACA 199

Ece1 CAACGGGGGACTCAAGGCGG TGGTGAGACCCAGGGTGGGC 92 GAGACGGCGCTGGCCAACAT TGGCAGGTGCCAAGGTCTGC 106 Gata4 TCTCACTATGGGCACAGCAG GCGATGTCTGAGTGACAGGA 136 Gata6 TCGAAACGCCGGTGCTCCAC GTTCACGCACTCGCGGCTCT 116 CGGTCGCGGCCGTTCTTCTC CACCAGCCGCCGTCAGTCAA 97 Hcn4 CCACCACTGGGTTCGGCCAC GCAGCCTGTGGAGAGCGAGC 109 Kdr GGCGGTGGTGACAGTATCTT CTCGGTGATGTACACGATGC 189 Mef2c ACGCCTGTCACCTAACATC TTTCCCTTTCCTTTCCTTTCC 150 Mlc2v CCCGAGGGCAAAGGGTCACT GACGTCAGGGGGAAAGGCTGC 117 TGGCAACTGGCCTCAGACACC ACGTTGGAGCTCCCGCCTTCT 71 Myh6 CTGCTGGAGAGGTTATTCCTCG GGAAGAGTGAGCGGGGCATCAAGG 302 Myh7 TGCAAGGCTCCAGGTCTGAGGGC GCCAACACCAACCTGTCCAAGTTC 202 Nanog AGGGTCTGCTACTGAGATGCTCTG CAACCACTGGTTTTTCTG CCACCG 364 Nkx2-5 CGACGGAAGCCACGCGTGCT CCGCTGTCGCTTGCACTT 180 Nppa (Anf) AGCCCAGAGTGGACTAGGCTGC TGCGTGACACACCACAAGGGC 123 TCAGATCGTGCCCCGACCCA GGCCTGGAAGCCAAAAGGCCA 88 Oct4 GGCGTTCTCTTTGGAAAGGTGTTC CTCGAACCACATCCTTCTCT 313 Pgp9.5 (Uchl1) TGCAGGTGCCATCCGCGAAG CCCTAGCACGTCGGCGAAGC 119 CCATGGCGCCAGCTCAGAGG CCACGGCAGAGAAGCGGACC 101 Shox2 GGAGCTGGACATGGGA GCCTCTGCTTGATTTTGGTC 140 Tbx3 CCCCGCTACGGGGGAGCAAT TGGAACCGCGGCTGGTACTT 129/189 CAAAGAGCGTGGGAGCCGGG CAAGCAGGGGCTCGACTGGC 98 Tbx5 TACCCCGCGCCCACTCTCAT TGCGGTCGGGGTCCAACACT 120 CCTGTGGTCAGGCAGTGCGG CTGGGCACGCCGTGAGTGTA 92

Table 2.2 Predicted activation state of upstream transcriptional regulators in TCDD-treated AHR-positive differentiating ES cells. Differentiation Day 5 Differentiation Day 8 Activation State Regulator z-score p-value Activation State Regulator z-score p-value Inhibited APLNR -2.1 5.05E-07 Inhibited APLNR -2.4 1.86E-09 BMP2 -2.4 1.57E-06 BMP4 -3.3 2.81E-23 BMP4 -2.6 5.93E-17 BMPR1A -2.7 2.87E-09 FGFR2 -2.8 9.26E-11 CTNNB1 -2.2 2.91E-22 GLI2 -2.4 3.31E-07 EPHB4 -2.5 8.04E-09 Hedgehog -2.7 1.42E-19 FGFR2 -2.9 4.73E-08 MLL -2.2 1.04E-12 GLI2 -2.4 7.45E-12 NFkB -2.2 5.33E-07 MLL -3.5 2.00E-29 NKX2-5 -1.1 1.37E+08 NKX2-5 -0.5 2.98E-08 SHH -3.1 5.48E-13 STAT3 -3.1 3.77E-08 TGFB1 -2.1 2.03E-07 TGFB1 -4.2 6.39E-15 TNF -2.8 1.75E-07 tretinoin -2.5 3.41E-42 WNT1 -2.9 1.92E-10 WNT11 -2.2 2.71E-08 WNT3A -2.9 7.34E-11 Activated GNL3 2.6 3.28E-14 Activated GNL3 2.4 2.31E-08 PHC2 2.6 3.85E-13 POU5F1 2.3 1.85E-19 POU4F1 2.5 1.16E-17 RNF2 2.2 3.01E-11 POU4F2 2.4 5.39E-19 SOX2 2.3 1.78E-20 POU5F1 2.7 5.31E-26 RNF2 3.1 1.27E-16 SOX2 2.3 3.87E-26

Table 2.2 continued

Differentiation Day 11 Differentiation Day 14 Activation State Regulator z-score p-value Activation State Regulator z-score p-value Inhibited ARID4B -2.1 8.03E-07 Inhibited ARID4A -2.1 1.31E-06 BMP2 -2.5 3.10E-15 ARID4B -2.1 5.62E-07 BMP7 -2.2 2.25E-08 BMP2 -2.5 4.31E-10 BMPR1A -2.6 5.76E-07 EPHB4 -2.1 6.34E-11 GLI3 -2.4 1.48E-11 GLI1 -2.4 8.28E-07 HOXA9 -2.2 9.81E-10 GSC -2.1 2.56E-06 MLL -3.1 2.58E-30 HDAC -2.2 3.26E-10 NKX2-5 -0.7 5.94E-08 HOXA9 -2.2 1.61E-08 SMO -2.1 7.57E-10 miR-34a-5p -2.2 2.72E-08 STAT3 -2.6 4.71E-07 MLL -2.9 8.01E-27 TGFB1 -3.4 1.48E-10 NKX2-5 -0.7 2.98E-08 tretinoin -2.8 1.63E-36 SPRY1 -2.2 3.88E-07 STAT3 -3.1 4.67E-07 Activated KLF4 2.1 3.18E-07 TGFB1 -3.3 5.52E-08 NANOG 2.1 2.68E-18 tretinoin -3.1 1.49E-32 OCT4 2.1 1.14E-09 PHC2 2.4 8.70E-11 Activated PHC2 2.4 5.07E-11 POU4F2 2.2 7.99E-15 SOX2 2.2 4.68E-22 POU5F1 2.5 1.19E-25 RNF2 2.1 1.99E-15 SOX2 2.3 1.07E-22

CHAPTER III

Ah Receptor Activation by Dioxin Disrupts Activin, BMP, and WNT Signals during the

Early Differentiation of Mouse Embryonic Stem Cells and Inhibits Cardiomyocyte

Functions

Qin Wang, Vinicius Carreira, Chia-I Ko, Yunxia Fan, Xiang Zhang, Jacek Biesiada, Mario Medvedovic,

and Alvaro Puga¶

Department of Environmental Health and Center for Environmental Genetics

University of Cincinnati College of Medicine

160 Panzeca Way, Cincinnati, OH 45267

¶To whom correspondence should be addressed

Alvaro Puga, Ph.D. Department of Environmental Health University of Cincinnati College of Medicine Cincinnati, Ohio 45267 E-mail: [email protected] Phone: 513.558.0916

Abstract The aryl hydrocarbon receptor (AHR), a ligand-activated transcription factor, is a critical mediator of gene-environment interactions. Previous analyses of genome-wide gene expression profiling during the differentiation of mouse embryonic stem cells (ESCs) into cardiomyocytes showed that AHR activation by the prototypical ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD; Dioxin) deregulated the expression of multiple homeotic transcription factors and inhibited the concomitant function of spontaneous cardiomyocyte contractility. To investigate whether these TCDD targets had a developmental window of sensitivity, we treated ESCs with TCDD at daily differentiation intervals and determined the resulting level of TCDD-induced cardiotoxicity. Surprisingly, cardiomyocyte contractility was an AHR-dependent TCDD target solely during the early period of panmesoderm development, comprised between differentiation days 0 and 3, a time when TCDD also disrupted the concerted expression of genes involved in TGFβ/BMP2/4 and WNT signaling pathways. Determination of the levels of secreted signal proteins in the culture medium by ELISA revealed that TCDD significantly suppressed the autocrine secretion of BMP4, WNT3a and WNT5a, while it elevated the secretion of

Activin A. Supplementing the culture medium with BMP4, WNT3a or WNT5a during the first three days of differentiation successfully countered TCDD-induced cardiotoxicity, while anti-WNT3a, or anti-

WNT5a antibodies or continuous Noggin (a BMP4 antagonist) or Activin A treatment inhibited the contractile phenotype. In wild type, but not in Ahr knockout ESCs, TCDD treatment also significantly altered mitochondrial copy number, consistent with mitochondria ultrastructural stress and damage. AHR activation by TCDD during early ES cell differentiation appears to disrupt the expression of signals critical to the ontogeny of cardiac mesoderm and cause the loss of contractility in the resulting cardiomyocyte lineage.

3.1 Introduction

The Barker Theory, often referred to as The Developmental Origins of Human Adult Disease, states that adverse influences early in development, and particularly during the embryonic stage, can lead to permanent changes in physiology and metabolism and result in increased disease risk in adulthood

(Barker 2007). In the context of environmental exposures, the prenatal and perinatal periods of development are particularly sensitive to toxicants, and both the nature and the severity of health outcomes may depend on the developmental time-period during which toxicant exposure occurs (Damstra

2002). In the case of dioxin, a widespread toxicant, data on fish, birds and mammals show that the developing tissues are more sensitive to TCDD—the prototypical dioxin—than the adult ones (Walker and Catron 2000; Kopf and Walker 2009; Plavicki et al. 2013).

Epidemiological and biological studies support the concept that the developing cardiovascular system is a distinct target of TCDD. Work in multiple species including humans, rodents, fish, and avian embryos have shown that developmental exposure to TCDD results in cardiac defects, including both cardiac hypertrophy and reduced cardiomyocyte proliferation, altered fetal heart size, and disruption of neovascularization (Ivnitski-Steele et al. 2005; Thackaberry et al. 2005). In utero exposure to TCDD also increases the susceptibility to cardiovascular dysfunction in adult life (Aragon et al. 2008). In humans, infants born to mothers living near incinerators that emit complex mixtures of dioxins, furans, particulates, and heavy metals exhibit a higher incidence of lethal congenital heart diseases (Dummer, Dickinson and

Parker 2003). More recent epidemiological studies also showed a correlation between the incidence of hypoplastic left heart syndrome and maternal exposure to halogenated hydrocarbons, dioxins and polychlorinated biphenyls (PCBs) during pregnancy (Kuehl and Loffredo 2006).

Most of the toxic endpoints observed in organisms exposed to TCDD are mediated by the Aryl

Hydrocarbon Receptor (AHR), a ligand activated transcription factor that belongs to the bHLH/PAS superfamily of transcription factors (Gu, Hogenesch and Bradfield 2000). The ligand-activated AHR dimerizes in the nucleus with the Aryl Hydrocarbon Receptor Translocator (ARNT, also termed HIF1β)

70 and the heterodimer binds to AHR/ARNT response elements located in the promoters of target genes, causing chromatin bending, recruitment of transcription coactivators, RNA polymerase II and associated chromatin remodeling factors, and initiation of gene transcription (Schnekenburger, Peng and Puga 2007).

In addition to the best known xenobiotic metabolism genes in the cytochrome P450 Cyp1 family, there are many other AHR/ARNT transcriptional targets, including genes involved in cell-cycle regulation and morphogenetic processes, suspected of playing key roles during cardiovascular development (Sartor et al.

2009).

Cardiomyocyte differentiation is a tightly orchestrated and dynamic process. It requires sequential expression of multiple transcription factors and proper temporal and spatial integration of multiple signal transduction pathways, including those controlled by the WNT, TGFβ and FGF superfamilies (Liu and

Foley 2011; Rajala, Pekkanen-Mattila and Aalto-Setala 2011). These factors do not function alone; their cooperation and interdependent regulation are essential for cardiac development such that subtle disruption by haploinsufficient, hypomorphic, or dominant-negative mutations lead to malfunction of the heart at later times during the lifespan of the organism (Schott et al. 1998; Chien 2000; Srivastava and

Olson 2000). Perturbation of the action of these regulatory factors by xenobiotic agents during cardiac development may account for the cardiotoxicity of the compounds.

Genetic knockout of the Ahr gene in mice disrupts cardiovascular homeostasis, causing pathological cardiac hypertrophy (Lund et al. 2003). In wild type mice, AHR expression is detectable in the heart of the postimplantation mouse embryo as early as gestation days (GD) 7.5 - 9.5 (Abbott, Birnbaum and

Perdew 1995; Wang et al. 2013). Expression is evident in all three embryonic germ layers in vivo and on day 3 of the differentiation of mouse ES cells into embryoid bodies (EBs). TCDD treatment during ES cell differentiation disrupts the concerted expression of genes involved in cardiac morphogenesis, including dozens of genes encoding homeobox transcription factors and Polycomb and trithorax group genes. Interestingly, TCDD treatment at early differentiation time points disrupts WNT and BMP

71 signaling pathways. In addition, AHR activation, inhibition or knockdown during mouse ES cell differentiation significantly inhibits cardiomyocyte contractility (Wang et al. 2013).

To investigate whether there was a critical time window of development for TCDD-induced cardiotoxicity, we treated ESCs with TCDD at daily differentiation intervals and determined the resulting level of TCDD-induced cardiotoxicity as determined by the ability of cardiomyocytes to contract spontaneously. Our results reveal that the early phase of EB formation, between day 0 – 3 of non-directed differentiation, is a critical time window for TCDD cardiotoxicity. In addition, TCDD also caused the disruption of genes in the TGFβ/BMP and WNT signaling pathways.

3.2 Materials and Methods 3.2.1 Culture of embryonic stem cells, in vitro differentiation and treatments.

AHR wild type (Ahr+/+) were the ESCs C57BL/6N C2 line already described (Gertsenstein et al.

2010; Wang et al. 2013). The AHR-knockout (Ahr-/-) ESCs were established in our laboratory from GD

3.5 blastocysts of C57BL6/J Ahr-/- pregnant dams by standard procedures (Doetschman et al. 1987). Both undifferentiated ES cells were maintained in ES medium, consisting of high glucose Dulbecco’s minimal essential medium (DMEM) (Gibco) supplemented with 15% ESC qualified fetal bovine serum (knockout serum replacement; Gibco), 2 mM glutamine, 1% nonessential amino acids, 100 U/mL penicillin, 100

μg/mL streptomycin, 0.1 mM β-mercaptoethanol, and 1000 U/mL ESGRO (LIF, Chemicon international).

Cells were seeded in 0.1% gelatin-coated plates at 37°C, 95% humidity with 5% CO2, and passaged every second or third day. Non-directed differentiation (hereinafter referred to simply as differentiation) was initiated on day 0 by transferring the cells to DMEM medium without LIF supplemented with 15% non-

ES qualified fetal bovine serum and suspended at a concentration of 40,000 - 70,000 cells/mL to form

EBs in hanging drops. Sixty 20-μL aliquots were pipetted onto the inner surface of a bacterial Petri dish lid and the lid was inverted over the bottom plate containing 15 mL phosphate-buffered saline (PBS) to provide humidity. Plates were incubated at 37°C for 3 days and thereafter the EBs were flushed with differentiation medium and incubated in 24-well or 10-cm plates for varying periods of time.

When needed, cultures were treated with 1 nM TCDD, the concentration commonly used for tissue culture work with the high-affinity AHR of C57BL/6 mice. TCDD was dissolved in DMSO and diluted in

DMEM to reach the desired concentration when added to growth medium. DMSO in DMEM served as the vehicle control, the final concentration of DMSO was ≤ 0.05 % of the final volume. TCDD treatment was kept in the culture throughout the experiment, except when indicated otherwise. As needed, some cultures were also exposed to 5 ng/mL Activin A (R&D Systems, Minneapolis, MN), 5 ng/mL BMP4

(R&D Systems), 150 ng/mL Noggin (Stemgent, Cambridge, MA), 20 ng/mL recombinant mouse WNT3a

(R&D Systems), 20 ng/mL WNT5a (R&D Systems), 1 μg/mL anti-WNT3a-IgG (R&D Systems) or 1

μg/mL anti-WNT5a-IgG (R&D Systems). Anti-WNT3a-IgG was certified by the manufacturer not to cross-react with mouse WNT1, -4, or 5a. Also reported by the manufacturer was that anti-WNT5a-IgG did not cross-react with mouse WNT1, 2b, 3a, 4, 5b, 8a, 8b, 9b, 10a, 10b, 11, or 16. The exposure to ligands, antagonists or neutralizing antibodies was conducted either during differentiation days 2 - 3, 0 - 3 or throughout days 0 - 12. Media and treatments were replaced every 48 h, as needed.

3.2.2 Determination of cardiomyocyte contractility.

To measure cardiomyocyte contractility, EBs were individually plated on wells of 24-well plates, allowed to differentiate for the indicated length of time in the presence of vehicle, TCDD, growth factors or antibodies, and visually scored daily for the presence of beating cell clusters. Beating became evident starting on day 6-7 and was maximal by day 11-12. If a well had more than one beating cluster, it was scored as a single beating EB.

3.2.3 Determination of Activin A, BMP4 and WNT levels in EB culture medium.

Ahr+/+ ESCs were allowed to differentiate by forming EBs in the presence of DMSO or TCDD as previously described. To determine the extracellular Activin A, BMP4 and WNT levels, the culture medium of day-1, day-2 and day-3 EBs for each treatment was obtained from triplicate hanging drops.

Culture levels of these signal proteins were determined using ELISA kits for Activin A (DAC00B, R&D

Systems, MN), BMP4 (MBS703931, MyBioSource), WNT3a (DL-WNT3A-Mu, DongLin Sci&Tech,

China), and WNT5a (MBS932852, MyBioSource). All determinations were conducted according to the manufactures’ protocols.

3.2.4 Transmission electron microscopy.

Three-day-old EBs treated with or without TCDD were collected and immediately fixed in phosphate-buffered 3% glutaraldehyde for 24 hours and submitted to the Pathology Research Core at

Cincinnati Children’s Hospital Medical Center (Cincinnati, OH) for sample processing and sectioning for electron microscopic examination. Samples were washed three times in 0.1 M cacodylate buffer and postfixed in 1% osmium tetroxide buffered with cacodylate, pH 7.2, at 4°C for 1 h. After dehydration in serial alcohol and propylene oxide solutions, samples were infiltrated with and embedded in LX112. Thin sections were stained with uranyl acetate and lead citrate. Imaging was performed on a transmission electron microscope (7600; Hitachi). Five non-overlapping ultraphotomicrographs per grid were taken at

8000X, 25000X, and 70000X magnifications and evaluated using Image J 1.47h software.

3.2.5 Mitochondria quantification.

The relative amounts of days 2 and 4 EBs or day-11 beating cardiomyocyte mitochondria were determined using real-time-PCR to measure the ratio of mitochondrial DNA [mtDNA] to nuclear DNA

[nDNA]. Day-11 beating cardiomyocytes were manually dissected from beating areas of differentiated

EBs under a dissecting microscope. Total DNA was extracted with the DNeasy Blood & Tissue Kit

(Qiagen, Valencia, CA) following the manufacturer’s specification. The PCR reactions were conducted in triplicate in a total volume of 25 μL containing SYBR Green PCR Master Mix (Applied Biosystems,

Grand Island, NY). Amplification was performed in a Stratagene Mx3000P real-time PCR system

(Agilent Technologies, Santa Clara, CA); the reaction was heated to 95 ºC for 10 min, followed by 40 cycles of denaturation at 95 ºC for 15 sec and annealing elongation at 60 ºC for 60 sec. Detection of the fluorescent product was carried out during the 72 ºC extension period, and emission data were quantified using threshold cycle (Ct) values. The targets were the genes coding for the nuclear cytochrome P450

Cyp1a1 and the mitochondrial nicotinamide adenine dinucleotide dehydrogenase-5 (Nd5). Primers for the

Cyp1a1 promoter region at -0.9 kb were: forward: 5'- AGGCTCTTCTCACGCAACTC -3’; reverse: 5'-

TAAGCCTGCTCCATCCTCTG -3’. Primers for Nd5 were: forward 5’-

TGGATGATGGTACGGACGAA-3’; reverse 5’-TGCGGT TATAGAGGATTGCTTGT-3’.

3.2.6 Total RNA isolation and RNA-seq data analysis.

Total RNA was extracted with the RNeasy Mini Kit (Qiagen) according to the manufacturer’s specifications. All steps of library construction, cluster generation, and HiSeq (Illumina,

San Diego, CA) sequencing were performed with biological duplicate samples by the Genomics

Sequencing Core of the Department of Environmental Health, University of Cincinnati. Library construction was done with the TruSeq RNA sample preparation kit (Illumina) using 1 μg of total RNA, with RNA integrity number ≥ 7.0 (Agilent 2100 Bioanalyzer; Agilent Technologies, Santa Clara, CA) to purify poly-A–containing mRNA with oligo-dT– attached magnetic beads. The purified mRNA was enzymatically fragmented, with random hexamers primed for first and second strand cDNA synthesis, followed by purification using Agencourt AMPure XP beads (Beckman Coulter, Florence, KY).

Overhangs in the double-strand cDNA were blunt-ended by end repair and adenylated with a single A- nucleotide at the 3´ end to prevent self-ligation in the following ligation step. AMPure XP bead-purified fragments were ligated to sample-specific indexing adapters and enriched by 10 cycles of PCR using adapter-specific primers. A 1-μL aliquot of purified PCR product (from a total sequencing library of 30

μL) was analyzed in an Agilent bioanalyzer using a DNA 1000 chip to check DNA size (~ 260 bp) and yield. To quantify the library concentration for clustering, the library was diluted 1:100 in a buffer containing 10 mM Tris-HCl, pH 8.0, and 0.05% Tween 20, and analyzed by quantitative PCR (qPCR) with a KAPA Library Quantification kit (KapaBiosystems, Woburn, MA) using an ABI 9700HT real- time PCR machine (Applied Biosystems). Equal amounts of six individually indexed cDNA libraries were pooled for clustering in an Illumina cBot system flow cell at a concentration of 8 pM using

Illumina’s TruSeq SR Cluster Kit v3, and sequenced for 50 cycles using a TruSeq SBS kit on the Illumina

HiSeq system. Each sample generated approximately 30 million sequence reads.

Sequence reads were demultiplexed and exported to fastq files using CASAVA 1.8 software

(Illumina). The reads were then aligned to the reference genome (mm10) using TopHat aligner (Trapnell,

Pachter and Salzberg 2009). The counts of reads aligning to each gene’s coding region were summarized using ShortRead (Morgan, Anders, Lawrence, Aboyoun, Pages and Gentleman 2009) and associated

Bioconductor packages (GenomicFeatures, IRanges, GenomicRanges, Biostrings, Rsamtools; http://www.bioconductor.org/packages/ release/BiocViews.html#_Software) for manipulating and analysis of next-generation sequencing data and custom-written R programs (Ihaka and Gentleman 1996).

Differential gene expression analysis between TCDD-treated and untreated cells was performed separately at each of the three different time points (day 1, day 2, and day 3). We performed statistical analysis to identify differentially expressed genes for each comparison using the negative-binomial model of read counts as implemented in the Bioconductor DESeq package (Anders and Huber 2010).

Genes in the TGFβ/BMP and WNT signaling pathways were hierarchically clustered based on the log2 fold change with positive values denoting up-regulation and negative values denoting down- regulation. Clustering was performed using custom-written R programs.

3.2.7 Statistical analysis.

Data are presented as mean ± standard error of the mean from at least three independent experiments.

Significant differences between groups were calculated using Student’s t-test. *, p-value <0.05; **, p- value <0.01; and *** p-value <0.001 are considered statistically significant.

3.3 Results 3.3.1 The early differentiation period between days 0 – 3 is a critical time window for TCDD- induced cardiotoxicity.

Pluripotent ESCs can develop into most embryonic lineages in culture (Keller 1995; Smith 2001), including cardiomyocytes (Yamashita et al. 2005). Differentiation of ESCs into cardiomyocytes in vitro is readily identifiable microscopically by visual examination of differentiating EBs that spontaneously develop a contractile phenotype. Those ESC-derived beating cardiomyocytes show all the properties

76 characteristic of cardiac cells, such as electrophysiologic phenotypes and formation of stable intracardiac grafts when injected into mice (Klug et al. 1996). In our previous studies, we observed that continuous treatment of differentiating ES cells with TCDD disrupted the cardiomyocyte beating phenotype in a dose-dependent manner that was dependent on AHR activation (Wang et al. 2013). Here, we extended this observation by further characterizing whether there was a critical developmental time window when differentiating ES cells were most sensitive to TCDD exposure. Wild-type Ahr+/+ differentiating ES cells exposed to TCDD during the period ranging from day-minus-2 or day-0 to day-11, showed significantly lower numbers of beating EB-derived cultures that never reached more than 30% of control values

(Figure 3.1A). In contrast, when TCDD treatment started at the end of day-3, day-5 or day-7, there was no significant decrease in the percent of beating EBs in the TCDD-treated groups compared to controls

(Figure 3.1A). Unlike the wild type ESCs, differentiating knockout Ahr-/- ESCs were resistant to TCDD- induced loss of contractility, although they showed a reproducible one-day delay in establishing the phenotype, possibly the effect of TCDD’s hydrophobicity on cellular processes (Figure 3.1B). These results indicate that there is a critical time window when the differentiating ES cells are most vulnerable to AHR-dependent TCDD-induced cardiotoxicity and that this window is between day-0 to day-3, the period when the ES cells in the hanging drop aggregate to form embryoid bodies. Beyond differentiation day-3, the cells in the EBs appear to be no longer sensitive to TCDD cardiotoxicity.

3.3.2 Early TCDD treatment disrupts the expression of genes involved in TGFβ/BMP and WNT signaling pathways.

Our earlier studies on the effect of TCDD on ES cell gene expression were focused on the regulatory consequences of TCDD treatment on the late differentiation days comprised between 5 and 14 days post removal of LIF (Wang et al. 2013). At the earliest time point on day-5, analysis of gene expression profiling using the Ingenuity Knowledge Base (Ingenuity®System-IPA) revealed that the most significant changes caused by TCDD were to the canonical WNT3A/β-Catenin signaling pathway and to the non- canonical WNT1. Several other signaling pathways were also significantly affected by TCDD treatment,

77 including the BMP2/4 and TGFβ signaling pathways (Figure 3.2). The signaling pathways controlled by

TGFβ/BMP/Activin and WNT are essential for panmesoderm induction and resulting cardiomyocyte differentiation (Fukuda and Yuasa 2006; Laflamme and Murry 2011). To test the hypothesis that these pathways cross-talked with the AHR/TCDD elicited signals, we used global gene expression profiling during the three days of EB differentiation to characterize the effect of TCDD on the expression of genes regulated by TGFβ/BMP and WNT. Ahr+/+ cells were allowed to differentiate in hanging-drops and samples were collected on day-1 and day-3 for RNA.seq analysis. A significant number of genes in the

TGFβ/BMP pathway, including those coding for Nodal, anti-Mullerian hormone receptor type 2, Activin receptor-1, Smad3/4/5 and various TGFβ superfamily inhibitors were down-regulated by TCDD at both day-1 and -3 of differentiation; others, like tgfbr1 and Bmp2 were upregulated at day-1 and down- regulated at day-3 (Figure 3.3A, also see Appendix Table A7). Interestingly, Inhba, encoding the Inhibin

βA subunit of both Inhibin and Activin, was down-regulated on day-1 and upregulated on day-3. Activin

A is formed by a homodimer of two Inhibin βA subunits whereas the Activin antagonist, Inhibin A, is a heterodimer of one Inhibin βA subunit and one Inhibin α subunit. In contrast to Inhibin βA, Inhibin α expression was depressed by 50% on day-3, suggesting that expression of Activin A, not Inhibin βA, was the one that was upregulated by TCDD on day-3, while the expression of Inhibin A was not significantly changed.

TCDD exposure also deregulated the expression of genes in the WNT pathway. A group of transcription factors including Ahr, Sox4, Nanog, and Tcf4, the latter two controlling maintenance of cell proliferation, were up-regulated on both day-1 and day-3. On the other hand, Wnt3a, Wnt9a and genes involved in WNT signal transduction, such as Wsp2 and Btrc were downregulated at both time points

(Figure 3.3B, also refer to Appendix Table A8). These results indicate that early developmental signaling mediated by the TGFβ/BMP and canonical and non-canonical WNT pathways are deregulated by TCDD treatment during the critical time window when TCDD disrupts cardiomyocyte beating.

3.3.3 TCDD–dependent increase in Activin A secretion suppresses contractility.

Both TGFβ and WNT are highly conserved secreted factors with roles in development and normal homeostasis. Knockout of the AHR elevates the secretion of active TGFβ in primary hepatocytes

(Gonzalez and Fernandez-Salguero 1998; Zaher et al. 1998), suggesting that AHR activation by TCDD may repress the secretion of other members of the TGFβ superfamily. Cross-talk between AHR and WNT pathways has been well established (Schneider et al. 2014) and the temporal modulation of canonical

WNT signaling in human pluripotent stem cells has been shown to result in robust cardiomyocyte differentiation (Lian et al. 2013). Hence, it is reasonable to hypothesize that the expression changes in genes of the TGFβ/BMP and WNT pathways could be the consequence of the suppressed expression of

TGFβ/BMP and WNT proteins, which would cause the dysfunction of the pertinent signal transduction pathways by depressing the secretion of the early signaling factors, including Activin A, BMP4 and WNT.

To test this hypothesis and determine the role that TCDD treatment might have on Activin A levels and function, we measured Activin A by ELISA in the medium of differentiating Ahr+/+ EBs.

The level of secreted Activin A in the differentiation culture medium was unchanged by TCDD treatment during differentiation days -1 and -2, but was significantly increased in TCDD treated cells on day-3 (Figure 3.4A). To determine whether elevated Activin A levels had an effect on contractility, we supplemented the medium with recombinant Activin A during the whole term of differentiation, between day-0 and day-12. This addition significantly decreased the number of beating EB-derived cardiomyocyte cultures in both TCDD and vehicle control treated groups (Figure 3.4B), suggesting that elevation of

Activin A levels in the medium by TCDD treatment could be at least partly responsible for suppression of cardiomyocyte contractility.

3.3.4 TCDD-mediated suppression of BMP4 secretion also suppresses cardiomyocyte contractility.

BMP4 plays a central role in many organ developmental processes, including cardiomyogenesis

(Hogan 1996; Hogan 1996). Studies to characterize the role of BMP signaling in cardiomyocyte differentiation have shown that administration of soluble BMP2 or BMP4 to explant chick embryo cultures induces cardiac differentiation (Schultheiss et al. 1997). We also measured BMP4 levels in the

79 differentiation medium to determine whether TCDD treatment altered BMP4 secretion during the first three days of differentiation. We found that BMP4 secretion was not changed relative to control on differentiation day-1 but was significantly suppressed by TCDD on differentiation days -2 and -3 (Figure

3.5A).

If TCDD induced cardiotoxicity were mediated by suppression of BMP4 secretion, we might expect that supplementing the culture medium with added ligand during the first three days of differentiation might be sufficient to rescue the cells from TCDD-induced cardiotoxicity. To test this hypothesis, ESCs were allowed to differentiate in the presence or absence of TCDD supplemented with soluble BMP4 or with its repressor, Noggin. Administration of BMP4 on differentiation day 2-3 significantly increased the number of beating EB-derived cardiomyocyte cultures exposed to TCDD, bringing the number of contractile cultures up to the level of the control group (Figure 3.5B). In contrast, repression of BMP4 by added Noggin significantly decreased the number of beating cultures (Figure 3.5C). These results indicate that suppression of BMP4 secretion by TCDD exposure during the first three days of differentiation may be at least in part responsible for the loss of cardiomyocyte contractility, which can be reversed by BMP4 supplementation.

3.3.5 TCDD-mediated suppression of WNT secretion also suppresses cardiomyocyte contractility.

WNT proteins, a large family of secreted signaling molecules, are one of the key regulators for proper cardiac specification, progenitor expansion and myocardial growth both in vivo and in vitro

(Cohen et al. 2008; Gessert and Kuhl 2010). To test whether disruption of contractility by TCDD was due to altered secretion of WNT proteins, we measured secreted canonical WNT3a and non-canonical

WNT5a levels by ELISA in the culture medium of EBs during the first three days of differentiation.

TCDD treatment significantly suppressed WNT3a secretion on day-2 and -3, while WNT5A secretion was also significantly decreased on day-3 (Figure 3.6 A-B).

If suppressed secretion of WNT proteins during the first three days of differentiation resulted in inhibited contractility, we would expect that addition of WNT back to the culture medium would counter

80 the TCDD-mediated cardiotoxicity. To test this hypothesis, we supplemented the culture medium with either WNT3a or WNT5a for the first three days of differentiation. In agreement with our hypothesis, supplementation with either soluble WNT3a or WNT5a increased the percent of beating TCDD-treated

EBs, completely countering the effect of TCDD on contractility (Figure 3.6 C-D). In confirmation of these results, addition of neutralizing WNT3a or WNT5a antibodies during the same period of time inhibited contractility almost completely in both control and TCDD-treated EBs (Figure 3.6 E-F). These data indicate that WNT is also a TCDD target during cardiomyocyte differentiation, and illustrate the signaling complexity responsible for the cardiac contractility.

3.3.6 Developmental TCDD treatment disrupts mitochondrial structure and abundance.

Our Ingenuity Knowledge Base (Ingenuity®System-IPA) analysis of gene expression pathways also showed a significant disruption of mitochondrial function as a consequence of TCDD treatment. To determine whether there were structural consequences of mitochondrial dysfunction, we examined Ahr+/+ and Ahr-/- EBs for the abundance and quality of mitochondria. The relative copy number of mitochondrial mtDNA to nuclear nDNA, a measure of mitochondrial abundance, was determined by comparing the amount of the mitochondrial Nd1 gene to the nuclear Cyp1a1 gene. Two-day-old wild-type EBs showed no difference in mitochondrial abundance between TCDD treated and control groups, but by day-4

TCDD-treated EBs showed a significant 30% increase in the mtDNA/nDNA ratio compared to vehicle control (Figure 3.7A). In contrast, on both day-2 and day-4, knockout EBs had a significantly lower mitochondria copy number, approximately 50% of the wild type, a number that was refractory to TCDD- induced copy number increase (Figure 3.7A).

The observed effect of TCDD on contractility of Ahr+/+ cardiomyocytes was never absolute; even when treatment was done during the critical window of day-0 to day-3, roughly 30% of EBs retained contractility (Figure 3.1A). Furthermore, when EB treatment was begun beyond the critical window, on days 3, 5, or 7, 100% of the EBs were contractile. To examine whether beating cardiomyocytes that were treated with TCDD also suffered mitochondria dysfunction, we micro-dissected day-11 beating

81 cardiomyocytes from both wild type and knockout cells that had been untreated or treated with TCDD from day-0 or day-5 to day-11. In the fully differentiated Ahr+/+ cardiomyocytes, the ratio of mtDNA to nDNA was also affected by the earlier TCDD treatment, which increased the mtDNA/nDNA ratio 2- to

2.5-fold over control (Figure 3.7B). In contrast, there was no significant change of mtDNA copy number in TCDD-treated Ahr-/- beating cardiomyocyte compared to control (Figure 3.7B), suggesting that TCDD- induced mitochondrial dysfunction is also AHR-dependent. Ultrastructurally, increased mitochondria numbers correlated with their higher density in the cytoplasm. Furthermore, mitochondria, individually or in clusters, showed ultrastructural features of stress and degeneration, as evidenced by focal to global swelling, loss of matrix density, cristae unpacking, disorganization and cristolysis which affected higher numbers of mitochondria in TCDD-treated Ahr+/+ cells (Figure 3.7 C-D).

3.4 Discussion

The results presented here show that AHR activation by TCDD during the early differentiation period, comprised between days 0 and 3 after removal of LIF, significantly suppressed the development of the contractile cardiomyocyte phenotype, defining a developmental window of cardiotoxicity. This early period is the time when EBs are experiencing self-organization and axis formation to progress from pluripotent ES cells to panmesoderm and cardiac mesoderm, a critical time window that requires not only the activation of multiple signaling pathways, including WNT, TGFβ/BMP and Activin among others, but also the combinatorial integration of developmental signals elicited by the cross-talk among them (ten

Berge et al. 2008). Consistent with the participation of these pathways, inhibition of the beating phenotype is accompanied by parallel disruption of the TGFβ/BMP and WNT signaling pathways.

Furthermore, TCDD treatment led to significant changes in the levels of these agents in the culture medium, causing an increase of Activin A and a decrease of BMP4 and WNTs secretion. Efficient cardiac differentiation requires the optimal combination of Activin A and BMP4 signaling (Kattman et al. 2011), hence it is plausible that inhibition of the beating phenotype may result from the imbalance of Activin A,

BMP4 and WNT signals caused by TCDD treatment. In support of this concept, administration of BMP4,

WNT3a or WNT5a on the first three days of differentiation is sufficient to counter the effects of TCDD- induced cardiotoxicity and blocking BMP4 or WNT by an antagonist or by specific antibodies suppresses the beating phenotype even more than TCDD. These results strongly suggest a causal connection between early TCDD treatment, interference with early BMP, Activin A and WNT signaling, and later disruption of cardiomyocyte function. Thus, it is not unexpected that single supplementation with either BMP4 or

WNT is sufficient to counter TCDD toxicity, further documenting the intertwined cross-talk of those signaling pathways. Conversely, disruption of just one of the factors—Activin A, in this case—may cause the imbalance of the whole regulatory network.

We find that beating cardiomyocytes that were treated with TCDD as panmesoderm cells or cardiomyocyte precursors show changes in mtDNA copy number. These cells however, retain expression of cardiomyocyte markers, including Nkx2-5, Myh6, Myh7, Mlc2v, and Cx40 (Wang et al. 2013).

MtDNA copy number is cell type specific and during development, mitochondrial transcription and mtDNA replication are tightly controlled and regulated, with changes constituting a biological response to damage and dysfunction (Thundathil et al. 2005; Spikings et al. 2007). In our present study, an increase in mtDNA copy number by TCDD treatment was observed as early as differentiation day-4 and the effect appeared to be cumulative, increasing to more that 2.5-fold over control by longer exposure times.

