Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Aberrant Methylation Underlies Insulin Gene Expression in Human InsulinomaARTICLE https://doi.org/10.1038/s41467-020-18839-1 OPEN Aberrant methylation underlies insulin gene expression in human insulinoma Esra Karakose1,6, Huan Wang 2,6, William Inabnet1, Rajesh V. Thakker 3, Steven Libutti4, Gustavo Fernandez-Ranvier 1, Hyunsuk Suh1, Mark Stevenson 3, Yayoi Kinoshita1, Michael Donovan1, Yevgeniy Antipin1,2, Yan Li5, Xiaoxiao Liu 5, Fulai Jin 5, Peng Wang 1, Andrew Uzilov 1,2, ✉ Carmen Argmann 1, Eric E. Schadt 1,2, Andrew F. Stewart 1,7 , Donald K. Scott 1,7 & Luca Lambertini 1,6 1234567890():,; Human insulinomas are rare, benign, slowly proliferating, insulin-producing beta cell tumors that provide a molecular “recipe” or “roadmap” for pathways that control human beta cell regeneration. An earlier study revealed abnormal methylation in the imprinted p15.5-p15.4 region of chromosome 11, known to be abnormally methylated in another disorder of expanded beta cell mass and function: the focal variant of congenital hyperinsulinism. Here, we compare deep DNA methylome sequencing on 19 human insulinomas, and five sets of normal beta cells. We find a remarkably consistent, abnormal methylation pattern in insu- linomas. The findings suggest that abnormal insulin (INS) promoter methylation and altered transcription factor expression create alternative drivers of INS expression, replacing cano- nical PDX1-driven beta cell specification with a pathological, looping, distal enhancer-based form of transcriptional regulation. Finally, NFaT transcription factors, rather than the cano- nical PDX1 enhancer complex, are predicted to drive INS transactivation. 1 From the Diabetes Obesity and Metabolism Institute, The Department of Surgery, The Department of Pathology, The Department of Genetics and Genomics Sciences and The Institute for Genomics and Multiscale Biology, The Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA.
- 
												  Connexin 40.1 (GJD4) (NM 153368) Human Tagged ORF Clone Lentiviral Particle – RC222438L3V | OrigeneOriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC222438L3V Connexin 40.1 (GJD4) (NM_153368) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: Connexin 40.1 (GJD4) (NM_153368) Human Tagged ORF Clone Lentiviral Particle Symbol: GJD4 Synonyms: CX40.1 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) ACCN: NM_153368 ORF Size: 1110 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC222438). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_153368.1 RefSeq Size: 1580 bp RefSeq ORF: 1113 bp Locus ID: 219770 UniProt ID: Q96KN9 Protein Families: Transmembrane MW: 40 kDa Gene Summary: Connexins, such as GJD4, are involved in the formation of gap junctions, intercellular conduits that directly connect the cytoplasms of contacting cells. Each gap junction channel is formed by docking of 2 hemichannels, each of which contains 6 connexin subunits (Sohl et al., 2003 [PubMed 12881038]).[supplied by OMIM, Mar 2008] This product is to be used for laboratory only.
- 
											Nucleoporin 107, 62 and 153 Mediate Kcnq1ot1 Imprinted Domain Regulation in Extraembryonic Endoderm Stem CellsARTICLE DOI: 10.1038/s41467-018-05208-2 OPEN Nucleoporin 107, 62 and 153 mediate Kcnq1ot1 imprinted domain regulation in extraembryonic endoderm stem cells Saqib S. Sachani 1,2,3,4, Lauren S. Landschoot1,2, Liyue Zhang1,2, Carlee R. White1,2, William A. MacDonald3,4, Michael C. Golding 5 & Mellissa R.W. Mann 3,4 1234567890():,; Genomic imprinting is a phenomenon that restricts transcription to predominantly one par- ental allele. How this transcriptional duality is regulated is poorly understood. Here we perform an RNA interference screen for epigenetic factors involved in paternal allelic silen- cing at the Kcnq1ot1 imprinted domain in mouse extraembryonic endoderm stem cells. Multiple factors are identified, including nucleoporin 107 (NUP107). To determine NUP107’s role and specificity in Kcnq1ot1 imprinted domain regulation, we deplete Nup107, as well as Nup62, Nup98/96 and Nup153. Nup107, Nup62 and Nup153, but not Nup98/96 depletion, reduce Kcnq1ot1 noncoding RNA volume, displace the Kcnq1ot1 domain from the nuclear periphery, reactivate a subset of normally silent paternal alleles in the domain, alter histone modifications with concomitant changes in KMT2A, EZH2 and EHMT2 occupancy, as well as reduce cohesin interactions at the Kcnq1ot1 imprinting control region. Our results establish an important role for specific nucleoporins in mediating Kcnq1ot1 imprinted domain regulation. 1 Departments of Obstetrics & Gynaecology, and Biochemistry, Western University, Schulich School of Medicine and Dentistry, London, ON N6A 5W9, Canada. 2 Children’s Health Research Institute, London, ON N6C 2V5, Canada. 3 Departments of Obstetrics, Gynecology and Reproductive Sciences, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213, USA. 4 Magee-Womens Research Institute, Pittsburgh, PA 15213, USA.
