Cultivation and Genomics of the First Freshwater SAR11 (LD12) Isolate

Supplemental Information for:

Cultivation and genomics of the first freshwater SAR11 (LD12) isolate

Michael W. Henson1, V. Celeste Lanclos1, Brant C. Faircloth1,2, and J. Cameron Thrash1,3

1. Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, U.S.A.

2. Museum of Natural History, Louisiana State University, Baton Rouge, LA 70803, U.S.A.

3. Materials and Correspondence: J. Cameron Thrash Department of Biological Sciences 202 Life Sciences Bldg. Louisiana State University Baton Rouge, LA 70803 [email protected] 225-578-8210

Supplemental Text

Genome assembly and quality assessment

I. SPAdes assembly Adapter file for Trimmomatic1 : >i7 GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGTTCGAATCTCGTATGCCGTCTTCTGCTTG >i5 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTCCTAGAGTGTAGATCTCGGTGGTCGCCGT ATCATT

Step 1. Trim pretty aggressively to remove adapters and bases < q20 at ends and over sliding window

$ java -jar ~/bin/trimmomatic-0.30.jar PE -threads 12 -phred33 -trimlog \ trimmed/530_trimlog.log \ untrimmed/530_subset1.r1.fastq \ untrimmed/530_subset1.r2.fastq \ trimmed/530_subset1.r1.fastq \ trimmed/530_subset1.r1.unpaired.fastq \ trimmed/530_subset1.r2.fastq \ trimmed/530_subset1.r2.unpaired.fastq \ ILLUMINACLIP:/scratch/jcthrash-test/530_adapters.fa:2:30:10 \ LEADING:20 TRAILING:20 SLIDINGWINDOW:13:20 MINLEN:40

Step 2. Assemble w/ SPAdes2:

$ python ~/src/SPAdes-3.10.1-Linux/bin/spades.py --threads 12 --memory 46 --cov- cutoff auto \ --pe1-1 trimmed/530_subset1.r1.fastq \ --pe1-2 trimmed/530_subset1.r2.fastq \ --s1 trimmed/530_subset1.r1.unpaired.fastq \ --s2 trimmed/530_subset1.r2.unpaired.fastq \ -o 530_assembly

This resulted in a single contig with overlapping ends, plus three very small sequences. The first was 83 bp and contained only repeats of “CCCTAA, ” the second was 78 bp of “C,” the third, 78 bp of “A.”

II. Quality assessment The single scaffold from the original SPAdes assembly was evaluated with Reapr3, manually broken based on the results (two FCD errors), and the gaps were extended using SSPACE4 and all the Illumina HiSeq reads (Step 1). Overlaps were determined with megablast and the scaffolds were manually rejoined with overlaps removed. Another run of Reapr (Step 2) identified only one FCD error. The break and SSPACE extension process was repeated, and overlaps determined again with megablast. To evaluate the quality of the overlaps at the outer ends of the scaffold, we artificially broke the scaffold in two, reorganized the ends so they were now internal, and removed overlaps. Reapr did not identify any additional errors at this step, but verified the previous single FCD error (Step 3). The break-extension process was repeated one more time (Step 4) and then again using the MiSeq reads, with a final re-evaluation with reapr identified only the single FCD error in the same location (Step 5). To assess the validity of the error, we repeated the quality assessment of the final scaffold using a separate algorithm, Pilon5 after mapping all the HiSeq reads to the scaffold using BWA6 (Step 6). This resulted in no errors. Corroborating information was obtained using CheckM7 (Step 7) and by evaluating the GC skew8 (Step 8). Detailed commands and outputs are as follows, according to the steps identified in this synopsis.

Step 1. Reapr $ reapr facheck 530_spades_sc.fasta no error $ reapr perfectmap 530_spades_sc.fasta 530_subset1.r1.fastq 530_subset1.r2.fastq 300 perfect $ reapr smaltmap 530_spades_sc.fasta 530_subset1.r1.fastq 530_subset1.r2.fastq 530_bwa.bam $ reapr pipeline 530_spades_sc.fasta 530_bwa.bam 530_reapr_output perfect

This gave similar output, with only two FCD errors and two small sections removed (and replaced with Ns). The scaffold was manually broken in these locations, with new fasta headers added, resulting in three scaffolds à 04.break.broken_assembly_broken.fa.