Mitochondrial dysfunction as a consequence of TCDD treatment has long been observed and identified as a universal biomarker for exposure to polycyclic aromatic hydrocarbons (Kim et al. 2014). Effects have been reported in multiple organs and cell types due to multiple mechanisms, including inhibited mitochondrial transcription, disrupted mitochondrial transmembrane potential, inhibition of the mitochondrial electron chain, increased generation of reactive oxygen species, decreased ATP synthesis, and altered mitochondrial copy number (Shertzer et al. 2006; Biswas et al. 2008; Aly and Domenech

2009; Chen et al. 2010; Kennedy et al. 2013; Park et al. 2013; Pavanello et al. 2013). In the context of cardiac consequences, zebrafish embryos exposed to TCDD show increased expression levels of mitochondrial energy transfer genes and subtle induction of several proteins coded by mitochondrial

83 genes, which may be related to cardiomyopathy (Handley-Goldstone et al. 2005). Acute cardiac mitochondrial oxidative damage has also been reported in Wistar rats after TCDD exposure (Pereira et al.

2013). Increased WNT signaling is a potent activator of mitochondrial biogenesis and reactive oxygen species generation (Wang et al. 2005). In hematopoietic progenitor cells, conditional expression of an active form of β-catenin resulted in a loss of mitochondrial membrane potential and induction of the intrinsic mitochondrial apoptotic pathway. Furthermore, non-canonical WNT5a regulates mitochondrial dynamics in neurons (Serrat et al. 2013; Godoy et al. 2014).

Interplay between the TGFβ/BMP and WNT pathways has been known for quite a long time and is important for cell fate determination; the two pathways are intertwined at multiple levels, reciprocally regulating each other’s ligand production, critical for establishing extracellular gradients of these morphogens during embryonic development, sharing common target genes in a synergistic manner (Guo and Wang 2009). During mesoderm differentiation, cross-talk between these two pathways control differentiation into panmesoderm, cardiac progenitor cells and cardiomyocytes (Figure 4.1). AHR cross- talk with each pathway has long been recognized (Schneider, Branam and Peterson 2014). By interference with each developmental stage, TCDD not only derails the regulatory pathways, but it also alters the expression of signature genes in each developmental stage, from Brachyury in the panmesoderm to

Nkx2.5, Gata4 and various other genes in the cardiomyocyte progenitor cells (Figure 4.1). It is worth noting that the factors that regulate development are not fixed in a static signaling state, but are in a dynamic state that receives and sends signals to one another to give rise to the changing phenotype of the developing embryo. Hence, the epigenetic structure of regulatory elements of relevant genes is in an ever- changing functional state and it may be expected that interference with their dynamic progress by an environmental agent such as TCDD, might alter the concerted pace and outcome of development. AHR might be a master upstream regulator that controls the expression of genes in signaling pathways crucial for embryonic development and adult tissue homeostasis.

3.5 Conclusions

Results from the present study add to the growing body of evidence that developing organisms are more sensitive to toxicant exposure than their more developed counterparts. TCDD exposure during the initial differentiation stages in mouse ES cells disrupted TGFβ and WNT signaling pathways essential for cardiac development. Untimely activation of the Ah receptor may result in the imbalance of the complex regulatory network responsible for attainment and maintenance of cardiovascular homeostasis. The significant role that the AHR plays in cardiovascular development makes the heart a very sensitive target of fetal environmental injury.

Identification of a critical window of developmental exposure to an environmental toxicant is of extreme importance to our understanding of the health outcome to that exposure (Selevan et al. 2000).

Many studies in fish, birds, and mammals have shown that the embryo and the fetus are more sensitive to

TCDD and TCDD-like chemicals than the adult (Peterson et al. 1993; Walker and Catron 2000; Lanham,

Peterson and Heideman 2012). Being aware of the developmental period of susceptibility to a toxicant would be highly informative because this knowledge would make it possible to avoid exposure during that time.

Acknowledgments

We thank Dr. Ying Xia for a critical reading of the manuscript. This research was supported by NIEHS grants R01 ES06273, R01 ES10807, R01 ES024744 and the NIEHS Center for Environmental Genetics grant P30 ES06096. Authors declare no conflict of interest.

Chapter III Figures and Tables

Figure 3.1 Determination of a window of susceptibility to TCDD-mediated loss of cardiomyocyte contractility. Ahr+/+ and Ahr-/- ES cells were incubated at 37°C for 3 days in hanging drops. On the third day the embryoid bodies were flushed with differentiation medium and individually incubated in 24-well plates for the duration of the experiment. TCDD treatment was (A) for the periods of time indicated for the Ahr+/+ cells, or (B) during the whole term differentiation from day-0 to day-11 for the Ahr-/- cells. EBs were examined daily under the microscope for the presence of a rhythmic beating phenotype. Data represent the mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001, compared to vehicle control by Bonferroni-corrected ANOVA.

Figure 3.2 z-scores of upstream transcriptional regulators’ changes induced by TCDD in EBs on day 5 of differentiation. Data from our previous analysis of gene expression changes induced by

TCDD on day-5 of differentiation (Wang et al. 2013) was re-analyzed using the Ingenuity

Knowledge Base tools from Ingenuity®System-IPA.

Figure 3.3 Clustering of the expression of genes involved in (A) TGFβ/BMP and (B) WNT signaling pathways. The heatmaps show the hierarchical clustering of RNA.seq data for day-1 and -3 of Ahr+/+ differentiating cells treated with 1 nM TCDD relative to DMSO vehicle.

Figure 3.4 Activin A effect on Ahr+/+ cardiomyocyte contractility. (A) Secreted Activin A levels in

Ahr+/+ EB culture medium determined by ELISA. (B) Effect of supplementing the differentiation medium with Activin A on the contractility of Ahr+/+ EB-derived cultures treated with or without TCDD. The number of EBs that developed a rhythmic beat was scored daily under the microscopy. TCDD and

Activin A treatment were maintained from day-0 to day-12. Data represent the mean ± SD of independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001 were considered as significant.

Figure 3.5 BMP4 effect on Ahr+/+ cardiomyocyte contractility. (A) Secreted BMP4 level in Ahr+/+ EB culture medium determined by ELISA. (B) Effect of supplementing differentiation medium with BMP4 or (C) BMP4 antagonist Noggin, on the contractility of Ahr+/+ EB-derived cultures treated with or without

TCDD. Experimental details as in Figure 3.4. Data represent the mean ± SD of independent experiments.

*p < 0.05, **p < 0.01, and ***p < 0.001 were considered as significant.

Figure 3.6 Effect of WNT3a and WNT5a on Ahr+/+ cardiomyocyte contractility. Secreted levels of (A)

WNT3a and (B) WNT5a in Ahr+/+ EB culture medium were determined by ELISA. Effect of supplementing the Ahr+/+ EB medium for the first 3 days of differentiation with (C) WNT3a or (D)

WNT5a; or with (E) anti-WNT3a IgG or (F) anti-WNT5a IgG on the contractility of EB-derived cultures

91 treated with or without TCDD. Experimental details as in Figure 3.4. Data represent the mean ± SD of independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001 were considered as significant.

Figure 3.7 TCDD treatment disrupts mitochondrial structure and abundance. (A) mtDNA/nDNA ratio on days 2 and 4 of differentiation for both Ahr+/+ and Ahr-/- EBs treated with TCDD or DMSO control. Data represent the mean ± SD of three independent experiments. TCDD treated was significantly different from that of vehicle control at *p < 0.05

93 on day-4. Ahr+/+ and Ahr-/- were significantly different (# p<0.001) for the same treatment and time point. (B) mtDNA/nDNA ratio on day-11 beating cardiomyocytes from either Ahr+/+ or

Ahr-/- ESCs treated by TCDD or vehicle control from day-0 or day-5 of differentiation. (C)

Ultra-thin sections of 3-day-old EBs from Ahr+/+. ESCs treated with DMSO vehicle or TCDD were used for ultrastructural evaluation by transmission electron microscopy. Representative photomicrographs illustrating higher density of mitochondria (arrows) within the EBs exposed to TCDD. Individual or clusters of mitochondria showed ultrastructural features of stress and degeneration (arrows), as evidenced by focal to global swelling, loss of matrix density, as well as cristae unpacking, disorganization and cristolysis, affecting a higher number of mitochondria in TCDD-treated group.

CHAPTER IV Conclusions and Perspectives

4.1 Summary of data

Developmental exposure to TCDD resulting in cardiac defects has been shown in multiple organisms including fish, birds, murine and humans (Ivnitski-Steele et al. 2005; Thackaberry et al. 2005).

Interestingly, many studies in these species have shown that the embryo and the fetus are more sensitive to TCDD and TCDD-like chemicals than the adult (Peterson, Theobald and Kimmel 1993; Walker and

Catron 2000; Lanham, Peterson and Heideman 2012). Consistent with the previously published studies, we observed that differentiating ES cells at the early time period between day-0 and day-3 are most susceptible to TCDD-induced cardiotoxicity. It is interesting that exposure occurred at different times could result in dramatically different outcomes depending on the stage of development. It has been well established that there are highly susceptible period[s] of organogenesis during development. Wilson has described the importance of exposure timing within the developing organism and how this eventually affects the outcomes observed (Selevan et al. 2000). Therefore, identification of a critical window of developmental exposure to an environmental toxicant is of extreme importance to our understanding of the health outcomes associated with that exposure (Selevan et al. 2000). Information about the susceptible window will aid in evaluation of the biological plausibility of research findings, comparison of data across species, identification of especially susceptible subgroups/ages for specific interventions (Selevan et al. 2000). This is of great concerns to humans as children in many cases are more vulnerable to toxicants than adults since they are still developing in many ways (Selevan et al. 2000). Being aware of the developmental period of susceptibility to a toxicant would be highly informative because this knowledge would make it possible to avoid exposure during that time.

In our present study, we identified the critical time window as well as the molecular mechanisms for

TCDD-induced cardiotoxicity during cardiomyocyte differentiation. We found that TCDD-driven AHR activation disrupted the concerted expression of genes involved in cardiomyogenesis at each stage of cardiac differentiation.

From pluripotent ESC to panmesoderm

The critical time window identified by my study at early differentiation day-0 to day-3 is a time for panmesoderm induction when EBs are experiencing self-organization and axis formation. Panmesoderm induction requires multiple signaling pathways including WNT, TGFβ/BMP and Activin A (Figure 4.1)

(ten Berge et al. 2008). TCDD exposure within this window causes decreased secretion of BMP4 and

WNTs as well as elevated secretion of Activin A at protein level (Figure 4.1), and deregulates the concerted expression of genes involved in TGFβ/BMP and WNT signaling pathways at mRNA level.

Efficient cardiac differentiation requires an optimal combination of Activin A and BMP4 (Kattman et al.

2011). It is reasonable to conclude that the decreased number of beating EBs may result from the imbalance of Activin A and BMP4 signals caused by TCDD exposure during this critical time window. In agreement with those findings, simple supplementary of the signal proteins including WNTs and BMP4 counters the TCDD-induced cardiac toxicity.

From panmesoderm to cardiac mesoderm

The transition from panmesoderm to cardiac mesoderm passes beyond the critical window. TCDD exposure down regulates the expression of panmesoderm marker Brachyury and cardiac mesoderm transcription factors Mesp1 and Mesp2.

From cardiac mesoderm to cardiac progenitors

Activin A signal is essential for panmesoderm induction, but elevated secretion of this protein on days 3-4 leads to the inhibition of the transition from cardiac mesoderm to cardiac progenitor cells. When differentiation proceeds to cardiac progenitor stage, TCDD exposure inhibits the WNT signal, which normally promotes the proliferation of cardiac progenitors. In addition, AHR activation also deregulates the expression of the master homeobox transcription factor Nkx2-5, and others including Tbx, Gata4,

Mef2c, Hand1 and Hand2, etc.

From cardiac progenitors to contracting cardiomyocytes

The final step is the maturation of contracting cardiomyocytes. We observed decreased EB-derived beating cultures along with down regulated expression of cardiac specific proteins including cardiac troponins, MHC and MLC, conduction proteins Hcn4 and Shox2, Connexins and ANF, etc.

TCDD exposure affects multiple signaling pathways including TGFβ/BMP and both canonical and non canonical WNT, all stages of cardiac development from panmesoderm induction throughout cardiomyocyte maturation, and the expression of hundreds of genes. Moreover, TCDD exposure also causes mitochondrial dysfunction, including increased mitochondrial copy number, ultrastructural stress, and damage such as focal to global swelling, loss of matrix density, cristae unpacking, disorganization, and cristolysis. Results from the present study add to the growing body of evidence that developing organisms are more sensitive to toxicant exposure than their more developed counterparts. TCDD exposure during the initial differentiation stages in mouse ES cells disrupted TGFβ and WNT signaling pathways essential for cardiac development. Untimely activation of the Ah receptor may result in the imbalance of the complex regulatory network responsible for attainment and maintenance of cardiovascular homeostasis. The significant role that the AHR plays in cardiovascular development makes the heart a very sensitive target of fetal environmental injury.

4.2 Future perspectives

Investigation of the TCDD-induced cardiac defects and the physiological function of the receptor in cardiac development remains an active field. There are a number of interesting questions underlying the findings in this dissertation that remain to be addressed to further understand the function of this important receptor during cardiomyocyte development. Several directions might be worth pursuing to understand the function of AHR signaling during cardiomyocyte differentiation.

(1) Signal transduction regulatory network.

The cross-talk between AHR and TGFβ signal pathway has been extensively studied and the interplay between AHR and canonical WNT signaling pathway has been well established (Schneider, Branam and

Peterson 2014). The results from this study show the evidence of cross-talk between AHR and non canonical WNT signaling. In addition, the interplay between TGFβ/BMP and WNT pathways has been known for quite a long time and is important for cell fate determination. The two pathways are intertwined at multi-levels (Guo and Wang 2009). It might be important to clarify the regulatory network between these signals in the specific context of cardiovascular development, and the regulation among the players within the network.

(2) Interaction between AHR and novel genes.

My RNA-Seq global gene expression results identified a number of novel AHR target genes involved in cardiac development. They may be regulated by AHR/TCDD axis in a direct or indirect way, based on whether they have AHREs in their promoter regions. These candidate genes include the 100 homeobox transcription factors and genes involved in TGFβ/BMP and WNT signal pathways. Characterizing the mechanisms how AHR regulates those genes may help us understand the physiological role of the receptor in cardiomyocyte differentiation. Other interesting candidate genes are the PcG and TxG genes, critical regulators of epigenetic modifications affecting differentiation during development.

Understanding how AHR regulates their expression may help to address how TCDD exposure adversely affects epigenetic modification during cardiomyocyte differentiation.

(3) TCDD exposure and mitochondrial dysfunction.

In the present study, we found TCDD-induced mitochondrial dysfunction. However, the underlying mechanism is not addressed here. The cross-talk between WNT signaling and mitochondria function has been reported. Increased Wnt signals are a potent activator of mitochondrial biogenesis and reactive oxygen species (ROS) generation (Wang et al. 2005). In hematopoietic progenitor cells, conditional expression of an active form of β-catenin resulted in a loss of mitochondrial membrane potential and intrinsic mitochondrial apoptotic pathway. In neurons, non canonical WNT5a regulates the mitochondrial dynamics (Serrat et al. 2013; Godoy et al. 2014). Moreover, TGFβ pathways involved in energy balance, metabolism, and ROS generation have been reported. Increased TGFβ activity is associated with

98 mitochondrial dysfunction and increasing mitochondrial ROS synthesis (Casalena et al. 2012; Abe et al.

2013; Das et al. 2014). In our present study, we found the early activation of the Ah receptor deregulates

TGFβ and WNT signaling. It is reasonable to hypothesize that AHR is the ultimate upstream regulator of all the biological processes. It might be important to understand the complex regulatory network among those factors.

(4) Interplay of AHR and the upstream regulators

We found the decreased secretion of BMP4 and WNT proteins and elevated secretion of Activin A within the critical time window of TCDD exposure. These signal proteins are processed by enzymatic cleavage before secretion. Future works may focus on the mechanisms of AHR’s role in regulating the secretion of these signal proteins.

(5) Characterization of the AHR null ES cell

We isolated AHR null ES cells and established an immortal cell line. Characterization of the global gene expression profile of these cells during differentiation compared to the wild type cells may reveal the role of the receptor in physiological development.

Chapter IV Figures and Tables

Figure 4.1 ESC differentiation trajectory into cardiomyocyte and impact of TCDD. Modified from

(Laflamme and Murry 2011; Rajala, Pekkanen-Mattila and Aalto-Setala 2011). The specification of the cardiomyocyte lineage involves a transition through a sequence of increasingly restricted progenitor cells, proceeding from pluripotent ESCs to mesoderm and cells committed to cardiac fates. Growth factors that regulate cell fate choices are listed at branch points in blue. Antagonists for each growth factor are listed in black. Key transcription factors and surface markers for each cell state are listed under the corresponding cell types in purple. Red stands for upregulation while green stands for down-regulation by

TCDD treatment at the specific time point. The critical time window when the cells are most vulnerable to TCDD-induced cardiotoxicity is the early time period between day 0-3 (shown by a red box), a time when pluripotent ESCs differentiate into panmesoderm. Within this time window, TCDD treatment increases Activin A and suppresses BMP4 and WNT secretion. Administration of BMP4, WNT3a, or

WNT5a counters the TCDD effects. An increase in Activin A on days 3-4 leads to the inhibition of the transition from cardiac mesoderm to cardiac progenitor cells. The AHR/TCDD axis also inhibits the

WNT signals that promote the cardiac progenitor lineage. TCDD-induced mitochondrial dysfunction is a

100 late event, independent from this critical time window. BMPs, bone morphogenetic proteins; CX, connexin; HCN4, potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4;

MESP, mesoderm posterior protein; MLC2a/v, myosin light chain 2a and/or 2v; MYH, myosin heavy chain; NPPA, natriuretic peptide precursor A; TBX, T-box transcription factor; WNT, wingless-type

MMTV integration site.

101

REFERENCES

(1997). IARC Working Group on the Evaluation of Carcinogenic Risks to Humans: Polychlorinated Dibenzo-Para-Dioxins and Polychlorinated Dibenzofurans. Lyon, France, 4-11 February 1997. IARC Monogr Eval Carcinog Risks Hum 69, 1-631.

Abbott, B. D., L. S. Birnbaum and G. H. Perdew (1995). Developmental expression of two members of a new class of transcription factors: I. Expression of aryl hydrocarbon receptor in the C57BL/6N mouse embryo. Dev Dyn 204, 133-143.

Abe, Y., T. Sakairi, C. Beeson and J. B. Kopp (2013). TGF-beta1 stimulates mitochondrial oxidative phosphorylation and generation of reactive oxygen species in cultured mouse podocytes, mediated in part by the mTOR pathway. Am J Physiol Renal Physiol 305, F1477-1490.

Abel, J. and T. Haarmann-Stemmann (2010). An introduction to the molecular basics of aryl hydrocarbon receptor biology. Biol Chem 391, 1235-1248.

Abnet, C. C., R. L. Tanguay, M. E. Hahn, W. Heideman and R. E. Peterson (1999). Two forms of aryl hydrocarbon receptor type 2 in rainbow trout (Oncorhynchus mykiss). Evidence for differential expression and enhancer specificity. J Biol Chem 274, 15159-15166.

Akasaka, T., N. Takahashi, M. Suzuki, H. Koseki, R. Bodmer and H. Koga (2002). MBLR, a new RING finger protein resembling mammalian Polycomb gene products, is regulated by cell cycle- dependent phosphorylation. Genes Cells 7, 835-850.

Alkema, M. J., J. Jacobs, J. W. Voncken, N. A. Jenkins, N. G. Copeland, D. P. Satijn, A. P. Otte, A. Berns and M. van Lohuizen (1997). MPc2, a new murine homolog of the Drosophila polycomb protein is a member of the mouse polycomb transcriptional repressor complex. J Mol Biol 273, 993-1003.

Aly, H. A. and O. Domenech (2009). Cytotoxicity and mitochondrial dysfunction of 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD) in isolated rat hepatocytes. Toxicol Lett 191, 79-87.

Anders, S. and W. Huber (2010). Differential expression analysis for sequence count data. Genome Biol 11, R106.

Anderson, D., T. Self, I. R. Mellor, G. Goh, S. J. Hill and C. Denning (2007). Transgenic enrichment of cardiomyocytes from human embryonic stem cells. Mol Ther 15, 2027-2036.

Andreasen, E. A., M. E. Hahn, W. Heideman, R. E. Peterson and R. L. Tanguay (2002). The zebrafish (Danio rerio) aryl hydrocarbon receptor type 1 is a novel vertebrate receptor. Mol Pharmacol 62, 234-249.

Antkiewicz, D. S., C. G. Burns, S. A. Carney, R. E. Peterson and W. Heideman (2005). Heart malformation is an early response to TCDD in embryonic zebrafish. Toxicol Sci 84, 368-377.

Antonsson, C., M. L. Whitelaw, J. McGuire, J. A. Gustafsson and L. Poellinger (1995). Distinct roles of the molecular chaperone hsp90 in modulating dioxin receptor function via the basic helix-loop- helix and PAS domains. Mol Cell Biol 15, 756-765.

102

Aragon, A. C., P. G. Kopf, M. J. Campen, J. K. Huwe and M. K. Walker (2008). In utero and lactational 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure: effects on fetal and adult cardiac gene expression and adult cardiac and renal morphology. Toxicol Sci 101, 321-330.

Aylward, L. L. and S. M. Hays (2002). Temporal trends in human TCDD body burden: decreases over three decades and implications for exposure levels. J Expo Anal Environ Epidemiol 12, 319-328.

Baba, T., J. Mimura, N. Nakamura, N. Harada, M. Yamamoto, K. Morohashi and Y. Fujii-Kuriyama (2005). Intrinsic function of the aryl hydrocarbon (dioxin) receptor as a key factor in female reproduction. Mol Cell Biol 25, 10040-10051.

Barak, O., M. A. Lazzaro, W. S. Lane, D. W. Speicher, D. J. Picketts and R. Shiekhattar (2003). Isolation of human NURF: a regulator of Engrailed gene expression. EMBO J 22, 6089-6100.

Barker, D. J. (2007). The origins of the developmental origins theory. J Intern Med 261, 412-417.

Barouki, R., X. Coumoul and P. M. Fernandez-Salguero (2007). The aryl hydrocarbon receptor, more than a xenobiotic-interacting protein. FEBS Lett 581, 3608-3615.

Barrett, T., D. B. Troup, S. E. Wilhite, P. Ledoux, D. Rudnev, C. Evangelista, I. F. Kim, A. Soboleva, M. Tomashevsky, K. A. Marshall, K. H. Phillippy, P. M. Sherman, R. N. Muertter and R. Edgar (2009). NCBI GEO: archive for high-throughput functional genomic data. Nucleic Acids Res 37, D885-890.

Barrier, M., K. Chandler, S. Jeffay, M. Hoopes, T. Knudsen and S. Hunter (2012). Mouse embryonic stem cell adherent cell differentiation and cytotoxicity assay. Methods Mol Biol 889, 181-195.

Baumann, C. and R. De La Fuente (2011). Role of Polycomb Group Protein Cbx2/M33 in Meiosis Onset and Maintenance of Chromosome Stability in the Mammalian Germline. Genes (Basel) 2, 59-80.

Beddington, R. S. and E. J. Robertson (1989). An assessment of the developmental potential of embryonic stem cells in the midgestation mouse embryo. Development 105, 733-737.

Beischlag, T. V., J. Luis Morales, B. D. Hollingshead and G. H. Perdew (2008). The aryl hydrocarbon receptor complex and the control of gene expression. Crit Rev Eukaryot Gene Expr 18, 207-250.

Bell, D. R. and A. Poland (2000). Binding of aryl hydrocarbon receptor (AhR) to AhR-interacting protein. The role of hsp90. J Biol Chem 275, 36407-36414.

Biben, C., R. Weber, S. Kesteven, E. Stanley, L. McDonald, D. A. Elliott, L. Barnett, F. Koentgen, L. Robb, M. Feneley and R. P. Harvey (2000). Cardiac septal and valvular dysmorphogenesis in mice heterozygous for mutations in the homeobox gene Nkx2-5. Circ Res 87, 888-895.

Biel, M., C. Wahl-Schott, S. Michalakis and X. Zong (2009). Hyperpolarization-activated cation channels: from genes to function. Physiol Rev 89, 847-885.

Biswas, G., S. Srinivasan, H. K. Anandatheerthavarada and N. G. Avadhani (2008). Dioxin-mediated tumor progression through activation of mitochondria-to-nucleus stress signaling. Proc Natl Acad Sci U S A 105, 186-191.

103

Black, B. L. and E. N. Olson (1998). Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Annu Rev Cell Dev Biol 14, 167-196.

Blümler P (1999). Dioxin: Seveso, Vietnam and everyday exposure, PH307: Disasters. Handout

Bocio, A. and J. L. Domingo (2005). Daily intake of polychlorinated dibenzo-p-dioxins/polychlorinated dibenzofurans (PCDD/PCDFs) in foodstuffs consumed in Tarragona, Spain: a review of recent studies (2001-2003) on human PCDD/PCDF exposure through the diet. Environ Res 97, 1-9.

Bock, K. W. and C. Kohle (2006). Ah receptor: dioxin-mediated toxic responses as hints to deregulated physiologic functions. Biochem Pharmacol 72, 393-404.

Boheler, K. R., J. Czyz, D. Tweedie, H. T. Yang, S. V. Anisimov and A. M. Wobus (2002). Differentiation of pluripotent embryonic stem cells into cardiomyocytes. Circ Res 91, 189-201.

Bondue, A., G. Lapouge, C. Paulissen, C. Semeraro, M. Iacovino, M. Kyba and C. Blanpain (2008). Mesp1 acts as a master regulator of multipotent cardiovascular progenitor specification. Cell Stem Cell 3, 69-84.

Bourillot, P. Y., I. Aksoy, V. Schreiber, F. Wianny, H. Schulz, O. Hummel, N. Hubner and P. Savatier (2009). Novel STAT3 target genes exert distinct roles in the inhibition of mesoderm and endoderm differentiation in cooperation with Nanog. Stem Cells 27, 1760-1771.

Boyer, L. A., D. Mathur and R. Jaenisch (2006). Molecular control of pluripotency. Curr Opin Genet Dev 16, 455-462.

Bruggeman, V., Q. Swennen, B. De Ketelaere, O. Onagbesan, K. Tona and E. Decuypere (2003). Embryonic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin in chickens: effects of dose and embryonic stage on hatchability and growth. Comp Biochem Physiol C Toxicol Pharmacol 136, 17-28.

Bruner-Tran, K. L. and K. G. Osteen (2011). Developmental exposure to TCDD reduces fertility and negatively affects pregnancy outcomes across multiple generations. Reprod Toxicol 31, 344-350.

Brunstrom, B. (1986). Activities in chick embryos of 7-ethoxycoumarin O-deethylase and aryl hydrocarbon (benzo[a]pyrene) hydroxylase and their induction by 3,3',4,4'-tetrachlorobiphenyl in early embryos. Xenobiotica 16, 865-872.

Brunstrom, B. (1988). Sensitivity of embryos from duck, goose, herring gull, and various chicken breeds to 3,3',4,4'-tetrachlorobiphenyl. Poult Sci 67, 52-57.

Brunstrom, B. and J. Lund (1988). Differences between chick and turkey embryos in sensitivity to 3,3',4,4'-tetrachloro-biphenyl and in concentration/affinity of the hepatic receptor for 2,3,7,8- tetrachlorodibenzo-p-dioxin. Comp Biochem Physiol C 91, 507-512.

Buesen, R., E. Genschow, B. Slawik, A. Visan, H. Spielmann, A. Luch and A. Seiler (2009). Embryonic stem cell test remastered: comparison between the validated EST and the new molecular FACS- EST for assessing developmental toxicity in vitro. Toxicol Sci 108, 389-400.

Butler, R. A., M. L. Kelley, W. H. Powell, M. E. Hahn and R. J. Van Beneden (2001). An aryl hydrocarbon receptor (AHR) homologue from the soft-shell clam, Mya arenaria: evidence that

104

invertebrate AHR homologues lack 2,3,7,8-tetrachlorodibenzo-p-dioxin and beta-naphthoflavone binding. Gene 278, 223-234.

Campbell, S. J., C. J. Henderson, D. C. Anthony, D. Davidson, A. J. Clark and C. R. Wolf (2005). The murine Cyp1a1 gene is expressed in a restricted spatial and temporal pattern during embryonic development. J Biol Chem 280, 5828-5835.

Cao, R., Y. Tsukada and Y. Zhang (2005). Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing. Mol Cell 20, 845-854.

Carney, S. A., J. Chen, C. G. Burns, K. M. Xiong, R. E. Peterson and W. Heideman (2006). Aryl hydrocarbon receptor activation produces heart-specific transcriptional and toxic responses in developing zebrafish. Mol Pharmacol 70, 549-561.

Casalena, G., I. Daehn and E. Bottinger (2012). Transforming growth factor-beta, bioenergetics, and mitochondria in renal disease. Semin Nephrol 32, 295-303.

Caspi, O., I. Huber, I. Kehat, M. Habib, G. Arbel, A. Gepstein, L. Yankelson, D. Aronson, R. Beyar and L. Gepstein (2007). Transplantation of human embryonic stem cell-derived cardiomyocytes improves myocardial performance in infarcted rat hearts. J Am Coll Cardiol 50, 1884-1893.

Cerlesi, S., A. Di Domenico and S. Ratti (1989). 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) persistence in the Seveso (Milan, Italy) soil. Ecotoxicol Environ Saf 18, 149-164.

Chaldoupi, S. M., P. Loh, R. N. Hauer, J. M. de Bakker and H. V. van Rijen (2009). The role of connexin40 in atrial fibrillation. Cardiovasc Res 84, 15-23.

Chambers, I. and A. Smith (2004). Self-renewal of teratocarcinoma and embryonic stem cells. Oncogene 23, 7150-7160.

Chambers, I. and S. R. Tomlinson (2009). The transcriptional foundation of pluripotency. Development 136, 2311-2322.

Chan, J. K., Y. B. Man, G. H. Xing, S. C. Wu, M. B. Murphy, Y. Xu and M. H. Wong (2013). Dietary exposure to polychlorinated dibenzo-p-dioxins and dibenzofurans via fish consumption and dioxin-like activity in fish determined by H4IIE-luc bioassay. Sci Total Environ 463-464, 1192- 1200.

Chen, S. C., T. L. Liao, Y. H. Wei, C. R. Tzeng and S. H. Kao (2010). Endocrine disruptor, dioxin (TCDD)-induced mitochondrial dysfunction and apoptosis in human trophoblast-like JAR cells. Mol Hum Reprod 16, 361-372.

Chien, K. R. (2000). Genomic circuits and the integrative biology of cardiac diseases. Nature 407, 227- 232.

Choi, J. W., M. Matsuda, M. Kawano, B. Y. Min and T. Wakimoto (2001). Accumulation profiles of persistent organochlorines in waterbirds from an estuary in Korea. Arch Environ Contam Toxicol 41, 353-363.

Cohen, E. D., Y. Tian and E. E. Morrisey (2008). Wnt signaling: an essential regulator of cardiovascular differentiation, morphogenesis and progenitor self-renewal. Development 135, 789-798.

105

Damstra, T. (2002). Potential effects of certain persistent organic pollutants and endocrine disrupting chemicals on the health of children. J Toxicol Clin Toxicol 40, 457-465.

Das, R., S. Xu, X. Quan, T. T. Nguyen, I. D. Kong, C. H. Chung, E. Y. Lee, S. K. Cha and K. S. Park (2014). Upregulation of mitochondrial Nox4 mediates TGF-beta-induced apoptosis in cultured mouse podocytes. Am J Physiol Renal Physiol 306, F155-167.

Davila, J. C., G. G. Cezar, M. Thiede, S. Strom, T. Miki and J. Trosko (2004). Use and application of stem cells in toxicology. Toxicol Sci 79, 214-223.

Dehal, P., Y. Satou, R. K. Campbell, J. Chapman, B. Degnan, A. De Tomaso, B. Davidson, A. Di Gregorio, M. Gelpke, D. M. Goodstein, N. Harafuji, K. E. Hastings, I. Ho, K. Hotta, W. Huang, T. Kawashima, P. Lemaire, D. Martinez, I. A. Meinertzhagen, S. Necula, M. Nonaka, N. Putnam, S. Rash, H. Saiga, M. Satake, A. Terry, L. Yamada, H. G. Wang, S. Awazu, K. Azumi, J. Boore, M. Branno, S. Chin-Bow, R. DeSantis, S. Doyle, P. Francino, D. N. Keys, S. Haga, H. Hayashi, K. Hino, K. S. Imai, K. Inaba, S. Kano, K. Kobayashi, M. Kobayashi, B. I. Lee, K. W. Makabe, C. Manohar, G. Matassi, M. Medina, Y. Mochizuki, S. Mount, T. Morishita, S. Miura, A. Nakayama, S. Nishizaka, H. Nomoto, F. Ohta, K. Oishi, I. Rigoutsos, M. Sano, A. Sasaki, Y. Sasakura, E. Shoguchi, T. Shin-i, A. Spagnuolo, D. Stainier, M. M. Suzuki, O. Tassy, N. Takatori, M. Tokuoka, K. Yagi, F. Yoshizaki, S. Wada, C. Zhang, P. D. Hyatt, F. Larimer, C. Detter, N. Doggett, T. Glavina, T. Hawkins, P. Richardson, S. Lucas, Y. Kohara, M. Levine, N. Satoh and D. S. Rokhsar (2002). The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science 298, 2157-2167.

Denis, M., S. Cuthill, A. C. Wikstrom, L. Poellinger and J. A. Gustafsson (1988). Association of the dioxin receptor with the Mr 90,000 heat shock protein: a structural kinship with the glucocorticoid receptor. Biochem Biophys Res Commun 155, 801-807.

Denison, M. S., J. M. Fisher and J. P. Whitlock, Jr. (1988). The DNA recognition site for the dioxin-Ah receptor complex. Nucleotide sequence and functional analysis. J Biol Chem 263, 17221-17224.

Denison, M. S., A. B. Okey, J. W. Hamilton, S. E. Bloom and C. F. Wilkinson (1986). Ah receptor for 2,3,7,8-tetrachlorodibenzo-p-dioxin: ontogeny in chick embryo liver. J Biochem Toxicol 1, 39-49.

Denison, M. S., A. Pandini, S. R. Nagy, E. P. Baldwin and L. Bonati (2002). Ligand binding and activation of the Ah receptor. Chem Biol Interact 141, 3-24.

Denison, M. S., A. A. Soshilov, G. He, D. E. DeGroot and B. Zhao (2011). Exactly the same but different: promiscuity and diversity in the molecular mechanisms of action of the aryl hydrocarbon (dioxin) receptor. Toxicol Sci 124, 1-22.

DeVito, M. J., L. S. Birnbaum, W. H. Farland and T. A. Gasiewicz (1995). Comparisons of estimated human body burdens of dioxinlike chemicals and TCDD body burdens in experimentally exposed animals. Environ Health Perspect 103, 820-831.

Dey, A. and D. W. Nebert (1998). Markedly increased constitutive CYP1A1 mRNA levels in the fertilized ovum of the mouse. Biochem Biophys Res Commun 251, 657-661.

106 di Domenico, A., V. Silano, G. Viviano and G. Zapponi (1980). Accidental release of 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD) at Seveso, Italy. V. Environmental persistence of TCDD in soil. Ecotoxicol Environ Saf 4, 339-345.

Doetschman, T., R. G. Gregg, N. Maeda, M. L. Hooper, D. W. Melton, S. Thompson and O. Smithies (1987). Targetted correction of a mutant HPRT gene in mouse embryonic stem cells. Nature 330, 576-578.

Doetschman, T. C., H. Eistetter, M. Katz, W. Schmidt and R. Kemler (1985). The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol 87, 27-45.

Doss, M. X., J. Winkler, S. Chen, R. Hippler-Altenburg, I. Sotiriadou, M. Halbach, K. Pfannkuche, H. Liang, H. Schulz, O. Hummel, N. Hubner, R. Rottscheidt, J. Hescheler and A. Sachinidis (2007). Global transcriptome analysis of murine embryonic stem cell-derived cardiomyocytes. Genome Biol 8, R56.

Dummer, T. J., H. O. Dickinson and L. Parker (2003). Adverse pregnancy outcomes around incinerators and crematoriums in Cumbria, north west England, 1956-93. J Epidemiol Community Health 57, 456-461.

Duncan, D. M., E. A. Burgess and I. Duncan (1998). Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes Dev 12, 1290-1303.

Durocher, D., F. Charron, R. Warren, R. J. Schwartz and M. Nemer (1997). The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J 16, 5687-5696.

Dwyer, J. H. and D. Flesch-Janys (1995). Agent Orange in Vietnam. Am J Public Health 85, 476-478.

El Sharaby, A. A., M. Egerbacher, A. K. Hammoda and P. Bock (2001). Immunohistochemical demonstration of Leu-7 (HNK-1), Neurone-specific Enolase (NSE) and Protein-Gene Peptide (PGP) 9.5 in the developing camel (Camelus dromedarius) heart. Anat Histol Embryol 30, 321- 325.

Emmons, R. B., D. Duncan and I. Duncan (2007). Regulation of the Drosophila distal antennal determinant spineless. Dev Biol 302, 412-426.

Emmons, R. B., D. Duncan, P. A. Estes, P. Kiefel, J. T. Mosher, M. Sonnenfeld, M. P. Ward, I. Duncan and S. T. Crews (1999). The spineless-aristapedia and tango bHLH-PAS proteins interact to control antennal and tarsal development in Drosophila. Development 126, 3937-3945.

Environment Australia (1999). Incineration and Dioxins: Review of Formation Processes consultancy report prepared by Environmental and Safety Services for Environment Australia. Commonwealth Department of the Environment and Heritage, Canberra.

Espinoza-Lewis, R. A., L. Yu, F. He, H. Liu, R. Tang, J. Shi, X. Sun, J. F. Martin, D. Wang, J. Yang and Y. Chen (2009). Shox2 is essential for the differentiation of cardiac pacemaker cells by repressing Nkx2-5. Dev Biol 327, 376-385.