- 
												  TRANSCRIPTIONAL REGULATION of Hur in RENAL STRESSTRANSCRIPTIONAL REGULATION OF HuR IN RENAL STRESS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Sudha Suman Govindaraju Graduate Program in Biochemistry The Ohio State University 2014 Dissertation Committee: Dr. Beth S. Lee, Ph.D., Advisor Dr. Kathleen Boris-Lawrie, Ph.D. Dr. Sissy M. Jhiang, Ph.D. Dr. Arthur R. Strauch, Ph.D Abstract HuR is a ubiquitously expressed RNA-binding protein that affects the post- transcriptional life of thousands of cellular mRNAs by regulating transcript stability and translation. HuR can post-transcriptionally regulate gene expression and modulate cellular responses to stress, differentiation, proliferation, apoptosis, senescence, inflammation, and the immune response. It is an important mediator of survival during cellular stress, but when inappropriately expressed, can promote oncogenic transformation. Not surprisingly, the expression of HuR itself is tightly regulated at multiple transcriptional and post-transcriptional levels. Previous studies demonstrated the existence of two alternate HuR transcripts that differ in their 5’ untranslated regions and have markedly different translatabilities. These forms were also found to be reciprocally expressed following cellular stress in kidney proximal tubule cell lines, and the shorter, more readily translatable variant was shown to be regulated by Smad 1/5/8 pathway and bone morphogenetic protein-7 (BMP-7) signaling. In this study, the factors that promote transcription of the longer alternate form were identified. NF-κB was shown to be important for expression of the long HuR mRNA, as was a newly identified region with potential for binding the Sp/KLF families of transcription factors.
- 
												  PLEKHO1 Knockdown Inhibits RCC Cell Viability in Vitro and in Vivo, Potentially by the Hippo and MAPK/JNK PathwaysINTERNATIONAL JOURNAL OF ONCOLOGY 55: 81-92, 2019 PLEKHO1 knockdown inhibits RCC cell viability in vitro and in vivo, potentially by the Hippo and MAPK/JNK pathways ZI YU1,2*, QIANG LI3*, GEJUN ZHANG2, CHENGCHENG LV1, QINGZHUO DONG2, CHENG FU1, CHUIZE KONG2 and YU ZENG1 1Department of Urology, Cancer Hospital of China Medical University, Liaoning Cancer Hospital and Institute, Shenyang, Liaoning 110042; 2Department of Urology, The First Hospital of China Medical University, Shenyang, Liaoning 110001; 3Department of Pathology, Cancer Hospital of China Medical University, Liaoning Cancer Hospital and Institute, Shenyang, Liaoning 110042, P.R. China Received November 17, 2018; Accepted May 17, 2019 DOI: 10.3892/ijo.2019.4819 Abstract. Renal cell carcinoma (RCC) is the most common involved in the serine/threonine-protein kinase hippo and JNK type of kidney cancer. By analysing The Cancer Genome signalling pathways. Together, the results of the present study Atlas (TCGA) database, 16 genes were identified to be suggest that PLEKHO1 may contribute to the development consistently highly expressed in RCC tissues compared with of RCC, and therefore, further study is needed to explore its the matched para-tumour tissues. Using a high-throughput cell potential as a therapeutic target. viability screening method, it was found that downregulation of only two genes significantly inhibited the viability of Introduction 786-O cells. Among the two genes, pleckstrin homology domain containing O1 (PLEKHO1) has never been studied in In 2018, kidney cancer is estimated to be diagnosed in RCC, to the best of our knowledge, and its expression level nearly 403,200 people worldwide and to lead to almost was shown to be associated with the prognosis of patients with 175,000 cancer-related deaths according to the latest data RCC in TCGA dataset.
- 
												  Table 2. SignificantTable 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
- 
												  Transcriptome Analyses of Rhesus Monkey Pre-Implantation Embryos Reveal ADownloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Transcriptome analyses of rhesus monkey pre-implantation embryos reveal a reduced capacity for DNA double strand break (DSB) repair in primate oocytes and early embryos Xinyi Wang 1,3,4,5*, Denghui Liu 2,4*, Dajian He 1,3,4,5, Shengbao Suo 2,4, Xian Xia 2,4, Xiechao He1,3,6, Jing-Dong J. Han2#, Ping Zheng1,3,6# Running title: reduced DNA DSB repair in monkey early embryos Affiliations: 1 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 2 Key Laboratory of Computational Biology, CAS Center for Excellence in Molecular Cell Science, Collaborative Innovation Center for Genetics and Developmental Biology, Chinese Academy of Sciences-Max Planck Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 3 Yunnan Key Laboratory of Animal Reproduction, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 4 University of Chinese Academy of Sciences, Beijing, China 5 Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, Yunnan 650204, China 6 Primate Research Center, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, China * Xinyi Wang and Denghui Liu contributed equally to this work 1 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press # Correspondence: Jing-Dong J. Han, Email: [email protected]; Ping Zheng, Email: [email protected] Key words: rhesus monkey, pre-implantation embryo, DNA damage 2 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Pre-implantation embryogenesis encompasses several critical events including genome reprogramming, zygotic genome activation (ZGA) and cell fate commitment.
- 
												  Seq2pathway Vignetteseq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
- 
												  Defining Functional Interactions During Biogenesis of Epithelial JunctionsARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
- 
												  Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn KbioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript.
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).