SSPACE $ perl SSPACE_Standard_v3.0.m.pl -l library.txt -s 04.break.broken_assembly_broken.fa -x 1 -v 1 -T 16 -b 530_sspacev2.1

The library.txt file specified all the original HiSeq reads. All three scaffolds were extended. Overlaps were identified with megablast by comparing each pair of scaffolds. $ cat 530_sspacev2.1.final.scaffolds.fasta | fastaToTab | grep scaffold1 | tabToFasta > scaffold1.fasta $ cat 530_sspacev2.1.final.scaffolds.fasta | fastaToTab | grep scaffold2 | tabToFasta > scaffold2.fasta $ cat 530_sspacev2.1.final.scaffolds.fasta | fastaToTab | grep scaffold3 | tabToFasta > scaffold3.fasta

$ makeblastdb -dbtype nucl -in scaffold1.fasta -out scaffold1db -parse_seqids -hash_index $ makeblastdb -dbtype nucl -in scaffold2.fasta -out scaffold2db -parse_seqids -hash_index

$ blastn -query scaffold2.fasta -db scaffold1db -out scaffold2v1blast $ blastn -query scaffold3.fasta -db scaffold1db -out scaffold3v1blast $ blastn -query scaffold3.fasta -db scaffold2db -out scaffold3v2blast

The order starting with the beginning of the longest scaffold is 1—>3—>2, with a loop back to 1. I removed overlaps and named the file 530_sspace_scaffold1.fasta.original.

To smooth out missing lines: $ cat 530_sspace_scaffold1.fasta.original | fastaToTab | tabToFasta > 530_sspace_scaffold1.fasta

Step 2. $ reapr facheck 530_sspace_scaffold1.fasta no error $ reapr perfectmap 530_sspace_scaffold1.fasta 530_R1.fastq 530_R2.fastq 300 perfect $ reapr smaltmap -n 16 530_sspace_scaffold1.fasta 530_R1.fastq 530_R2.fastq 530_sspace_scaffold1.bam $ reapr pipeline 530_sspace_scaffold1.fasta 530_sspace_scaffold1.bam 530_sspace_scaffold1_output perfect

Just one RCD error.

Step 3. Check to see if that is the same and only error if the 2—>1 gap is closed. I’ve redone the scaffold assembly such that the scaffolds are 3—>2 —>1: 530_sspace_scaffold1_ro.fasta.original

$ cat 530_sspace_scaffold1_ro.fasta.original | fastaToTab | tabToFasta > 530_sspace_scaffold1_ro.fasta

$ reapr facheck 530_sspace_scaffold1_ro.fasta no error $ reapr perfectmap 530_sspace_scaffold1_ro.fasta 530_R1.fastq 530_R2.fastq 300 perfect $ reapr smaltmap -n 16 530_sspace_scaffold1_ro.fasta 530_R1.fastq 530_R2.fastq 530_sspace_scaffold1_ro.bam $ reapr pipeline 530_sspace_scaffold1_ro.fasta 530_sspace_scaffold1_ro.bam 530_sspace_scaffold1_ro_output perfect

The 04.break.broken_assembly_bin.fa files for both 530_sspace_scaffold1 and 530_sspace_scaffold1_ro are 100% identical across their alignments (NCBI megablast), but slightly different sizes. Importantly this also means that the scaffold end join is not an issue.

Step 4. Now try to eliminate the FCD error with a final break and extension of 530_sspace_scaffold1.fasta.

Take the 04.break.broken_assembly.fa file from reapr_sspacev2.1a, manually remove the Ns, break the scaffold and rename the headers —> 04.break.broken_assembly_broken.fa.original

$ cat 04.break.broken_assembly_broken.fa.original | fastaToTab | tabToFasta > 530_sspace_scaffold1_broken.fasta run SSPACE with the same library.txt file as above.

$ mv sspace.o630499 library.txt q_sspace 530_sspace_scaffold1_broken.fasta 530_sspacev2.2/ $ cd 530_sspacev2.2/

Although the scaffolds were not joined, the larger one was extended.

$ cat 530_sspacev2.2.final.scaffolds.fasta | fastaToTab | grep scaffold1 | tabToFasta > scaffold1.fasta $ cat 530_sspacev2.2.final.scaffolds.fasta | fastaToTab | grep scaffold2 | tabToFasta > scaffold2.fasta $ makeblastdb -dbtype nucl -in scaffold1.fasta -out scaffold1db -parse_seqids -hash_index $ blastn -query scaffold2.fasta -db scaffold1db -out scaffold2v1blast megablast showed that the beginning of scaffold two has a 616 bp overlap with the end of scaffold 1. Also, the end of scaffold 2 has a 462 bp overlap with the beginning of scaffold 1, as it should.