107

EU (1986) Council Directive 86/609/EEC on the approximation of laws. Regulations and administrative provisions of the Member States regarding the protection of animals used for experimental and other scientific purposes. Official Journal L 358, 18/12/1986 P. 0001–0028. http://ec.europa.eu/environment/chemicals/lab_animals/home_en.htm accessed (Jul. 20. 2015).

Evans, M. J. and M. H. Kaufman (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154-156.

Fernandez-Salguero, P., T. Pineau, D. M. Hilbert, T. McPhail, S. S. Lee, S. Kimura, D. W. Nebert, S. Rudikoff, J. M. Ward and F. J. Gonzalez (1995). Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science 268, 722-726.

Fernandez-Salguero, P. M., D. M. Hilbert, S. Rudikoff, J. M. Ward and F. J. Gonzalez (1996). Aryl- hydrocarbon receptor-deficient mice are resistant to 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced toxicity. Toxicol Appl Pharmacol 140, 173-179.

Festag, M., B. Viertel, P. Steinberg and C. Sehner (2007). An in vitro embryotoxicity assay based on the disturbance of the differentiation of murine embryonic stem cells into endothelial cells. II. Testing of compounds. Toxicol In Vitro 21, 1631-1640.

Fishman, M. C. and K. R. Chien (1997). Fashioning the vertebrate heart: earliest embryonic decisions. Development 124, 2099-2117.

Frakes, R. A., C. Q. Zeeman and B. Mower (1993). Bioaccumulation of 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD) by fish downstream of pulp and paper mills in Maine. Ecotoxicol Environ Saf 25, 244-252.

Franco, D., W. H. Lamers and A. F. Moorman (1998). Patterns of expression in the developing myocardium: towards a morphologically integrated transcriptional model. Cardiovasc Res 38, 25- 53.

Fu, J. D., P. Jiang, S. Rushing, J. Liu, N. Chiamvimonvat and R. A. Li (2010). Na+/Ca2+ exchanger is a determinant of excitation-contraction coupling in human embryonic stem cell-derived ventricular cardiomyocytes. Stem Cells Dev 19, 773-782.

Fujii-Kuriyama, Y. and K. Kawajiri (2010). Molecular mechanisms of the physiological functions of the aryl hydrocarbon (dioxin) receptor, a multifunctional regulator that senses and responds to environmental stimuli. Proc Jpn Acad Ser B Phys Biol Sci 86, 40-53.

Fuks, F., W. A. Burgers, N. Godin, M. Kasai and T. Kouzarides (2001). Dnmt3a binds deacetylases and is recruited by a sequence-specific repressor to silence transcription. EMBO J 20, 2536-2544.

Fukuda, K. and S. Yuasa (2006). Stem cells as a source of regenerative cardiomyocytes. Circ Res 98, 1002-1013.

Fukunaga, B. N., M. R. Probst, S. Reisz-Porszasz and O. Hankinson (1995). Identification of functional domains of the aryl hydrocarbon receptor. J Biol Chem 270, 29270-29278.

Furness, S. G. and F. Whelan (2009). The pleiotropy of dioxin toxicity--xenobiotic misappropriation of the aryl hydrocarbon receptor's alternative physiological roles. Pharmacol Ther 124, 336-353.

108

Garcia-Cao, M., R. O'Sullivan, A. H. Peters, T. Jenuwein and M. A. Blasco (2004). Epigenetic regulation of telomere length in mammalian cells by the Suv39h1 and Suv39h2 histone methyltransferases. Nat Genet 36, 94-99.

Genschow, E., G. Scholz, N. Brown, A. Piersma, M. Brady, N. Clemann, H. Huuskonen, F. Paillard, S. Bremer, K. Becker and H. Spielmann (2000). Development of prediction models for three in vitro embryotoxicity tests in an ECVAM validation study. In Vitr Mol Toxicol 13, 51-66.

Gertsenstein, M., L. M. Nutter, T. Reid, M. Pereira, W. L. Stanford, J. Rossant and A. Nagy (2010). Efficient generation of germ line transmitting chimeras from C57BL/6N ES cells by aggregation with outbred host embryos. PLoS One 5, e11260.

Gessert, S. and M. Kuhl (2010). The multiple phases and faces of wnt signaling during cardiac differentiation and development. Circ Res 107, 186-199.

Giesy, J. P., J. P. Ludwig and D. E. Tillitt (1994). Deformities in birds of the great lakes region. Environ Sci Technol 28, 128A-135A.

Godoy, J. A., M. S. Arrazola, D. Ordenes, C. Silva-Alvarez, N. Braidy and N. C. Inestrosa (2014). Wnt- 5a ligand modulates mitochondrial fission-fusion in rat hippocampal neurons. J Biol Chem 289, 36179-36193.

Gonzalez, F. J. and P. Fernandez-Salguero (1998). The aryl hydrocarbon receptor: studies using the AHR- null mice. Drug Metab Dispos 26, 1194-1198.

Gough, M. (1991). Agent Orange: exposure and policy. Am J Public Health 81, 289-290.

Greulich, F., C. Rudat and A. Kispert (2011). Mechanisms of T-box gene function in the developing heart. Cardiovasc Res 91, 212-222.

Gu, Y. Z., J. B. Hogenesch and C. A. Bradfield (2000). The PAS superfamily: sensors of environmental and developmental signals. Annu Rev Pharmacol Toxicol 40, 519-561.

Guo, X. and X. F. Wang (2009). Signaling cross-talk between TGF-beta/BMP and other pathways. Cell Res 19, 71-88.

Hahn, M. E. (2001). Dioxin toxicology and the aryl hydrocarbon receptor: insights from fish and other non-traditional models. Mar Biotechnol (NY) 3, S224-238.

Hahn, M. E. (2002). Aryl hydrocarbon receptors: diversity and evolution. Chem Biol Interact 141, 131- 160.

Hahn, M. E., S. I. Karchner, B. R. Evans, D. G. Franks, R. R. Merson and J. M. Lapseritis (2006). Unexpected diversity of aryl hydrocarbon receptors in non-mammalian vertebrates: insights from comparative genomics. J Exp Zool A Comp Exp Biol 305, 693-706.

Hahn, M. E., S. I. Karchner, M. A. Shapiro and S. A. Perera (1997). Molecular evolution of two vertebrate aryl hydrocarbon (dioxin) receptors (AHR1 and AHR2) and the PAS family. Proc Natl Acad Sci U S A 94, 13743-13748.

109

Handley-Goldstone, H. M., M. W. Grow and J. J. Stegeman (2005). Cardiovascular gene expression profiles of dioxin exposure in zebrafish embryos. Toxicol Sci 85, 683-693.

Harstad, E. B., C. A. Guite, T. L. Thomae and C. A. Bradfield (2006). Liver deformation in Ahr-null mice: evidence for aberrant hepatic perfusion in early development. Mol Pharmacol 69, 1534-1541.

Harvey, R. P. (1996). NK-2 homeobox genes and heart development. Dev Biol 178, 203-216.

Harzheim, D., K. H. Pfeiffer, L. Fabritz, E. Kremmer, T. Buch, A. Waisman, P. Kirchhof, U. B. Kaupp and R. Seifert (2008). Cardiac pacemaker function of HCN4 channels in mice is confined to embryonic development and requires cyclic AMP. EMBO J 27, 692-703.

Hattori, F., H. Chen, H. Yamashita, S. Tohyama, Y. S. Satoh, S. Yuasa, W. Li, H. Yamakawa, T. Tanaka, T. Onitsuka, K. Shimoji, Y. Ohno, T. Egashira, R. Kaneda, M. Murata, K. Hidaka, T. Morisaki, E. Sasaki, T. Suzuki, M. Sano, S. Makino, S. Oikawa and K. Fukuda (2010). Nongenetic method for purifying stem cell-derived cardiomyocytes. Nat Methods 7, 61-66.

Hemenway, C. S., B. W. Halligan, G. C. Gould and L. S. Levy (2000). Identification and analysis of a third mouse Polycomb gene, MPc3. Gene 242, 31-40.

Henry, T. R., J. M. Spitsbergen, M. W. Hornung, C. C. Abnet and R. E. Peterson (1997). Early life stage toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in zebrafish (Danio rerio). Toxicol Appl Pharmacol 142, 56-68.

Hescheler, J., B. K. Fleischmann, S. Lentini, V. A. Maltsev, J. Rohwedel, A. M. Wobus and K. Addicks (1997). Embryonic stem cells: a model to study structural and functional properties in cardiomyogenesis. Cardiovasc Res 36, 149-162.

Hewitt, M., C. M. Ellison, S. J. Enoch, J. C. Madden and M. T. Cronin (2010). Integrating (Q)SAR models, expert systems and read-across approaches for the prediction of developmental toxicity. Reprod Toxicol 30, 147-160.

Hiroi, Y., S. Kudoh, K. Monzen, Y. Ikeda, Y. Yazaki, R. Nagai and I. Komuro (2001). Tbx5 associates with Nkx2-5 and synergistically promotes cardiomyocyte differentiation. Nat Genet 28, 276-280.

Hoffman, D. J., B. A. Rattner, L. Sileo, D. Docherty and T. J. Kubiak (1987). Embryotoxicity, teratogenicity, and aryl hydrocarbon hydroxylase activity in Forster's terns on Green Bay, Lake Michigan. Environ Res 42, 176-184.

Hofsteen, P., V. Mehta, M. S. Kim, R. E. Peterson and W. Heideman (2013). TCDD inhibits heart regeneration in adult zebrafish. Toxicol Sci 132, 211-221.

Hogan, B. L. (1996). Bone morphogenetic proteins in development. Curr Opin Genet Dev 6, 432-438.

Hogan, B. L. (1996). Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev 10, 1580-1594.

Horsley, D., A. Hutchings, G. W. Butcher and P. B. Singh (1996). M32, a murine homologue of Drosophila heterochromatin protein 1 (HP1), localises to euchromatin within interphase nuclei and is largely excluded from constitutive heterochromatin. Cytogenet Cell Genet 73, 308-311.

110

Houweling, A. C., M. M. van Borren, A. F. Moorman and V. M. Christoffels (2005). Expression and regulation of the atrial natriuretic factor encoding gene Nppa during development and disease. Cardiovasc Res 67, 583-593.

Hu, J., M. Zheng, W. Liu, C. Li, Z. Nie, G. Liu, K. Xiao and S. Dong (2013). Occupational exposure to polychlorinated dibenzo-p-dioxins and dibenzofurans, dioxin-like polychlorinated biphenyls, and polychlorinated naphthalenes in workplaces of secondary nonferrous metallurgical facilities in China. Environ Sci Technol 47, 7773-7779.

Huang, X., J. A. Powell-Coffman and Y. Jin (2004). The AHR-1 aryl hydrocarbon receptor and its co- factor the AHA-1 aryl hydrocarbon receptor nuclear translocator specify GABAergic neuron cell fate in C. elegans. Development 131, 819-828.

Huber, I., I. Itzhaki, O. Caspi, G. Arbel, M. Tzukerman, A. Gepstein, M. Habib, L. Yankelson, I. Kehat and L. Gepstein (2007). Identification and selection of cardiomyocytes during human embryonic stem cell differentiation. FASEB J 21, 2551-2563.

Ikuta, T., H. Eguchi, T. Tachibana, Y. Yoneda and K. Kawajiri (1998). Nuclear localization and export signals of the human aryl hydrocarbon receptor. J Biol Chem 273, 2895-2904.

Inui, H., T. Itoh, K. Yamamoto, S. Ikushiro and T. Sakaki (2014). Mammalian cytochrome P450- dependent metabolism of polychlorinated dibenzo-p-dioxins and coplanar polychlorinated biphenyls. Int J Mol Sci 15, 14044-14057.

IPCS (1989). Polychlorinated Dibenso-Para-Dioxin and Dibenzofurans. International Programme on Chemical Safety.

Ismail, I. H., J. P. Gagne, M. C. Caron, D. McDonald, Z. Xu, J. Y. Masson, G. G. Poirier and M. J. Hendzel (2012). CBX4-mediated SUMO modification regulates BMI1 recruitment at sites of DNA damage. Nucleic Acids Res 40, 5497-5510.

Isono, K., Y. Fujimura, J. Shinga, M. Yamaki, O. W. J, Y. Takihara, Y. Murahashi, Y. Takada, Y. Mizutani-Koseki and H. Koseki (2005). Mammalian polyhomeotic homologues Phc2 and Phc1 act in synergy to mediate polycomb repression of Hox genes. Mol Cell Biol 25, 6694-6706.

Ivnitski-Steele, I. and M. K. Walker (2005). Inhibition of neovascularization by environmental agents. Cardiovasc Toxicol 5, 215-226.

Ivnitski-Steele, I. D., M. Friggens, M. Chavez and M. K. Walker (2005). 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD) inhibition of coronary vasculogenesis is mediated, in part, by reduced responsiveness to endogenous angiogenic stimuli, including vascular endothelial growth factor A (VEGF-A). Birth Defects Res A Clin Mol Teratol 73, 440-446.

Jaenisch, R. and R. Young (2008). Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell 132, 567-582.

Janz, D. M. and G. D. Bellward (1996). In ovo 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure in three avian species. 1. Effects on thyroid hormones and growth during the perinatal period. Toxicol Appl Pharmacol 139, 281-291.

111

Jeong, K. S., J. H. Park and S. Lee (2005). The analysis of X-chromosome inactivation-related gene expression from single mouse embryo with sex-determination. Biochem Biophys Res Commun 333, 803-807.

Karchner, S. I., D. G. Franks, S. W. Kennedy and M. E. Hahn (2006). The molecular basis for differential dioxin sensitivity in birds: role of the aryl hydrocarbon receptor. Proc Natl Acad Sci U S A 103, 6252-6257.

Karchner, S. I., W. H. Powell and M. E. Hahn (1999). Identification and functional characterization of two highly divergent aryl hydrocarbon receptors (AHR1 and AHR2) in the teleost Fundulus heteroclitus. Evidence for a novel subfamily of ligand-binding basic helix loop helix-Per-ARNT- Sim (bHLH-PAS) factors. J Biol Chem 274, 33814-33824.

Kattman, S. J., A. D. Witty, M. Gagliardi, N. C. Dubois, M. Niapour, A. Hotta, J. Ellis and G. Keller (2011). Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell Stem Cell 8, 228-240.

Kehat, I., D. Kenyagin-Karsenti, M. Snir, H. Segev, M. Amit, A. Gepstein, E. Livne, O. Binah, J. Itskovitz-Eldor and L. Gepstein (2001). Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. J Clin Invest 108, 407-414.

Kelada, F. S. (1990). Occupational intake by dermal exposure to polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans in pulp mill industry. Am Ind Hyg Assoc J 51, 519-521.

Keller, G. (2005). Embryonic stem cell differentiation: emergence of a new era in biology and medicine. Genes Dev 19, 1129-1155.

Keller, G. M. (1995). In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 7, 862-869.

Kennedy, L. H., C. H. Sutter, S. Leon Carrion, Q. T. Tran, S. Bodreddigari, E. Kensicki, R. P. Mohney and T. R. Sutter (2013). 2,3,7,8-Tetrachlorodibenzo-p-dioxin-mediated production of reactive oxygen species is an essential step in the mechanism of action to accelerate human keratinocyte differentiation. Toxicol Sci 132, 235-249.

Kennedy, S. W., A. Lorenzen, S. P. Jones, M. E. Hahn and J. J. Stegeman (1996). Cytochrome P4501A induction in avian hepatocyte cultures: a promising approach for predicting the sensitivity of avian species to toxic effects of halogenated aromatic hydrocarbons. Toxicol Appl Pharmacol 141, 214-230.

Kewley, R. J., M. L. Whitelaw and A. Chapman-Smith (2004). The mammalian basic helix-loop- helix/PAS family of transcriptional regulators. Int J Biochem Cell Biol 36, 189-204.

Kim, H. Y., H. R. Kim, M. G. Kang, N. T. Trang, H. J. Baek, J. D. Moon, J. H. Shin, S. P. Suh, D. W. Ryang, H. Kook and M. G. Shin (2014). Profiling of biomarkers for the exposure of polycyclic aromatic hydrocarbons: lamin-A/C isoform 3, poly[ADP-ribose] polymerase 1, and mitochondria copy number are identified as universal biomarkers. Biomed Res Int 2014, 605135.

Kim, M. D., L. Y. Jan and Y. N. Jan (2006). The bHLH-PAS protein Spineless is necessary for the diversification of dendrite morphology of Drosophila dendritic arborization neurons. Genes Dev 20, 2806-2819.

112

Kitajima, M., K. N. Khan, A. Fujishita, H. Masuzaki, T. Koji and T. Ishimaru (2004). Expression of the arylhydrocarbon receptor in the peri-implantation period of the mouse uterus and the impact of dioxin on mouse implantation. Arch Histol Cytol 67, 465-474.

Klug, M. G., M. H. Soonpaa, G. Y. Koh and L. J. Field (1996). Genetically selected cardiomyocytes from differentiating embronic stem cells form stable intracardiac grafts. J Clin Invest 98, 216-224.

Kolaja, K. (2014). Stem cells and stem cell-derived tissues and their use in safety assessment. J Biol Chem 289, 4555-4561.

Kopf, P. G. and M. K. Walker (2009). Overview of developmental heart defects by dioxins, PCBs, and pesticides. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev 27, 276-285.

Kubiak, T. J., H. J. Harris, L. M. Smith, T. R. Schwartz, D. L. Stalling, J. A. Trick, L. Sileo, D. E. Docherty and T. C. Erdman (1989). Microcontaminants and reproductive impairment of the Forster's tern on Green Bay, Lake Michigan--1983. Arch Environ Contam Toxicol 18, 706-727.

Kuehl, K. S. and C. A. Loffredo (2006). A cluster of hypoplastic left heart malformation in Baltimore, Maryland. Pediatr Cardiol 27, 25-31.

Kumar, D., T. J. Kamp and M. M. LeWinter (2005). Embryonic stem cells: differentiation into cardiomyocytes and potential for heart repair and regeneration. Coron Artery Dis 16, 111-116.

Kuruppu, S. and A. I. Smith (2012). Endothelin Converting Enzyme-1 phosphorylation and trafficking. FEBS Lett 586, 2212-2217.

Kuske, B., P. Y. Pulyanina and N. I. zur Nieden (2012). Embryonic stem cell test: stem cell use in predicting developmental cardiotoxicity and osteotoxicity. Methods Mol Biol 889, 147-179.

Laflamme, M. A. and C. E. Murry (2011). Heart regeneration. Nature 473, 326-335.

Laget, S., M. Joulie, F. Le Masson, N. Sasai, E. Christians, S. Pradhan, R. J. Roberts and P. A. Defossez (2010). The human proteins MBD5 and MBD6 associate with heterochromatin but they do not bind methylated DNA. PLoS One 5, e11982.

Lahvis, G. P. and C. A. Bradfield (1998). Ahr null alleles: distinctive or different? Biochem Pharmacol 56, 781-787.

Lahvis, G. P., S. L. Lindell, R. S. Thomas, R. S. McCuskey, C. Murphy, E. Glover, M. Bentz, J. Southard and C. A. Bradfield (2000). Portosystemic shunting and persistent fetal vascular structures in aryl hydrocarbon receptor-deficient mice. Proc Natl Acad Sci U S A 97, 10442-10447.

Lahvis, G. P., R. W. Pyzalski, E. Glover, H. C. Pitot, M. K. McElwee and C. A. Bradfield (2005). The aryl hydrocarbon receptor is required for developmental closure of the ductus venosus in the neonatal mouse. Mol Pharmacol 67, 714-720.

Lai, T. J., X. Liu, Y. L. Guo, N. W. Guo, M. L. Yu, C. C. Hsu and W. J. Rogan (2002). A cohort study of behavioral problems and intelligence in children with high prenatal polychlorinated biphenyl exposure. Arch Gen Psychiatry 59, 1061-1066.

113

Lanham, K. A., R. E. Peterson and W. Heideman (2012). Sensitivity to dioxin decreases as zebrafish mature. Toxicol Sci 127, 360-370.

Lazzaro, M. A. and D. J. Picketts (2001). Cloning and characterization of the murine Imitation Switch (ISWI) genes: differential expression patterns suggest distinct developmental roles for Snf2h and Snf2l. J Neurochem 77, 1145-1156.

Lessard, J., J. I. Wu, J. A. Ranish, M. Wan, M. M. Winslow, B. T. Staahl, H. Wu, R. Aebersold, I. A. Graef and G. R. Crabtree (2007). An essential switch in subunit composition of a chromatin remodeling complex during neural development. Neuron 55, 201-215.

Lian, X., J. Zhang, S. M. Azarin, K. Zhu, L. B. Hazeltine, X. Bao, C. Hsiao, T. J. Kamp and S. P. Palecek (2013). Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/beta-catenin signaling under fully defined conditions. Nat Protoc 8, 162-175.

Lien, C. L., C. Wu, B. Mercer, R. Webb, J. A. Richardson and E. N. Olson (1999). Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer. Development 126, 75- 84.

Lin, T. M., K. Ko, R. W. Moore, U. Simanainen, T. D. Oberley and R. E. Peterson (2002). Effects of aryl hydrocarbon receptor null mutation and in utero and lactational 2,3,7,8-tetrachlorodibenzo-p- dioxin exposure on prostate and seminal vesicle development in C57BL/6 mice. Toxicol Sci 68, 479-487.

Liu, W. and A. C. Foley (2011). Signaling pathways in early cardiac development. Wiley Interdiscip Rev Syst Biol Med 3, 191-205.

Loebel, D. A., C. M. Watson, R. A. De Young and P. P. Tam (2003). Lineage choice and differentiation in mouse embryos and embryonic stem cells. Dev Biol 264, 1-14.

Lorenzen, A., J. L. Shutt and S. W. Kennedy (1997). Sensitivity of common tern (Sterna hirundo) embryo HepatocyteCultures to CYP1A induction and porphyrin accumulation by halogenated aromatic hydrocarbons and common tern egg extracts. Arch Environ Contam Toxicol 32, 126-134.

Lund, A. K., M. B. Goens, N. L. Kanagy and M. K. Walker (2003). Cardiac hypertrophy in aryl hydrocarbon receptor null mice is correlated with elevated angiotensin II, endothelin-1, and mean arterial blood pressure. Toxicol Appl Pharmacol 193, 177-187.

Ma, Q. and J. P. Whitlock, Jr. (1997). A novel cytoplasmic protein that interacts with the Ah receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional response to 2,3,7,8- tetrachlorodibenzo-p-dioxin. J Biol Chem 272, 8878-8884.

Maltsev, V. A., J. Rohwedel, J. Hescheler and A. M. Wobus (1993). Embryonic stem cells differentiate in vitro into cardiomyocytes representing sinusnodal, atrial and ventricular cell types. Mech Dev 44, 41-50.

Maltsev, V. A., A. M. Wobus, J. Rohwedel, M. Bader and J. Hescheler (1994). Cardiomyocytes differentiated in vitro from embryonic stem cells developmentally express cardiac-specific genes and ionic currents. Circ Res 75, 233-244.

114

Mandal, P. K. (2005). Dioxin: a review of its environmental effects and its aryl hydrocarbon receptor biology. J Comp Physiol B 175, 221-230.

Martello, G., P. Bertone and A. Smith (2013). Identification of the missing pluripotency mediator downstream of leukaemia inhibitory factor. EMBO J 32, 2561-2574.

Martin, G. R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78, 7634-7638.

Mathew, L. K., S. Sengupta, J. A. Franzosa, J. Perry, J. La Du, E. A. Andreasen and R. L. Tanguay (2009). Comparative expression profiling reveals an essential role for raldh2 in epimorphic regeneration. J Biol Chem 284, 33642-33653.

Matsuda, T., T. Nakamura, K. Nakao, T. Arai, M. Katsuki, T. Heike and T. Yokota (1999). STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J 18, 4261-4269.

McCulley, D. J. and B. L. Black (2012). Transcription factor pathways and congenital heart disease. Curr Top Dev Biol 100, 253-277.

Mehta, V., R. E. Peterson and W. Heideman (2008). 2,3,7,8-Tetrachlorodibenzo-p-dioxin exposure prevents cardiac valve formation in developing zebrafish. Toxicol Sci 104, 303-311.

Miller, J. S., K. A. Alley and P. McGlave (1994). Differentiation of natural killer (NK) cells from human primitive marrow progenitors in a stroma-based long-term culture system: identification of a CD34+7+ NK progenitor. Blood 83, 2594-2601.

Mimura, J., K. Yamashita, K. Nakamura, M. Morita, T. N. Takagi, K. Nakao, M. Ema, K. Sogawa, M. Yasuda, M. Katsuki and Y. Fujii-Kuriyama (1997). Loss of teratogenic response to 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD) in mice lacking the Ah (dioxin) receptor. Genes Cells 2, 645-654.

Minakuchi, M., N. Kakazu, M. J. Gorrin-Rivas, T. Abe, T. D. Copeland, K. Ueda and Y. Adachi (2001). Identification and characterization of SEB, a novel protein that binds to the acute undifferentiated leukemia-associated protein SET. Eur J Biochem 268, 1340-1351.

Mocarelli, P. (2001). Seveso: a teaching story. Chemosphere 43, 391-402.

Moreland, R. T., J. F. Ryan, C. Pan and A. D. Baxevanis (2009). The Homeodomain Resource: a comprehensive collection of sequence, structure, interaction, genomic and functional information on the homeodomain protein family. Database (Oxford) 2009, bap004.

Moretti, A., L. Caron, A. Nakano, J. T. Lam, A. Bernshausen, Y. Chen, Y. Qyang, L. Bu, M. Sasaki, S. Martin-Puig, Y. Sun, S. M. Evans, K. L. Laugwitz and K. R. Chien (2006). Multipotent embryonic isl1+ progenitor cells lead to cardiac, smooth muscle, and endothelial cell diversification. Cell 127, 1151-1165.

Morgan, M., S. Anders, M. Lawrence, P. Aboyoun, H. Pages and R. Gentleman (2009). ShortRead: a bioconductor package for input, quality assessment and exploration of high-throughput sequence data. Bioinformatics 25, 2607-2608.

115

Mummery, C., D. Ward-van Oostwaard, P. Doevendans, R. Spijker, S. van den Brink, R. Hassink, M. van der Heyden, T. Opthof, M. Pera, A. B. de la Riviere, R. Passier and L. Tertoolen (2003). Differentiation of human embryonic stem cells to cardiomyocytes: role of coculture with visceral endoderm-like cells. Circulation 107, 2733-2740.

Murry, C. E. and G. Keller (2008). Differentiation of embryonic stem cells to clinically relevant populations: lessons from embryonic development. Cell 132, 661-680.

Nair, S. C., E. J. Toran, R. A. Rimerman, S. Hjermstad, T. E. Smithgall and D. F. Smith (1996). A pathway of multi-chaperone interactions common to diverse regulatory proteins: estrogen receptor, Fes tyrosine kinase, heat shock transcription factor Hsf1, and the aryl hydrocarbon receptor. Cell Stress Chaperones 1, 237-250.

Nakano, T., H. Kodama and T. Honjo (1994). Generation of lymphohematopoietic cells from embryonic stem cells in culture. Science 265, 1098-1101.

Narayan, N., I. H. Lee, R. Borenstein, J. Sun, R. Wong, G. Tong, M. M. Fergusson, J. Liu, Rovira, II, H. L. Cheng, G. Wang, M. Gucek, D. Lombard, F. W. Alt, M. N. Sack, E. Murphy, L. Cao and T. Finkel (2012). The NAD-dependent deacetylase SIRT2 is required for programmed necrosis. Nature 492, 199-204.

Nielsen, S. J., R. Schneider, U. M. Bauer, A. J. Bannister, A. Morrison, D. O'Carroll, R. Firestein, M. Cleary, T. Jenuwein, R. E. Herrera and T. Kouzarides (2001). Rb targets histone H3 methylation and HP1 to promoters. Nature 412, 561-565.

Nishikawa, S. I., S. Nishikawa, M. Hirashima, N. Matsuyoshi and H. Kodama (1998). Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development 125, 1747-1757.

Niwa, H. (2007). How is pluripotency determined and maintained? Development 134, 635-646.

Niwa, H., T. Burdon, I. Chambers and A. Smith (1998). Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 12, 2048-2060.

O'Carroll, D., H. Scherthan, A. H. Peters, S. Opravil, A. R. Haynes, G. Laible, S. Rea, M. Schmid, A. Lebersorger, M. Jerratsch, L. Sattler, M. G. Mattei, P. Denny, S. D. Brown, D. Schweizer and T. Jenuwein (2000). Isolation and characterization of Suv39h2, a second histone H3 methyltransferase gene that displays testis-specific expression. Mol Cell Biol 20, 9423-9433.

Okano, M., D. W. Bell, D. A. Haber and E. Li (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247-257.

Otsuki, T., K. Yata, A. Takata-Tomokuni, F. Hyodoh, Y. Miura, H. Sakaguchi, T. Hatayama, S. Hatada, T. Tsujioka, Y. Sato, H. Murakami, Y. Sadahira and T. Sugihara (2004). Expression of protein gene product 9.5 (PGP9.5)/ubiquitin-C-terminal hydrolase 1 (UCHL-1) in human myeloma cells. Br J Haematol 127, 292-298.

Pal, R. and A. Khanna (2006). Role of smad- and wnt-dependent pathways in embryonic cardiac development. Stem Cells Dev 15, 29-39.

116

Park, W. H., D. W. Jun, J. T. Kim, J. H. Jeong, H. Park, Y. S. Chang, K. S. Park, H. K. Lee and Y. K. Pak (2013). Novel cell-based assay reveals associations of circulating serum AhR-ligands with metabolic syndrome and mitochondrial dysfunction. Biofactors 39, 494-504.

Patandin, S., P. C. Dagnelie, P. G. Mulder, E. Op de Coul, J. E. van der Veen, N. Weisglas-Kuperus and P. J. Sauer (1999). Dietary exposure to polychlorinated biphenyls and dioxins from infancy until adulthood: A comparison between breast-feeding, toddler, and long-term exposure. Environ Health Perspect 107, 45-51.

Patient, R. K. and J. D. McGhee (2002). The GATA family (vertebrates and invertebrates). Curr Opin Genet Dev 12, 416-422.

Pavanello, S., L. Dioni, M. Hoxha, U. Fedeli, D. Mielzynska-Svach and A. A. Baccarelli (2013). Mitochondrial DNA copy number and exposure to polycyclic aromatic hydrocarbons. Cancer Epidemiol Biomarkers Prev 22, 1722-1729.

Pelclova, D., P. Urban, J. Preiss, E. Lukas, Z. Fenclova, T. Navratil, Z. Dubska and Z. Senholdova (2006). Adverse health effects in humans exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Rev Environ Health 21, 119-138.

Pennings, J. L., D. A. van Dartel, J. F. Robinson, T. E. Pronk and A. H. Piersma (2011). Gene set assembly for quantitative prediction of developmental toxicity in the embryonic stem cell test. Toxicology 284, 63-71.

Pera, M. F. and P. P. Tam (2010). Extrinsic regulation of pluripotent stem cells. Nature 465, 713-720.

Perdew, G. H. and C. A. Bradfield (1996). Mapping the 90 kDa heat shock protein binding region of the Ah receptor. Biochem Mol Biol Int 39, 589-593.

Pereira, A. H., C. F. Clemente, A. C. Cardoso, T. H. Theizen, S. A. Rocco, C. C. Judice, M. C. Guido, V. D. Pascoal, I. Lopes-Cendes, J. R. Souza and K. G. Franchini (2009). MEF2C silencing attenuates load-induced left ventricular hypertrophy by modulating mTOR/S6K pathway in mice. PLoS One 4, e8472.

Pereira, S. P., G. C. Pereira, C. V. Pereira, F. S. Carvalho, M. H. Cordeiro, P. C. Mota, J. Ramalho-Santos, A. J. Moreno and P. J. Oliveira (2013). Dioxin-induced acute cardiac mitochondrial oxidative damage and increased activity of ATP-sensitive potassium channels in Wistar rats. Environ Pollut 180, 281-290.

Peters, A. H., D. O'Carroll, H. Scherthan, K. Mechtler, S. Sauer, C. Schofer, K. Weipoltshammer, M. Pagani, M. Lachner, A. Kohlmaier, S. Opravil, M. Doyle, M. Sibilia and T. Jenuwein (2001). Loss of the Suv39h histone methyltransferases impairs mammalian heterochromatin and genome stability. Cell 107, 323-337.

Peterson, R. E., H. M. Theobald and G. L. Kimmel (1993). Developmental and reproductive toxicity of dioxins and related compounds: cross-species comparisons. Crit Rev Toxicol 23, 283-335.

Plageman, T. F., Jr. and K. E. Yutzey (2004). Differential expression and function of Tbx5 and Tbx20 in cardiac development. J Biol Chem 279, 19026-19034.

117

Plavicki, J., P. Hofsteen, R. E. Peterson and W. Heideman (2013). Dioxin inhibits zebrafish epicardium and proepicardium development. Toxicol Sci 131, 558-567.

Pohjanvirta, R., M. Korkalainen, I. D. Moffat, P. C. Botros, A. B. Okey (2012). The Ah Receptor in Biology and Toxicology (R. Pohjanvirta Eds.) WILEY, Hoboken, NJ.

Pollenz, R. S., S. E. Wilson and E. J. Dougherty (2006). Role of endogenous XAP2 protein on the localization and nucleocytoplasmic shuttling of the endogenous mouse Ahb-1 receptor in the presence and absence of ligand. Mol Pharmacol 70, 1369-1379.

Powell-Coffman, J. A., C. A. Bradfield and W. B. Wood (1998). Caenorhabditis elegans orthologs of the aryl hydrocarbon receptor and its heterodimerization partner the aryl hydrocarbon receptor nuclear translocator. Proc Natl Acad Sci U S A 95, 2844-2849.

Public Health England (2008). Dioxins toxicological Overview. Prepared by the Toxicology Department CRCE, PHE Version 1.

Puga, A. (2011). Perspectives on the potential involvement of the AH receptor-dioxin axis in cardiovascular disease. Toxicol Sci 120, 256-261.

Puga, A., C. R. Tomlinson and Y. Xia (2005). Ah receptor signals cross-talk with multiple developmental pathways. Biochem Pharmacol 69, 199-207.

Qin, H. and J. A. Powell-Coffman (2004). The Caenorhabditis elegans aryl hydrocarbon receptor, AHR-1, regulates neuronal development. Dev Biol 270, 64-75.

Rajala, K., M. Pekkanen-Mattila and K. Aalto-Setala (2011). Cardiac differentiation of pluripotent stem cells. Stem Cells Int 2011, 383709.

Ramadoss, P. and G. H. Perdew (2005). The transactivation domain of the Ah receptor is a key determinant of cellular localization and ligand-independent nucleocytoplasmic shuttling properties. Biochemistry 44, 11148-11159.

Reyes, H., S. Reisz-Porszasz and O. Hankinson (1992). Identification of the Ah receptor nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science 256, 1193-1195.

Riazi, A. M., J. K. Takeuchi, L. K. Hornberger, S. H. Zaidi, F. Amini, J. Coles, B. G. Bruneau and G. S. Van Arsdell (2009). NKX2-5 regulates the expression of beta-catenin and GATA4 in ventricular myocytes. PLoS One 4, e5698.

Rohwedel, J., K. Guan, C. Hegert and A. M. Wobus (2001). Embryonic stem cells as an in vitro model for mutagenicity, cytotoxicity and embryotoxicity studies: present state and future prospects. Toxicol In Vitro 15, 741-753.

Rosa, A. and A. H. Brivanlou (2013). Regulatory non-coding RNAs in pluripotent stem cells. Int J Mol Sci 14, 14346-14373.

Rowlands, J. C., I. J. McEwan and J. A. Gustafsson (1996). Trans-activation by the human aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator proteins: direct interactions with basal transcription factors. Mol Pharmacol 50, 538-548.

118

Roy, N. K. and I. Wirgin (1997). Characterization of the aromatic hydrocarbon receptor gene and its expression in Atlantic tomcod. Arch Biochem Biophys 344, 373-386.

Ryan, J. J. and R. J. Norstrom (1991). Occurrence of polychlorinated dibenzodibenzo-p-dioxins and dibenzofurans in humans and major exposure routes. IARC Sci Publ, 51-104.

Sachinidis, A., B. K. Fleischmann, E. Kolossov, M. Wartenberg, H. Sauer and J. Hescheler (2003). Cardiac specific differentiation of mouse embryonic stem cells. Cardiovasc Res 58, 278-291.

Sanderson, J. T. and G. D. Bellward (1995). Hepatic microsomal ethoxyresorufin O-deethylase-inducing potency in ovo and cytosolic Ah receptor binding affinity of 2,3,7,8-tetrachlorodibenzo-p-dioxin: comparison of four avian species. Toxicol Appl Pharmacol 132, 131-145.

Sartor, M. A., G. D. Leikauf and M. Medvedovic (2009). LRpath: a logistic regression approach for identifying enriched biological groups in gene expression data. Bioinformatics 25, 211-217.

Sartor, M. A., M. Schnekenburger, J. L. Marlowe, J. F. Reichard, Y. Wang, Y. Fan, C. Ma, S. Karyala, D. Halbleib, X. Liu, M. Medvedovic and A. Puga (2009). Genomewide analysis of aryl hydrocarbon receptor binding targets reveals an extensive array of gene clusters that control morphogenetic and developmental programs. Environ Health Perspect 117, 1139-1146.

Schecter, A., P. Cramer, K. Boggess, J. Stanley, O. Papke, J. Olson, A. Silver and M. Schmitz (2001). Intake of dioxins and related compounds from food in the U.S. population. J Toxicol Environ Health A 63, 1-18.

Schmidt, J. V. and C. A. Bradfield (1996). Ah receptor signaling pathways. Annu Rev Cell Dev Biol 12, 55-89.

Schmidt, J. V., G. H. Su, J. K. Reddy, M. C. Simon and C. A. Bradfield (1996). Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci U S A 93, 6731-6736.

Schneider, A. J., A. M. Branam and R. E. Peterson (2014). Intersection of AHR and Wnt signaling in development, health, and disease. Int J Mol Sci 15, 17852-17885.

Schnekenburger, M., L. Peng and A. Puga (2007). HDAC1 bound to the Cyp1a1 promoter blocks histone acetylation associated with Ah receptor-mediated trans-activation. Biochim Biophys Acta 1769, 569-578.

