Prof. Marjanca Starčič Erjavec, PhD Molecular Genetics and Microbiology Group Department of Biology Biotechnical Faculty Ljubljana, Slovenia 1869 nuclein
Miescher‘s lab at the Johannes Friedrich Miescher University of Tübingen (1844 – 1895) 1928 TRANSFORMATION
Smooth colony Rough colony S. pneumoniae – with capsule S. pneumoniae – without capsule
Frederick Griffith (1879 - 1941)
1944
Oswald T. Avery Colin MacLeod Maclyn McCarty (1877-1955) (1909 – 1972) (1911 – 2005)
Performed experiments with the cell extract of S. pneumoniae.
Proof: DNA is the hereditary molecule . Avery-MacLeod-McCarty Assay
centrifugation, heat inactivation, homogenization, filtration pneumococci bacterial filtrate with capsule and without capsule pneumococci without capsule – RNase protease DNase non-pathogenic
pneumococci without capsule – non-pathogenic 1952 A biological proof that the genes are made of DNA.
Martha C. Chase Alfred Hershey (1927 – 2003) (1908 – 1997) Hershey-Chase experiment
Labeling of bacteriophages Labeled bacteriophages infect cells Detection of radioactivity
Phage proteins labeled with Radioactivity is outside of the cell radioactive sulphur
Phage DNA is labeled with Radioactivity is IN the cell radioactive phosphorus 1953
James D. Watson Francis Crick (1928–) (1916–2004)
3D-model of DNA
1961 genetic code (Nirenberg, later also Ochoa and Khorana)
Marshall W. Nirenberg (1927-2010) 1965 RESTRICTION ENZYMES
Research into restriction of phages
Restriction-modification systems in bacteria
1968: EcoB (Linn & Arber), Werner Arber (1929 – ) EcoK (Meselson, Yuan)
1967 DNA-ligase
Succeed to form covalent circles of phage l linear DNA using an E. coli extract
Martin Gellert (1929 -) 1970
Haemophilus influenzae
Endonuclaese R
Hamilton O. Smith (1931 – ) HindII 5‘-GTY^RAC-3‘ 1971
Applications of restriction enzymes
Daniel Nathans (1928 – 1999)
1971
Cut DNA molecules with EcoRI to generate complementary sequences on the vector and the fragment
Fragment DNA to be Vector molecule cloned – insert from – DNA of SV40 phage l virus Join insert from phage l with SV40 virus vector
Paul N. Berg Recombinant DNA molecule (1926 – )
1972
Stanley N. Cohen Herbert W. Boyer (1935 – ) (1936 – )
Cohen – plasmids, their transfer - Abr
hot pastrami
Boyer – restriction enzymes (EcoRI) and religation
corned beef Cut DNA with EcoRI to generate complementary sequences on the vector and the fragment
Fragment DNA of the Vector molecule R6-5 plasmid – insert – DNA of pSC101 plasmid Join insert and vector
Bacteria Recombinant DNA molecule
Bacterial chromosome Recombinant DNA molecule
Insertion of rDNA into bacteria for replication
MOLECULAR CLONING
Molecular cloning (recombinant DNA technology, genetic engineering) includes isolation of a certain DNA fragment and its amplification to a large number of copies.
INSERT + VECTOR Plasmid Chromosomal DNA DNA
Plasmid DNA isolation Chromosomal DNA isolation Digestion with restriction enzyme Digestion with restriction enzyme
Ligation of insert into the vector Molecular cloning of Trasnformation into the host cell inserts obtained Replication of host cells with DNA isolation Primer 2 Gene to be cloned Primer 1
Ligation of insert into the vector
Molecular Trasnformation into the host cell cloning of Replication of host cells inserts obtained with PCR Vectors and host cells
VECTOR INSERT SIZE HOST CELLS Plasmid, 10 kb Bacteria, mammalian cells phagmid
Virus 5–100 kb Bacteria, insect and mammalian cells
Cosmid 30–40 kb Bacteria BAC 100 kb Bacteria YAC 1 Mb Yeasts Properties of a good plasmid vector 1. A small size. 2. A replication region, which allows the multiplication of the plasmid in a host cell until the desired number of copies. 3. A polyclonal site (polylinker). 4. A selection marker (a gene that allows selection, e.g. a gene coding for an antibiotic resistance). 5. A differentiation marker (a gene that allows differentiation of cells harboring a plasmid vector with an insert from those without an insert, e.g. gene for -complementation). Vector plasmid pUC19 Vector plasmid pUC19 - polylinker -complementation Special vectors
• “shuttle” vectors • expression vectors • vectors for site-specific mutagenesis • promoter-probe vectors • etc. Enzymes in molecular cloning Standard enzymes: • restrictase: cuts dsDNA at specific palindromic sequences • ligase: introduction of phosohodiester bonds • polymerase: elongation of DNA strands • RNase: digestion of RNA restrictase
ligase But also: • phosphatase: removes phosphates • polynucleotide kinase: binds phosphates; e.g. radioactive labelling • reverse transcriptase: makes cDNA on RNA templates • exonuclease: removes nucleotides from the end of the strand • methylase: addition of Met into the DNA EcoRI
5‘ TTACGCGAGAATTCGCTCATTG 3‘ 3‘ AATGCGCTCTTAAGCGAGTAAC 5‘
EcoRI
5‘ TTACGCGAG AATTCGCTCATTG 3‘ 3‘ AATGCGCTCTTAA GCGAGTAAC 5‘
homodimer 6 bp in the recognition site Mg2+ ions as cofactors first restrictase, used for molecular cloning
• Multiple resistant bacteria pose one of greatest risks for human health.