Join the two and run reaper another time —> 530_sspace_scaffold2.fasta.original $ cat 530_sspace_scaffold2.fasta.original | fastaToTab | tabToFasta > 530_sspace_scaffold2.fasta $ cp 530_sspace_scaffold2.fasta ../ $ cd ../

$ reapr facheck 530_sspace_scaffold2.fasta no error $ reapr perfectmap 530_sspace_scaffold2.fasta 530_R1.fastq 530_R2.fastq 300 perfect $ reapr smaltmap -n 16 530_sspace_scaffold2.fasta 530_R1.fastq 530_R2.fastq 530_sspace_scaffold2.bam $ reapr pipeline 530_sspace_scaffold2.fasta 530_sspace_scaffold2.bam 530_sspace_scaffold2_output perfect

This is still showing an FCD error in the same place. Attempt to close with MiSeq reads.

Step 5. Manually break 04.break.broken_assembly.fa —> 04.break.broken_assembly_broken.fa.original.

$ cat 04.break.broken_assembly_broken.fa.original | fastaToTab | tabToFasta > 04.break.broken_assembly_broken.fa

Run SSPACE as above but with MiSeq reads.

This only extended one scaffold. Run megablast to identify overlaps: $ cat 530_sspacev3.final.scaffolds.fasta | fastaToTab | grep scaffold1 | tabToFasta > scaffold1.fasta $ cat 530_sspacev3.final.scaffolds.fasta | fastaToTab | grep scaffold2 | tabToFasta > scaffold2.fasta $ makeblastdb -dbtype nucl -in scaffold1.fasta -out scaffold1db -parse_seqids -hash_index $ blastn -query scaffold2.fasta -db scaffold1db -out scaffold2v1blast

There was the typical overlap from the scaffold ends, 462 bp in this case. There was only a 236 bp overlap between the end of scaffold 1 and the beginning of scaffold 2. I joined these manually for another reapr check —> 530_sspacev3_scaffold2.fasta.original $ cat 530_sspacev3_scaffold2.fasta.original | fastaToTab | tabToFasta > 530_sspacev3_scaffold2.fasta

Run reapr with the miseq sequences and the hiseq sequences and compare FCD reports.

$ reapr facheck 530_sspacev3_scaffold2.fasta no error $ reapr perfectmap 530_sspacev3_scaffold2.fasta /project/jcthrash/genome_fastqs/LSUCC0530_S1_L001_R1_001.fastq /project/jcthrash/genome_fastqs/LSUCC0530_S1_L001_R2_001.fastq 440 perfect $ reapr smaltmap -n 16 530_sspacev3_scaffold2.fasta /project/jcthrash/genome_fastqs/LSUCC0530_S1_L001_R1_001.fastq /project/jcthrash/genome_fastqs/LSUCC0530_S1_L001_R2_001.fastq 530_sspacev3_scaffold2.bam $ reapr pipeline 530_sspacev3_scaffold2.fasta 530_sspacev3_scaffold2.bam 530_sspacev3_scaffold2_output perfect

This actually yielded no FCD errors, but many errors regarding low fragment coverage within the contig. Try running the hiseq reads across this new assembly.

$ reapr perfectmap 530_sspacev3_scaffold2.fasta /project/jcthrash/genome_fastqs/530_R1.fastq /project/jcthrash/genome_fastqs/530_R2.fastq 300 perfect $ reapr smaltmap -n 16 530_sspacev3_scaffold2.fasta /project/jcthrash/genome_fastqs/530_R1.fastq /project/jcthrash/genome_fastqs/530_R2.fastq 530_sspacev3_scaffold2_hs.bam $ reapr pipeline 530_sspacev3_scaffold2.fasta 530_sspacev3_scaffold2_hs.bam 530_sspacev3_scaffold2_hs_output perfect

This yielded the same erroneous region it did for all the checks (using all the reads). Time to cross-evaluate with a different algorithm.

Step 6. Manually remove the scaffold overlaps at the ends of 530_sspacev3_scaffold2.fasta and change the header —> LSUCC0530_final_assembly.fasta bwa $ cd hiseq_bwa/ $ bwa index LSUCC0530_final_assembly.fasta $ bwa aln -n 0 -t 16 LSUCC0530_final_assembly.fasta /project/jcthrash/genome_fastqs/530_R1.fastq > 530_R1.sai $ bwa aln -n 0 -t 16 LSUCC0530_final_assembly.fasta /project/jcthrash/genome_fastqs/530_R2.fastq > 530_R2.sai $ bwa sampe LSUCC0530_final_assembly.fasta 530_R1.sai 530_R2.sai /project/jcthrash/genome_fastqs/530_R1.fastq /project/jcthrash/genome_fastqs/530_R2.f astq > 530_R1R2.sam $ samtools faidx LSUCC0530_final_assembly.fasta $ samtools import LSUCC0530_final_assembly.fasta.fai 530_R1R2.sam 530_R1R2.bam $ samtools sort 530_R1R2.bam 530_R1R2.sorted $ samtools index 530_R1R2.sorted.bam