Scholz, G., E. Genschow, I. Pohl, S. Bremer, M. Paparella, H. Raabe, J. Southee and H. Spielmann (1999). Prevalidation of the Embryonic Stem Cell Test (EST)-A New In Vitro Embryotoxicity Test. Toxicol In Vitro 13, 675-681.

Schoorlemmer, J., C. Marcos-Gutierrez, F. Were, R. Martinez, E. Garcia, D. P. Satijn, A. P. Otte and M. Vidal (1997). Ring1A is a transcriptional repressor that interacts with the Polycomb-M33 protein and is expressed at rhombomere boundaries in the mouse hindbrain. EMBO J 16, 5930-5942.

Schott, J. J., D. W. Benson, C. T. Basson, W. Pease, G. M. Silberbach, J. P. Moak, B. J. Maron, C. E. Seidman and J. G. Seidman (1998). Congenital heart disease caused by mutations in the transcription factor NKX2-5. Science 281, 108-111.

119

Schuettengruber, B., D. Chourrout, M. Vervoort, B. Leblanc and G. Cavalli (2007). Genome regulation by polycomb and trithorax proteins. Cell 128, 735-745.

Schultheiss, T. M., J. B. Burch and A. B. Lassar (1997). A role for bone morphogenetic proteins in the induction of cardiac myogenesis. Genes Dev 11, 451-462.

Sebastian, S., P. Sreenivas, R. Sambasivan, S. Cheedipudi, P. Kandalla, G. K. Pavlath and J. Dhawan (2009). MLL5, a trithorax homolog, indirectly regulates H3K4 methylation, represses cyclin A2 expression, and promotes myogenic differentiation. Proc Natl Acad Sci U S A 106, 4719-4724.

Seiler, A., A. Visan, R. Buesen, E. Genschow and H. Spielmann (2004). Improvement of an in vitro stem cell assay for developmental toxicity: the use of molecular endpoints in the embryonic stem cell test. Reprod Toxicol 18, 231-240.

Selevan, S. G., C. A. Kimmel and P. Mendola (2000). Identifying critical windows of exposure for children's health. Environ Health Perspect 108 Suppl 3, 451-455.

Serrat, R., G. Lopez-Domenech, S. Mirra, M. Quevedo, J. Garcia-Fernandez, F. Ulloa, F. Burgaya and E. Soriano (2013). The non-canonical Wnt/PKC pathway regulates mitochondrial dynamics through degradation of the arm-like domain-containing protein Alex3. PLoS One 8, e67773.

Shertzer, H. G., M. B. Genter, D. Shen, D. W. Nebert, Y. Chen and T. P. Dalton (2006). TCDD decreases ATP levels and increases reactive oxygen production through changes in mitochondrial F(0)F(1)- ATP synthase and ubiquinone. Toxicol Appl Pharmacol 217, 363-374.

Shimizu, Y., Y. Nakatsuru, M. Ichinose, Y. Takahashi, H. Kume, J. Mimura, Y. Fujii-Kuriyama and T. Ishikawa (2000). Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor. Proc Natl Acad Sci U S A 97, 779-782.

Shinde, K., M. Phatak, F. M. Johannes, J. Chen, Q. Li, J. K. Vineet, Z. Hu, K. Ghosh, J. Meller and M. Medvedovic (2010). Genomics Portals: integrative web-platform for mining genomics data. BMC Genomics 11, 27.

Shur, I., R. Socher and D. Benayahu (2006). In vivo association of CReMM/CHD9 with promoters in osteogenic cells. J Cell Physiol 207, 374-378.

Signorini, S., P. M. Gerthoux, C. Dassi, M. Cazzaniga, P. Brambilla, N. Vincoli and P. Mocarelli (2000). Environmental exposure to dioxin: the Seveso experience. Andrologia 32, 263-270.

Silva, J. and A. Smith (2008). Capturing pluripotency. Cell 132, 532-536.

Singh, P. B., J. R. Miller, J. Pearce, R. Kothary, R. D. Burton, R. Paro, T. C. James and S. J. Gaunt (1991). A sequence motif found in a Drosophila heterochromatin protein is conserved in animals and plants. Nucleic Acids Res 19, 789-794.

Smith, A. G. (2001). Embryo-derived stem cells: of mice and men. Annu Rev Cell Dev Biol 17, 435-462.

Smith, A. G., J. K. Heath, D. D. Donaldson, G. G. Wong, J. Moreau, M. Stahl and D. Rogers (1988). Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336, 688-690.

120

Sohl, G. and K. Willecke (2004). Gap junctions and the connexin protein family. Cardiovasc Res 62, 228- 232.

Solter, D. (2006). From teratocarcinomas to embryonic stem cells and beyond: a history of embryonic stem cell research. Nat Rev Genet 7, 319-327.

Sommer, R. J., A. J. Hume, J. M. Ciak, J. J. Vannostrand, M. Friggens and M. K. Walker (2005). Early developmental 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure decreases chick embryo heart chronotropic response to isoproterenol but not to agents affecting signals downstream of the beta- adrenergic receptor. Toxicol Sci 83, 363-371.

Sonnenfeld, M., M. Ward, G. Nystrom, J. Mosher, S. Stahl and S. Crews (1997). The Drosophila tango gene encodes a bHLH-PAS protein that is orthologous to mammalian Arnt and controls CNS midline and tracheal development. Development 124, 4571-4582.

Spielmann, H., E. Genschow, G. Scholz, N. A. Brown, A. H. Piersma, M. Brady, N. Clemann, H. Huuskonen, F. Paillard, S. Bremer and K. Becker (2001). Preliminary results of the ECVAM validation study on three in vitro embryotoxicity tests. Altern Lab Anim 29, 301-303.

Spikings, E. C., J. Alderson and J. C. St John (2007). Regulated mitochondrial DNA replication during oocyte maturation is essential for successful porcine embryonic development. Biol Reprod 76, 327-335.

Srivastava, D. and E. N. Olson (2000). A genetic blueprint for cardiac development. Nature 407, 221-226.

Steenland, K., P. Bertazzi, A. Baccarelli and M. Kogevinas (2004). Dioxin revisited: developments since the 1997 IARC classification of dioxin as a human carcinogen. Environ Health Perspect 112, 1265-1268.

Stewart, C. L., P. Kaspar, L. J. Brunet, H. Bhatt, I. Gadi, F. Kontgen and S. J. Abbondanzo (1992). Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 359, 76-79.

Stieber, J., S. Herrmann, S. Feil, J. Loster, R. Feil, M. Biel, F. Hofmann and A. Ludwig (2003). The hyperpolarization-activated channel HCN4 is required for the generation of pacemaker action potentials in the embryonic heart. Proc Natl Acad Sci U S A 100, 15235-15240.

Stummann, T. C. and S. Bremer (2012). Embryonic stem cells in safety pharmacology and toxicology. Adv Exp Med Biol 745, 14-25.

Surapureddi, S., N. Viswakarma, S. Yu, D. Guo, M. S. Rao and J. K. Reddy (2006). PRIC320, a transcription coactivator, isolated from peroxisome proliferator-binding protein complex. Biochem Biophys Res Commun 343, 535-543.

Svensson, B. G., A. Nilsson, M. Hansson, C. Rappe, B. Akesson and S. Skerfving (1991). Exposure to dioxins and dibenzofurans through the consumption of fish. N Engl J Med 324, 8-12.

Swanson, H. I., W. K. Chan and C. A. Bradfield (1995). DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins. J Biol Chem 270, 26292-26302.

121

Takihara, Y., D. Tomotsune, M. Shirai, Y. Katoh-Fukui, K. Nishii, M. A. Motaleb, M. Nomura, R. Tsuchiya, Y. Fujita, Y. Shibata, T. Higashinakagawa and K. Shimada (1997). Targeted disruption of the mouse homologue of the Drosophila polyhomeotic gene leads to altered anteroposterior patterning and neural crest defects. Development 124, 3673-3682.

Tanaka, M., Z. Chen, S. Bartunkova, N. Yamasaki and S. Izumo (1999). The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development. Development 126, 1269-1280. ten Berge, D., W. Koole, C. Fuerer, M. Fish, E. Eroglu and R. Nusse (2008). Wnt signaling mediates self- organization and axis formation in embryoid bodies. Cell Stem Cell 3, 508-518.

Thackaberry, E. A., D. M. Gabaldon, M. K. Walker and S. M. Smith (2002). Aryl hydrocarbon receptor null mice develop cardiac hypertrophy and increased hypoxia-inducible factor-1alpha in the absence of cardiac hypoxia. Cardiovasc Toxicol 2, 263-274.

Thackaberry, E. A., Z. Jiang, C. D. Johnson, K. S. Ramos and M. K. Walker (2005). Toxicogenomic profile of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the murine fetal heart: modulation of cell cycle and extracellular matrix genes. Toxicol Sci 88, 231-241.

Thackaberry, E. A., B. A. Nunez, I. D. Ivnitski-Steele, M. Friggins and M. K. Walker (2005). Effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on murine heart development: alteration in fetal and postnatal cardiac growth, and postnatal cardiac chronotropy. Toxicol Sci 88, 242-249.

Thundathil, J., F. Filion and L. C. Smith (2005). Molecular control of mitochondrial function in preimplantation mouse embryos. Mol Reprod Dev 71, 405-413.

Tohyama, S., F. Hattori, M. Sano, T. Hishiki, Y. Nagahata, T. Matsuura, H. Hashimoto, T. Suzuki, H. Yamashita, Y. Satoh, T. Egashira, T. Seki, N. Muraoka, H. Yamakawa, Y. Ohgino, T. Tanaka, M. Yoichi, S. Yuasa, M. Murata, M. Suematsu and K. Fukuda (2013). Distinct metabolic flow enables large-scale purification of mouse and human pluripotent stem cell-derived cardiomyocytes. Cell Stem Cell 12, 127-137.

Tomita-Mitchell, A., C. L. Maslen, C. D. Morris, V. Garg and E. Goldmuntz (2007). GATA4 sequence variants in patients with congenital heart disease. J Med Genet 44, 779-783.

Tong, J. K., C. A. Hassig, G. R. Schnitzler, R. E. Kingston and S. L. Schreiber (1998). Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex. Nature 395, 917-921.

Trapnell, C., L. Pachter and S. L. Salzberg (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105-1111.

U.S. EPA (2007). Exposure and Human Health Reassessment of 2,3,7,8-Tetrachlorodibenzo-p-Dioxin (TCDD) and Related Compounds National Academy Sciences (NAS) Review Draft. Environmental Protection Agency, U.S.A. van Dartel, D. A., J. L. Pennings, L. J. de la Fonteyne, M. H. van Herwijnen, J. H. van Delft, F. J. van Schooten and A. H. Piersma (2010). Monitoring developmental toxicity in the embryonic stem cell test using differential gene expression of differentiation-related genes. Toxicol Sci 116, 130- 139.

122

Van Houdt, J. K., B. A. Nowakowska, S. B. Sousa, B. D. van Schaik, E. Seuntjens, N. Avonce, A. Sifrim, O. A. Abdul-Rahman, M. J. van den Boogaard, A. Bottani, M. Castori, V. Cormier-Daire, M. A. Deardorff, I. Filges, A. Fryer, J. P. Fryns, S. Gana, L. Garavelli, G. Gillessen-Kaesbach, B. D. Hall, D. Horn, D. Huylebroeck, J. Klapecki, M. Krajewska-Walasek, A. Kuechler, M. A. Lines, S. Maas, K. D. Macdermot, S. McKee, A. Magee, S. A. de Man, Y. Moreau, F. Morice-Picard, E. Obersztyn, J. Pilch, E. Rosser, N. Shannon, I. Stolte-Dijkstra, P. Van Dijck, C. Vilain, A. Vogels, E. Wakeling, D. Wieczorek, L. Wilson, O. Zuffardi, A. H. van Kampen, K. Devriendt, R. Hennekam and J. R. Vermeesch (2012). Heterozygous missense mutations in SMARCA2 cause Nicolaides-Baraitser syndrome. Nat Genet 44, 445-449, S441.

Vasquez, A., N. Atallah-Yunes, F. C. Smith, X. You, S. E. Chase, A. E. Silverstone and K. L. Vikstrom (2003). A role for the aryl hydrocarbon receptor in cardiac physiology and function as demonstrated by AhR knockout mice. Cardiovasc Toxicol 3, 153-163.

Vojnits, K. and S. Bremer (2010). Challenges of using pluripotent stem cells for safety assessments of substances. Toxicology 270, 10-17.

Walker, M. K. and T. F. Catron (2000). Characterization of cardiotoxicity induced by 2,3,7, 8- tetrachlorodibenzo-p-dioxin and related chemicals during early chick embryo development. Toxicol Appl Pharmacol 167, 210-221.

Walker, M. K., R. S. Pollenz and S. M. Smith (1997). Expression of the aryl hydrocarbon receptor (AhR) and AhR nuclear translocator during chick cardiogenesis is consistent with 2,3,7,8- tetrachlorodibenzo-p-dioxin-induced heart defects. Toxicol Appl Pharmacol 143, 407-419.

Wang, H. and S. K. Dey (2006). Roadmap to embryo implantation: clues from mouse models. Nat Rev Genet 7, 185-199.

Wang, K. C., J. A. Helms and H. Y. Chang (2009). Regeneration, repair and remembering identity: the three Rs of Hox gene expression. Trends Cell Biol 19, 268-275.

Wang, Q., J. Chen, C. I. Ko, Y. Fan, V. Carreira, Y. Chen, Y. Xia, M. Medvedovic and A. Puga (2013). Disruption of aryl hydrocarbon receptor homeostatic levels during embryonic stem cell differentiation alters expression of homeobox transcription factors that control cardiomyogenesis. Environ Health Perspect 121, 1334-1343.

Wang, Y., Y. Fan and A. Puga (2010). Dioxin exposure disrupts the differentiation of mouse embryonic stem cells into cardiomyocytes. Toxicol Sci 115, 225-237.

Wang, Y., Y. Zheng, W. Zhang, H. Yu, K. Lou, Y. Zhang, Q. Qin, B. Zhao, Y. Yang and R. Hui (2007). Polymorphisms of KDR gene are associated with coronary heart disease. J Am Coll Cardiol 50, 760-767.

Wang, Z., W. Shu, M. M. Lu and E. E. Morrisey (2005). Wnt7b activates canonical signaling in epithelial and vascular smooth muscle cells through interactions with Fzd1, Fzd10, and LRP5. Mol Cell Biol 25, 5022-5030.

Watanabe, D., I. Suetake, T. Tada and S. Tajima (2002). Stage- and cell-specific expression of Dnmt3a and Dnmt3b during embryogenesis. Mech Dev 118, 187-190.

123

Watt, A. J., M. A. Battle, J. Li and S. A. Duncan (2004). GATA4 is essential for formation of the proepicardium and regulates cardiogenesis. Proc Natl Acad Sci U S A 101, 12573-12578.

Weiss, A. and L. A. Leinwand (1996). The mammalian myosin heavy chain gene family. Annu Rev Cell Dev Biol 12, 417-439.

Westfall, M. V., K. A. Pasyk, D. I. Yule, L. C. Samuelson and J. M. Metzger (1997). Ultrastructure and cell-cell coupling of cardiac myocytes differentiating in embryonic stem cell cultures. Cell Motil Cytoskeleton 36, 43-54.

White, S. S. and L. S. Birnbaum (2009). An overview of the effects of dioxins and dioxin-like compounds on vertebrates, as documented in human and ecological epidemiology. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev 27, 197-211.

Williams, R. L., D. J. Hilton, S. Pease, T. A. Willson, C. L. Stewart, D. P. Gearing, E. F. Wagner, D. Metcalf, N. A. Nicola and N. M. Gough (1988). Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336, 684-687.

Wingender, E. (2008). The TRANSFAC project as an example of framework technology that supports the analysis of genomic regulation. Brief Bioinform 9, 326-332.

Wu, Q., S. Ohsako, T. Baba, K. Miyamoto and C. Tohyama (2002). Effects of 2,3,7,8-tetrachlorodibenzo- p-dioxin (TCDD) on preimplantation mouse embryos. Toxicology 174, 119-129.

Wu, S. M., Y. Fujiwara, S. M. Cibulsky, D. E. Clapham, C. L. Lien, T. M. Schultheiss and S. H. Orkin (2006). Developmental origin of a bipotential myocardial and smooth muscle cell precursor in the mammalian heart. Cell 127, 1137-1150.

Xiao, Q., G. Wang, X. Yin, Z. Luo, A. Margariti, L. Zeng, M. Mayr, S. Ye and Q. Xu (2011). Chromobox protein homolog 3 is essential for stem cell differentiation to smooth muscles in vitro and in embryonic arteriogenesis. Arterioscler Thromb Vasc Biol 31, 1842-1852.

Xu, X. Q., R. Zweigerdt, S. Y. Soo, Z. X. Ngoh, S. C. Tham, S. T. Wang, R. Graichen, B. Davidson, A. Colman and W. Sun (2008). Highly enriched cardiomyocytes from human embryonic stem cells. Cytotherapy 10, 376-389.

Yamaki, M., K. Isono, Y. Takada, K. Abe, T. Akasaka, H. Tanzawa and H. Koseki (2002). The mouse Edr2 (Mph2) gene has two forms of mRNA encoding 90- and 36-kDa polypeptides. Gene 288, 103-110.

Yamashita, J. K., M. Takano, M. Hiraoka-Kanie, C. Shimazu, Y. Peishi, K. Yanagi, A. Nakano, E. Inoue, F. Kita and S. Nishikawa (2005). Prospective identification of cardiac progenitors by a novel single cell-based cardiomyocyte induction. FASEB J 19, 1534-1536.

Yoshida, K., I. Chambers, J. Nichols, A. Smith, M. Saito, K. Yasukawa, M. Shoyab, T. Taga and T. Kishimoto (1994). Maintenance of the pluripotential phenotype of embryonic stem cells through direct activation of gp130 signalling pathways. Mech Dev 45, 163-171.

Young, R. A. (2011). Control of the embryonic stem cell state. Cell 144, 940-954.

124

Zaher, H., P. M. Fernandez-Salguero, J. Letterio, M. S. Sheikh, A. J. Fornace, Jr., A. B. Roberts and F. J. Gonzalez (1998). The involvement of aryl hydrocarbon receptor in the activation of transforming growth factor-beta and apoptosis. Mol Pharmacol 54, 313-321. zur Nieden, N. I., L. A. Davis and D. E. Rancourt (2010). Comparing three novel endpoints for developmental osteotoxicity in the embryonic stem cell test. Toxicol Appl Pharmacol 247, 91-97.

125

APPENDIX

Table A1 Cardiac Marker Genes Affected in Their Expression by TCDD Treatment of Differentiating Mouse ES Cells.

Gene Description Function Expression Reference Connexin gene consists of 20 members in mouse. Major gap-junction protein in the atrial myocardium. Expressed mainly in the atrial working (Sohl and Willecke Four isoforms Cx 40, Cx43, Cx45, Cx37 are Gap junctions are responsible for cell-cell myocardium, the conduction system and 2004; Chaldoupi et Cx40 known as “cardiovascular connexins”, playing conduction of the action potential. the vasculature. al. 2009) roles in cardiovascular morphology and function. endothelin-1 converting enzyme-1, type II Cleave endothelin precursor big-endothelin-1, a 38- Exists as a dimer on the cell surface (Kuruppu and Smith metallorprotease, amino-acid peptide, to yield functional form of 2012) Four isoforms Ece1a, Ece1b, Ece1c and Ece1d endothilin-1; endothelin-1 and ECE play a role in Ece1 endocrine function as well as growth and development. ECE-1 is involved in the pathogenesis of disease states including cancer, cardiovascular disease and Alzheimer’s disease. Belong to Zinc finger super family, members of Essential for the hypertrophic response; induce the GATA4/5/6 mainly expressed in (Patient and this family including GATA 1-6. formation of cardiac myocytes in embryonic endodermally derived tissues including McGhee 2002) Gata4 Regulate cell-fate specification and differentiation, carcinoma cells. heart, lung, stomach, intestine, ovary blood and control cell proliferation and movement. vessels, etc. Refer to the above cell. Synergistically with NFAT activated smooth- Refer to the above cell. (Patient and Gata6 muscle-specific gene transcription to maintain McGhee 2002) differentiated Vascular smooth muscle cells. Hyperpolarization-activated cyclic nucleotide- “Pacemaker channels”, help generate rhythmic Prominently expressed in the pace maker (Stieber et al. 2003; gated channel; members includes HCN 1-4. activity within groups of heart and brain cells. region of the mammalian heart, also Harzheim et al. Hcn4 In the embryo, cAMP-bound HCN4 is a powerful expressed in the brain. 2008; Biel et al. pacemaker. In adult mice, HCN4 ensures stable heart 2009) rhythm during and after stress, not pacemaking.

126

Table A1 Continued

Kinase insert domain-containing receptor/fetal Required for the differentiation of endothelial EPCs, endothelial cells, primitive and (Wang et al. 2007) liver kinase-1 (Flk1),also called VEGFR2 progenitor cells (EPCs) and for the movement of more mature hematopoietic cells. (vascular endothelial growth factor receptor -2) EPCs from the posterior primitive streak to the yolk Kdr CD309 (cluster of differentiation 309). sac, a precondition for the subsequent formation of A type III receptor tyrosine kinase blood vessels; plays a critical roles in the development and formation of blood vessel networks. Belongs to myocyte enhancer factor-2 family, also Pivotal role in morphogenesis and myogenesis of In all developing muscle cells, non-muscle (Black and Olson referred to as RSRF (Related to Serum Response skeletal, cardiac and smooth muscle cells. cells including brain and lymphoid tissue. 1998; Pereira et al. Mef2c Factor); members in this gene family include Regulates cardiac hypertrophy and remodeling. 2009) Mef2 a-d. Regulatory (phosphorylatable) myosin light Associated with the cardiac myosin beta heavy Ventricular myocardium restricted. (Franco et al. 1998) chain , three members Mlc2a, Mlc2v and Mlc2f chain, Ca2+ triggers the phosphorylation of Mlc2v belong to this group. regulatory light chain which in turn triggers contraction. Myosin heavy chain A ubiquitous eukaryotic motor protein; interacts with Myh6 is expressed in the adult ventricles (Weiss and actin to generate the force for cellular movements and atria, exclusively restricted to the Leinwand 1996) ranging from cytokinesis to muscle contraction. heart. Myh7 is expressed in both cardiac Myh6/7 and slow (type I) skeletal muscle fibers; the abundant isoform in the ventricles of all mammals during fetal life. Nkx2 homeobox 5, family members including Early role in cardiomyocyte specification and First detected in mesodermal cells (Harvey 1996; Lien Nkx2-3, Nkx2-5, Nkx2-6 and Nkx2-7 differentiation and late role in cardiac specified to form heart at ED 7.5 in mouse et al. 1999) morphogenesis. and the expression is maintained Nkx2-5 throughout the developing and adult heart. Transiently expressed in the developing pharynx, thyroid and stomach.

127

Table A1 Continued

Atrial natriuretic peptide (ANF) An inhibitor of renal tubular reabsorption of NaCl Expression of Nppa is an early and specific (Durocher et al. produced and excreted by the heart. ANF promoter is marker for the differentiating working 1997; Houweling et Nppa a transcriptional target for both GATA-4 and NKX2- myocardium of the atria and ventricles of al. 2005) 5; Induction of Nppa is a conserved feature of the developing heart. ventricular hypertrophy. Protein gene product 9.5 A specific tissue marker for the neuroendocrine Cytoplasm of neuronal cells; (El Sharaby et al. system; corresponds with abnormal ventricular morphologically dynamic myocardial 2001; Otsuki et al. automaticity. regions during heart ontogenesis; 2004) Pgp9.5 expressed in myocardial sleeves, cardiac nerves and components of the cardiac conduction systems. Short stature homeobox 2 Pacemaking function; an essential transcription Restricted to the sinus venosus region and (Espinoza-Lewis et factor for the differentiation of cardiac pacemaker eventually to SAN, including the al. 2009) Shox2 cells through repressing NKX2-5. pacemaker and sinus valves in the developing heart.

Belongs to T-box gene family encoding more than Inhibition of chamber myocardium, conduction Non-chamber myocardium of the (Greulich et al. 20 transcription factors, which share a highly system pattering. atrioventricular canal (AVC) during 2011) conserved DNA-binding region. cardiac development; epithelial and neural Tbx3 crest cells in the pharyngeal region, in the sinoatrial node (SAN) primordium, and in all mature components of the central conduction system. Refer to the above cell. Chamber formation, septation and cardiomyocyte First expressed in bilateral wings of the (Greulich, Rudat differentiation. cardiogenic mesoderm and later in the and Kispert 2011) endocardium and myocardium of the Tbx5 inflow region, the atria, the AVC and the left ventricle.

128

Table A2 z-Scores of Top 100 GO Terms AHR-Positive vs Unselected Cells.

Cluster GO Term Name Day 5 Day 8 Day 11 Day 14 A GO:0061311 cell surface receptor signaling pathway involved in heart development -9.891 -3.060 -16.157 -10.559 A GO:0005615 extracellular space -7.709 -3.211 -9.624 -10.566 A GO:0009887 organ morphogenesis -5.171 -2.728 -8.570 -9.784 A GO:0001501 skeletal system development -4.420 -2.696 -8.071 -9.558 A GO:0001944 vasculature development -4.737 -3.083 -8.229 -10.952 A GO:0001568 blood vessel development -4.678 -3.123 -8.396 -10.887 A GO:0072358 cardiovascular system development -5.112 -3.258 -9.450 -12.585 A GO:0072359 circulatory system development -5.112 -3.258 -9.450 -12.585 A GO:0007507 heart development -4.537 -3.391 -11.191 -11.076 A GO:0048738 cardiac muscle tissue development -3.999 -3.073 -10.263 -11.319 A GO:0061371 determination of heart left/right asymmetry -6.679 -2.466 -10.306 -7.025 A GO:0001947 heart looping -6.623 -2.536 -10.599 -7.276 A GO:0003143 embryonic heart tube morphogenesis -6.275 -2.400 -10.079 -6.932 A GO:0003209 cardiac atrium morphogenesis -5.600 -2.216 -12.360 -9.402 A GO:0003230 cardiac atrium development -5.489 -2.164 -12.089 -9.439 A GO:0035051 cardiac cell differentiation -5.399 -2.548 -11.658 -9.201 A GO:0003151 outflow tract morphogenesis -5.225 -2.203 -10.854 -9.043 A GO:0060976 coronary vasculature development -4.020 -3.185 -12.002 -9.163 A GO:0048762 mesenchymal cell differentiation -3.960 -2.201 -11.256 -9.279 A GO:0060485 mesenchyme development -3.829 -2.382 -11.217 -9.456 A GO:0014031 mesenchymal cell development -3.631 -2.197 -11.060 -8.509 A GO:0048644 muscle organ morphogenesis -2.710 -2.892 -11.598 -10.281 A GO:0048483 autonomic nervous system development -2.524 -2.171 -11.116 -9.320 A GO:2000826 regulation of heart morphogenesis -4.234 -2.363 -14.179 -8.944 A GO:0005110 frizzled-2 binding -3.762 -2.153 -14.265 -6.930

129

A GO:0005518 collagen binding -3.751 -0.734 -12.376 -5.336 A GO:0033613 activating transcription factor binding -3.237 -3.134 -9.921 -6.864 A GO:0060317 cardiac epithelial to mesenchymal transition -2.392 -1.971 -10.325 -6.134 A GO:0048538 thymus development -1.778 -1.648 -10.242 -6.073 A GO:0060043 regulation of cardiac muscle cell proliferation -1.799 -2.185 -9.907 -7.380 A GO:0045668 negative regulation of osteoblast differentiation -1.081 -2.097 -10.484 -7.175 A GO:0060716 labyrinthine layer blood vessel development -0.751 -2.055 -10.062 -5.258 A GO:0060840 artery development -2.532 -2.440 -10.223 -7.960 A GO:0048844 artery morphogenesis -2.525 -2.366 -10.671 -8.324 A GO:0060045 positive regulation of cardiac muscle cell proliferation -2.036 -1.955 -11.459 -8.217 A GO:0043392 negative regulation of DNA binding -1.716 -1.700 -11.068 -7.675 A GO:0043388 positive regulation of DNA binding -0.934 -1.714 -10.905 -8.496 A GO:0033275 actin-myosin filament sliding -0.764 -1.555 -10.051 -8.569 A GO:0001755 neural crest cell migration -1.133 1.942 -10.655 -7.465 A GO:0003156 regulation of organ formation -5.904 -2.940 -16.705 -10.114 A GO:0048645 organ formation -5.561 -3.030 -15.355 -9.696 A GO:0060914 heart formation -4.125 -2.703 -17.433 -11.621 A GO:0003206 cardiac chamber morphogenesis -4.342 -3.396 -15.442 -13.470 A GO:0003205 cardiac chamber development -4.319 -3.358 -15.043 -13.285 A GO:0048485 sympathetic nervous system development -3.430 -3.089 -15.117 -12.831 A GO:0003007 heart morphogenesis -4.739 -3.255 -13.228 -11.083 A GO:0003208 cardiac ventricle morphogenesis -2.581 -2.770 -13.634 -12.855 A GO:0003231 cardiac ventricle development -3.176 -2.531 -11.801 -11.987 A GO:0055008 cardiac muscle tissue morphogenesis -2.073 -3.244 -13.117 -11.775 A GO:0060415 muscle tissue morphogenesis -1.952 -3.052 -12.409 -11.120 A GO:0060039 pericardium development -2.506 -2.494 -14.535 -11.173 A GO:0010463 mesenchymal cell proliferation -2.998 -2.723 -15.632 -10.808

130

A GO:2000677 regulation of transcription regulatory region DNA binding -1.996 -2.472 -15.931 -10.762 A GO:0060977 coronary vasculature morphogenesis -1.550 -3.341 -13.856 -10.029 A GO:0003215 cardiac right ventricle morphogenesis -2.106 -3.774 -17.536 -12.809 A GO:0042415 norepinephrine metabolic process -1.124 -2.618 -18.240 -11.556 A GO:0010658 striated muscle cell apoptosis -0.638 -2.349 -15.710 -13.672 A GO:0010659 cardiac muscle cell apoptosis -0.638 -2.349 -15.710 -13.672 A GO:0010656 negative regulation of muscle cell apoptosis -0.610 -2.409 -15.996 -15.264 A GO:0061046 regulation of branching involved in lung morphogenesis -1.684 -2.439 -16.725 -8.354 A GO:0060431 primary lung bud formation -1.552 -2.402 -16.684 -8.090 positive regulation of epithelial cell proliferation involved in lung A GO:0060501 morphogenesis -0.757 -2.425 -16.831 -8.869 A GO:0060502 epithelial cell proliferation involved in lung morphogenesis -0.908 -2.059 -14.193 -7.556 A GO:2000794 regulation of epithelial cell proliferation involved in lung morphogenesis -0.663 -2.191 -15.338 -8.077 A GO:0043586 tongue development -1.069 -2.413 -14.870 -9.623 A GO:0001967 suckling behavior -0.819 -2.274 -15.948 -10.175 A GO:0009713 catechol-containing compound biosynthetic process 0.807 -2.162 -14.875 -9.668 A GO:0034312 diol biosynthetic process 0.807 -2.162 -14.875 -9.668 A GO:0042423 catecholamine biosynthetic process 0.807 -2.162 -14.875 -9.668 A GO:0010660 regulation of muscle cell apoptosis -0.348 -1.819 -12.503 -12.059 A GO:0010657 muscle cell apoptosis -0.266 -1.614 -11.317 -10.837 A GO:0070888 E-box binding 0.981 -1.663 -12.768 -9.502 A GO:0022610 biological adhesion -3.774 -6.665 -5.136 -9.411 A GO:0007155 cell adhesion -3.615 -6.700 -5.166 -9.419 A GO:0019838 growth factor binding -2.541 -2.864 -5.746 -10.666 A GO:0005201 extracellular matrix structural constituent -2.140 -3.236 -5.980 -10.570 A GO:0071230 cellular response to amino acid stimulus -1.588 -3.901 -6.080 -12.970 A GO:0071229 cellular response to acid -1.728 -3.556 -5.499 -11.739 A GO:0043200 response to amino acid stimulus -1.335 -3.490 -5.460 -11.584

131

A GO:0071417 cellular response to organic nitrogen -1.145 -3.524 -5.530 -11.685 A GO:0071418 cellular response to amine stimulus -1.216 -3.579 -5.609 -11.890 A GO:0014075 response to amine stimulus -0.686 -2.684 -4.352 -9.776 A GO:0070206 protein trimerization -1.873 -1.557 -2.367 -9.829 A GO:0048012 hepatocyte growth factor receptor signaling pathway -1.490 -1.455 -2.667 -9.969 A GO:0051450 myoblast proliferation -0.149 -0.370 -2.052 -10.966 A GO:0003810 protein-glutamine gamma-glutamyltransferase activity -1.086 -0.121 -0.099 -9.424 A GO:0030199 collagen fibril organization -0.682 -3.365 -6.162 -16.120 A GO:0070208 protein heterotrimerization -0.128 -1.936 -4.018 -16.051 A GO:0048407 platelet-derived growth factor binding -2.779 -6.011 -8.666 -16.527 A GO:0044420 extracellular matrix part -2.202 -3.814 -11.876 -17.142 A GO:0005578 proteinaceous extracellular matrix -3.531 -9.933 -15.052 -20.776 A GO:0031012 extracellular matrix -3.465 -9.789 -14.343 -20.239 A GO:0005581 collagen -1.565 -3.084 -15.857 -22.253 A GO:0060973 cell migration involved in heart development -6.018 -4.272 -24.845 -18.014 A GO:0061323 cell proliferation involved in heart morphogenesis -1.987 -3.502 -23.912 -16.063 A GO:2000679 positive regulation of transcription regulatory region DNA binding -1.973 -3.729 -24.324 -16.048 A GO:0061307 cardiac neural crest cell differentiation involved in heart development -1.772 -3.464 -24.203 -16.531 A GO:0061308 cardiac neural crest cell development involved in heart development -1.975 -3.812 -26.548 -18.170 A GO:0003680 AT DNA binding -1.779 -3.762 -25.508 -17.228 A GO:0042421 norepinephrine biosynthetic process -1.718 -3.816 -25.973 -16.691 A GO:0005583 fibrillar collagen -1.307 -6.147 -28.491 -18.322 A GO:0071526 semaphorin-plexin signaling pathway -4.625 -3.490 -17.651 -15.070 A GO:0003211 cardiac ventricle formation -4.167 -3.736 -20.234 -14.678 A GO:0003207 cardiac chamber formation -4.028 -3.693 -19.485 -14.515 A GO:0060536 cartilage morphogenesis -2.168 -3.644 -20.144 -14.627 A GO:0048934 peripheral nervous system neuron differentiation -2.110 -3.315 -20.939 -13.994

132

A GO:0048935 peripheral nervous system neuron development -2.110 -3.315 -20.939 -13.994 A GO:0003263 cardioblast proliferation -1.762 -3.203 -20.898 -13.160 A GO:0003264 regulation of cardioblast proliferation -1.762 -3.203 -20.898 -13.160 A GO:0003266 regulation of secondary heart field cardioblast proliferation -1.762 -3.203 -20.898 -13.160 A GO:0003228 atrial cardiac muscle tissue development -1.479 -2.908 -21.933 -15.265 A GO:0055009 atrial cardiac muscle tissue morphogenesis -1.479 -2.908 -21.933 -15.265 A GO:0061032 visceral serous pericardium development -1.144 -3.226 -21.181 -15.758 A GO:0010667 negative regulation of cardiac muscle cell apoptosis -0.972 -3.126 -20.428 -17.842 A GO:0007512 adult heart development -0.926 -2.538 -19.509 -16.270 A GO:0010664 negative regulation of striated muscle cell apoptosis -0.902 -2.950 -19.352 -16.855 A GO:0010662 regulation of striated muscle cell apoptosis -0.832 -2.796 -18.425 -16.154 A GO:0010665 regulation of cardiac muscle cell apoptosis -0.832 -2.796 -18.425 -16.154 A GO:0030198 extracellular matrix organization -2.802 -13.064 -7.683 -11.410 A GO:0043062 extracellular structure organization -2.802 -13.064 -7.683 -11.410 A GO:0008593 regulation of Notch signaling pathway -2.464 -20.127 -4.206 -2.418 A GO:0007219 Notch signaling pathway -1.586 -11.896 -2.554 -1.801 B GO:0051151 negative regulation of smooth muscle cell differentiation -16.901 -2.060 -3.612 -2.111 B GO:0060395 SMAD protein signal transduction -12.698 -3.353 -0.796 1.343 B GO:0010470 regulation of gastrulation -11.909 -2.992 -0.525 -0.092 B GO:0051150 regulation of smooth muscle cell differentiation -11.685 -1.733 -4.126 -2.630 B GO:0045995 regulation of embryonic development -9.051 -2.627 -4.875 -2.493 B GO:0051145 smooth muscle cell differentiation -9.431 -1.520 -3.657 -3.932 B GO:0051148 negative regulation of muscle cell differentiation -8.996 -1.219 -2.601 -2.342 B GO:0042661 regulation of mesodermal cell fate specification -9.546 -0.471 -0.304 -0.370 B GO:0050710 negative regulation of cytokine secretion -8.431 -0.684 0.491 0.319 B GO:0001542 ovulation from ovarian follicle -8.490 -0.305 -0.318 -0.227 B GO:2000380 regulation of mesoderm development -7.970 -0.360 -0.239 -0.170