• Since 1987 decline in the number of new approved antibiotics. Number of death cases today and in 2050
The Review on Antimicrobial Resistance, Chaired by Jim O’Neill WHO list of bacteria for which new antibiotics are urgently needed 27 February 2017 News Release GENEVA WHO priority pathogens list for R&D of new antibiotics
Priority 1: CRITICAL • Acinetobacter baumannii, carbapenem-resistant • Pseudomonas aeruginosa, carbapenem-resistant • Enterobacteriaceae, carbapenem-resistant, ESBL-producing Priority 2: HIGH • Enterococcus faecium, vancomycin-resistant • Staphylococcus aureus, methicillin-resistant, vancomycin-intermediate and resistant • Helicobacter pylori, clarithromycin-resistant • Campylobacter spp., fluoroquinolone-resistant • Salmonellae, fluoroquinolone-resistant • Neisseria gonorrhoeae, cephalosporin-resistant, fluoroquinolone-resistant Priority 3: MEDIUM • Streptococcus pneumoniae, penicillin-non-susceptible • Haemophilus influenzae, ampicillin-resistant • Shigella spp., fluoroquinolone-resistant WHO list of bacteria for which new antibiotics are urgently needed 27 February 2017 News Release GENEVA WHO priority pathogens list for R&D of new antibiotics
Priority 1: CRITICAL • Acinetobacter baumannii, carbapenem-resistant • Pseudomonas aeruginosa, carbapenem-resistant E. coli • Enterobacteriaceae, carbapenem-resistant, ESBL-producing Priority 2: HIGH • Enterococcus faecium, vancomycin-resistant • Staphylococcus aureus, methicillin-resistant, vancomycin-intermediate and resistant • Helicobacter pylori, clarithromycin-resistant • Campylobacter spp., fluoroquinolone-resistant • Salmonellae, fluoroquinolone-resistant • Neisseria gonorrhoeae, cephalosporin-resistant, fluoroquinolone-resistant Priority 3: MEDIUM • Streptococcus pneumoniae, penicillin-non-susceptible • Haemophilus influenzae, ampicillin-resistant • Shigella spp., fluoroquinolone-resistant https://www.newsweek.com/2019/05/31/de ath-antibiotics-running-out-effective-drugs- fight-superbug-army-1423712.html Conjugation / conjugal transfer
DNA transfer between two bacterial cells that are in direct contact Main positive regulator - TraJ Bacterial conjugation
• direct contact with the F-pilus and formation of a mating pore;
• mobilization of the DNA transfer (cut at a specific site oriT of F-plasmid);
• transfer of a single linear DNA molecule with the 5 'end from the donor into the recipient cell and simultaneous synthesis of the missing DNA strand in the donor and the recipient;
• transferred linear DNA molecule (double-stranded) is circularized and thus a functional plasmid is formed
44. Three – concepts of conjugation
based based antimicrobial agents. Plasmid, 2008; 60: 38 60: Plasmid, 2008; antimicrobial based agents. antimicrobial -
agents Filutowicz et al. Bacterial conjugation Bacterial al. et Filutowicz
44. Three – concepts of conjugation
based based antimicrobial agents. Plasmid, 2008; 60: 38 60: Plasmid, 2008; antimicrobial based agents. antimicrobial kill anti-kill -
agents Filutowicz et al. Bacterial conjugation Bacterial al. et Filutowicz Based on the probiotic E. coli strain Nissle 1917, EcN, (MUTAFLOR), the conjugative plasmid pOX38 and bacteriocin colicin E7 a novel conjugation-based antimicrobial agent was constructed with the techniques of molecular biology.
tra pOX38 (55 kb) cat Construction of the novel strain with the conjugation- based antimicrobial agent Strain with the conjugation-based antimicrobial system (strain ŽP)
pOX38 with the ColE7 activity gene
chromosome with ColE7 immunity gene
The plasmid is in conjugation transferred into the target recipient cell. In the recipient cell the ColE7 is synthesised and the target cell is killed. Killing effect of ŽP Real time PCR – revealing traJ gene expression
traJ expression was higher at 4 h than at 24 h Conjugative assays of the ŽP strain
Mating ŽP × K12 TG1 Mating control strain × K12 TG1 Conjugation Conjug. Conjug. in CFU rec. CFU tc. freq. CFU rec. CFU tc. freq. Liquid 7 7 4 –3 medium 3.9×10 6.1×10 6.4×10 1.0×10 (3.1×106) 0 n. a. (7.4×106) (7.2×103) (2.7×10–4) Planktonic 8 8 5 –4 growth 1.1×10 1.6×10 1.3×10 8.0×10 (1.7×107) 0 n. a. (8.5×107) (3.4×104) (2.2×10–4)
Biofilm 3.7×107 3.1×107 7.1×103 2.3×10–4 (4.9×106) 0 n. a. (4.6×106) (2.3×103) (6.2×10–5) Preformed 7 7 5 –3 biofilm 2.7×10 5.4×10 4.9×10 9.2×10 (2.0×106) 0 n. a. (8.1×106) (5.8×104) (2.9×10–3) CFU data
The CFU of recipients, donors and transconjugants in conjugation mixture. E. coli K-12 TG1 (pXen lux+ Apr) per se and in conjugation mixture with either the control donor strain N4i pOX38:Cm or the killer donor strain N4i pOX38a:Cm . Bioluminescence assays
The bioluminescence (relative light units) of the recipients per se and in conjugation mixtures. E. coli K-12 TG1 (pXen lux+) per se (filled circles) and in conjugation mixture with either the control donor strain N4i pOX38:Cm (filled triangles) or the killer donor strain N4i pOX38a:Cm (filled squares). The means and the standard deviations of at least three independent experiments preformed in 6 to 12 technical repeats are shown. *Significant differences between variants at P ≤ 005.
https://www.economist.com/business/2016/01/09/cutting-remarks