On my local machine pilon $ java -Xmx16G -jar ../../../Applications/pilon-1.22.jar --genome LSUCC0530_final_assembly.fasta --frags 530_R1R2.sorted.bam

Pilon version 1.22 Wed Mar 15 16:38:30 2017 -0400 Genome: LSUCC0530_final_assembly.fasta Fixing snps, indels, gaps, local Input genome size: 1160202 Scanning BAMs 530_R1R2.sorted.bam: 14264790 reads, 0 filtered, 9778615 mapped, 9537494 proper, 30284 stray, FR 100% 311+/-109, max 639 Processing LSUCC0530_final_assembly:1-1160202 frags 530_R1R2.sorted.bam: coverage 1018 Total Reads: 9989452, Coverage: 1018, minDepth: 102 Confirmed 1160121 of 1160202 bases (99.99%) Corrected 0 snps; 0 ambiguous bases; corrected 0 small insertions totaling 0 bases, 0 small deletions totaling 0 bases # Attempting to fix local continuity breaks LSUCC0530_final_assembly:1-1160202 log: Finished processing LSUCC0530_final_assembly:1-1160202 Writing updated LSUCC0530_final_assembly_pilon to pilon.fasta Mean frags coverage: 1018 Mean total coverage: 1018

Step 7. $ checkm lineage_wf -x .fasta -t 16 -f 530_sspacev3_scaffold2 530_sspacev3_in/ 530_sspacev3_out/

CheckM results still predict the scaffold to be 100% complete with 0% contamination, and it clades in the same space with the subclade III taxa. Output:

------

Bin Id Marker lineage # genomes # markers # marker sets 0 1 2 3 4 5+ Completeness Contamination Strain heterogeneity

------

530_sspacev3_scaffold2 k__Bacteria (UID2495) 2993 139 83 0 139 0 0 0 0 100.00 0.00 0.00

------

Step 8. gc_skew $ gc_skew -f LSUCC0530_final_assembly.fasta LSUCC0530_final_assembly -> Origin: 640,030 Terminus: 51,160

L68CC0530_fLnaO_assePbOy GC 6kew (wLnGow 1000, sOLGe 10) 0.4 500

0.3 0

0.2 −500

0.1 −1000

0.0 −1500 GC 6kew GC −0.1 −2000 CuPuOatLve GC 6kew GC CuPuOatLve

−0.2 −2500

−0.3 −3000

−0.4 −3500 0 200000 400000 600000 800000 1000000 3osLtLon on GenoPe (bS)

CuPuOatLve GC 6kew GC 6kew 2UL:640,030 TeU:51,160

This final assembly was submitted to IMG9 for genome annotation. It is publically available with IMG Taxon ID 2728369501, and at GenBank under accession number CP024034.

Supplemental Tables and Figures

Supplemental Table

Table S1 is provided as a spreadsheet, Table_S1.xlsx (hosted with the publication link at http://thethrashlab.com/publications), and contains tabs detailing the AAI vs. synteny analyses; all gene terms for Figure 3; the complete record of osmolyte transport and synthesis genes examined in this study; metadata for samples and genomes used in this study; RPKM calculations; and media recipes. Osmolyte genes were identified using a variety of sources10-31, indicated in the table.

Supplemental Figure Legends

Figure S1. Flow cytometry plot of strain LSUCC0530 during the initial experiment by which it was isolated. Side scatter is plotted vs. green fluorescence.

Figure S2. Phylogenetic inference of the Alphaproteobacteria, including LSUCC0530 and other reference SAR11 sequences, using 16S rRNA genes. Values at nodes indicate Shimodaira-Hasegawa like values from FastTree2.

Figure S3. Box plots of intragenic spacer distributions for subclade IIIa and IIIb (LD12) with Wilcoxon rank-sum results indicated.

Figure S4. Metagenomic recruitment to the LSUCC0530 genome scaffold using sequences from Feitsui Reservoir (A) and Lake Gatun (B). Recruitment is plotted according to percent identity of read hit to the genome. HVR2 is visible as the region of very poor recruitment on the left side of each plot.

Figure S5. Phylogenetic tree of aceA (isocitrate dehydrogenase) sequences. Scale bar indicates 0.1 changes per position. Values at nodes indicate Shimodaira-Hasegawa like values from FastTree2.

Figure S6. Phylogenetic tree of malate synthase sequences. Scale bar indicates 0.1 changes per position. Values at nodes indicate Shimodaira-Hasegawa like values from FastTree2.

Figure S7. Gene neighborhood of malate synthase (red, center) in the LSUCC0530 genome and those of a subset of other SAR11 genomes. Conserved region is boxed.