133

B GO:0018022 peptidyl-lysine methylation -8.198 -0.646 -1.459 -0.598 B GO:0018024 histone-lysine N-methyltransferase activity -7.881 -0.614 -1.381 -0.534 B GO:0016278 lysine N-methyltransferase activity -7.569 -0.616 -1.297 -0.471 B GO:0016279 protein-lysine N-methyltransferase activity -7.569 -0.616 -1.297 -0.471 B GO:0001711 endodermal cell fate commitment -10.454 2.501 6.346 5.509 B GO:0035987 endodermal cell differentiation -10.315 2.324 6.001 5.209 B GO:0003306 Wnt receptor signaling pathway involved in heart development -9.510 2.190 6.331 4.755 B GO:0001714 endodermal cell fate specification -9.930 2.917 7.193 6.246 regulation of Wnt receptor signaling pathway involved in heart B GO:0003307 development -9.513 2.878 8.033 6.065 B GO:2000043 regulation of cardiac cell fate specification -8.833 2.674 7.419 5.586 B GO:0001706 endoderm formation -12.349 1.362 4.088 3.586 B GO:0007369 gastrulation -8.737 2.574 3.130 3.462 B GO:0007492 endoderm development -8.701 2.413 3.017 3.266 B GO:0001704 formation of primary germ layer -8.023 1.739 2.398 3.080 B GO:0060911 cardiac cell fate commitment -7.466 1.934 5.558 4.176 B GO:0042074 cell migration involved in gastrulation -8.511 7.318 4.687 5.564 B GO:0001710 mesodermal cell fate commitment -5.642 4.737 5.658 5.601 B GO:0007398 ectoderm development -4.168 4.906 5.476 4.800 B GO:0009948 anterior/posterior axis specification -4.018 4.836 3.405 3.324 C GO:0008584 male gonad development -1.781 4.672 3.103 7.317 C GO:0005160 transforming growth factor beta receptor binding -1.668 5.699 12.856 15.199 C GO:0033327 Leydig cell differentiation -1.866 6.731 7.773 18.403 C GO:0030238 male sex determination 1.264 5.838 6.564 15.789 C GO:0060008 Sertoli cell differentiation 2.158 6.962 7.496 17.725 C GO:0001825 blastocyst formation -3.710 9.045 10.296 7.806 C GO:0001824 blastocyst development -2.052 6.956 7.666 5.924

134

C GO:0001829 trophectodermal cell differentiation -0.879 6.197 9.718 8.510 C GO:0030325 adrenal gland development -4.750 4.545 5.281 13.030 C GO:0060363 cranial suture morphogenesis -0.606 3.315 5.555 10.843 C GO:0097094 craniofacial suture morphogenesis -0.606 3.315 5.555 10.843 C GO:0007530 sex determination 0.897 4.710 5.179 12.757 C GO:0045120 pronucleus 3.908 2.188 9.694 5.295 C GO:0045743 positive regulation of fibroblast growth factor receptor signaling pathway -0.471 4.838 1.356 1.892 C GO:0035283 central nervous system segmentation 0.207 5.858 1.640 2.284 C GO:0035284 brain segmentation 0.207 5.858 1.640 2.284 C GO:0045103 intermediate filament-based process 0.887 5.187 1.369 1.749 C GO:0045104 intermediate filament cytoskeleton organization 0.935 5.303 1.408 1.790 C GO:0048892 lateral line nerve development 1.259 6.608 2.586 1.977 C GO:0048925 lateral line system development 1.259 6.608 2.586 1.977 C GO:0048880 sensory system development 1.314 5.753 2.443 1.890 C GO:0001547 antral ovarian follicle growth 1.587 6.662 4.141 1.366 C GO:2000194 regulation of female gonad development 1.728 7.128 4.168 1.282 C GO:0060052 neurofilament cytoskeleton organization 1.618 8.530 2.451 2.358 C GO:0060053 neurofilament cytoskeleton 1.979 8.269 2.379 2.271 C GO:0005883 neurofilament 2.220 10.005 2.905 2.764 C GO:0017158 regulation of calcium ion-dependent exocytosis 0.725 5.713 6.229 3.581 C GO:0045835 negative regulation of meiosis 2.369 5.583 4.859 3.724 C GO:0007128 meiotic prophase I 4.391 6.148 5.424 4.867 C GO:0051324 prophase 4.391 6.148 5.424 4.867 C GO:0060631 regulation of meiosis I 4.145 5.310 4.318 3.646 C GO:0048477 oogenesis 4.895 5.138 4.932 3.566 C GO:0032504 multicellular organism reproduction 4.661 4.882 4.498 5.683 C GO:0048609 multicellular organismal reproductive process 4.661 4.882 4.498 5.683

135

C GO:0048610 cellular process involved in reproduction 5.412 5.076 3.972 5.315 C GO:0051177 meiotic sister chromatid cohesion 5.951 5.237 5.051 4.741 C GO:0007276 gamete generation 5.332 5.912 5.472 6.353 C GO:0019953 sexual reproduction 5.647 6.147 5.789 6.496 C GO:0007283 spermatogenesis 5.819 6.050 5.675 6.731 C GO:0048232 male gamete generation 5.819 6.050 5.675 6.731 C GO:0007127 meiosis I 7.247 7.254 4.466 3.778 C GO:0051321 meiotic cell cycle 7.154 5.535 3.543 3.083 C GO:0007126 meiosis 7.332 5.692 3.654 3.182 C GO:0051327 M phase of meiotic cell cycle 7.332 5.692 3.654 3.182 C GO:0070193 synaptonemal complex organization 6.292 8.545 6.055 5.040 C GO:0007130 synaptonemal complex assembly 6.695 9.256 6.551 5.460 C GO:0000801 central element 7.393 8.483 5.408 4.549 C GO:0070192 chromosome organization involved in meiosis 9.392 10.497 6.529 5.639 C GO:0007129 synapsis 9.792 11.165 6.925 5.994 D GO:0009055 electron carrier activity 7.544 0.756 2.945 1.185 D GO:0046906 tetrapyrrole binding 7.792 -1.460 2.929 1.269 D GO:0020037 heme binding 8.336 -1.289 3.074 1.362 D GO:0072593 reactive oxygen species metabolic process 9.182 1.964 3.842 1.725 D GO:0051320 S phase 7.480 0.641 0.402 0.781 D GO:0000084 S phase of mitotic cell cycle 8.411 0.768 0.334 0.789 D GO:0046686 response to cadmium ion 8.691 1.382 0.420 0.685 D GO:0045931 positive regulation of mitotic cell cycle 7.729 -0.402 0.348 0.436 D GO:0006776 vitamin A metabolic process 7.710 -0.451 0.085 0.465 D GO:0009110 vitamin biosynthetic process 8.293 -0.479 0.264 0.182 D GO:0006720 isoprenoid metabolic process 8.385 -0.704 0.335 0.412 D GO:0033261 regulation of S phase 8.433 -0.286 0.263 0.491

136

D GO:0008299 isoprenoid biosynthetic process 8.829 -0.400 0.330 0.657 D GO:0042737 drug catabolic process 8.736 0.095 0.245 -0.072 D GO:0009410 response to xenobiotic stimulus 8.260 -1.704 0.242 0.618 D GO:0006805 xenobiotic metabolic process 8.618 -1.811 0.279 0.626 D GO:0071466 cellular response to xenobiotic stimulus 8.618 -1.811 0.279 0.626 D GO:0019439 aromatic compound catabolic process 8.719 -1.222 -1.399 0.281 D GO:0042738 exogenous drug catabolic process 9.163 0.092 0.309 0.310 D GO:0016725 oxidoreductase activity, acting on CH or CH2 groups 9.560 0.146 0.331 0.301 D GO:0070989 oxidative demethylation 9.579 0.136 0.343 0.082 D GO:0042573 retinoic acid metabolic process 9.655 -0.427 0.174 0.339 D GO:0008395 steroid hydroxylase activity 9.865 -0.253 0.328 0.473 D GO:0007090 regulation of S phase of mitotic cell cycle 10.003 -0.268 0.298 0.475 D GO:0042362 fat-soluble vitamin biosynthetic process 10.827 -0.346 0.289 0.421 D GO:0006721 terpenoid metabolic process 11.077 -0.486 0.160 0.090 D GO:0006778 porphyrin-containing compound metabolic process 12.282 1.776 0.980 1.116 D GO:0033013 tetrapyrrole metabolic process 12.282 1.776 0.980 1.116 D GO:0071276 cellular response to cadmium ion 14.052 2.640 0.989 0.478 D GO:0019748 secondary metabolic process 12.360 -0.551 -0.322 -0.658 D GO:0016098 monoterpenoid metabolic process 12.642 0.108 0.622 0.122 D GO:0070988 demethylation 13.418 0.289 0.475 0.372 D GO:0017144 drug metabolic process 13.576 0.158 0.408 0.350 D GO:0009698 phenylpropanoid metabolic process 13.577 -0.223 0.492 0.713 oxidoreductase activity, acting on paired donors, with incorporation or D GO:0016712 reduction of molecular oxygen 14.777 -0.184 0.498 0.692 D GO:0042178 xenobiotic catabolic process 14.821 0.124 0.631 0.825 D GO:0070330 aromatase activity 15.188 -0.209 0.514 0.534 D GO:0032451 demethylase activity 16.157 0.229 0.603 0.771 D GO:0035238 vitamin A biosynthetic process 17.452 0.119 0.835 1.016

137

D GO:0042904 9-cis-retinoic acid biosynthetic process 17.452 0.119 0.835 1.016 D GO:0042905 9-cis-retinoic acid metabolic process 17.452 0.119 0.835 1.016 D GO:0009812 flavonoid metabolic process 18.557 -0.061 0.898 1.124 D GO:0045750 positive regulation of S phase of mitotic cell cycle 19.072 -0.048 0.952 1.203 oxidoreductase activity, acting on diphenols and related substances as D GO:0016679 donors 19.416 0.131 1.011 1.241 D GO:0009804 coumarin metabolic process 19.558 0.035 0.935 1.213 D GO:0017085 response to insecticide 21.374 0.512 1.356 1.732 D GO:0042743 hydrogen peroxide metabolic process 16.464 3.096 7.312 3.479 D GO:0042537 benzene-containing compound metabolic process 11.692 -0.869 -7.156 -4.682 D GO:0009404 toxin metabolic process 26.958 -0.126 1.388 1.207 D GO:0050665 hydrogen peroxide biosynthetic process 28.857 0.183 1.617 1.302

138

Table A3 z-Scores of Top 100 GO Terms AHR-Positive 48 h TCDD vs Control Cells.

Cluster GO Term Name Day 5 Day 8 Day 11 Day 14 A GO:0060070 canonical Wnt receptor signaling pathway 3.117 -10.989 -1.351 -3.635 A GO:0016055 Wnt receptor signaling pathway 3.138 -9.243 -0.968 -5.242 A GO:0030509 BMP signaling pathway 1.907 -9.535 3.028 -3.326 A GO:0007341 penetration of zona pellucida 0.722 -8.155 0.543 -2.051 A GO:0030215 semaphorin receptor binding 1.656 -11.177 -6.117 -4.983 A GO:0000904 cell morphogenesis involved in differentiation 5.037 -10.911 -4.506 -6.703 A GO:0000902 cell morphogenesis 6.292 -10.111 -4.156 -5.485 A GO:0032989 cellular component morphogenesis 7.659 -9.882 -4.774 -6.264 A GO:0002009 morphogenesis of an epithelium 6.531 -9.264 -2.800 -8.960 A GO:0051642 centrosome localization 2.205 -8.569 -5.258 -4.422 A GO:0061371 determination of heart left/right asymmetry 1.523 -8.212 -3.903 -6.583 A GO:0048812 neuron projection morphogenesis 3.519 -9.070 -4.197 -6.041 A GO:0007411 axon guidance 2.775 -8.716 -4.088 -5.530 A GO:0048666 neuron development 3.715 -8.231 -3.290 -5.755 A GO:0035239 tube morphogenesis 4.313 -8.132 -3.192 -5.743 A GO:0031175 neuron projection development 4.405 -7.978 -3.430 -5.912 A GO:0048858 cell projection morphogenesis 3.894 -8.053 -3.508 -5.111 A GO:0032990 cell part morphogenesis 3.759 -8.033 -3.469 -5.009 A GO:0009887 organ morphogenesis 5.369 -8.488 -3.926 -7.085 A GO:0009792 embryo development ending in birth or egg hatching 5.513 -8.110 -4.680 -7.163 A GO:0043009 chordate embryonic development 5.623 -7.884 -4.585 -7.005 A GO:0070848 response to growth factor stimulus 5.217 -7.778 -3.231 -6.688 A GO:0005916 fascia adherens 5.448 -4.263 -6.527 -7.307 A GO:0008284 positive regulation of cell proliferation 7.119 -5.327 -4.825 -6.690 A GO:0003007 heart morphogenesis 4.592 -5.406 -3.164 -7.958

139

A GO:0040011 locomotion 10.425 -9.896 -4.968 -6.468 A GO:0016477 cell migration 11.580 -9.422 -4.876 -6.001 A GO:0048646 anatomical structure formation involved in morphogenesis 10.443 -9.445 -4.718 -5.400 A GO:0048870 cell motility 10.905 -8.905 -4.543 -5.663 A GO:0051674 localization of cell 10.905 -8.905 -4.543 -5.663 A GO:0006928 cellular component movement 10.472 -8.326 -4.431 -5.296 A GO:0005604 basement membrane 14.326 -3.527 -2.464 -6.039 A GO:0031589 cell-substrate adhesion 11.639 -6.134 -3.511 -3.599 A GO:0010810 regulation of cell-substrate adhesion 10.836 -5.764 -2.620 -2.463 A GO:0010811 positive regulation of cell-substrate adhesion 10.027 -5.157 -3.295 -2.520 A GO:0051094 positive regulation of developmental process 10.113 -5.628 -4.935 -4.726 A GO:0010740 positive regulation of intracellular protein kinase cascade 9.480 -4.348 -4.687 -4.326 A GO:0010647 positive regulation of cell communication 9.454 -5.398 -3.768 -4.187 A GO:0048584 positive regulation of response to stimulus 8.967 -4.883 -3.161 -3.428 A GO:0044319 wound healing, spreading of cells 9.755 -0.522 -4.075 -2.724 A GO:0031032 actomyosin structure organization 9.656 -0.908 -4.436 -5.543 A GO:0030036 actin cytoskeleton organization 10.185 -2.814 -3.220 -3.315 A GO:0051216 cartilage development 9.202 -2.203 -2.062 -5.032 A GO:0030485 smooth muscle contractile fiber 7.076 1.307 -10.597 -3.964 A GO:0048729 tissue morphogenesis 8.246 -10.131 3.099 -8.932 A GO:0060429 epithelium development 9.762 -7.786 3.244 -9.078 A GO:0022603 regulation of anatomical structure morphogenesis 7.683 -8.329 4.667 -5.015 A GO:0007169 transmembrane receptor protein tyrosine kinase signaling pathway 7.296 -7.895 3.426 -1.896 A GO:0022610 biological adhesion 13.610 -9.472 3.999 -6.453 A GO:0007155 cell adhesion 13.720 -9.360 4.005 -6.528 A GO:0072358 cardiovascular system development 11.756 -8.286 8.152 -5.339 A GO:0072359 circulatory system development 11.756 -8.286 8.152 -5.339

140

A GO:0007167 enzyme linked receptor protein signaling pathway 11.121 -9.289 6.149 -2.794 A GO:0048514 blood vessel morphogenesis 11.349 -7.639 6.180 -4.015 A GO:0031012 extracellular matrix 13.064 -7.550 3.938 -4.833 A GO:0030334 regulation of cell migration 12.811 -6.290 4.428 -4.598 A GO:0051270 regulation of cellular component movement 12.549 -6.276 4.415 -4.291 A GO:2000145 regulation of cell motility 12.437 -6.091 4.233 -4.414 A GO:0040012 regulation of locomotion 12.066 -6.682 4.042 -4.398 A GO:0005578 proteinaceous extracellular matrix 12.190 -6.381 3.265 -4.114 A GO:0044420 extracellular matrix part 12.442 -3.580 3.861 -4.106 A GO:0019838 growth factor binding 10.776 -4.570 5.427 -4.009 A GO:0007160 cell-matrix adhesion 9.687 -5.272 3.325 -2.427 A GO:0009967 positive regulation of signal transduction 9.764 -5.363 4.164 -4.333 A GO:0023056 positive regulation of signaling 9.355 -5.421 3.718 -4.113 A GO:0009986 cell surface 9.416 -7.179 4.148 -3.789 A GO:0005615 extracellular space 9.015 -6.452 4.280 -3.383 A GO:0030335 positive regulation of cell migration 13.481 -3.135 2.692 -2.104 A GO:2000147 positive regulation of cell motility 13.281 -3.095 2.601 -2.029 A GO:0051272 positive regulation of cellular component movement 13.181 -3.003 2.538 -2.036 A GO:0040017 positive regulation of locomotion 12.940 -2.924 2.687 -2.003 A GO:0005178 integrin binding 12.084 -2.622 3.441 -2.046 A GO:0005912 adherens junction 10.829 -2.645 4.063 -3.573 A GO:0070161 anchoring junction 10.788 -2.541 4.047 -3.348 A GO:0042060 wound healing 10.674 -1.254 4.260 -4.268 A GO:0030198 extracellular matrix organization 10.256 -1.302 3.993 -2.834 A GO:0043062 extracellular structure organization 10.256 -1.302 3.993 -2.834 A GO:0009611 response to wounding 9.742 -1.358 3.670 -2.547 A GO:0051146 striated muscle cell differentiation 9.366 -3.716 3.442 -3.052

141

A GO:0055002 striated muscle cell development 9.183 -2.555 3.332 -2.841 A GO:0048407 platelet-derived growth factor binding 11.261 -1.768 7.193 -7.043 A GO:0005583 fibrillar collagen 7.142 -2.176 5.267 -7.352 A GO:0001944 vasculature development 12.549 -8.671 8.834 5.239 A GO:0001568 blood vessel development 12.724 -7.660 9.104 5.454 A GO:0001525 angiogenesis 11.554 -5.936 5.185 3.378 A GO:0030155 regulation of cell adhesion 11.177 -5.727 2.791 1.804 A GO:0045785 positive regulation of cell adhesion 10.469 -4.551 3.441 2.060 A GO:0030054 cell junction 9.573 -3.571 3.857 2.281 A GO:0010595 positive regulation of endothelial cell migration 9.717 -2.306 5.230 4.967 A GO:0032432 actin filament bundle 13.984 5.776 -3.615 -2.137 A GO:0001725 stress fiber 12.880 4.067 -3.355 -1.992 A GO:0042641 actomyosin 12.145 3.709 -3.042 -1.697 A GO:0015629 actin cytoskeleton 12.205 5.213 -3.755 -3.014 A GO:0030029 actin filament-based process 10.584 3.166 -3.080 -3.167 A GO:0004859 phospholipase inhibitor activity 12.600 2.691 0.441 -0.994 A GO:0005587 collagen type IV 12.163 -0.437 -0.526 -0.577 A GO:0030935 sheet-forming collagen 12.163 -0.437 -0.526 -0.577 A GO:0043236 laminin binding 11.212 -1.194 1.299 -1.212 A GO:0050840 extracellular matrix binding 11.599 1.432 -2.172 -2.050 A GO:0010755 regulation of plasminogen activation 10.290 0.555 -1.897 -0.328 A GO:0055102 lipase inhibitor activity 9.821 1.891 0.708 -0.500 A GO:0030195 negative regulation of blood coagulation 8.924 0.934 -0.379 0.177 A GO:1900047 negative regulation of hemostasis 8.924 0.934 -0.379 0.177 A GO:0050819 negative regulation of coagulation 10.144 0.941 1.749 1.499 A GO:0048661 positive regulation of smooth muscle cell proliferation 9.432 1.137 2.699 1.720 A GO:0048660 regulation of smooth muscle cell proliferation 8.930 1.462 2.469 1.193

142

A GO:0060706 cell differentiation involved in embryonic placenta development 9.194 2.433 4.561 1.578 A GO:0018149 peptide cross-linking 9.389 -0.288 3.322 -0.671 A GO:0034330 cell junction organization 9.209 -1.697 3.175 1.558 A GO:0008092 cytoskeletal protein binding 10.693 5.863 2.705 -1.491 A GO:0061061 muscle structure development 10.692 5.472 4.416 -3.840 A GO:0042692 muscle cell differentiation 9.519 3.233 4.191 -2.506 A GO:0005544 calcium-dependent phospholipid binding 10.781 2.473 1.729 -1.905 A GO:0003779 actin binding 10.150 3.036 2.277 -2.221 A GO:0030055 cell-substrate junction 9.062 2.463 1.922 -1.829 A GO:0005925 focal adhesion 9.018 2.439 2.230 -1.486 A GO:0005924 cell-substrate adherens junction 8.957 2.261 2.091 -1.686 A GO:0030855 epithelial cell differentiation 8.213 5.296 2.512 -8.727 A GO:0030216 keratinocyte differentiation 7.596 4.355 -1.178 -7.950 A GO:0009913 epidermal cell differentiation 6.778 5.324 -1.408 -7.504 A GO:0048864 stem cell development 1.873 10.167 3.953 -3.176 A GO:0019827 stem cell maintenance 1.487 9.969 3.952 -2.793 A GO:0048863 stem cell differentiation 1.695 8.425 3.891 -3.864 A GO:0015245 fatty acid transporter activity 3.292 10.165 -1.156 -0.970 A GO:0050542 icosanoid binding 1.512 11.885 1.469 1.702 A GO:0050543 icosatetraenoic acid binding 1.512 11.885 1.469 1.702 A GO:0051782 negative regulation of cell division -0.546 9.173 -1.037 1.164 A GO:0070841 inclusion body assembly 0.239 8.676 0.579 0.650 A GO:0090083 regulation of inclusion body assembly 0.606 8.287 0.443 0.930 A GO:0000407 pre-autophagosomal structure 1.036 7.885 1.733 1.595 A GO:0046546 development of primary male sexual characteristics -3.749 7.920 -1.099 -1.664 A GO:0001829 trophectodermal cell differentiation -1.916 8.594 3.611 4.333 A GO:0001892 embryonic placenta development 8.842 7.199 8.472 4.995

143

A GO:0001890 placenta development 8.634 6.828 9.085 6.551 A GO:0043542 endothelial cell migration 9.111 3.492 6.528 5.319 A GO:0010594 regulation of endothelial cell migration 8.833 2.965 7.187 6.001 A GO:0045662 negative regulation of myoblast differentiation 3.092 4.565 7.200 6.277 A GO:0060711 labyrinthine layer development 4.026 4.840 6.945 4.322 A GO:0032878 regulation of establishment or maintenance of cell polarity 1.004 2.392 7.459 5.945 A GO:0015665 alcohol transmembrane transporter activity 0.974 3.284 6.993 6.043 A GO:0045713 low-density lipoprotein particle receptor biosynthetic process 2.143 1.497 7.038 7.644 A GO:0010871 negative regulation of receptor biosynthetic process 1.898 1.640 6.405 6.912 A GO:0016936 galactoside binding 4.231 0.940 6.402 5.727 A GO:0060712 spongiotrophoblast layer development 2.752 1.353 6.358 3.481 A GO:0009404 toxin metabolic process 5.789 2.698 3.677 6.934 A GO:0048185 activin binding -0.137 -2.677 7.080 4.237 A GO:0030033 microvillus assembly 0.664 -0.884 6.452 5.343 antigen processing and presentation of endogenous peptide antigen via A GO:0019885 MHC class I 0.587 -3.381 3.326 8.947 A GO:0002483 antigen processing and presentation of endogenous peptide antigen -0.172 -3.003 2.866 7.782 A GO:0019883 antigen processing and presentation of endogenous antigen 0.151 -2.732 2.636 7.262 A GO:0042573 retinoic acid metabolic process 2.226 0.813 3.107 8.851 A GO:0035238 vitamin A biosynthetic process 3.303 0.997 2.448 8.343 A GO:0042904 9-cis-retinoic acid biosynthetic process 3.303 0.997 2.448 8.343 A GO:0042905 9-cis-retinoic acid metabolic process 3.303 0.997 2.448 8.343 A GO:0034754 cellular hormone metabolic process 1.791 -1.115 4.275 7.522 A GO:0004030 aldehyde dehydrogenase [NAD(P)+] activity 0.640 1.160 2.362 7.141 A GO:0006776 vitamin A metabolic process 1.330 0.847 2.585 7.081 A GO:0001523 retinoid metabolic process 1.055 0.899 2.373 6.611 A GO:0016101 diterpenoid metabolic process 1.055 0.899 2.373 6.611 A GO:0060900 embryonic camera-type eye formation -0.665 -0.569 2.473 6.964

144

A GO:0042612 MHC class I protein complex 0.612 -1.510 2.268 6.597 B GO:0048864 stem cell development 1.873 10.167 3.953 -3.176 B GO:0019827 stem cell maintenance 1.487 9.969 3.952 -2.793 B GO:0048863 stem cell differentiation 1.695 8.425 3.891 -3.864 B GO:0015245 fatty acid transporter activity 3.292 10.165 -1.156 -0.970 B GO:0050542 icosanoid binding 1.512 11.885 1.469 1.702 B GO:0050543 icosatetraenoic acid binding 1.512 11.885 1.469 1.702 B GO:0051782 negative regulation of cell division -0.546 9.173 -1.037 1.164 B GO:0070841 inclusion body assembly 0.239 8.676 0.579 0.650 B GO:0090083 regulation of inclusion body assembly 0.606 8.287 0.443 0.930 B GO:0000407 pre-autophagosomal structure 1.036 7.885 1.733 1.595 B GO:0046546 development of primary male sexual characteristics -3.749 7.920 -1.099 -1.664 B GO:0001829 trophectodermal cell differentiation -1.916 8.594 3.611 4.333 B GO:0001892 embryonic placenta development 8.842 7.199 8.472 4.995 B GO:0001890 placenta development 8.634 6.828 9.085 6.551 B GO:0043542 endothelial cell migration 9.111 3.492 6.528 5.319 B GO:0010594 regulation of endothelial cell migration 8.833 2.965 7.187 6.001 B GO:0045662 negative regulation of myoblast differentiation 3.092 4.565 7.200 6.277 B GO:0060711 labyrinthine layer development 4.026 4.840 6.945 4.322 B GO:0032878 regulation of establishment or maintenance of cell polarity 1.004 2.392 7.459 5.945 B GO:0015665 alcohol transmembrane transporter activity 0.974 3.284 6.993 6.043 B GO:0045713 low-density lipoprotein particle receptor biosynthetic process 2.143 1.497 7.038 7.644 B GO:0010871 negative regulation of receptor biosynthetic process 1.898 1.640 6.405 6.912 B GO:0016936 galactoside binding 4.231 0.940 6.402 5.727 B GO:0060712 spongiotrophoblast layer development 2.752 1.353 6.358 3.481 B GO:0009404 toxin metabolic process 5.789 2.698 3.677 6.934 B GO:0048185 activin binding -0.137 -2.677 7.080 4.237

145

B GO:0030033 microvillus assembly 0.664 -0.884 6.452 5.343 antigen processing and presentation of endogenous peptide antigen via B GO:0019885 MHC class I 0.587 -3.381 3.326 8.947 B GO:0002483 antigen processing and presentation of endogenous peptide antigen -0.172 -3.003 2.866 7.782 B GO:0019883 antigen processing and presentation of endogenous antigen 0.151 -2.732 2.636 7.262 B GO:0042573 retinoic acid metabolic process 2.226 0.813 3.107 8.851 B GO:0035238 vitamin A biosynthetic process 3.303 0.997 2.448 8.343 B GO:0042904 9-cis-retinoic acid biosynthetic process 3.303 0.997 2.448 8.343 B GO:0042905 9-cis-retinoic acid metabolic process 3.303 0.997 2.448 8.343 B GO:0034754 cellular hormone metabolic process 1.791 -1.115 4.275 7.522 B GO:0004030 aldehyde dehydrogenase [NAD(P)+] activity 0.640 1.160 2.362 7.141 B GO:0006776 vitamin A metabolic process 1.330 0.847 2.585 7.081 B GO:0001523 retinoid metabolic process 1.055 0.899 2.373 6.611 B GO:0016101 diterpenoid metabolic process 1.055 0.899 2.373 6.611 B GO:0060900 embryonic camera-type eye formation -0.665 -0.569 2.473 6.964 B GO:0042612 MHC class I protein complex 0.612 -1.510 2.268 6.597 C GO:0004551 nucleotide diphosphatase activity -11.216 -9.964 -9.572 -6.960 C GO:0010424 DNA methylation on cytosine within a CG sequence -15.046 -7.462 -18.565 -13.837 C GO:0032776 DNA methylation on cytosine -15.046 -7.462 -18.565 -13.837 C GO:0006346 methylation-dependent chromatin silencing -12.804 -6.344 -15.276 -11.719 C GO:0045322 unmethylated CpG binding -12.007 -6.119 -14.460 -10.845 C GO:0046498 S-adenosylhomocysteine metabolic process -11.458 -6.103 -13.271 -10.241 C GO:0023019 signal transduction involved in regulation of gene expression -5.838 -11.285 0.373 -1.370 C GO:0007509 mesoderm migration involved in gastrulation -0.813 -13.884 -0.575 -2.270 C GO:0001839 neural plate morphogenesis -0.619 -11.877 -0.574 -2.956 C GO:0001840 neural plate development -1.034 -10.639 -0.639 -2.755 C GO:0060379 cardiac muscle cell myoblast differentiation -0.554 -10.211 -0.346 -2.594 C GO:0004768 stearoyl-CoA 9-desaturase activity -1.339 -10.142 -3.240 -3.288

146

C GO:0016215 acyl-CoA desaturase activity -1.211 -9.937 -4.017 -4.452 oxidoreductase activity, acting on paired donors, with oxidation of a pair C GO:0016717 of donors -0.711 -8.258 -3.190 -3.547 C GO:0021915 neural tube development -1.960 -8.486 -1.117 -3.853 C GO:0001707 mesoderm formation -3.594 -10.889 -3.060 -2.858 C GO:0001704 formation of primary germ layer -3.439 -10.573 -2.904 -2.719 C GO:0048332 mesoderm morphogenesis -3.439 -10.411 -2.824 -2.646 C GO:0048667 cell morphogenesis involved in neuron differentiation -2.901 -8.873 -3.290 -4.947 C GO:0007409 axonogenesis -3.195 -8.678 -3.285 -4.895 C GO:0007498 mesoderm development -4.749 -9.208 -3.258 -3.888 C GO:0005003 ephrin receptor activity -4.181 -8.428 -3.183 -2.888 C GO:0009952 anterior/posterior pattern specification -4.339 -8.007 -2.392 -3.130 C GO:0042758 long-chain fatty acid catabolic process -4.276 -9.278 -1.619 -1.343 C GO:0001561 fatty acid alpha-oxidation -4.651 -9.248 -1.718 -1.319 C GO:0031957 very long-chain fatty acid-CoA ligase activity -3.936 -8.664 -1.445 -1.166 C GO:0035567 non-canonical Wnt receptor signaling pathway -3.188 -8.658 -1.204 -3.149 C GO:0060346 bone trabecula formation -4.163 -8.535 -1.192 -2.598 C GO:0061430 bone trabecula morphogenesis -4.163 -8.535 -1.192 -2.598 C GO:0017147 Wnt-protein binding -3.988 -8.084 -1.302 -2.520 C GO:0035121 tail morphogenesis -4.818 -13.709 -4.296 -4.473 C GO:0007369 gastrulation -3.108 -11.535 -4.922 -4.345 C GO:0042074 cell migration involved in gastrulation -7.228 -11.323 -7.341 -5.130 C GO:0030903 notochord development -4.611 -11.885 -6.016 -7.048 C GO:0044344 cellular response to fibroblast growth factor stimulus -6.258 -10.771 -4.943 -6.927 C GO:0071774 response to fibroblast growth factor stimulus -6.258 -10.771 -4.943 -6.927 C GO:0009948 anterior/posterior axis specification -6.003 -9.907 -5.704 -5.560 C GO:0048598 embryonic morphogenesis -3.360 -8.470 -4.418 -6.799 C GO:0022008 neurogenesis -5.150 -8.502 -4.976 -6.456

147

C GO:0030182 neuron differentiation -4.348 -8.632 -4.706 -6.760 C GO:0048699 generation of neurons -4.421 -8.167 -4.405 -6.306 C GO:0008543 fibroblast growth factor receptor signaling pathway -6.754 -8.180 -4.757 -6.011 C GO:0035282 segmentation -7.957 -10.346 -3.689 -3.980 C GO:0001756 somitogenesis -7.166 -9.719 -3.793 -3.405 C GO:0061053 somite development -6.783 -9.198 -3.825 -4.434 C GO:0046475 glycerophospholipid catabolic process -9.966 -7.032 -4.666 -3.182 C GO:0010508 positive regulation of autophagy -6.918 -8.376 -7.970 -3.042 C GO:0014054 positive regulation of gamma-aminobutyric acid secretion -1.271 -9.571 -10.690 -11.477 C GO:0051957 positive regulation of amino acid transport -1.271 -9.571 -10.690 -11.477 C GO:0014050 negative regulation of glutamate secretion -1.057 -8.514 -8.311 -8.982 C GO:0014052 regulation of gamma-aminobutyric acid secretion -1.152 -8.396 -9.229 -10.276 C GO:0046942 carboxylic acid transport -2.203 -9.421 -7.153 -6.663 C GO:0015849 organic acid transport -2.149 -9.338 -7.084 -6.601 C GO:0046943 carboxylic acid transmembrane transporter activity -1.732 -8.313 -6.859 -6.122 C GO:0005342 organic acid transmembrane transporter activity -1.654 -8.177 -6.741 -6.019 C GO:0015837 amine transport -1.607 -7.492 -6.383 -5.702 C GO:0006865 amino acid transport -1.178 -8.829 -8.628 -7.928 C GO:0015171 amino acid transmembrane transporter activity -1.628 -8.359 -8.690 -7.314 C GO:0003333 amino acid transmembrane transport -1.733 -7.664 -8.338 -7.256 C GO:0071705 nitrogen compound transport -1.275 -7.612 -7.872 -7.599 C GO:0005275 amine transmembrane transporter activity -1.267 -7.754 -7.664 -6.434 C GO:0032892 positive regulation of organic acid transport -2.627 -6.348 -6.982 -6.905 C GO:0043403 skeletal muscle tissue regeneration -2.499 -4.177 -6.869 -7.255 C GO:0014051 gamma-aminobutyric acid secretion -0.718 -6.859 -7.368 -8.500 C GO:0015812 gamma-aminobutyric acid transport -1.046 -6.324 -6.758 -7.768 C GO:0051955 regulation of amino acid transport -0.440 -6.062 -6.568 -7.397

148

C GO:0015179 L-amino acid transmembrane transporter activity -0.795 -5.461 -6.183 -6.034 C GO:0014829 vascular smooth muscle contraction 3.985 -0.837 -7.923 -4.023 C GO:0043123 positive regulation of I-kappaB kinase/NF-kappaB cascade 2.685 -3.935 -6.905 -5.935 C GO:0005865 striated muscle thin filament 4.936 -1.498 -6.543 -7.246 C GO:0060174 limb bud formation -0.790 -5.686 -8.980 -12.515 C GO:0007512 adult heart development -0.527 -3.757 -6.996 -11.022 C GO:0014866 skeletal myofibril assembly 2.443 -2.307 -7.656 -9.541 C GO:0030240 skeletal muscle thin filament assembly 2.443 -2.307 -7.656 -9.541 C GO:0045844 positive regulation of striated muscle tissue development 1.991 -3.089 -7.099 -10.020 C GO:0048636 positive regulation of muscle organ development 1.991 -3.089 -7.099 -10.020 C GO:0072530 purine-containing compound transmembrane transport -0.603 -2.634 -7.783 -8.601 C GO:0005243 gap junction channel activity -0.616 -3.281 -7.354 -8.488 C GO:0015174 basic amino acid transmembrane transporter activity -0.500 -4.153 -6.852 -8.975 C GO:0090162 establishment of epithelial cell polarity 0.882 -4.149 -6.090 -8.660 C GO:0002070 epithelial cell maturation -0.392 -2.765 -6.163 -7.388 C GO:0015809 arginine transport 0.364 -3.276 -6.083 -7.779 C GO:0015802 basic amino acid transport 0.082 -2.988 -5.031 -6.703 C GO:0001502 cartilage condensation 4.846 -1.521 -4.664 -11.130 C GO:0005720 nuclear heterochromatin -9.507 -3.767 -11.859 -8.554 C GO:0006349 regulation of gene expression by genetic imprinting -8.108 -3.899 -10.787 -8.247 C GO:0000792 heterochromatin -9.009 -3.086 -9.566 -6.421 C GO:0051571 positive regulation of histone H3-K4 methylation -8.959 -5.461 -11.294 -11.593 C GO:0051573 negative regulation of histone H3-K9 methylation -7.238 -5.455 -10.577 -11.500 C GO:0051570 regulation of histone H3-K9 methylation -7.596 -4.519 -10.572 -10.281 C GO:0031062 positive regulation of histone methylation -7.247 -4.265 -10.058 -9.739 C GO:0010216 maintenance of DNA methylation -8.971 -2.291 -8.812 -2.653 C GO:0071514 genetic imprinting -6.602 -3.048 -8.818 -6.680

149

C GO:0006342 chromatin silencing -7.124 -3.055 -8.373 -6.241 C GO:0045814 negative regulation of gene expression, epigenetic -6.771 -2.749 -7.853 -5.797 C GO:0031061 negative regulation of histone methylation -5.125 -3.784 -8.623 -8.753 C GO:0031503 protein complex localization -5.919 -3.773 -8.056 -8.241 C GO:0051567 histone H3-K9 methylation -6.353 -3.119 -7.990 -7.616 C GO:0051569 regulation of histone H3-K4 methylation -5.565 -3.524 -7.260 -7.559 C GO:0043200 response to amino acid stimulus -5.788 -6.736 -7.785 -6.217 C GO:0071230 cellular response to amino acid stimulus -6.227 -5.657 -7.847 -5.582 C GO:0071418 cellular response to amine stimulus -5.797 -5.309 -7.516 -5.860 C GO:0071417 cellular response to organic nitrogen -5.672 -5.199 -7.379 -5.751 C GO:0071229 cellular response to acid -6.571 -5.521 -7.057 -5.256 C GO:0046128 purine ribonucleoside metabolic process -6.604 -4.267 -7.219 -5.754 C GO:0042278 purine nucleoside metabolic process -6.431 -3.917 -6.808 -5.371 C GO:0031054 pre-miRNA processing -2.776 -1.349 -8.066 -5.920 C GO:0034661 ncRNA catabolic process -3.550 -1.361 -7.218 -4.482 C GO:0035198 miRNA binding -3.008 -1.942 -6.811 -4.986 C GO:0035196 production of miRNAs involved in gene silencing by miRNA -2.717 -1.003 -7.247 -5.563 C GO:0031050 dsRNA fragmentation -2.574 -0.883 -6.856 -5.282 C GO:0070918 production of small RNA involved in gene silencing by RNA -2.574 -0.883 -6.856 -5.282 C GO:0016458 gene silencing -5.235 -1.694 -7.679 -5.575 C GO:0006305 DNA alkylation -6.057 -2.240 -6.679 -4.722 C GO:0006306 DNA methylation -6.057 -2.240 -6.679 -4.722 C GO:0040029 regulation of gene expression, epigenetic -4.549 -0.770 -6.334 -4.420 C GO:0031060 regulation of histone methylation -4.703 -2.754 -6.648 -6.518 C GO:0031641 regulation of myelination -0.916 -4.325 -7.077 -4.683 C GO:0022010 central nervous system myelination -0.709 -3.140 -6.882 -3.450 C GO:0032291 axon ensheathment in central nervous system -0.709 -3.140 -6.882 -3.450

150

C GO:0045109 intermediate filament organization -1.276 -2.594 -0.607 -15.524 C GO:0045104 intermediate filament cytoskeleton organization -2.369 -2.028 -3.079 -14.773 C GO:0045103 intermediate filament-based process -2.259 -1.937 -2.972 -14.484 C GO:0000307 cyclin-dependent protein kinase holoenzyme complex -3.479 1.865 -3.067 -9.471 C GO:0071772 response to BMP stimulus 1.280 1.429 1.446 -11.363 C GO:0071773 cellular response to BMP stimulus 1.280 1.429 1.446 -11.363 C GO:0060272 embryonic skeletal joint morphogenesis 1.354 0.560 0.408 -9.559 C GO:0031424 keratinization 1.830 -0.906 0.548 -9.719 C GO:0072498 embryonic skeletal joint development 1.053 -0.499 0.267 -9.044 C GO:0060351 cartilage development involved in endochondral bone morphogenesis 3.047 -2.649 -1.266 -7.993 C GO:0045737 positive regulation of cyclin-dependent protein kinase activity 4.269 -1.619 -0.890 -7.454 C GO:0030836 positive regulation of actin filament depolymerization 0.186 -0.236 -3.635 -6.671 C GO:0005179 hormone activity 1.710 -1.940 14.542 15.121

151

Table A4 Expression levels of transcription factors that show differential expression between TCDD-treated AHR-positive cells and controls

(Log2Fold change) geneid symbol name Day 5 Day 11 Day 14 Day 8 11910 Atf3 activating transcription factor 3 0.372 2.510 0.436 0.224 223922 Atf7 activating transcription factor 7 0.207 1.011 0.235 0.285 12053 Bcl6 B-cell leukemia/lymphoma 6 0.337 2.619 0.771 0.676 12578 Cdkn2a cyclin-dependent kinase inhibitor 2A 0.536 1.781 0.409 0.216 12606 Cebpa CCAAT/enhancer binding protein (C/EBP), alpha -0.141 1.092 1.354 0.326 Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal 12705 Cited1 domain 1 0.076 2.062 1.842 1.351 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal 17684 Cited2 domain, 2 0.080 1.355 0.811 0.793 12914 Crebbp CREB binding protein 0.024 0.060 -0.033 0.195 12387 Ctnnb1 catenin (cadherin associated protein), beta 1 -0.003 -0.157 0.142 0.078 13393 Dlx3 distal-less homeobox 3 0.477 2.991 1.609 1.042 13819 Epas1 endothelial PAS domain protein 1 0.426 0.165 -0.056 0.108 23871 Ets1 E26 avian leukemia oncogene 1, 5' domain 0.446 1.793 -0.002 -0.065 15376 Foxa2 forkhead box A2 -0.502 0.909 0.212 -0.105 17300 Foxc1 forkhead box C1 0.535 1.278 1.479 0.261 14234 Foxc2 forkhead box C2 1.811 1.135 2.207 1.643 14106 Foxh1 forkhead box H1 -0.724 -1.011 -1.247 -0.817 108655 Foxp1 forkhead box P1 -0.894 -1.110 -0.895 -0.534 14461 Gata2 GATA binding protein 2 0.729 1.655 2.085 1.407 14462 Gata3 GATA binding protein 3 1.343 2.280 1.469 0.695 14463 Gata4 GATA binding protein 4 0.588 0.842 0.691 0.191 14465 Gata6 GATA binding protein 6 0.898 1.915 0.941 0.432 14472 Gbx2 gastrulation brain homeobox 2 0.083 -0.201 -1.072 -0.943

152

14634 Gli3 GLI-Kruppel family member GLI3 -0.242 0.288 0.195 0.063 15110 Hand1 heart and neural crest derivatives expressed transcript 1 0.032 4.321 1.602 1.077 15111 Hand2 heart and neural crest derivatives expressed transcript 2 1.142 -0.861 1.546 1.373 433759 Hdac1 histone deacetylase 1 -0.072 -0.293 -0.002 -0.006 15214 Hey2 hairy/enhancer-of-split related with YRPW motif 2 -0.334 0.569 0.298 0.585 21405 Hnf1a HNF1 homeobox A 0.901 -0.254 0.126 0.217 74318 Hopx HOP homeobox -1.727 -1.464 -0.345 -0.415 15394 Hoxa1 homeobox A1 0.592 1.760 1.085 0.769 15395 Hoxa10 homeobox A10 1.225 1.193 0.441 0.927 15400 Hoxa3 homeobox A3 0.322 2.237 0.656 0.780 15410 Hoxb3 homeobox B3 -1.175 -1.557 0.544 0.598 15413 Hoxb5 homeobox B5 0.611 -2.906 -0.541 0.866 15430 Hoxd10 homeobox D10 1.744 -0.309 0.064 0.675 50916 Irx4 Iroquois related homeobox 4 (Drosophila) 0.355 3.366 1.968 -0.012 16392 Isl1 ISL1 transcription factor, LIM/homeodomain 0.243 0.701 1.066 0.317 16476 Jun Jun oncogene 0.464 2.165 0.235 0.200 16598 Klf2 Kruppel-like factor 2 (lung) 1.061 0.646 0.598 0.384 12224 Klf5 Kruppel-like factor 5 0.317 1.529 0.281 0.110 16842 Lef1 lymphoid enhancer binding factor 1 -2.344 -2.594 -0.857 -0.246 17260 Mef2c myocyte enhancer factor 2C -1.391 -2.194 0.228 0.466 17268 Meis1 Meis homeobox 1 0.333 2.853 1.277 0.563 17292 Mesp1 mesoderm posterior 1 -1.045 -0.374 0.392 0.084 17293 Mesp2 mesoderm posterior 2 1.206 -0.457 0.438 0.693 17387 Mmp14 matrix metallopeptidase 14 (membrane-inserted) -0.321 2.518 0.155 -0.148 17701 Msx1 homeobox, msh-like 1 -2.056 -2.261 -0.475 0.771 17869 Myc myelocytomatosis oncogene -0.828 -0.542 -0.578 -0.308 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived 18109 Mycn (avian) -0.413 -1.390 -1.009 -0.612

153

71950 Nanog Nanog homeobox 0.903 0.400 0.732 0.609 18091 Nkx2-5 NK2 transcription factor related, locus 5 (Drosophila) 0.099 0.060 0.806 0.043 18092 Nkx2-6 NK2 transcription factor related, locus 6 (Drosophila) -1.153 -0.782 -0.107 -0.144 11819 Nr2f2 nuclear receptor subfamily 2, group F, member 2 2.063 3.143 0.828 0.050 15370 Nr4a1 nuclear receptor subfamily 4, group A, member 1 -0.076 1.132 0.365 0.009 26423 Nr5a1 nuclear receptor subfamily 5, group A, member 1 -0.052 0.170 0.925 -0.616 26424 Nr5a2 nuclear receptor subfamily 5, group A, member 2 1.183 1.283 0.379 0.209 18505 Pax3 paired box gene 3 -0.205 1.360 -0.682 -0.235 18508 Pax6 paired box gene 6 -0.537 -0.771 -0.495 -0.260 18741 Pitx2 paired-like homeodomain transcription factor 2 -0.414 -1.072 0.049 0.303 18999 Pou5f1 POU domain, class 5, transcription factor 1 -0.567 -0.795 -0.323 -0.180 19130 Prox1 prospero-related homeobox 1 -0.005 0.832 0.139 0.277 18933 Prrx1 paired related homeobox 1 -0.047 1.217 -0.053 0.290 218772 Rarb retinoic acid receptor, beta 0.708 2.732 1.593 0.415 19411 Rarg retinoic acid receptor, gamma -0.234 -0.472 -0.377 -0.160 19697 Rela v-rel reticuloendotheliosis viral oncogene homolog A (avian) 0.236 1.215 0.132 0.075 12394 Runx1 runt related transcription factor 1 -0.052 2.531 0.038 -0.188 12393 Runx2 runt related transcription factor 2 -0.036 -0.435 -1.206 -0.350 20429 Shox2 short stature homeobox 2 0.066 0.597 1.459 0.685 17127 Smad3 MAD homolog 3 (Drosophila) 0.199 1.299 0.650 0.212 17128 Smad4 MAD homolog 4 (Drosophila) 0.224 0.842 -0.035 -0.001 20665 Sox10 SRY-box containing gene 10 -0.041 -1.410 0.151 -0.005 20671 Sox17 SRY-box containing gene 17 1.113 1.082 0.891 0.145 20672 Sox18 SRY-box containing gene 18 -0.263 -2.465 -0.111 0.174 20674 Sox2 SRY-box containing gene 2 0.588 -0.251 0.102 0.115 20677 Sox4 SRY-box containing gene 4 -0.422 -0.123 -0.188 -0.095 20678 Sox5 SRY-box containing gene 5 0.930 0.256 1.087 -0.167

154

20679 Sox6 SRY-box containing gene 6 -0.188 1.040 -0.363 -0.451 20680 Sox7 SRY-box containing gene 7 0.883 0.132 -0.420 0.112 20681 Sox8 SRY-box containing gene 8 0.676 -0.717 0.169 0.680 20682 Sox9 SRY-box containing gene 9 0.091 0.943 1.384 -0.232 20848 Stat3 signal transducer and activator of transcription 3 0.351 1.248 0.370 0.265 20850 Stat5a signal transducer and activator of transcription 5A 0.721 1.347 0.954 0.519 20997 T brachyury -3.143 -0.355 -0.292 -1.263 21349 Tal1 T-cell acute lymphocytic leukemia 1 -1.749 -3.801 -1.958 1.086 21380 Tbx1 T-box 1 0.895 0.781 0.386 -0.174 76365 Tbx18 T-box18 1.049 -0.290 0.221 0.351 21385 Tbx2 T-box 2 0.256 0.832 1.133 0.737 57246 Tbx20 T-box 20 -0.399 0.249 -0.452 0.287 21386 Tbx3 T-box 3 1.594 2.221 1.292 0.840 21388 Tbx5 T-box 5 0.477 -0.119 -0.456 -0.087 21414 Tcf7 transcription factor 7, T-cell specific -0.185 -0.843 -0.095 -0.029 21415 Tcf7l1 transcription factor 7-like 1 (T-cell specific, HMG box) -0.003 -0.509 0.165 0.020 21416 Tcf7l2 transcription factor 7-like 2, T-cell specific, HMG-box -0.092 0.609 0.704 0.220 21676 Tead1 TEA domain family member 1 0.058 1.301 0.247 0.074 21679 Tead4 TEA domain family member 4 0.435 2.290 0.456 0.190 22059 Trp53 transformation related protein 53 0.046 -0.256 -0.176 -0.086 22431 Wt1 Wilms tumor 1 homolog -1.240 -3.080 -1.149 -1.061 22773 Zic3 zinc finger protein of the cerebellum 3 -0.227 -0.430 -0.621 -0.391 77128 A930001N09Rik RIKEN cDNA A930001N09 gene 0.322 0.361 0.258 0.319 56321 Aatf apoptosis antagonizing transcription factor 0.115 -0.387 -0.176 0.045 11538 Adnp activity-dependent neuroprotective protein 0.092 0.028 0.126 0.113 240442 Adnp2 ADNP homeobox 2 -0.069 -0.163 0.186 0.316 17355 Aff1 AF4/FMR2 family, member 1 -0.129 0.604 -0.471 -0.311

155

16764 Aff3 AF4/FMR2 family, member 3 -0.579 -1.249 -0.396 -0.185 226747 Ahctf1 AT hook containing transcription factor 1 0.022 -0.251 -0.011 0.118 11622 Ahr aryl-hydrocarbon receptor -0.321 -0.521 -0.436 -0.403 216285 Alx1 ALX homeobox 1 0.286 -0.719 -0.226 0.782 11694 Alx3 aristaless-like homeobox 3 0.881 0.754 0.327 1.715 11695 Alx4 aristaless-like homeobox 4 -0.386 0.492 1.081 0.078 11835 Ar androgen receptor -1.406 -3.245 -0.714 0.272 13496 Arid3a AT rich interactive domain 3A (BRIGHT-like) 0.505 2.385 1.009 0.686 11863 Arnt aryl hydrocarbon receptor nuclear translocator 0.090 -0.176 0.180 0.226 11864 Arnt2 aryl hydrocarbon receptor nuclear translocator 2 -0.151 -0.889 -0.729 -0.283 11865 Arntl aryl hydrocarbon receptor nuclear translocator-like -0.129 0.007 0.132 0.247 272322 Arntl2 aryl hydrocarbon receptor nuclear translocator-like 2 -0.359 1.312 0.949 0.284 11878 Arx aristaless related homeobox -0.165 -1.132 -0.095 0.269 17172 Ascl1 achaete-scute complex homolog 1 (Drosophila) -0.077 -1.453 -0.439 1.481 17173 Ascl2 achaete-scute complex homolog 2 (Drosophila) 0.305 -0.991 0.424 0.168 11908 Atf1 activating transcription factor 1 0.008 -0.429 -0.237 -0.007 11909 Atf2 activating transcription factor 2 -0.089 0.017 -0.184 -0.004 11911 Atf4 activating transcription factor 4 0.359 -0.128 -0.313 0.014 107503 Atf5 activating transcription factor 5 0.786 0.376 0.090 0.565 12915 Atf6b activating transcription factor 6 beta -0.741 -0.378 -0.366 -0.340 330361 AW146020 expressed sequence AW146020 -0.056 -0.147 0.091 -0.208 12013 Bach1 BTB and CNC homology 1 0.104 0.085 0.112 0.197 12014 Bach2 BTB and CNC homology 2 0.173 1.689 0.172 0.159 54422 Barhl1 BarH-like 1 (Drosophila) 0.140 0.299 -0.917 -0.729 104382 Barhl2 BarH-like 2 (Drosophila) -0.044 -0.057 -0.752 0.134 12022 Barx1 BarH-like homeobox 1 0.670 0.833 0.968 0.209 12023 Barx2 BarH-like homeobox 2 0.670 -0.452 1.834 0.413

156

53314 Batf basic leucine zipper transcription factor, ATF-like -0.939 -1.132 0.216 -0.294 74481 Batf2 basic leucine zipper transcription factor, ATF-like 2 0.408 1.151 0.064 0.441 381319 Batf3 basic leucine zipper transcription factor, ATF-like 3 -0.695 -0.372 2.370 1.211 12051 Bcl3 B-cell leukemia/lymphoma 3 0.354 1.681 1.042 0.684 107771 Bmyc brain expressed myelocytomatosis oncogene -0.170 -0.199 0.612 0.309 244813 Bsx brain specific homeobox -0.189 0.822 0.168 -0.474 241066 Carf calcium response factor 0.039 0.435 0.351 0.026 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 12396 Cbfa2t2 (human) 0.309 -0.112 0.249 0.174 core-binding factor, runt domain, alpha subunit 2, translocated to, 3 12398 Cbfa2t3 (human) 0.947 1.610 1.533 0.845 12590 Cdx1 caudal type homeobox 1 0.493 1.189 0.822 1.030 12591 Cdx2 caudal type homeobox 2 0.130 -0.237 2.145 1.627 12592 Cdx4 caudal type homeobox 4 -2.681 -2.609 -1.133 -0.479 12608 Cebpb CCAAT/enhancer binding protein (C/EBP), beta 0.557 0.677 1.233 0.710 12609 Cebpd CCAAT/enhancer binding protein (C/EBP), delta 0.077 -0.295 -0.237 -0.269 110794 Cebpe CCAAT/enhancer binding protein (C/EBP), epsilon -0.183 -2.236 0.178 0.391 26371 Ciao1 cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) 0.037 -0.053 0.212 0.068 12753 Clock circadian locomotor output cycles kaput 0.132 0.442 0.157 0.187 12912 Creb1 cAMP responsive element binding protein 1 -0.247 -0.335 -0.285 -0.096 12913 Creb3 cAMP responsive element binding protein 3 0.396 2.146 0.304 0.229 26427 Creb3l1 cAMP responsive element binding protein 3-like 1 0.049 1.577 -0.049 -0.047 208647 Creb3l2 cAMP responsive element binding protein 3-like 2 0.298 2.379 0.886 0.404 208677 Creb3l3 cAMP responsive element binding protein 3-like 3 0.089 1.067 0.056 0.090 78284 Creb3l4 cAMP responsive element binding protein 3-like 4 -0.204 0.676 0.482 0.359 231991 Creb5 cAMP responsive element binding protein 5 -0.094 1.896 0.121 0.260 232430 Crebl2 cAMP responsive element binding protein-like 2 0.350 1.069 0.351 0.252 233490 Crebzf CREB/ATF bZIP transcription factor -0.327 -0.297 -0.204 -0.179

157

12916 Crem cAMP responsive element modulator 0.189 0.268 -0.119 0.235 12951 Crx cone-rod homeobox containing gene -0.204 -0.066 -0.100 -0.053 215418 Csrnp1 cysteine-serine-rich nuclear protein 1 0.017 0.675 0.212 0.346 207785 Csrnp2 cysteine-serine-rich nuclear protein 2 -0.021 -0.389 0.298 0.501 77771 Csrnp3 cysteine-serine-rich nuclear protein 3 -0.273 0.186 -0.468 -0.085 13016 Ctbp1 C-terminal binding protein 1 -0.002 -0.195 -0.017 0.009 13018 Ctcf CCCTC-binding factor -0.067 -0.535 -0.089 0.078 13047 Cux1 cut-like homeobox 1 0.079 -0.289 0.241 0.243 13048 Cux2 cut-like homeobox 2 0.584 0.906 0.592 0.336 13134 Dach1 dachshund 1 (Drosophila) -1.053 -0.299 1.196 0.397 13170 Dbp D site albumin promoter binding protein 0.272 -0.434 0.611 0.386 13172 Dbx1 developing brain homeobox 1 0.408 -0.147 0.496 1.115 13198 Ddit3 DNA-damage inducible transcript 3 0.891 0.995 0.163 0.560 13390 Dlx1 distal-less homeobox 1 -0.381 0.283 0.912 0.882 13392 Dlx2 distal-less homeobox 2 1.158 0.368 0.632 0.214 13394 Dlx4 distal-less homeobox 4 -0.449 1.396 1.343 0.994 13395 Dlx5 distal-less homeobox 5 -0.206 -0.162 0.589 0.177 13396 Dlx6 distal-less homeobox 6 -0.793 -2.808 1.311 1.061 140477 Dmbx1 diencephalon/mesencephalon homeobox 1 0.539 0.746 0.822 0.300 50796 Dmrt1 doublesex and mab-3 related transcription factor 1 1.218 -1.503 0.537 0.756 240590 Dmrt3 doublesex and mab-3 related transcription factor 3 1.053 -0.390 2.206 0.706 242523 Dmrta1 doublesex and mab-3 related transcription factor like family A1 -0.071 -0.534 -0.876 -0.411 242620 Dmrta2 doublesex and mab-3 related transcription factor like family A2 0.875 1.800 0.428 -0.142 56296 Dmrtb1 DMRT-like family B with proline-rich C-terminal, 1 0.904 -2.148 0.227 0.140 71241 Dmrtc2 doublesex and mab-3 related transcription factor like family C2 0.681 0.245 0.265 0.680 13555 E2f1 E2F transcription factor 1 0.332 -0.331 -0.088 0.000 242705 E2f2 E2F transcription factor 2 -0.491 0.169 -0.195 -0.042

158

13557 E2f3 E2F transcription factor 3 -0.367 -0.293 -0.257 -0.152 104394 E2f4 E2F transcription factor 4 -0.282 -0.527 -0.268 -0.127 13559 E2f5 E2F transcription factor 5 0.174 -0.219 0.221 0.044 50496 E2f6 E2F transcription factor 6 0.016 -0.285 -0.008 0.122 52679 E2f7 E2F transcription factor 7 -0.147 -0.303 -0.189 -0.025 108961 E2f8 E2F transcription factor 8 -0.027 0.204 0.024 0.397 13591 Ebf1 early B-cell factor 1 -1.314 -0.339 -0.449 -0.745 26940 Ecsit ECSIT homolog (Drosophila) -0.182 -0.497 -0.534 -0.230 13653 Egr1 early growth response 1 -0.716 -0.376 -0.608 -0.336 13654 Egr2 early growth response 2 -0.637 -0.229 -0.762 0.178 13661 Ehf ets homologous factor 0.093 0.230 0.495 -0.275 13709 Elf1 E74-like factor 1 0.322 1.103 0.698 0.495 69257 Elf2 E74-like factor 2 0.334 0.417 0.468 0.431 13710 Elf3 E74-like factor 3 0.882 0.468 0.874 0.543 56501 Elf4 E74-like factor 4 (ets domain transcription factor) 0.678 2.202 1.189 0.661 13711 Elf5 E74-like factor 5 1.080 1.065 2.308 1.347 13712 Elk1 ELK1, member of ETS oncogene family 0.113 0.291 0.028 0.091 13713 Elk3 ELK3, member of ETS oncogene family 0.006 1.589 0.687 0.664 13714 Elk4 ELK4, member of ETS oncogene family -0.278 0.218 -0.062 0.270 13796 Emx1 empty spiracles homolog 1 (Drosophila) 0.845 1.207 2.954 0.940 13797 Emx2 empty spiracles homolog 2 (Drosophila) -0.687 0.691 0.786 0.275 13798 En1 engrailed 1 -0.218 1.013 -0.030 0.349 13799 En2 engrailed 2 0.266 -0.701 0.601 0.542 13813 Eomes eomesodermin homolog (Xenopus laevis) -0.480 -0.311 1.070 0.534 328572 Ep300 E1A binding protein p300 -0.053 0.088 0.007 0.153 13875 Erf Ets2 repressor factor 0.520 0.238 0.231 0.201 13876 Erg avian erythroblastosis virus E-26 (v-ets) oncogene related -0.014 -0.337 0.647 0.051

159

13982 Esr1 estrogen receptor 1 (alpha) -0.411 -0.782 1.226 -0.126 13983 Esr2 estrogen receptor 2 (beta) -0.621 -0.670 -0.765 -0.351 26379 Esrra estrogen related receptor, alpha 0.437 0.370 0.171 0.112 26380 Esrrb estrogen related receptor, beta 1.358 1.317 0.415 0.342 26381 Esrrg estrogen-related receptor gamma -0.221 -0.849 -0.541 -0.455 23872 Ets2 E26 avian leukemia oncogene 2, 3' domain 0.327 1.057 1.345 1.041 14009 Etv1 ets variant gene 1 -1.813 -1.172 -1.467 -0.777 14008 Etv2 ets variant gene 2 -1.692 -2.454 -1.690 -1.406 27049 Etv3 ets variant gene 3 0.216 0.887 0.534 0.403 18612 Etv4 ets variant gene 4 (E1A enhancer binding protein, E1AF) -0.567 -0.126 -1.035 -0.492 104156 Etv5 ets variant gene 5 -0.432 -0.653 -0.449 -0.195 14011 Etv6 ets variant gene 6 (TEL oncogene) -0.611 -0.151 -0.029 0.011 14028 Evx1 even skipped homeotic gene 1 homolog -1.839 -0.220 -0.529 -0.296 14029 Evx2 even skipped homeotic gene 2 homolog 0.815 -0.139 0.459 0.293 50754 Fbxw7 F-box and WD-40 domain protein 7 0.040 0.127 -0.057 0.004 260298 Fev FEV (ETS oncogene family) 0.310 -0.635 -0.675 0.293 14247 Fli1 Friend leukemia integration 1 -0.247 -0.496 -0.459 1.271 14281 Fos FBJ osteosarcoma oncogene 0.610 1.320 1.065 0.454 14282 Fosb FBJ osteosarcoma oncogene B -0.006 0.640 0.934 0.691 14283 Fosl1 fos-like antigen 1 -0.229 0.304 -0.637 0.265 14284 Fosl2 fos-like antigen 2 0.590 3.633 -0.077 -0.194 15375 Foxa1 forkhead box A1 0.033 0.319 0.147 -0.754 15377 Foxa3 forkhead box A3 -0.297 -0.565 -0.196 0.188 64290 Foxb1 forkhead box B1 -0.708 0.033 -0.726 0.066 14240 Foxb2 forkhead box B2 -0.134 1.445 1.203 1.179 15229 Foxd1 forkhead box D1 0.263 -0.026 0.603 -0.273 17301 Foxd2 forkhead box D2 1.126 0.802 1.387 -0.400

160

15221 Foxd3 forkhead box D3 -1.319 -1.395 -0.992 -1.105 14237 Foxd4 forkhead box D4 -1.513 -0.337 -1.308 0.120 110805 Foxe1 forkhead box E1 0.027 0.724 0.581 -2.159 30923 Foxe3 forkhead box E3 -0.134 -0.139 -0.107 0.854 15227 Foxf1a forkhead box F1a 0.390 0.434 0.751 0.687 14238 Foxf2 forkhead box F2 0.863 1.000 -0.566 0.024 14233 Foxi1 forkhead box I1 0.408 -0.139 -0.107 0.440 270004 Foxi2 forkhead box I2 0.025 -0.150 1.623 -0.532 15223 Foxj1 forkhead box J1 0.133 -0.176 0.166 -0.124 60611 Foxj2 forkhead box J2 0.351 1.263 0.783 0.726 230700 Foxj3 forkhead box J3 0.300 0.445 0.210 0.283 17425 Foxk1 forkhead box K1 0.112 0.125 0.022 0.256 68837 Foxk2 forkhead box K2 -0.070 -0.289 -0.225 -0.050 14241 Foxl1 forkhead box L1 -0.006 -0.163 -0.626 -0.024 26927 Foxl2 forkhead box L2 0.619 1.616 -0.305 -0.280 14235 Foxm1 forkhead box M1 -0.041 -0.389 -0.030 -0.144 15218 Foxn1 forkhead box N1 0.391 1.393 -1.816 -0.149 71375 Foxn3 forkhead box N3 -0.142 -0.090 -0.101 0.291 116810 Foxn4 forkhead box N4 0.073 -1.413 1.465 0.970 56458 Foxo1 forkhead box O1 -0.036 -0.065 0.074 0.032 56484 Foxo3 forkhead box O3 0.443 0.114 0.381 0.445 54601 Foxo4 forkhead box O4 -0.363 -0.440 0.913 0.782 329934 Foxo6 forkhead box O6 0.564 -0.573 1.172 0.774 114142 Foxp2 forkhead box P2 -0.249 0.384 -0.388 -0.251 20371 Foxp3 forkhead box P3 -0.424 -0.147 -0.152 -0.153 74123 Foxp4 forkhead box P4 -0.003 0.005 0.223 -0.027 15220 Foxq1 forkhead box Q1 0.753 3.047 0.681 0.185

161

382074 Foxr1 forkhead box R1 0.027 -0.045 -0.512 -0.222 436240 Foxr2 forkhead box R2 -1.633 -1.554 -1.421 -1.000 14239 Foxs1 forkhead box S1 0.898 -0.139 0.496 -1.747 14390 Gabpa GA repeat binding protein, alpha -0.081 -0.142 -0.201 -0.019 14460 Gata1 GATA binding protein 1 0.969 -0.321 -1.274 1.407 14464 Gata5 GATA binding protein 5 -0.376 1.104 0.433 1.005 67210 Gatad1 GATA zinc finger domain containing 1 -0.054 -0.089 -0.086 -0.187 229542 Gatad2b GATA zinc finger domain containing 2B 0.112 0.036 -0.035 0.248 231044 Gbx1 gastrulation brain homeobox 1 0.286 -0.309 -0.594 -1.464 67367 Gcfc1 GC-rich sequence DNA-binding factor 1 -0.157 -0.024 -0.140 -0.144 14531 Gcm1 glial cells missing homolog 1 (Drosophila) 0.209 -0.719 -1.642 0.116 107889 Gcm2 glial cells missing homolog 2 (Drosophila) 0.408 -0.139 0.680 0.859 14633 Gli2 GLI-Kruppel family member GLI2 0.059 -0.046 -0.353 -0.348 83396 Glis2 GLIS family zinc finger 2 -0.123 0.824 0.461 0.130 226075 Glis3 GLIS family zinc finger 3 0.013 0.932 0.508 0.417 225908 Gm98 predicted gene 98 -1.480 -1.429 -1.986 -1.350 56809 Gmeb1 glucocorticoid modulatory element binding protein 1 -0.400 -0.652 -0.437 -0.237 73274 Gpbp1 GC-rich promoter binding protein 1 0.225 0.061 0.262 0.261 195733 Grhl1 grainyhead-like 1 (Drosophila) 0.404 -0.180 0.308 -0.030 252973 Grhl2 grainyhead-like 2 (Drosophila) -0.176 -0.575 -0.333 -0.491 14836 Gsc goosecoid homeobox 0.465 -0.311 1.985 0.871 195333 Gsc2 goosecoid homebox 2 0.506 -1.018 1.185 0.237 14842 Gsx1 GS homeobox 1 -0.743 -2.103 -1.559 0.040 14843 Gsx2 GS homeobox 2 2.280 -0.077 1.458 0.130 57080 Gtf2ird1 general transcription factor II I repeat domain-containing 1 0.127 -0.062 0.178 -0.015 66596 Gtf3a general transcription factor III A 0.047 -0.258 -0.007 0.027 15182 Hdac2 histone deacetylase 2 -0.055 -0.094 -0.071 -0.072

162

245596 Hdx highly divergent homeobox -0.750 -0.573 -0.773 -0.124 234219 Helt Hey-like transcription factor (zebrafish) 0.140 -0.665 -1.082 0.443 15205 Hes1 hairy and enhancer of split 1 (Drosophila) -0.241 0.438 0.413 -0.033 55927 Hes6 hairy and enhancer of split 6 (Drosophila) -0.933 -1.582 -0.638 -0.557 15209 Hesx1 homeobox gene expressed in ES cells 1.062 0.154 0.328 -0.009 15213 Hey1 hairy/enhancer-of-split related with YRPW motif 1 -0.293 0.025 0.851 0.017 56198 Heyl hairy/enhancer-of-split related with YRPW motif-like -0.365 0.037 1.231 0.864 15242 Hhex hematopoietically expressed homeobox 0.265 0.048 0.301 0.279 15251 Hif1a hypoxia inducible factor 1, alpha subunit -0.054 -0.155 -0.009 0.178 53417 Hif3a hypoxia inducible factor 3, alpha subunit 0.022 -0.628 0.426 -0.016 102423 Hinfp histone H4 transcription factor 0.069 0.392 -0.010 0.141 15273 Hivep2 human immunodeficiency virus type I enhancer binding protein 2 -0.640 1.110 0.253 0.187 217082 Hlf hepatic leukemia factor -0.739 -1.354 -2.225 -0.804 15284 Hlx H2.0-like homeobox -0.559 0.132 0.249 1.144 219150 Hmbox1 homeobox containing 1 -0.129 0.384 0.065 0.309 15353 Hmg20b high mobility group 20 B 0.236 0.703 0.401 0.074 15361 Hmga1 high mobility group AT-hook 1 -0.261 -1.183 -0.744 -0.432 15289 Hmgb1 high mobility group box 1 -0.151 -0.839 -0.329 -0.113 97165 Hmgb2 high mobility group box 2 0.032 -0.834 -0.245 -0.011 15371 Hmx1 H6 homeobox 1 0.414 -0.040 1.600 0.989 15372 Hmx2 H6 homeobox 2 0.273 -0.139 0.226 0.375 15373 Hmx3 H6 homeobox 3 0.912 -0.136 -0.109 0.077 21410 Hnf1b HNF1 homeobox B 0.563 0.634 1.494 0.474 15378 Hnf4a hepatic nuclear factor 4, alpha 0.408 0.853 1.963 0.877 30942 Hnf4g hepatocyte nuclear factor 4, gamma 0.111 0.098 -0.108 -0.131 15384 Hnrnpab heterogeneous nuclear ribonucleoprotein A/B -0.141 -0.573 -0.270 -0.153 239099 Homez homeodomain leucine zipper-encoding gene -0.495 -0.410 0.063 0.066

163

15396 Hoxa11 homeobox A11 0.482 0.033 -0.255 0.676 15398 Hoxa13 homeobox A13 0.815 0.861 1.325 0.609 15399 Hoxa2 homeobox A2 0.636 0.231 0.362 0.069 15401 Hoxa4 homeobox A4 0.084 -1.089 1.413 1.525 15402 Hoxa5 homeobox A5 -0.131 0.334 0.448 1.556 15403 Hoxa6 homeobox A6 0.815 0.861 1.478 0.524 15404 Hoxa7 homeobox A7 0.458 0.309 0.155 0.513 15405 Hoxa9 homeobox A9 -0.696 -0.272 0.092 1.048 15407 Hoxb1 homeobox B1 -0.885 -2.889 -0.532 0.929 15408 Hoxb13 homeobox B13 -0.461 -0.157 0.786 0.874 103889 Hoxb2 homeobox B2 -0.931 -2.849 1.536 0.682 15412 Hoxb4 homeobox B4 0.782 0.926 0.778 0.308 15414 Hoxb6 homeobox B6 1.479 -1.574 -1.082 0.443 15415 Hoxb7 homeobox B7 0.178 -0.159 -0.377 0.987 15416 Hoxb8 homeobox B8 -0.117 -0.558 -1.087 0.047 15417 Hoxb9 homeobox B9 0.614 1.489 -1.980 -0.991 209448 Hoxc10 homeobox C10 0.603 -1.050 1.211 1.288 109663 Hoxc11 homeobox C11 0.815 -0.139 -0.107 -0.172 15421 Hoxc12 homeobox C12 -0.592 -0.504 -0.071 -0.123 15422 Hoxc13 homeobox C13 0.606 0.415 0.017 -0.518 15423 Hoxc4 homeobox C4 0.151 0.685 2.020 0.927 15424 Hoxc5 homeobox C5 -0.216 -0.224 -0.269 0.928 15425 Hoxc6 homeobox C6 1.103 0.369 0.543 0.187 15426 Hoxc8 homeobox C8 -0.261 -0.173 -0.302 0.257 15427 Hoxc9 homeobox C9 1.408 -0.417 0.623 0.203 15429 Hoxd1 homeobox D1 -1.322 -0.852 1.074 0.794 15431 Hoxd11 homeobox D11 0.505 -1.407 0.203 0.650

164

15432 Hoxd12 homeobox D12 1.084 -2.139 -0.675 0.077 15433 Hoxd13 homeobox D13 -0.567 -2.501 -0.071 0.602 15434 Hoxd3 homeobox D3 -1.011 -0.922 0.175 0.592 15436 Hoxd4 homeobox D4 1.057 -0.942 1.721 1.506 15437 Hoxd8 homeobox D8 1.277 2.425 1.043 0.018 15438 Hoxd9 homeobox D9 0.544 1.536 0.952 1.741 15499 Hsf1 heat shock factor 1 -0.090 -0.061 0.123 0.136 15500 Hsf2 heat shock factor 2 0.234 -0.066 -0.042 0.034 245525 Hsf3 heat shock transcription factor 3 -0.134 -0.516 -0.541 0.440 26386 Hsf4 heat shock transcription factor 4 0.559 -0.081 0.820 0.310 327992 Hsf5 heat shock transcription factor family member 5 0.310 -0.569 0.232 -0.076 15901 Id1 inhibitor of DNA binding 1 -0.187 0.511 0.658 -0.214 22778 Ikzf1 IKAROS family zinc finger 1 -0.763 -0.625 0.436 0.718 16362 Irf1 interferon regulatory factor 1 -0.725 -1.396 -0.044 0.059 16363 Irf2 interferon regulatory factor 2 0.204 2.155 1.150 1.012 54131 Irf3 interferon regulatory factor 3 -0.075 0.157 0.267 0.087 16364 Irf4 interferon regulatory factor 4 -0.374 -1.679 -0.415 1.539 27056 Irf5 interferon regulatory factor 5 0.157 0.995 0.535 -0.104 54139 Irf6 interferon regulatory factor 6 0.578 1.449 0.369 -0.178 54123 Irf7 interferon regulatory factor 7 0.083 0.036 2.717 1.866 15900 Irf8 interferon regulatory factor 8 -0.700 -1.218 0.056 0.557 16391 Irf9 interferon regulatory factor 9 -0.010 0.542 0.588 0.459 16371 Irx1 Iroquois related homeobox 1 (Drosophila) 0.227 0.024 0.923 0.311 16372 Irx2 Iroquois related homeobox 2 (Drosophila) 0.514 0.559 1.229 0.870 16373 Irx3 Iroquois related homeobox 3 (Drosophila) 0.058 -0.618 2.498 1.029 54352 Irx5 Iroquois related homeobox 5 (Drosophila) -0.355 -0.916 0.539 -0.039 64379 Irx6 Iroquois related homeobox 6 (Drosophila) -0.250 -2.247 2.737 0.627