Figure S8. Results of growth experiments testing salinity range (A) and temperature range (B). Results are plotted as cell concentration by hour, and are centered at zero as the beginning of logarithmic growth to allow for ease of comparison across multiple independent experiments. Replicates are plotted as separate colors. Replicates showing aberrant growth (e.g., black line in A, 2.9) were not plotted in Figure 4.

Figure S9. Relative abundance of the LD12 OTU in coastal samples from the northern Gulf of Mexico. Bar graph indicates OTU7 relative abundance compared with all other SAR11 OTUs, with sites ordered according to increasing salinity. Inset depicts the LD12 OTU7 only data with a linear regression, equation and R2 value included, and 95% confidence intervals shaded.

Figure S10. Relative abundance of LD12 genome microclusters at 85, 90, 92, 98, and 100% percent identity, for comparison with Figure 5 (95% identity). RPKM values are listed by site, with data aggregated for all genomes in microclusters A-C, according to the key. Colors indicate broad environmental categories.

Additional Supplemental Information, including Table S1, alignments, scripts, and density plots for all recruitment analyses, is available with the manuscript link at http://thethrashlab.com/publications.

References Cited

1 Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120, (2014). 2 Bankevich, A. et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. Journal of Computational Biology 19, 455-477, (2012). 3 Hunt, M. et al. REAPR: a universal tool for genome assembly evaluation. Genome Biol 14, 1-10, (2013). 4 Boetzer, M., Henkel, C. V., Jansen, H. J., Butler, D. & Pirovano, W. Scaffolding pre- assembled contigs using SSPACE. Bioinformatics 27, 578-579, (2011). 5 Walker, B. J. et al. Pilon: An Integrated Tool for Comprehensive Microbial Variant Detection and Genome Assembly Improvement. PLOS ONE 9, (2014). 6 Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754-1760, (2009). 7 Parks, D. H., Imelfort, M., Skennerton, C. T., Hugenholtz, P. & Tyson, G. W. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Research 25, 1043-1055, (2015). 8 Brown, C. T. et al. Unusual biology across a group comprising more than 15% of domain Bacteria. Nature 523, 208-211, (2015). 9 Markowitz, V. M. et al. IMG 4 version of the integrated microbial genomes comparative analysis system. Nucleic Acids Research 42, D560-567, (2014). 10 Empadinhas, N. & da Costa, M. Osmoadaptation mechanisms in prokaryotes: distribution of compatible solutes. International Microbiology, (2008). 11 Klähn, S. & Hagemann, M. Compatible solute biosynthesis in cyanobacteria. Environmental Microbiology 13, 551-562, (2011). 12 Wood, J. M. Bacterial responses to osmotic challenges. The Journal of General Physiology 145, 381-388, (2015). 13 Dupont, L. et al. The Sinorhizobium meliloti ABC transporter Cho is highly specific for choline and expressed in bacteroids from Medicago sativa nodules. J. Bacteriol. 186, 5988-5996, (2004). 14 van Alebeek, G.-J., Hermans, J. M. H., Keltjens, J. T. & Vogels, G. D. Quantification of intermediates involved in the cyclic 2,3-diphosphoglycerate metabolism of methanogenic bacteria by ion-exchange chromatography. Journal of Chromatography A 606, 65-71, (1992). 15 Chen, L., Spiliotis, E. T. & Roberts, M. F. Biosynthesis of Di-myo-inositol-1,1'- phosphate, a novel osmolyte in hyperthermophilic archaea. J. Bacteriol. 180, 3785- 3792, (1998). 16 Curson, A. R. J. et al. Dimethylsulfoniopropionate biosynthesis in marine bacteria and identification of the key gene in this process. Nature Microbiology 2, 17009, (2017). 17 Lin, H. et al. Genetic and Marine Cyclonic Eddy Analyses on the Largest Macroalgal Bloom in the World. Environ. Sci. Technol. 45, 5996-6002, (2011). 18 Reshetnikov, A. S., Khmelenina, V. N. & Trotsenko, Y. A. Characterization of the ectoine biosynthesis genes of haloalkalotolerant obligate methanotroph “Methylomicrobium alcaliphilum 20Z”. Archives of Microbiology 184, 286-297, (2006). 19 Hagemann, M. & Erdmann, N. Activation and pathway of glucosylglycerol synthesis in the cyanobacterium Synechocystis sp. PCC 6803. Microbiology 140, 1427-1431, (1994). 20 Jorasch, P., Wolter, F. P., Zähringer, U. & Heinz, E. A UDP glucosyltransferase from Bacillus subtilis successively transfers up to four glucose residues to 1,2 diacylglycerol: expression of ypfP in Escherichia coli and structural analysis of its reaction products. Molecular Microbiology 29, 419-430, (1998). 21 Hosie, A. & Poole, P. Bacterial ABC transporters of amino acids. Research in Microbiology 152, 259-270, (2001). 22 Kronemeyer, W., Peekhaus, N., Krämer, R., Sahm, H. & Eggeling, L. Structure of the gluABCD cluster encoding the glutamate uptake system of Corynebacterium glutamicum. J. Bacteriol. 177, 1152-1158, (1995). 23 Walshaw, D. L. & Poole, P. S. The general lamino acid permease of Rhizobium leguminosarum is an ABC uptake system that also influences efflux of solutes. Molecular Microbiology 21, 1239-1252, (1996). 24 Quintero, M. a., Montesinos, M. a., Herrero, A. & Flores, E. Identification of Genes Encoding Amino Acid Permeases by Inactivation of Selected ORFs from the Synechocystis Genomic Sequence. Genome Research 11, 2034-2040, (2001). 25 Hagemann, M. Molecular biology of cyanobacterial salt acclimation. FEMS Microbiology Reviews 35, 87-123, (2011). 26 García-Estepa, R. et al. The ectD Gene, Which Is Involved in the Synthesis of the Compatible Solute Hydroxyectoine, Is Essential for Thermoprotection of the Halophilic Bacterium Chromohalobacter salexigens. J. Bacteriol. 188, 3774-3784, (2006). 27 Bursy, J., Pierik, A. J., Pica, N. & Bremer, E. Osmotically Induced Synthesis of the Compatible Solute Hydroxyectoine Is Mediated by an Evolutionarily Conserved Ectoine Hydroxylase. Journal of Biological Chemistry 282, 31147-31155, (2007). 28 Pflüger, K. et al. Lysine-2,3-aminomutase and ß-lysine acetyltransferase genes of methanogenic archaea are salt induced and are essential for the biosynthesis of Ne- acetyl-ß-lysine and growth at high salinity. Appl. Environ. Microbiol. 69, (2003). 29 Brill, J., Hoffmann, T., Bleisteiner, M. & Bremer, E. Osmotically Controlled Synthesis of the Compatible Solute Proline Is Critical for Cellular Defense of Bacillus subtilis against High Osmolarity. J. Bacteriol. 193, 5335-5346, (2011). 30 Agnello, G., Chang, L. L., Lamb, C. M., Georgiou, G. & Stone, E. M. Discovery of a Substrate Selectivity Motif in Amino Acid Decarboxylases Unveils a Taurine Biosynthesis Pathway in Prokaryotes. ACS Chemical Biology 8, 2264-2271, (2013). 31 Lidbury, I., Murrell, J. C. & Chen, Y. Trimethylamine N-oxide metabolism by abundant marine heterotrophic bacteria. Proc. Natl. Acad. Sci. U.S.A. 111, 2710-2715, (2014).