165

104360 Isl2 insulin related protein 2 (islet 2) 0.725 0.208 0.010 -0.062 71597 Isx intestine specific homeobox -0.592 0.256 -0.109 -1.156 81703 Jdp2 Jun dimerization protein 2 0.931 1.950 0.934 0.690 16477 Junb Jun-B oncogene -0.130 1.895 0.898 0.608 16478 Jund Jun proto-oncogene related gene d 0.467 0.621 0.794 0.359 99982 Kdm1a lysine (K)-specific demethylase 1A 0.123 -0.154 0.251 0.203 194655 Klf11 Kruppel-like factor 11 1.025 0.343 0.443 0.352 16597 Klf12 Kruppel-like factor 12 -0.650 0.364 -0.907 -0.350 66277 Klf15 Kruppel-like factor 15 -0.080 0.422 0.460 0.125 118445 Klf16 Kruppel-like factor 16 0.091 -0.429 -0.040 -0.053 75753 Klf17 Kruppel-like factor 17 0.077 -0.522 -0.817 -0.385 16600 Klf4 Kruppel-like factor 4 (gut) 1.414 1.625 0.368 0.274 23849 Klf6 Kruppel-like factor 6 0.246 1.644 0.646 0.588 93691 Klf7 Kruppel-like factor 7 (ubiquitous) -0.300 0.843 -0.430 0.111 320858 L3mbtl4 l(3)mbt-like 4 (Drosophila) 0.273 -0.139 -0.105 -0.868 76893 Lass2 LAG1 homolog, ceramide synthase 2 -0.402 0.398 0.380 0.217 67260 Lass4 LAG1 homolog, ceramide synthase 4 -0.455 -0.154 -0.784 -0.925 71949 Lass5 LAG1 homolog, ceramide synthase 5 -0.251 0.486 0.002 0.008 241447 Lass6 LAG1 homolog, ceramide synthase 6 -0.427 0.943 -0.303 -0.073 16814 Lbx1 ladybird homeobox homolog 1 (Drosophila) 0.753 0.586 -0.089 0.869 16815 Lbx2 ladybird homeobox homolog 2 (Drosophila) 1.024 0.439 -0.439 0.431 212391 Lcor ligand dependent nuclear receptor corepressor 0.220 0.694 0.505 0.431 16869 Lhx1 LIM homeobox protein 1 -2.217 0.483 0.719 -0.197 16870 Lhx2 LIM homeobox protein 2 1.351 -0.326 1.347 1.968 16871 Lhx3 LIM homeobox protein 3 -1.150 -3.280 -0.447 -0.387 16872 Lhx4 LIM homeobox protein 4 -0.244 -0.030 -0.320 -0.837 16873 Lhx5 LIM homeobox protein 5 -0.271 0.352 -0.674 -0.570

166

16874 Lhx6 LIM homeobox protein 6 -0.081 0.376 -0.007 0.335 16875 Lhx8 LIM homeobox protein 8 -0.236 -1.665 -0.107 0.208 16876 Lhx9 LIM homeobox protein 9 1.386 -1.407 -0.095 1.332 110648 Lmx1a LIM homeobox transcription factor 1 alpha -0.096 -0.999 0.275 0.186 16917 Lmx1b LIM homeobox transcription factor 1 beta 1.332 -0.589 1.273 0.437 17132 Maf avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog 0.302 1.078 0.367 0.446 v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A 378435 Mafa (avian) 0.926 -0.245 0.811 0.538 v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B 16658 Mafb (avian) 0.340 -0.983 -0.482 0.371 v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F 17133 Maff (avian) -0.191 0.704 -0.307 0.347 v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G 17134 Mafg (avian) 0.056 -0.232 -0.060 0.014 v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K 17135 Mafk (avian) 0.128 0.871 0.225 0.462 17187 Max Max protein -0.049 -0.143 -0.056 0.066 14013 Mecom MDS1 and EVI1 complex locus -0.650 0.095 0.159 -0.685 17257 Mecp2 methyl CpG binding protein 2 0.040 0.335 0.219 0.027 17258 Mef2a myocyte enhancer factor 2A 0.088 0.874 0.067 0.070 17259 Mef2b myocyte enhancer factor 2B 0.687 -0.078 -0.256 0.142 17261 Mef2d myocyte enhancer factor 2D 0.161 1.085 0.660 0.600 17536 Meis2 Meis homeobox 2 -0.511 1.585 0.980 0.459 17537 Meis3 Meis homeobox 3 -0.161 1.852 0.734 0.109 17285 Meox1 mesenchyme homeobox 1 -0.046 0.797 0.135 0.523 17286 Meox2 mesenchyme homeobox 2 -0.592 -0.918 -0.071 0.078 29808 Mga MAX gene associated 0.020 -0.035 -0.199 -0.042 17342 Mitf microphthalmia-associated transcription factor 0.355 0.998 0.799 0.379 27217 Mixl1 Mix1 homeobox-like 1 (Xenopus laevis) -2.066 -1.434 0.191 -0.004

167

210719 Mkx mohawk homeobox -0.373 -0.482 0.179 0.197 17428 Mnt max binding protein 0.164 -0.015 0.160 0.398 15285 Mnx1 motor neuron and pancreas homeobox 1 0.234 -0.636 1.230 -0.616 67871 Mrrf mitochondrial ribosome recycling factor 0.284 -0.313 -0.351 0.045 17702 Msx2 homeobox, msh-like 2 0.462 2.857 0.474 -0.157 17703 Msx3 homeobox, msh-like 3 -0.621 -1.407 -1.318 -0.124 116870 Mta1 metastasis associated 1 -0.217 -0.475 -0.011 0.017 23942 Mta2 metastasis-associated gene family, member 2 -0.072 -0.070 -0.029 0.028 116871 Mta3 metastasis associated 3 0.403 -0.288 0.318 0.288 17764 Mtf1 metal response element binding transcription factor 1 0.096 0.301 0.297 0.395 17863 Myb myeloblastosis oncogene -0.838 -1.527 -1.307 -1.034 v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma 16918 Mycl1 derived (avian) -0.361 -0.904 -0.073 -0.379 17870 Mycs myc-like oncogene, s-myc protein 0.815 -0.139 -0.071 0.443 17927 Myod1 myogenic differentiation 1 -1.217 -2.533 -1.109 -0.747 17928 Myog myogenin 0.589 -0.540 1.192 1.533 232934 Mypop Myb-related transcription factor, partner of profilin -0.300 -0.621 0.425 0.359 217127 Myst2 MYST histone acetyltransferase 2 0.400 -0.050 0.229 0.362 17932 Myt1 myelin transcription factor 1 -0.080 0.571 1.396 0.209 17933 Myt1l myelin transcription factor 1-like -1.490 -1.414 -0.352 0.488 20185 Ncor1 nuclear receptor co-repressor 1 -0.123 -0.177 0.055 0.101 18012 Neurod1 neurogenic differentiation 1 -0.390 -2.372 -2.135 -1.404 11925 Neurog3 neurogenin 3 0.788 -2.912 -2.826 -1.564 54446 Nfat5 nuclear factor of activated T-cells 5 -0.265 0.638 0.043 -0.017 18018 Nfatc1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 0.447 0.620 0.599 0.415 18019 Nfatc2 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 -0.046 1.204 0.475 0.285 18021 Nfatc3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 0.012 -0.109 0.078 0.257 73181 Nfatc4 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 -0.019 0.348 0.458 0.049

168

18022 Nfe2 nuclear factor, erythroid derived 2 -0.312 0.466 -0.319 0.551 18023 Nfe2l1 nuclear factor, erythroid derived 2,-like 1 -0.245 0.263 0.045 0.067 18024 Nfe2l2 nuclear factor, erythroid derived 2, like 2 0.239 -0.243 0.159 0.116 18025 Nfe2l3 nuclear factor, erythroid derived 2, like 3 -0.586 -0.276 0.591 0.192 18027 Nfia nuclear factor I/A 0.526 0.047 0.467 0.320 18028 Nfib nuclear factor I/B 0.053 0.125 -0.268 -0.308 18029 Nfic nuclear factor I/C 0.264 0.188 0.182 0.113 18030 Nfil3 nuclear factor, interleukin 3, regulated 0.134 0.498 0.187 0.225 18032 Nfix nuclear factor I/X 0.734 0.239 0.426 0.738 18033 Nfkb1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1, p105 0.157 0.700 0.270 0.135 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, 18034 Nfkb2 p49/p100 -0.030 1.337 -0.050 -0.055 74164 Nfx1 nuclear transcription factor, X-box binding 1 -0.132 -0.430 -0.144 0.009 18044 Nfya nuclear transcription factor-Y alpha 0.064 -0.079 0.198 0.327 18045 Nfyb nuclear transcription factor-Y beta 0.192 -0.481 -0.233 -0.181 18046 Nfyc nuclear transcription factor-Y gamma 0.058 -0.593 -0.159 0.001 20231 Nkx1-2 NK1 transcription factor related, locus 2 (Drosophila) -3.895 -1.631 -0.402 0.054 21869 Nkx2-1 NK2 homeobox 1 -0.289 0.657 -0.563 -0.620 18088 Nkx2-2 NK2 transcription factor related, locus 2 (Drosophila) -0.135 0.573 -0.504 0.177 18089 Nkx2-3 NK2 transcription factor related, locus 3 (Drosophila) -0.996 -0.433 1.675 0.318 228731 Nkx2-4 NK2 transcription factor related, locus 4 (Drosophila) -0.090 -1.607 0.807 0.555 18094 Nkx2-9 NK2 transcription factor related, locus 9 (Drosophila) 0.668 1.114 -1.009 -0.503 18095 Nkx3-1 NK-3 transcription factor, locus 1 (Drosophila) -0.176 -0.503 0.542 0.812 12020 Nkx3-2 NK3 homeobox 2 1.391 -0.249 -0.709 0.441 18096 Nkx6-1 NK6 homeobox 1 0.797 -0.047 0.541 0.747 14912 Nkx6-2 NK6 homeobox 2 0.279 0.300 -0.038 -0.207 74561 Nkx6-3 NK6 homeobox 3 0.156 1.185 0.069 0.989 18291 Nobox NOBOX oogenesis homeobox -0.199 -0.057 -0.027 -0.232

169

70769 Nolc1 nucleolar and coiled-body phosphoprotein 1 -0.204 -0.847 -0.554 -0.315 18128 Notch1 Notch gene homolog 1 (Drosophila) 0.015 0.207 -0.191 -0.649 384452 Noto notochord homolog (Xenopus laevis) -0.527 -0.139 0.496 -0.408 18143 Npas2 neuronal PAS domain protein 2 0.044 0.492 0.684 -0.081 244879 Npat nuclear protein in the AT region 0.132 0.206 0.151 0.139 11614 Nr0b1 nuclear receptor subfamily 0, group B, member 1 1.134 0.827 0.084 0.038 23957 Nr0b2 nuclear receptor subfamily 0, group B, member 2 0.164 -0.616 0.124 1.177 217166 Nr1d1 nuclear receptor subfamily 1, group D, member 1 0.283 -0.354 0.201 0.182 353187 Nr1d2 nuclear receptor subfamily 1, group D, member 2 0.281 -0.163 -0.211 0.056 22260 Nr1h2 nuclear receptor subfamily 1, group H, member 2 -0.023 -0.112 0.064 0.080 22259 Nr1h3 nuclear receptor subfamily 1, group H, member 3 -0.410 0.232 -0.052 -0.155 20186 Nr1h4 nuclear receptor subfamily 1, group H, member 4 -0.218 0.496 -0.109 -0.135 18171 Nr1i2 nuclear receptor subfamily 1, group I, member 2 -0.532 0.496 2.652 2.189 12355 Nr1i3 nuclear receptor subfamily 1, group I, member 3 -0.525 -0.508 -0.590 -0.873 22025 Nr2c1 nuclear receptor subfamily 2, group C, member 1 -0.353 0.233 0.178 -0.216 22026 Nr2c2 nuclear receptor subfamily 2, group C, member 2 -0.104 -0.033 -0.134 0.019 21907 Nr2e1 nuclear receptor subfamily 2, group E, member 1 0.179 -0.540 -1.439 0.826 23958 Nr2e3 nuclear receptor subfamily 2, group E, member 3 0.408 0.571 -0.108 0.984 13865 Nr2f1 nuclear receptor subfamily 2, group F, member 1 -0.202 1.395 0.995 0.198 13864 Nr2f6 nuclear receptor subfamily 2, group F, member 6 -0.185 -0.208 0.235 -0.068 14815 Nr3c1 nuclear receptor subfamily 3, group C, member 1 0.120 -0.002 0.283 0.176 110784 Nr3c2 nuclear receptor subfamily 3, group C, member 2 0.593 0.717 0.900 1.332 18227 Nr4a2 nuclear receptor subfamily 4, group A, member 2 -0.092 0.548 0.460 0.382 18124 Nr4a3 nuclear receptor subfamily 4, group A, member 3 0.764 1.345 1.627 1.220 14536 Nr6a1 nuclear receptor subfamily 6, group A, member 1 -0.011 -0.362 0.092 0.233 18181 Nrf1 nuclear respiratory factor 1 -0.055 -0.259 -0.100 0.073 18185 Nrl neural retina leucine zipper gene 0.815 -0.030 -0.439 0.664

170

50914 Olig1 oligodendrocyte transcription factor 1 -0.584 0.408 0.292 0.082 50913 Olig2 oligodendrocyte transcription factor 2 -0.892 -0.625 -0.248 -0.522 15379 Onecut1 one cut domain, family member 1 0.218 -1.217 1.665 0.922 225631 Onecut2 one cut domain, family member 2 -0.366 0.776 0.517 0.096 246086 Onecut3 one cut domain, family member 3 0.345 -0.289 -0.020 1.058 18420 Otp orthopedia homolog (Drosophila) 0.273 -0.030 -0.675 0.288 18423 Otx1 orthodenticle homolog 1 (Drosophila) -0.012 -0.861 0.720 0.934 18424 Otx2 orthodenticle homolog 2 (Drosophila) -1.656 -2.166 -1.833 -1.321 18426 Ovol1 OVO homolog-like 1 (Drosophila) 0.131 -0.673 0.688 0.374 107586 Ovol2 ovo-like 2 (Drosophila) -0.037 -0.958 0.341 -0.086 18813 Pa2g4 proliferation-associated 2G4 -0.185 -0.726 -0.432 -0.236 18503 Pax1 paired box gene 1 0.022 -1.475 -1.204 -0.445 18504 Pax2 paired box gene 2 0.198 -0.816 0.253 0.819 18506 Pax4 paired box gene 4 0.408 -0.139 -0.107 0.440 18507 Pax5 paired box gene 5 -0.134 0.335 -0.709 1.179 18509 Pax7 paired box gene 7 -0.129 -1.049 -0.107 -0.385 18510 Pax8 paired box gene 8 -0.760 -2.089 -1.394 -0.237 18511 Pax9 paired box gene 9 0.034 0.317 0.967 -0.471 18514 Pbx1 pre B-cell leukemia transcription factor 1 -0.478 -0.691 1.062 0.605 18515 Pbx2 pre B-cell leukemia transcription factor 2 0.079 0.085 0.571 0.223 18516 Pbx3 pre B-cell leukemia transcription factor 3 -0.219 -0.911 0.120 0.144 80720 Pbx4 pre-B-cell leukemia homeobox 4 0.062 0.309 0.062 -0.267 71041 Pcgf6 polycomb group ring finger 6 -0.030 -0.731 -0.413 -0.256 18609 Pdx1 pancreatic and duodenal homeobox 1 -0.216 0.736 -0.365 -0.144 18667 Pgr progesterone receptor -1.078 -1.627 -1.089 -0.254 68479 Phf5a PHD finger protein 5A -0.239 -0.708 -0.529 -0.336 11859 Phox2a paired-like homeobox 2a 0.244 -0.419 -0.076 -0.020

171

18935 Phox2b paired-like homeobox 2b 0.408 -0.516 1.226 1.440 18740 Pitx1 paired-like homeodomain transcription factor 1 1.151 1.145 1.212 0.561 18742 Pitx3 paired-like homeodomain transcription factor 3 -0.398 -1.175 0.528 0.412 18771 Pknox1 Pbx/knotted 1 homeobox 0.121 -0.307 -0.092 0.295 208076 Pknox2 Pbx/knotted 1 homeobox 2 0.191 1.531 0.973 -0.189 18736 Pou1f1 POU domain, class 1, transcription factor 1 0.782 1.151 -0.084 -0.144 18986 Pou2f1 POU domain, class 2, transcription factor 1 -0.429 -0.462 -0.740 -0.267 18987 Pou2f2 POU domain, class 2, transcription factor 2 -0.985 -0.893 -0.991 -0.615 18988 Pou2f3 POU domain, class 2, transcription factor 3 -0.981 0.516 -0.008 0.446 18991 Pou3f1 POU domain, class 3, transcription factor 1 -1.446 -3.587 -2.100 -1.664 18992 Pou3f2 POU domain, class 3, transcription factor 2 -0.242 -0.366 -0.209 0.200 18993 Pou3f3 POU domain, class 3, transcription factor 3 0.638 -0.259 0.822 0.380 18994 Pou3f4 POU domain, class 3, transcription factor 4 -0.682 -0.403 0.914 -1.217 18996 Pou4f1 POU domain, class 4, transcription factor 1 0.648 0.289 0.363 0.587 18997 Pou4f2 POU domain, class 4, transcription factor 2 -1.546 -0.352 -1.146 -1.378 18998 Pou4f3 POU domain, class 4, transcription factor 3 -0.524 -2.175 -0.761 -1.463 75507 Pou5f2 POU domain class 5, transcription factor 2 -0.812 0.861 -0.516 -0.514 19009 Pou6f1 POU domain, class 6, transcription factor 1 -0.319 0.303 0.306 0.108 218030 Pou6f2 POU domain, class 6, transcription factor 2 -0.592 -0.734 -0.860 1.073 19013 Ppara peroxisome proliferator activated receptor alpha 0.118 1.193 0.555 -0.089 19015 Ppard peroxisome proliferator activator receptor delta 0.206 0.274 0.671 0.498 19016 Pparg peroxisome proliferator activated receptor gamma 0.640 1.335 2.854 2.103 50907 Preb prolactin regulatory element binding -0.034 -0.109 0.307 0.068 19127 Prop1 paired like homeodomain factor 1 0.408 -0.139 -0.107 -0.144 20204 Prrx2 paired related homeobox 2 0.485 2.373 1.203 0.614 107751 Prrxl1 paired related homeobox protein-like 1 -0.888 -0.139 -0.709 0.440 19290 Pura purine rich element binding protein A 0.436 0.311 -0.023 0.143

172

19291 Purb purine rich element binding protein B -0.424 -0.099 -0.357 -0.200 19401 Rara retinoic acid receptor, alpha 0.058 -0.790 -0.163 -0.153 19434 Rax retina and anterior neural fold homeobox 0.131 -0.282 0.522 0.095 recombination signal binding protein for immunoglobulin kappa J region- 19668 Rbpjl like 0.145 0.561 -0.079 -0.819 104383 Rcor2 REST corepressor 2 0.109 -0.316 -0.009 -0.142 19696 Rel reticuloendotheliosis oncogene -0.248 0.334 0.468 0.610 19698 Relb avian reticuloendotheliosis viral (v-rel) oncogene related B 0.410 1.283 0.020 0.000 68703 Rere arginine glutamic acid dipeptide (RE) repeats -0.071 0.097 0.314 0.305 19883 Rora RAR-related orphan receptor alpha 0.486 0.142 0.384 0.660 225998 Rorb RAR-related orphan receptor beta -0.222 0.535 -0.230 0.442 19885 Rorc RAR-related orphan receptor gamma -1.174 -2.329 -1.804 0.268 12395 Runx1t1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) -0.855 -1.370 -0.813 -0.153 12399 Runx3 runt related transcription factor 3 -0.226 -0.048 -0.258 0.296 20181 Rxra retinoid X receptor alpha 0.270 0.446 1.057 0.616 20182 Rxrb retinoid X receptor beta 0.047 -0.241 0.123 0.167 20183 Rxrg retinoid X receptor gamma -2.149 -3.109 -2.008 -0.772 20230 Satb1 special AT-rich sequence binding protein 1 -0.756 -2.094 -0.099 0.063 212712 Satb2 special AT-rich sequence binding protein 2 0.712 0.558 0.366 0.489 18292 Sebox SEBOX homeobox -0.708 -0.589 -1.515 -1.372 20375 Sfpi1 SFFV proviral integration 1 -0.018 0.149 0.824 0.951 20464 Sim1 single-minded homolog 1 (Drosophila) -0.447 -0.349 -0.605 0.235 20465 Sim2 single-minded homolog 2 (Drosophila) 0.147 1.653 1.068 0.916 20466 Sin3a transcriptional regulator, SIN3A (yeast) -0.020 -0.412 0.014 0.067 20471 Six1 sine oculis-related homeobox 1 homolog (Drosophila) 0.424 -0.491 0.157 0.070 20472 Six2 sine oculis-related homeobox 2 homolog (Drosophila) -0.001 0.095 -0.103 -0.121 20473 Six3 sine oculis-related homeobox 3 homolog (Drosophila) 0.195 0.384 -0.623 0.695 20474 Six4 sine oculis-related homeobox 4 homolog (Drosophila) 0.068 -0.586 -0.373 -0.236

173

20475 Six5 sine oculis-related homeobox 5 homolog (Drosophila) -0.358 0.971 0.991 0.334 20476 Six6 sine oculis-related homeobox 6 homolog (Drosophila) -1.177 -1.254 -1.148 0.752 17125 Smad1 MAD homolog 1 (Drosophila) 0.182 0.368 0.165 0.162 17126 Smad2 MAD homolog 2 (Drosophila) 0.264 0.137 0.135 0.207 17129 Smad5 MAD homolog 5 (Drosophila) -0.294 0.310 0.455 0.167 17130 Smad6 MAD homolog 6 (Drosophila) 0.564 -0.038 1.407 0.578 17131 Smad7 MAD homolog 7 (Drosophila) 0.033 0.153 -0.056 0.044 55994 Smad9 MAD homolog 9 (Drosophila) -0.717 0.285 0.195 0.291 30927 Snai3 snail homolog 3 (Drosophila) -0.176 0.074 0.461 0.012 227631 Sohlh1 spermatogenesis and oogenesis specific basic helix-loop-helix 1 0.697 -0.686 0.859 1.216 20666 Sox11 SRY-box containing gene 11 -0.367 -0.346 -0.466 -0.671 223227 Sox21 SRY-box containing gene 21 1.435 0.482 0.300 -0.134 20683 Sp1 trans-acting transcription factor 1 -0.062 -0.367 -0.303 -0.027 20687 Sp3 trans-acting transcription factor 3 0.204 -0.123 0.289 0.355 20688 Sp4 trans-acting transcription factor 4 -0.099 -0.570 -0.009 0.307 30051 Spdef SAM pointed domain containing ets transcription factor 0.687 -0.555 -0.114 0.218 56381 Spen SPEN homolog, transcriptional regulator (Drosophila) -0.121 0.190 0.114 0.255 272382 Spib Spi-B transcription factor (Spi-1/PU.1 related) 0.496 -0.122 -0.437 -0.055 20728 Spic Spi-C transcription factor (Spi-1/PU.1 related) -0.339 1.560 0.593 0.713 79401 Spz1 spermatogenic leucine zipper 1 1.408 -0.065 0.453 1.877 20787 Srebf1 sterol regulatory element binding transcription factor 1 -0.377 0.311 0.287 0.301 20788 Srebf2 sterol regulatory element binding factor 2 -0.366 -0.183 -0.076 0.018 20807 Srf serum response factor -0.177 0.115 -0.217 -0.091 269397 Ss18l1 synovial sarcoma translocation gene on chromosome 18-like 1 0.368 0.487 0.147 0.176 240690 St18 suppression of tumorigenicity 18 0.815 -0.414 -0.370 0.327 20846 Stat1 signal transducer and activator of transcription 1 -0.176 0.446 0.881 0.504 20847 Stat2 signal transducer and activator of transcription 2 0.111 0.116 0.838 0.674

174

20849 Stat4 signal transducer and activator of transcription 4 -0.721 -0.336 -0.351 0.001 20851 Stat5b signal transducer and activator of transcription 5B 0.304 1.366 0.671 0.427 20852 Stat6 signal transducer and activator of transcription 6 0.304 0.303 0.405 0.309 94186 Strn3 striatin, calmodulin binding protein 3 -0.083 0.167 -0.078 -0.089 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated 226182 Taf5 factor 0.101 -0.355 -0.071 0.029 TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated 21343 Taf6 factor 0.044 -0.172 0.038 0.092 21374 Tbp TATA box binding protein -0.110 -0.354 0.090 0.099 227606 Tbpl2 TATA box binding protein like 2 0.408 -0.139 -0.107 -0.144 21375 Tbr1 T-box brain gene 1 0.066 0.411 -0.705 0.148 109575 Tbx10 T-box 10 1.131 -1.070 1.581 1.429 21384 Tbx15 T-box 15 0.591 1.035 0.637 0.095 83993 Tbx19 T-box 19 0.999 -0.139 0.496 -1.115 57765 Tbx21 T-box 21 -0.817 -0.779 0.449 0.095 245572 Tbx22 T-box 22 -1.524 -1.749 -0.098 -0.646 21387 Tbx4 T-box 4 0.267 -0.965 0.228 0.530 21389 Tbx6 T-box 6 0.389 0.015 -0.100 0.426 56070 Tcerg1 transcription elongation regulator 1 (CA150) -0.031 -0.396 -0.038 -0.028 21406 Tcf12 transcription factor 12 -0.068 0.301 0.155 0.131 21411 Tcf20 transcription factor 20 0.125 0.118 0.327 0.385 21412 Tcf21 transcription factor 21 0.164 -0.782 -0.541 2.206 66855 Tcf25 transcription factor 25 (basic helix-loop-helix) -0.038 0.003 0.085 0.060 21423 Tcf3 transcription factor 3 0.004 -0.326 0.107 0.053 21413 Tcf4 transcription factor 4 -0.504 -0.120 -0.075 0.193 21418 Tcfap2a transcription factor AP-2, alpha -0.090 0.587 0.131 -0.069 21419 Tcfap2b transcription factor AP-2 beta -0.150 0.405 0.053 0.204 21420 Tcfap2c transcription factor AP-2, gamma 1.190 1.242 1.482 1.067

175

226896 Tcfap2d transcription factor AP-2, delta 0.408 -0.665 -0.107 -0.144 332937 Tcfap2e transcription factor AP-2, epsilon -0.321 -0.944 0.180 0.020 209446 Tcfe3 transcription factor E3 -0.085 -0.737 -0.398 -0.126 21425 Tcfeb transcription factor EB 0.823 0.834 0.712 0.456 21677 Tead2 TEA domain family member 2 -0.288 -0.179 0.094 -0.018 21678 Tead3 TEA domain family member 3 -0.371 1.441 0.988 0.323 21685 Tef thyrotroph embryonic factor 0.476 -0.009 0.253 0.056 21780 Tfam transcription factor A, mitochondrial -0.068 -0.308 -0.175 -0.034 21781 Tfdp1 transcription factor Dp 1 -0.199 -0.473 -0.292 -0.169 211586 Tfdp2 transcription factor Dp 2 -0.363 -1.039 -0.110 0.050 54723 Tfip11 tuftelin interacting protein 11 0.065 -0.185 0.068 0.113 21815 Tgif1 TGFB-induced factor homeobox 1 -0.031 -0.170 0.113 0.021 228839 Tgif2 TGFB-induced factor homeobox 2 -0.114 -0.533 0.160 0.165 21833 Thra thyroid hormone receptor alpha 0.152 0.085 0.273 -0.099 21834 Thrb thyroid hormone receptor beta 0.311 0.160 0.708 1.226 21908 Tlx1 T-cell leukemia, homeobox 1 1.277 -1.235 1.388 0.571 21909 Tlx2 T-cell leukemia, homeobox 2 -0.203 -0.147 0.650 1.207 27140 Tlx3 T-cell leukemia, homeobox 3 0.092 0.442 0.294 0.454 21973 Top2a topoisomerase (DNA) II alpha -0.033 -0.738 -0.070 0.113 21974 Top2b topoisomerase (DNA) II beta -0.125 0.195 0.180 0.117 224829 Trerf1 transcriptional regulating factor 1 -0.165 -0.805 -0.005 -0.050 21849 Trim28 tripartite motif-containing 28 0.116 -0.580 -0.339 -0.177 22061 Trp63 transformation related protein 63 1.311 3.540 1.267 -0.379 22062 Trp73 transformation related protein 73 -0.705 -1.453 -1.541 -1.210 83925 Trps1 trichorhinophalangeal syndrome I (human) -0.114 0.204 -0.423 -0.256 21807 Tsc22d1 TSC22 domain family, member 1 0.519 1.057 -0.082 0.137 14605 Tsc22d3 TSC22 domain family, member 3 0.504 0.348 1.168 1.260

176

78829 Tsc22d4 TSC22 domain family, member 4 0.006 0.601 0.400 0.181 110796 Tshz1 teashirt zinc finger family member 1 -0.174 1.738 0.802 0.632 228911 Tshz2 teashirt zinc finger family member 2 -0.177 1.302 0.740 0.717 243931 Tshz3 teashirt zinc finger family member 3 0.227 -1.168 0.134 0.048 22160 Twist1 twist homolog 1 (Drosophila) -0.320 -0.918 0.195 0.285 13345 Twist2 twist homolog 2 (Drosophila) -0.681 1.417 2.037 0.425 22255 Uncx UNC homeobox -0.173 -0.266 -0.928 0.244 22278 Usf1 upstream transcription factor 1 -0.398 -1.185 -0.509 -0.250 22282 Usf2 upstream transcription factor 2 0.261 -0.019 0.114 0.073 22326 Vax1 ventral anterior homeobox containing gene 1 0.999 0.218 -0.107 0.111 24113 Vax2 ventral anterior homeobox containing gene 2 0.452 2.093 1.045 0.369 22337 Vdr vitamin D receptor 0.451 1.998 1.168 0.008 21427 Vps72 vacuolar protein sorting 72 (yeast) 0.168 -0.049 0.125 0.075 114889 Vsx1 visual system homeobox 1 homolog (zebrafish) -0.592 2.120 0.324 -0.133 12677 Vsx2 visual system homeobox 2 -0.135 -2.147 0.474 1.071 22433 Xbp1 X-box binding protein 1 -0.022 0.389 0.100 0.152 22632 Yy1 YY1 transcription factor 0.048 -0.082 0.089 0.134 235320 Zbtb16 zinc finger and BTB domain containing 16 0.038 0.716 1.412 0.743 22642 Zbtb17 zinc finger and BTB domain containing 17 0.090 0.163 0.208 0.011 268294 Zbtb24 zinc finger and BTB domain containing 24 0.237 0.390 0.279 0.270 245007 Zbtb38 zinc finger and BTB domain containing 38 0.419 0.390 0.121 0.192 22724 Zbtb7b zinc finger and BTB domain containing 7B 0.166 0.789 0.412 0.051 57432 Zc3h8 zinc finger CCCH type containing 8 -0.306 -0.529 -0.551 -0.182 21417 Zeb1 zinc finger E-box binding homeobox 1 0.712 0.202 0.179 0.354 24136 Zeb2 zinc finger E-box binding homeobox 2 -0.370 0.963 -0.191 -0.055 11906 Zfhx3 zinc finger homeobox 3 -0.152 0.362 -0.200 -0.120 80892 Zfhx4 zinc finger homeodomain 4 -1.158 0.152 -0.682 -0.305

177

22646 Zfp105 zinc finger protein 105 -0.080 -0.915 -0.309 -0.278 22661 Zfp148 zinc finger protein 148 -0.083 0.144 0.175 0.186 385674 Zfp174 zinc finger protein 174 0.110 0.633 0.445 0.277 432731 Zfp187 zinc finger protein 187 -0.098 -0.011 -0.027 0.011 59057 Zfp191 zinc finger protein 191 -0.083 -0.404 -0.143 -0.171 69890 Zfp219 zinc finger protein 219 -0.082 -0.229 0.029 0.042 226442 Zfp281 zinc finger protein 281 0.021 -0.303 -0.445 -0.376 170740 Zfp287 zinc finger protein 287 -0.048 -0.064 -0.257 -0.010 21408 Zfp354a zinc finger protein 354A -0.445 -0.379 0.178 0.049 140482 Zfp358 zinc finger protein 358 -0.007 0.480 0.705 0.019 238673 Zfp367 zinc finger protein 367 0.006 -0.349 -0.131 -0.051 235682 Zfp445 zinc finger protein 445 -0.458 -0.302 -0.172 -0.123 232816 Zfp628 zinc finger protein 628 -0.108 -0.433 0.319 0.263 67778 Zfp639 zinc finger protein 639 0.010 -0.210 -0.032 -0.018 1E+08 Zglp1 zinc finger, GATA-like protein 1 -0.368 -0.494 -0.299 -0.186 229007 Zgpat zinc finger, CCCH-type with G patch domain 0.020 0.136 -0.072 -0.118 22770 Zhx1 zinc fingers and homeoboxes 1 -0.106 0.689 0.067 -0.014 387609 Zhx2 zinc fingers and homeoboxes 2 -0.238 0.891 -0.101 -0.098 320799 Zhx3 zinc fingers and homeoboxes 3 0.023 1.053 0.459 0.350 22771 Zic1 zinc finger protein of the cerebellum 1 -0.076 -1.155 -1.374 0.405 22772 Zic2 zinc finger protein of the cerebellum 2 -1.366 -0.981 -0.098 -0.285 65100 Zic5 zinc finger protein of the cerebellum 5 -1.039 -1.087 -0.355 -0.358 74570 Zkscan1 zinc finger with KRAB and SCAN domains 1 0.077 0.246 0.313 0.317 67235 Zkscan14 zinc finger with KRAB and SCAN domains 14 0.147 0.495 0.541 0.566 268417 Zkscan17 zinc finger with KRAB and SCAN domains 17 0.066 -0.302 -0.020 0.128 72739 Zkscan3 zinc finger with KRAB and SCAN domains 3 -0.379 0.526 0.080 -0.064 22757 Zkscan5 zinc finger with KRAB and SCAN domains 5 0.055 -0.465 -0.003 0.215

178

52712 Zkscan6 zinc finger with KRAB and SCAN domains 6 0.285 0.175 0.289 0.277 332221 Zscan10 zinc finger and SCAN domain containing 10 -0.482 -1.177 -0.966 -0.846 22758 Zscan12 zinc finger and SCAN domain containing 12 0.146 0.103 -0.072 0.079 22691 Zscan2 zinc finger and SCAN domain containing 2 0.317 0.606 0.615 0.444 269585 Zscan20 zinc finger and SCAN domains 20 -0.110 -0.228 0.064 0.083 22697 Zscan21 zinc finger and SCAN domain containing 21 0.026 -0.153 0.136 0.075 80292 Zxdc ZXD family zinc finger C 0.274 0.381 1.010 0.855

179

Table A5 Expression levels of transcription factors that regulate cardiomyocyte differentiation in TCDD-treated AHR-positive cells relative to controls (Log2 Fold change)

AHR geneid symbol PWM name Day 5 Day 8 Day 11 Day 14 11910 Atf3 No activating transcription factor 3 0.372 2.510 0.436 0.224 223922 Atf7 No activating transcription factor 7 0.207 1.011 0.235 0.285 12053 Bcl6 Yes B-cell leukemia/lymphoma 6 0.337 2.619 0.771 0.676 12578 Cdkn2a No cyclin-dependent kinase inhibitor 2A 0.536 1.781 0.409 0.216 12606 Cebpa No CCAAT/enhancer binding protein (C/EBP), alpha -0.141 1.092 1.354 0.326 Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy- 12705 Cited1 Yes terminal domain 1 0.076 2.062 1.842 1.351 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy- 17684 Cited2 No terminal domain, 2 0.080 1.355 0.811 0.793 12914 Crebbp Yes CREB binding protein 0.024 0.060 -0.033 0.195 12387 Ctnnb1 No catenin (cadherin associated protein), beta 1 -0.003 -0.157 0.142 0.078 13393 Dlx3 Yes distal-less homeobox 3 0.477 2.991 1.609 1.042 13819 Epas1 Yes endothelial PAS domain protein 1 0.426 0.165 -0.056 0.108 23871 Ets1 Yes E26 avian leukemia oncogene 1, 5' domain 0.446 1.793 -0.002 -0.065 15376 Foxa2 No forkhead box A2 -0.502 0.909 0.212 -0.105 17300 Foxc1 No forkhead box C1 0.535 1.278 1.479 0.261 14234 Foxc2 No forkhead box C2 1.811 1.135 2.208 1.643 14106 Foxh1 No forkhead box H1 -0.724 -1.011 -1.247 -0.817 108655 Foxp1 No forkhead box P1 -0.894 -1.110 -0.895 -0.534 14461 Gata2 Yes GATA binding protein 2 0.729 1.655 2.085 1.407 14462 Gata3 Yes GATA binding protein 3 1.343 2.280 1.469 0.695 14463 Gata4 No GATA binding protein 4 0.588 0.842 0.691 0.191 14465 Gata6 No GATA binding protein 6 0.899 1.915 0.941 0.432 14472 Gbx2 No gastrulation brain homeobox 2 0.083 -0.202 -1.072 -0.943

180

14634 Gli3 Yes GLI-Kruppel family member GLI3 -0.242 0.288 0.196 0.063 15110 Hand1 Yes heart and neural crest derivatives expressed transcript 1 0.032 4.321 1.602 1.077 15111 Hand2 Yes heart and neural crest derivatives expressed transcript 2 1.142 -0.861 1.547 1.373 433759 Hdac1 No histone deacetylase 1 -0.072 -0.293 -0.002 -0.006 15214 Hey2 No hairy/enhancer-of-split related with YRPW motif 2 -0.334 0.569 0.298 0.585 21405 Hnf1a No HNF1 homeobox A 0.901 -0.254 0.126 0.217 74318 Hopx No HOP homeobox -1.727 -1.464 -0.345 -0.415 15394 Hoxa1 Yes homeobox A1 0.592 1.760 1.085 0.769 15395 Hoxa10 Yes homeobox A10 1.225 1.193 0.441 0.927 15400 Hoxa3 No homeobox A3 0.322 2.237 0.656 0.780 15410 Hoxb3 No homeobox B3 -1.175 -1.557 0.544 0.598 15413 Hoxb5 No homeobox B5 0.611 -2.906 -0.541 0.866 15430 Hoxd10 No homeobox D10 1.744 -0.309 0.064 0.675 50916 Irx4 No Iroquois related homeobox 4 (Drosophila) 0.355 3.366 1.968 -0.012 16392 Isl1 No ISL1 transcription factor, LIM/homeodomain 0.243 0.701 1.066 0.317 16476 Jun No Jun oncogene 0.464 2.165 0.235 0.200 16598 Klf2 No Kruppel-like factor 2 (lung) 1.061 0.646 0.598 0.384 12224 Klf5 Yes Kruppel-like factor 5 0.317 1.529 0.281 0.110 16842 Lef1 Yes lymphoid enhancer binding factor 1 -2.344 -2.594 -0.857 -0.246 17260 Mef2c No myocyte enhancer factor 2C -1.391 -2.194 0.228 0.466 17268 Meis1 No Meis homeobox 1 0.333 2.853 1.277 0.563 17292 Mesp1 No mesoderm posterior 1 -1.045 -0.374 0.392 0.084 17293 Mesp2 No mesoderm posterior 2 1.206 -0.457 0.438 0.693 17387 Mmp14 Yes matrix metallopeptidase 14 (membrane-inserted) -0.321 2.518 0.155 -0.148 17701 Msx1 Yes homeobox, msh-like 1 -2.056 -2.261 -0.476 0.771 17869 Myc Yes myelocytomatosis oncogene -0.828 -0.542 -0.578 -0.308 v-myc myelocytomatosis viral related oncogene, neuroblastoma 18109 Mycn Yes derived (avian) -0.413 -1.390 -1.009 -0.612