5 10 4 10 3 10 2 10 1 10 Side Scatter (SSC-HLog Side Scatter 0 10 100 101 102 103 104 105 Green-B Florescence (Hlog) Brucella ceti M644/93/1 Brucella pinnipedialis M163/99/10 0.7Brucella pinnipedialis M292/94/1 0.80.9Brucella suis bv. 3 str. 686 0.9 0.5Brucella ceti M13/05/1 0.5Brucella sp. F5/99 0.5Brucella pinnipedialis B2/94 Brucella ceti B1/94 0.4 0.9Brucella suis bv. 5 str. 513 Brucella abortus bv. 5 str. B3196 Brucella abortus NCTC 8038 Brucella abortus bv 1 9-941 Brucella melitensis bv Abortus 2308 Brucella ovis ATCC 25840 Brucella suis 1330 Brucella melitensis 16M 0.90.3Brucella abortus bv. 2 str. 86/8/59 Brucella abortus bv. 3 str. Tulya Brucella abortus bv. 4 str. 292 0.4 0.4 Brucella abortus bv. 6 str. 870 1 Brucella abortus bv. 9 str. C68 Brucella abortus S19 Brucella abortus str. 2308 A 0.8 Brucella canis ATCC 23365 Brucella ceti Cudo Brucella melitensis ATCC 23457 Brucella melitensis bv. 1 str. Rev.1 Brucella melitensis bv. 2 str. 63/9 Brucella melitensis bv. 3 str. Ether Brucella microti CCM 4915 Brucella suis ATCC 23445 Brucella neotomae 5K33 Brucella sp. 83/13 1 Brucella sp. NF 2653 0.9Brucella sp. BO1 0.2Brucella sp. BO2 0.4 0.9 Brucella suis bv. 4 str. 40 Ochrobactrum intermedium LMG 3301 Ochrobactrum anthropi ATCC 49188 Bartonella henselae Houston-1 0.9 Bartonella quintana Toulouse 0.2 Bartonella grahamii as4aup 0.8 1 0.7Bartonella tribocorum CIP 105476 Bartonella bacilliformis KC583 Bartonella clarridgeiae 73 Rhizobium etli GR56 0.2Rhizobium etli Kim 5 0.80.8Rhizobium etli CFN 42 1 Rhizobium etli CIAT 894 Rhizobium etli Brasil 5 0.9 Rhizobium etli CIAT 652 1 Rhizobium leguminosarum bv trifolii WSM2297 1 Rhizobium leguminosarum bv. viciae 3841 1 0.9Rhizobium leguminosarum bv. trifolii WSM1325 Rhizobium leguminosarum bv. trifolii WSM2304 1 Agrobacterium radiobacter K84 0.7 Ensifer meliloti AK83 0.8Ensifer meliloti BL225C 1 Ensifer meliloti 1021 0.5 0.5 Ensifer medicae WSM419 Rhizobium sp. NGR234 0.4 Agrobacterium tumefaciens C58 Cereon 1 Agrobacterium tumefaciens C58 Dupont 0.5 1 Agrobacterium sp. H13-3 Agrobacterium vitis S4 Mesorhizobium loti MAFF303099 1 Mesorhizobium opportunistum WSM2075 0.7 Mesorhizobium ciceri biovar biserrulae WSM1271 0.9 1 Fulvimarina pelagi HTCC2506 1 Mesorhizobium sp. BNC1 Hoeflea phototrophica DFL-43 Candidatus Liberibacter asiaticus str. psy62 1 Candidatus Liberibacter solanacearum CLso-ZC1 Bradyrhizobium sp. WSM1253 Bradyrhizobium sp. WSM1417 Bradyrhizobium sp. WSM471 0.8 Bradyrhizobium japonicum USDA 110 0.3Bradyrhizobium sp. BTAi1 0.70.9 Bradyrhizobium sp. ORS278 Rhodopseudomonas palustris CGA009 0.3 0.9 1 Rhodopseudomonas palustris TIE-1 1 1 Rhodopseudomonas palustris DX-1 1 Rhodopseudomonas palustris BisA53 1 Rhodopseudomonas palustris BisB18 0.9 1 Rhodopseudomonas palustris HaA2 0.1 Rhodopseudomonas palustris BisB5 Nitrobacter hamburgensis X14 Nitrobacter sp. Nb-311A 0.9 0.9Nitrobacter winogradskyi Nb-255 0.9 Afipia sp. 1NLS2 0.6 Oligotropha carboxidovorans OM5 1 Methylobacterium extorquens AM1 1 Methylobacterium extorquens DSM 13060 1 0.9Methylobacterium chloromethanicum CM4 0.9 1 Methylobacterium extorquens DM4 1 0.1 Methylobacterium extorquens PA1 1 Methylobacterium populi BJ001 0.6 Methylobacterium nodulans ORS 2060 1 Methylobacterium sp. 4-46 Methylobacterium radiotolerans JCM 2831 Microvirga sp. Lut6 1 Microvirga sp. WSM3557 Beijerinckia indica indica ATCC 9039 1 Methylocella silvestris BL2 0.6 Methylocystis sp. ATCC 49242 1 Methylosinus trichosporium OB3b Azorhizobium caulinodans ORS 571 1 Xanthobacter autotrophicus Py2 1 Starkeya novella DSM 506 Hyphomicrobium denitrificans 1NES1 1 Hyphomicrobium denitrificans ATCC 51888 1 Rhodomicrobium vannielii ATCC 17100 Labrenzia