181

71950 Nanog Yes Nanog homeobox 0.903 0.400 0.732 0.609 18091 Nkx2-5 No NK2 transcription factor related, locus 5 (Drosophila) -1.153 -0.782 -8901.000 -0.925 18092 Nkx2-6 No NK2 transcription factor related, locus 6 (Drosophila) -1.153 -0.782 -0.107 -0.144 11819 Nr2f2 Yes nuclear receptor subfamily 2, group F, member 2 2.063 3.143 0.828 0.050 15370 Nr4a1 No nuclear receptor subfamily 4, group A, member 1 -0.076 1.132 0.365 0.009 26423 Nr5a1 Yes nuclear receptor subfamily 5, group A, member 1 -0.052 0.170 0.925 -0.616 26424 Nr5a2 Yes nuclear receptor subfamily 5, group A, member 2 1.183 1.283 0.379 0.209 18505 Pax3 Yes paired box gene 3 -0.205 1.360 -0.682 -0.235 18508 Pax6 No paired box gene 6 -0.537 -0.771 -0.495 -0.260 18741 Pitx2 Yes paired-like homeodomain transcription factor 2 -0.414 -1.072 0.049 0.303 18999 Pou5f1 Yes POU domain, class 5, transcription factor 1 -0.567 -0.795 -0.323 -0.180 19130 Prox1 Yes prospero-related homeobox 1 -0.005 0.832 0.140 0.277 18933 Prrx1 No paired related homeobox 1 -0.047 1.217 -0.053 0.290 218772 Rarb No retinoic acid receptor, beta 0.708 2.732 1.594 0.415 19411 Rarg Yes retinoic acid receptor, gamma -0.234 -0.472 -0.377 -0.160 19697 Rela No v-rel reticuloendotheliosis viral oncogene homolog A (avian) 0.236 1.215 0.132 0.075 12394 Runx1 Yes runt related transcription factor 1 -0.052 2.531 0.038 -0.188 12393 Runx2 Yes runt related transcription factor 2 -0.036 -0.435 -1.206 -0.350 20429 Shox2 No short stature homeobox 2 0.066 0.598 1.459 0.685 17127 Smad3 No MAD homolog 3 (Drosophila) 0.199 1.300 0.650 0.212 17128 Smad4 Yes MAD homolog 4 (Drosophila) 0.224 0.842 -0.035 -0.001 20665 Sox10 Yes SRY-box containing gene 10 -0.041 -1.410 0.151 -0.005 20671 Sox17 Yes SRY-box containing gene 17 1.113 1.082 0.891 0.145 20672 Sox18 No SRY-box containing gene 18 -0.263 -2.465 -0.111 0.174 20674 Sox2 Yes SRY-box containing gene 2 0.589 -0.251 0.102 0.115 20677 Sox4 Yes SRY-box containing gene 4 -0.423 -0.123 -0.188 -0.095 20678 Sox5 Yes SRY-box containing gene 5 0.930 0.256 1.087 -0.167

182

20679 Sox6 No SRY-box containing gene 6 -0.188 1.040 -0.363 -0.451 20680 Sox7 Yes SRY-box containing gene 7 0.883 0.132 -0.420 0.112 20681 Sox8 No SRY-box containing gene 8 0.676 -0.717 0.169 0.680 20682 Sox9 Yes SRY-box containing gene 9 0.091 0.943 1.384 -0.232 20848 Stat3 No signal transducer and activator of transcription 3 0.351 1.248 0.370 0.265 20850 Stat5a Yes signal transducer and activator of transcription 5A 0.721 1.347 0.954 0.519 20997 T Yes brachyury -3.143 -0.355 -0.292 -1.263 21349 Tal1 No T-cell acute lymphocytic leukemia 1 -1.750 -3.801 -1.958 1.086 21380 Tbx1 No T-box 1 0.895 0.781 0.386 -0.174 76365 Tbx18 Yes T-box18 1.049 -0.290 0.221 0.352 21385 Tbx2 No T-box 2 0.256 0.832 1.133 0.737 57246 Tbx20 No T-box 20 -0.399 0.249 -0.452 0.287 21386 Tbx3 Yes T-box 3 1.594 2.221 1.292 0.840 21388 Tbx5 Yes T-box 5 0.477 -0.119 -0.456 -0.087 21414 Tcf7 No transcription factor 7, T-cell specific -0.186 -0.843 -0.095 -0.029 21415 Tcf7l1 No transcription factor 7-like 1 (T-cell specific, HMG box) -0.003 -0.509 0.165 0.020 21416 Tcf7l2 No transcription factor 7-like 2, T-cell specific, HMG-box -0.092 0.609 0.704 0.220 21676 Tead1 No TEA domain family member 1 0.058 1.301 0.247 0.074 21679 Tead4 Yes TEA domain family member 4 0.435 2.290 0.456 0.190 22059 Trp53 Yes transformation related protein 53 0.046 -0.256 -0.176 -0.086 22431 Wt1 No Wilms tumor 1 homolog -1.240 -3.080 -1.149 -1.061 22773 Zic3 Yes zinc finger protein of the cerebellum 3 -0.227 -0.430 -0.621 -0.391

183

Table A6 Summary of PcG and TxG genes affected in their expression by TCDD treatment in AHR-positive cells.

Gene Description Function Expression Reference Cbx1 Chromobox protein homolog Component of heterochromatin. In all adult and embryonic tissues (Singh et al. 1991) 1 Cbx2 Chromobox protein homolog Component of a PcG multiprotein PRC1-like complex, which function as Expressed in most embryonic tissue (Schoorlemmer et al. 2; also known as M33. a transcriptional repressor. Critical roles in germ cell viability, meiosis except the heart from ED8.5-11.5; 1997; Baumann and De onset and homologous chromosome synapsis in mammalian germ line. expressed in CNS, PNS, olfactory and La Fuente 2011) tongue epithelia, lung gastrointestinal duct and urogenital system at ED 13.5; CNS, thymus, various epithelial cell types at ED 15.5. Cbx3 Chromobox protein homolog Component of heterochromatin; interact with Dia-1/SRF, whose Localized in the nucleus; associated (Horsley et al. 1996; 3 interaction is essential for smooth muscle cell differentiation from stem with euchromatin and is largely Xiao et al. 2011) cells and for the development of functional cardiovascular system. excluded from constitutive heterochromatin. Cbx4 Chromobox protein homolog E3 SUMO-protein ligase which facilitates SUMO1 conjugation; a Localized in the nucleus. (Alkema et al. 1997; 4 component of a PcG multiprotein PRC1-like complex. Ismail et al. 2012) Cbx8 Chromobox protein homolog Component of a PcG multiprotein PRC1-like complex, which functions Expressed at low levels throughout (Hemenway et al. 2000; 8 as a transcriptional repressor. embryogenesis, decreased at later Cao et al. 2005) stages. Chd3 Chromodomain helicase DNA Not known in mouse. In human, it is a component of the histone Widely expressed in human. Not (Tong et al. 1998) binding protein 3 deacetylase NuRD complex which remodels chromatin by deacetylating known in mouse. histones. Chd9 Chromodomain-helicase- May act as a transcriptional co-activator for PPARA and possibly other Expressed in osteoprogenitor cells (Shur et al. 2006; DNA-binding protein nuclear receptor; a potential ATP-dependent chromatin remodeling during development and in mature Surapureddi et al. 9;peroxisomal proliferator- protein; binds to A/T-rich DNA and has DNA-dependent ATPase bone. 2006) activator receptor A- activity interacting complex 320 kDa protein

184

Table A6 Continued

Dnmt3a DNA methyltransferase Required for genome-wide de novo methylation and is essential for the Ubiquitously expressed in (Okano et al. 1999; establishment of DNA methylation patterns during development. Also mesenchymal cells after ED 10.5 Fuks et al. 2001; plays a role in paternal and maternal imprinting; essential for mammalian during embryogenesis. In somatic cells, Watanabe et al. 2002) proper development. Regulate gene transcription in addition to de novo isoform 1 is expressed ubiquitously at methylation. low levels. Isoform 2 is restricted to tissues containing cells which are undergoing active de novo methylation. Dnmt3b DNA methyltransferase Required for genome-wide de novo methylation and is essential for the Highly expressed in totipotent (Okano et al. 1999; establishment of DNA methylation patterns during development. Also embryonic cells such as inner cell Watanabe et al. 2002) function as transcriptional co-repressor. mass, epiblast and embryonic ectoderm cells. Mbd5 Belong to Methyl-Binding Associate with heterochromatin but do not bind to methylated DNA. Expressed in all tissues, but with a wide (Laget et al. 2010) proteins May contribute to the formation or function of heterochromatin. range of levels; the highest expression was in the brain, testis and oocytes. Mll5 Myeloid/lymphoid or mixed- Specifically mono-and di-methylates Histone H3 Lys4. The methylated Nucleus speckle (by similarity) (Sebastian et al. 2009) lineage leukemia protein 5 H3K4 represents a specific tag for epigenetic transcriptional activation. homolog Also function as an important cell cycle regulator. Pcgf5 Polycomb group RING finger Component of a PcG multiprotein PRC-1 like complex, which function May expressed in nucleus (by (Barrett et al. 2009) protein 5 as a transcriptional repressor. similarity) Pcgf6 Polycomb group RING finger Transcriptional repressor. A component of a PcG multiprotein PRC-1 Expressed in ovary, testis, stomach, (Akasaka et al. 2002) protein 6 like complex, which functions as a transcriptional repressor. liver, thymus and kidney. Ph1 Polyhomeotic-like protein 1 Component of a PcG multiprotein PRC1-like complex, which functions Highly expressed in testis with lower (Takihara et al. 1997; as transcription repressor of many genes throughout development. levels in most other tissues Isono et al. 2005) Ph2 Polyhomeotic-like protein 2 Refer to the above cell Ubiquitously expressed in embryos and (Yamaki et al. 2002; adult tissues. Isono et al. 2005) Setbp1 SET-binding protein May function in the SET-related leukemogenesis and tumorigenesis by Expressed ubiquitously in all human (Minakuchi et al. 2001) suppressing SET function adult tissues.

185

Table A6 Continued

Setd7 Histone H4-K4 Specifically monomethylates Histone H3 Lys4. Methylated H4K4 Expressed during all pre-implementation (Jeong et al. 2005) methyltransferase SETD7; represents a marker for epigenetic transcriptional activation. stages during embryogenesis. SET domain-containing protein. Sirt2 Silent information regulator 2, NAD-dependent deacetylase. SIRT2 is an important regulator of Expressed in the cytoplasma, (Narayan et al. 2012) members of Sir2 family share programmed necrosis. Marked protection from ischaemic injury was colocalized with microtubules. a ~260 amino acid region of observed from either Sirt2-/- mice or wild type mice treated with Sirt2 homology, being divided into inhibitor. five classes. Smarca1 SWI/SNF-related matrix- Energy-transducing component of the nucleosome-remodeling factor and Predominantly expressed in cortex, (Lazzaro and Picketts associated actin-dependent CERF complex. May play a role in neural development. cerebellum, ovaries, testes, uterus and 2001; Barak et al. regulator of chromatin placenta. During development, 2003) subfamily A member 1 expressed throughout the embryo at ED 9.5 to ED 15.5 Smarca2 A member of the SWI/SNF Transcriptional coactivator cooperating with hormone receptors to Expressed in the cortical plate in the (Lessard et al. 2007; family of proteins. potentiate transcription activation. Involved in vitamin D-coupled embryo and in the cortex and the Van Houdt et al. 2012) transcription regulation. Belong to the neural progenitors-specific hippocampus in adult. Localized in the chromatin remodeling complex and the neuron-specific chromatin nucleus. remodeling complex, with the former essential for the self- renewal/proliferative capacity of the neural stem cells and the later role of regulating the genes for dendrite growth. Mutations in this gene cause Nicolaides-Baraitser syndrome in human. Suv39h2 Histone H3-lysine 9 N- Specifically trimethylates Histone H3 Lys9 using monomethylationed H3 Testis specific; predominant expressed (O'Carroll et al. 2000; methyltransferase 2 Lys9 as substrate. H3-Lys9 trimethylation is a specific tag for epigenetics in type B spermatogonia and Peters et al. 2001; transcriptional repression. Epigenetically regulate telomere length in preleptotene spermatocytes; Garcia-Cao et al. 2004) mammalian cells; may regulate higher-order chromatin organization; Suv39h1 Histon H3-lysine 9 N- Refer to the above cell. In addition, Suv39h1 is targeted to Histone H3 Expression present throughout (Nielsen et al. 2001; methyltransferase 1 via its interaction with RB1 and is involved in many processes including embryogenesis; widely expressed. Peters et al. 2001; regulation of the control switch for exiting the cell cycle and entering Garcia-Cao et al. 2004) differentiation etc.

Suv39h2

186

Table A7 Expression levels of genes involved in TGFβ/BMP signal pathways in Day-1 and Day-3 Ahr+/+ EBs treated by TCDD relative to controls (Log2 Fold change) geneid Symbol Name Day1 Day3 11477 Acvr1 Activin A receptor, type 1 -0.377 -0.224 11480 Acvr2a Activin receptor IIA 0.510 0.280 11482 Acvrl1 Activin A receptor, type II-like 1 -0.695 -1.521 11705 Amh Anti-Mullerian hormone -1.154 -2.377 110542 Amhr2 Anti-Mullerian hormone type 2 receptor -0.744 -1.243 11911 Atf4 Activating transcription factor 4 -0.306 0.054 68010 Bambi BMP and activin membrane-bound inhibitor, homolog (Xenopus laevis) -0.224 -0.088 12097 Bglap2 Bone gamma-carboxyglutamate protein 2 -0.656 -0.613 12153 Bmp1 Bone morphogenetic protein 1 -0.691 -0.401 12156 Bmp2 Bone morphogenetic protein 2 0.593 -0.668 110075 Bmp3 Bone morphogenetic protein 3 -0.634 0.284 12159 Bmp4 Bone morphogenetic protein 4 0.364 0.721 12160 Bmp5 Bone morphogenetic protein 5 1.071 -0.005 12161 Bmp6 Bone morphogenetic protein 6 -0.515 -0.251 12162 Bmp7 Bone morphogenetic protein 7 0.024 -0.866 73230 Bmper BMP-binding endothelial regulator -0.320 -0.540 12166 Bmpr1a Bone morphogenetic protein receptor, type 1A 0.540 0.601 12167 Bmpr1b Bone morphogenetic protein receptor, type 1B 0.237 0.320 12168 Bmpr2 Bone morphogenic protein receptor, type II (serine/threonine kinase) 0.189 0.414 12575 Cdkn1a Cyclin-dependent kinase inhibitor 1A (P21) -0.065 0.527 12576 Cdkn1b Cyclin-dependent kinase inhibitor 1B 0.342 0.169 12579 Cdkn2b Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 0.370 -0.621 12667 Chrd Chordin -0.405 -1.747

187

12842 Col1a1 Collagen, type I, alpha 1 -0.630 -0.233 12843 Col1a2 Collagen, type I, alpha 2 0.357 -0.699 13179 Dcn Decorin 0.267 -0.395 13392 Dlx2 Distal-less homeobox 2 -1.896 0.766 13730 Emp1 Epithelial membrane protein 1 0.896 -0.590 13805 Eng Endoglin -0.075 0.182 14281 Fos FBJ osteosarcoma oncogene 0.661 0.267 14313 Fst Follistatin -0.041 -0.400 17873 Gadd45b Growth arrest and DNA-damage-inducible 45 beta 0.234 0.243 14559 Gdf1 Growth differentiation factor 1 -0.695 0.035 12165 Gdf2 Growth differentiation factor 2 -0.012 -0.082 14562 Gdf3 Growth differentiation factor 3 -0.292 -0.057 14563 Gdf5 Growth differentiation factor 5 -0.330 1.153 242316 Gdf6 Growth differentiation factor 6 -0.907 0.047 238057 Gdf7 Growth differentiation factor 7 1.255 2.499 14836 Gsc Goosecoid homeobox 0.119 -1.838 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain 64209 Herpud1 member 1 -0.274 -0.015 15901 Id1 Inhibitor of DNA binding 1 0.099 1.770 15902 Id2 Inhibitor of DNA binding 2 -0.267 0.351 15982 Ifrd1 Interferon-related developmental regulator 1 -0.102 -0.009 16000 Igf1 Insulin-like growth factor 1 -0.764 0.370 16009 Igfbp3 Insulin-like growth factor binding protein 3 0.738 0.413 16193 Il6 Interleukin 6 -0.012 -0.957 16322 Inha Inhibin alpha 0.621 -0.573 16323 Inhba Inhibin beta-A -0.662 0.549

188

16476 Jun Jun oncogene -0.579 -0.134 16477 Junb Jun-B oncogene -0.076 -0.049 13590 Lefty1 Left right determination factor 1 -0.619 -0.636 268977 Ltbp1 Latent transforming growth factor beta binding protein 1 0.180 0.109 16997 Ltbp2 Latent transforming growth factor beta binding protein 2 0.329 0.563 108075 Ltbp4 Latent transforming growth factor beta binding protein 4 -0.244 -0.379 14013 Mecom MDS1 and EVI1 complex locus -0.447 0.646 17869 Myc Myelocytomatosis oncogene -0.091 -0.302 18119 Nodal Nodal -0.099 -0.303 18121 Nog Noggin -1.162 -0.785 18591 Pdgfb Platelet derived growth factor, B polypeptide -0.430 -1.014 18792 Plau Plasminogen activator, urokinase -0.801 -0.861 12394 Runx1 Runt related transcription factor 1 0.086 -0.142 18787 Serpine1 Serine (or cysteine) peptidase inhibitor, clade E, member 1 -0.980 0.109 17125 Smad1 MAD homolog 1 (Drosophila) -0.205 -0.286 17126 Smad2 MAD homolog 2 (Drosophila) 0.176 -0.006 17127 Smad3 MAD homolog 3 (Drosophila) -0.337 -0.250 17128 Smad4 MAD homolog 4 (Drosophila) -0.442 -0.439 17129 Smad5 MAD homolog 5 (Drosophila) -0.338 -0.407 17131 Smad7 MAD homolog 7 (Drosophila) 0.044 0.042 75788 Smurf1 SMAD specific E3 ubiquitin protein ligase 1 0.067 0.365 20677 Sox4 SRY-box containing gene 4 0.872 0.507 20846 Stat1 Signal transducer and activator of transcription 1 -0.365 0.169 21667 Tdgf1 Teratocarcinoma-derived growth factor 1 0.684 -0.180 21803 Tgfb1 Transforming growth factor, beta 1 -0.433 -0.509 21804 Tgfb1i1 Transforming growth factor beta 1 induced transcript 1 2.269 0.589

189

21808 Tgfb2 Transforming growth factor, beta 2 0.899 -0.374 21809 Tgfb3 Transforming growth factor, beta 3 -0.662 0.557 21810 Tgfbi Transforming growth factor, beta induced -0.335 -0.766 21812 Tgfbr1 Transforming growth factor, beta receptor I -0.002 0.295 21813 Tgfbr2 Transforming growth factor, beta receptor II 0.541 -0.650 21814 Tgfbr3 Transforming growth factor, beta receptor III -0.720 0.154 73122 Tgfbrap1 Transforming growth factor, beta receptor associated protein 1 0.207 0.573 21825 Thbs1 Thrombospondin 1 0.517 0.414 22035 Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 1.010 0.969 21807 Tsc22d1 TSC22 domain family, member 1 0.522 0.640

190

Table A8 Expression levels of genes involved in WNT signal pathways in Day-1 and Day-3 Ahr+/+ EBs treated by TCDD relative to controls

(Log2 Fold change) geneid Symbol Name Day1 Day3 18671 Abcb1a ATP-binding cassette, sub-family B (MDR/TAP), member 1A -0.014 0.410 11622 Ahr Aryl-hydrocarbon receptor 0.508 1.406 57875 Angptl4 Angiopoietin-like 4 0.108 0.222 69538 Antxr1 Anthrax toxin receptor 1 -0.242 -0.238 12006 Axin2 Axin2 -0.483 -0.364 11799 Birc5 Baculoviral IAP repeat-containing 5 -0.012 0.038 12159 Bmp4 Bone morphogenetic protein 4 0.364 0.721 12234 Btrc Beta-transducin repeat containing protein -0.524 -0.259 12294 Cacna2d3 Calcium channel, voltage-dependent, alpha2/delta subunit 3 0.845 -1.258 12443 Ccnd1 Cyclin D1 0.071 -0.072 12444 Ccnd2 Cyclin D2 -0.334 -0.524 12505 Cd44 CD44 antigen -1.039 0.014 12550 Cdh1 Cadherin 1 0.780 1.035 12578 Cdkn2a Cyclin-dependent kinase inhibitor 2A -0.260 -0.993 57810 Cdon Cell adhesion molecule-related/down-regulated by oncogenes 0.197 -0.013 12609 Cebpd CCAAT/enhancer binding protein (C/EBP), delta -0.081 -0.411 14219 Ctgf Connective tissue growth factor 0.952 1.181 65969 Cubn Cubilin (intrinsic factor-cobalamin receptor) 0.173 0.557 13132 Dab2 Disabled homolog 2 (Drosophila) 0.085 0.440 13380 Dkk1 Dickkopf homolog 1 (Xenopus laevis) -0.290 -0.739 13386 Dlk1 Delta-like 1 homolog (Drosophila) -0.941 -0.526 269109 Dpp10 Dipeptidylpeptidase 10 -0.171 -0.709 13641 Efnb1 Ephrin B1 -0.348 1.100

191

13649 Egfr Epidermal growth factor receptor -0.689 0.485 13653 Egr1 Early growth response 1 0.414 0.049 18606 Enpp2 Ectonucleotide pyrophosphatase/phosphodiesterase 2 0.657 0.789 23872 Ets2 E26 avian leukemia oncogene 2, 3' domain -0.021 -0.295 80857 Fgf20 Fibroblast growth factor 20 -0.012 0.103 14175 Fgf4 Fibroblast growth factor 4 -0.250 -0.103 14178 Fgf7 Fibroblast growth factor 7 1.285 1.186 14180 Fgf9 Fibroblast growth factor 9 -0.227 -0.664 14268 Fn1 Fibronectin 1 -0.090 -0.183 14283 Fosl1 Fos-like antigen 1 -0.044 0.013 14313 Fst Follistatin -0.041 -0.400 14369 Fzd7 Frizzled homolog 7 (Drosophila) 0.658 0.889 14563 Gdf5 Growth differentiation factor 5 -0.330 1.153 14573 Gdnf Glial cell line derived neurotrophic factor -0.907 -0.449 14609 Gja1 Gap junction protein, alpha 1 1.349 1.552 15902 Id2 Inhibitor of DNA binding 2 -0.267 0.351 16000 Igf1 Insulin-like growth factor 1 -0.764 0.370 16002 Igf2 Insulin-like growth factor 2 -0.176 0.258 16193 Il6 Interleukin 6 -0.012 -0.957 16367 Irs1 Insulin receptor substrate 1 -0.456 0.118 16449 Jag1 Jagged 1 0.083 0.112 12224 Klf5 Kruppel-like factor 5 -0.127 -0.222 16842 Lef1 Lymphoid enhancer binding factor 1 0.069 0.311 16971 Lrp1 Low density lipoprotein receptor-related protein 1 -0.148 0.126 17295 Met Met proto-oncogene -0.124 0.520 17390 Mmp2 Matrix metallopeptidase 2 -0.556 -0.032

192

17393 Mmp7 Matrix metallopeptidase 7 -0.527 0.103 17395 Mmp9 Matrix metallopeptidase 9 0.099 -0.363 17869 Myc Myelocytomatosis oncogene -0.091 -0.302 71950 Nanog Nanog homeobox 1.480 0.814 319504 Nrcam Neuron-glia-CAM-related cell adhesion molecule -0.062 -0.566 18186 Nrp1 Neuropilin 1 0.373 -0.329 18212 Ntrk2 Neurotrophic tyrosine kinase, receptor, type 2 0.207 0.385 18595 Pdgfra Platelet derived growth factor receptor, alpha polypeptide -0.321 -0.120 18741 Pitx2 Paired-like homeodomain transcription factor 2 -0.201 -0.696 18793 Plaur Plasminogen activator, urokinase receptor 0.061 -0.479 18999 Pou5f1 POU domain, class 5, transcription factor 1 -0.610 -0.652 67916 Ppap2b Phosphatidic acid phosphatase type 2B -0.203 -0.142 19015 Ppard Peroxisome proliferator activator receptor delta 0.018 -0.284 19206 Ptch1 Patched homolog 1 0.024 0.273 19225 Ptgs2 Prostaglandin-endoperoxide synthase 2 1.916 1.822 12393 Runx2 Runt related transcription factor 2 -1.206 -0.929 20319 Sfrp2 Secreted frizzled-related protein 2 0.032 0.037 20471 Six1 Sine oculis-related homeobox 1 homolog (Drosophila) 0.190 0.094 319757 Smo Smoothened homolog (Drosophila) 0.732 0.642 20674 Sox2 SRY-box containing gene 2 -0.033 0.297 20682 Sox9 SRY-box containing gene 9 0.030 1.813 20997 T Brachyury 0.204 -0.937 21413 Tcf4 Transcription factor 4 0.668 0.826 21414 Tcf7 Transcription factor 7, T-cell specific -0.598 -0.293 21415 Tcf7l1 Transcription factor 7-like 1 (T-cell specific, HMG box) -0.262 -0.108 21416 Tcf7l2 Transcription factor 7-like 2, T-cell specific, HMG-box -0.065 -0.178

193

21809 Tgfb3 Transforming growth factor, beta 3 -0.662 0.557 21885 Tle1 Transducin-like enhancer of split 1, homolog of Drosophila E(spl) 0.107 0.139 22160 Twist1 Twist homolog 1 (Drosophila) 1.132 0.716 22339 Vegfa Vascular endothelial growth factor A -0.038 -0.007 22402 Wisp1 WNT1 inducible signaling pathway protein 1 -0.058 -0.469 22403 Wisp2 WNT1 inducible signaling pathway protein 2 -0.155 -0.512 22416 Wnt3a Wingless-related MMTV integration site 3A -1.109 -0.482 22418 Wnt5a Wingless-related MMTV integration site 5A 0.048 0.308 216795 Wnt9a Wingless-type MMTV integration site 9A -1.036 -0.484

194

REFERENCES of APPENDIX

Akasaka, T., N. Takahashi, et al. (2002). MBLR, a new RING finger protein resembling mammalian Polycomb gene products, is regulated by cell cycle-dependent phosphorylation. Genes Cells 7(8):835-850.

Alkema, M. J., J. Jacobs, et al. (1997). MPc2, a new murine homolog of the Drosophila polycomb protein is a member of the mouse polycomb transcriptional repressor complex. J Mol Biol 273(5):993-1003.

Anders S, Huber W. 2010. Differential expression analysis for sequence count data. Genome Biol 11:R106.

Barak, O., M. A. Lazzaro, et al. (2003). Isolation of human NURF:a regulator of Engrailed gene expression. EMBO J 22(22):6089-6100.

Barrett T, Troup DB, Wilhite SE, Ledoux P, Rudnev D, Evangelista C, et al. 2009. NCBI GEO:archive for high-throughput functional genomic data. Nucleic Acids Res 37:D885- D890.

Baumann, C. and R. De La Fuente (2011). Role of Polycomb Group Protein Cbx2/M33 in Meiosis Onset and Maintenance of Chromosome Stability in the Mammalian Germline. Genes (Basel) 2(1):59-80.

Biel, M., C. Wahl-Schott, et al. (2009). Hyperpolarization-activated cation channels:from genes to function. Physiol Rev 89(3):847-885.

Black, B. L. and E. N. Olson (1998). Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Annu Rev Cell Dev Biol 14:167-196.

Cao, R., Y. Tsukada, et al. (2005). Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing. Mol Cell 20(6):845-854.

Chaldoupi, S. M., P. Loh, et al. (2009). The role of connexin40 in atrial fibrillation. Cardiovasc Res 84(1):15-23.

Durocher, D., F. Charron, et al. (1997). The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J 16(18):5687-5696.

El Sharaby, A. A., M. Egerbacher, et al. (2001). Immunohistochemical demonstration of Leu-7 (HNK-1), Neurone-specific Enolase (NSE) and Protein-Gene Peptide (PGP) 9.5 in the developing camel (Camelus dromedarius) heart. Anat Histol Embryol 30(6):321-325.

Espinoza-Lewis, R. A., L. Yu, et al. (2009). Shox2 is essential for the differentiation of cardiac pacemaker cells by repressing Nkx2-5. Dev Biol 327(2):376-385.

Franco, D., W. H. Lamers, et al. (1998). Patterns of expression in the developing myocardium:towards a morphologically integrated transcriptional model. Cardiovasc Res 38(1):25-53.

195

Fuks, F., W. A. Burgers, et al. (2001). Dnmt3a binds deacetylases and is recruited by a sequence- specific repressor to silence transcription. EMBO J 20(10):2536-2544.

Garcia-Cao, M., R. O'Sullivan, et al. (2004). Epigenetic regulation of telomere length in mammalian cells by the Suv39h1 and Suv39h2 histone methyltransferases. Nat Genet 36(1):94-99.

Gertsenstein M, Nutter LM, Reid T, Pereira M, Stanford WL, Rossant J, et al. 2010. Efficient generation of germ line transmitting chimeras from C57BL/6N ES cells by aggregation with outbred host embryos. PLoS One 5:e11260.

Greulich, F., C. Rudat, et al. (2011). Mechanisms of T-box gene function in the developing heart. Cardiovasc Res 91(2):212-222.

Harvey, R. P. (1996). NK-2 homeobox genes and heart development. Dev Biol 178(2):203-216.

Harzheim, D., K. H. Pfeiffer, et al. (2008). Cardiac pacemaker function of HCN4 channels in mice is confined to embryonic development and requires cyclic AMP. EMBO J 27(4):692-703.

Hemenway, C. S., B. W. Halligan, et al. (2000). Identification and analysis of a third mouse Polycomb gene, MPc3. Gene 242(1-2):31-40.

Horsley, D., A. Hutchings, et al. (1996). M32, a murine homologue of Drosophila heterochromatin protein 1 (HP1), localises to euchromatin within interphase nuclei and is largely excluded from constitutive heterochromatin. Cytogenet Cell Genet 73(4):308-311.

Houweling, A. C., M. M. van Borren, et al. (2005). "Expression and regulation of the atrial natriuretic factor encoding gene Nppa during development and disease." Cardiovasc Res 67(4):583-593.

Ihaka P, Gentleman R. 1996. R:A language for data analysis and graphics. In: 299-314.

Ismail, I. H., J. P. Gagne, et al. (2012). CBX4-mediated SUMO modification regulates BMI1 recruitment at sites of DNA damage. Nucleic Acids Res 40(12):5497-5510.

Isono, K., Y. Fujimura, et al. (2005). Mammalian polyhomeotic homologues Phc2 and Phc1 act in synergy to mediate polycomb repression of Hox genes. Mol Cell Biol 25(15):6694-6706.

Jeong, K. S., J. H. Park, et al. (2005). The analysis of X-chromosome inactivation-related gene expression from single mouse embryo with sex-determination. Biochem Biophys Res Commun 333(3):803-807.

Kuruppu, S. and A. I. Smith (2012). Endothelin Converting Enzyme-1 phosphorylation and trafficking. FEBS Lett 586(16):2212-2217.

Laget, S., M. Joulie, et al. (2010). The human proteins MBD5 and MBD6 associate with heterochromatin but they do not bind methylated DNA. PLoS One 5(8):e11982.

196

Lazzaro, M. A. and D. J. Picketts (2001). Cloning and characterization of the murine Imitation Switch (ISWI) genes:differential expression patterns suggest distinct developmental roles for Snf2h and Snf2l. J Neurochem 77(4):1145-1156.

Lessard, J., J. I. Wu, et al. (2007). An essential switch in subunit composition of a chromatin remodeling complex during neural development. Neuron 55(2):201-215.

Lien, C. L., C. Wu, et al. (1999). Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer. Development 126(1):75-84.

Minakuchi, M., N. Kakazu, et al. (2001). Identification and characterization of SEB, a novel protein that binds to the acute undifferentiated leukemia-associated protein SET. Eur J Biochem 268(5):1340-1351.

Morgan M, Anders S, Lawrence M, Aboyoun P, Pages H, Gentleman R. 2009. ShortRead:a bioconductor package for input, quality assessment and exploration of high-throughput sequence data. Bioinformatics 25:2607-2608.

Narayan, N., I. H. Lee, et al. (2012). The NAD-dependent deacetylase SIRT2 is required for programmed necrosis. Nature 492(7428):199-204.

O'Carroll, D., H. Scherthan, et al. (2000). Isolation and characterization of Suv39h2, a second histone H3 methyltransferase gene that displays testis-specific expression. Mol Cell Biol 20(24):9423-9433.

Okano, M., D. W. Bell, et al. (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99(3):247-257.

Otsuki, T., K. Yata, et al. (2004). Expression of protein gene product 9.5 (PGP9.5)/ubiquitin-C- terminal hydrolase 1 (UCHL-1) in human myeloma cells. Br J Haematol 127(3):292-298.

Patient, R. K. and J. D. McGhee (2002). The GATA family (vertebrates and invertebrates). Curr Opin Genet Dev 12(4):416-422.

Pereira, A. H., C. F. Clemente, et al. (2009). MEF2C silencing attenuates load-induced left ventricular hypertrophy by modulating mTOR/S6K pathway in mice. PLoS One 4(12):e8472.

Peters, A. H., D. O'Carroll, et al. (2001). Loss of the Suv39h histone methyltransferases impairs mammalian heterochromatin and genome stability. Cell 107(3):323-337.

Sartor MA, Leikauf GD, Medvedovic M. 2009. LRpath:a logistic regression approach for identifying enriched biological groups in gene expression data. Bioinformatics 25:211- 217.

Schoorlemmer, J., C. Marcos-Gutierrez, et al. (1997). Ring1A is a transcriptional repressor that interacts with the Polycomb-M33 protein and is expressed at rhombomere boundaries in the mouse hindbrain. EMBO J 16(19):5930-5942.

197

Sebastian, S., P. Sreenivas, et al. (2009). MLL5, a trithorax homolog, indirectly regulates H3K4 methylation, represses cyclin A2 expression, and promotes myogenic differentiation. Proc Natl Acad Sci U S A 106(12):4719-4724.

Shinde K, Phatak M, Johannes FM, Chen J, Li Q, Vineet JK, et al. 2010. Genomics Portals:integrative web-platform for mining genomics data. BMC Genomics 11:27.

Shur, I., R. Socher, et al. (2006). In vivo association of CReMM/CHD9 with promoters in osteogenic cells. J Cell Physiol 207(2):374-378.

Singh, P. B., J. R. Miller, et al. (1991). A sequence motif found in a Drosophila heterochromatin protein is conserved in animals and plants. Nucleic Acids Res 19(4):789-794.

Sohl, G. and K. Willecke (2004). Gap junctions and the connexin protein family. Cardiovasc Res 62(2):228-232.

Stieber, J., S. Herrmann, et al. (2003). The hyperpolarization-activated channel HCN4 is required for the generation of pacemaker action potentials in the embryonic heart. Proc Natl Acad Sci U S A 100(25):15235-15240.

Surapureddi, S., N. Viswakarma, et al. (2006). PRIC320, a transcription coactivator, isolated from peroxisome proliferator-binding protein complex. Biochem Biophys Res Commun 343(2):535-543.

Takihara, Y., D. Tomotsune, et al. (1997). Targeted disruption of the mouse homologue of the Drosophila polyhomeotic gene leads to altered anteroposterior patterning and neural crest defects. Development 124(19):3673-3682.

Tong, J. K., C. A. Hassig, et al. (1998). Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex. Nature 395(6705):917-921.

Trapnell C, Pachter L, Salzberg SL. 2009. TopHat:discovering splice junctions with RNA-Seq. Bioinformatics 25:1105-1111.

Van Houdt, J. K., B. A. Nowakowska, et al. (2012). Heterozygous missense mutations in SMARCA2 cause Nicolaides-Baraitser syndrome. Nat Genet 44(4):445-449, S441.

Wang, Y., Y. Zheng, et al. (2007). Polymorphisms of KDR gene are associated with coronary heart disease. J Am Coll Cardiol 50(8):760-767.

Watanabe, D., I. Suetake, et al. (2002). Stage- and cell-specific expression of Dnmt3a and Dnmt3b during embryogenesis. Mech Dev 118(1-2):187-190.

Weber H, Birnbaum LS. 1985. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and 2,3,7,8- tetrachlorodibenzofuran (TCDF) in pregnant C57BL/6N mice:distribution to the embryo and excretion. Arch Toxicol 57:159-162.

Weiss, A. and L. A. Leinwand (1996). The mammalian myosin heavy chain gene family. Annu Rev Cell Dev Biol 12:417-439.

198

Xiao, Q., G. Wang, et al. (2011). Chromobox protein homolog 3 is essential for stem cell differentiation to smooth muscles in vitro and in embryonic arteriogenesis. Arterioscler Thromb Vasc Biol 31(8):1842-1852.

Yamaki, M., K. Isono, et al. (2002). The mouse Edr2 (Mph2) gene has two forms of mRNA encoding 90- and 36-kDa polypeptides. Gene 288(1-2):103-110.

199