alexandrii DFL-11 0.8 0.9 Stappia aggregata IAM 12614 1 Roseibium sp. TrichSKD4 1 Pseudovibrio sp. JE062 Ahrensia sp. R2A130 Phaeobacter gallaeciensis 2.10 0.9 Rhodobacterales bacterium Y4I 0.3Phaeobacter gallaeciensis BS107 1 0.8 Roseobacter sp. MED193 1 Roseobacter sp. SK209-2-6 Roseovarius nubinhibens ISM 0.20.5 Ruegeria sp. R11 Silicibacter sp. TM1040 1 0.7 1 Silicibacter sp. TrichCH4B 0.9 Rhodobacteraceae bacterium KLH11 0.8 1 0.9 Silicibacter lacuscaerulensis ITI-1157 Silicibacter pomeroyi DSS-3 Citreicella sp. SE45 0.9 1 Pelagibaca bermudensis HTCC2601 0.2 HIMB11 Sagittula stellata E-37 Roseovarius sp. 217 1 0.9 0.9 Roseovarius sp. TM1035 0.7 Roseobacter sp. AzwK-3b Sulfitobacter sp. EE-36 0.9 1 0.90.9 Sulfitobacter sp. NAS-14.1 0.9 Roseobacter sp. GAI101 0.7 Oceanibulbus indolifex HEL-45 Roseobacter denitrificans OCh 114 1 0.3 1 Roseobacter litoralis Och 149 1 1 Octadecabacter antarcticus 238 1 1 Octadecabacter antarcticus 307 0.7 0.6 1 0.4 Thalassiobium sp. R2A62 0.4 Loktanella vestfoldensis SKA53 1 Roseobacter sp. CCS2 Rhodobacterales bacterium HTCC2150 1 0.8 Rhodobacterales sp. HTCC2255 0.9 Jannaschia sp. CCS1 Rhodobacterales bacterium HTCC2083 Ketogulonicigenium vulgare Y25 Maritimibacter alkaliphilus HTCC2654 Oceanicola batsensis HTCC2597 0.6 1 Oceanicola granulosus HTCC2516 Marivita sp SSW136 Dinoroseobacter shibae DFL 12 Rhodobacter sphaeroides 2.4.1 0.9Rhodobacter sphaeroides ATCC 17029 0.9 Rhodobacter sphaeroides KD131 0.9 Rhodobacter sphaeroides ATCC 17025 1 IMCC1702 0.9 Rhodobacter sp. SW2 Rhodobacter capsulatus SB1003 Paracoccus denitrificans PD1222 Hirschia baltica ATCC 49814 0.9 Hyphomonas neptunium ATCC 15444 1 Maricaulis maris MCS10 Parvibaculum lavamentivorans DS-1 1 Parvularcula bermudensis HTCC2503 Erythrobacter litoralis HTCC2594 0.8 Erythrobacter sp. NAP1 1 1 Citromicrobium bathyomarinum JL354 0.7 Altererythrobacter sp. IMCC5003 0.9 1 Altererythrobacter sp. KYW2 0.2 Sphingopyxis alaskensis RB2256 Novosphingobium aromaticivorans DSM 12444 1 Zymomonas mobilis mobilis ZM4 0.8Zymomonas mobilis subsp. mobilis ATCC 10988 1 Zymomonas mobilis subsp. mobilis NCIMB 11163 Sphingobium chlorophenolicum L-1 1 Sphingobium japonicum UT26S 1 0.8 0.8 Sphingomonas sp. SKA58 Sphingomonas wittichii RW1 Brevundimonas aveniformis DSM 17977 0.1 Brevundimonas subvibrioides ATCC 15264 0.9 Brevundimonas sp. BAL3 0.1 Brevundimonas diminuta ATCC11568 0.9 Brevundimonas naejangsanensis DSM 23858 0.3 1 Caulobacter crescentus CB15 0.9 Caulobacter segnis ATCC 21756 1 1 Caulobacter crescentus NA1000 Caulobacter sp. K31 Asticcacaulis excentricus CB 48 Anaplasma marginale St. Maries Anaplasma marginale str. Mississippi 0.9Anaplasma marginale str. Virginia 1 Anaplasma marginale Florida 1 Anaplasma marginale str. Puerto Rico Anaplasma centrale str. Israel 1 Anaplasma phagocytophilum HZ Ehrlichia chaffeensis Arkansas Ehrlichia chaffeensis Sapulpa 1 0.9 1 Ehrlichia canis Jake 1 Ehrlichia ruminantium Gardel Wolbachia endosymbiont of Drosophila ananassae 1 Wolbachia sp. wRi Wolbachia endosymbiont of Drosophila melanogaster 1 Wolbachia endosymbiont of Culex quinquefasciatus JHB 1 Wolbachia pipientis wPip 0.7 Wolbachia endosymbiont TRS of Brugia malayi Neorickettsia risticii str. Illinois 1 1 Neorickettsia sennetsu Miyayama Rickettsia rickettsii Iowa 0.8Rickettsia rickettsii Sheila Smith 0.9Rickettsia peacockii str. Rustic 0.8Rickettsia conorii Malish 7 0.40 0.8Rickettsia sibirica 246 0.7 Rickettsia africae ESF-5 0.3 Rickettsia massiliae MTU5 0.4 1 Rickettsia prowazekii Madrid E 0.9Rickettsia prowazekii Rp22 1 1 Rickettsia typhi Wilmington Rickettsia akari Hartford 0.9Rickettsia felis URRWXCal2 Rickettsia canadensis McKiel Rickettsia bellii OSU 85-389 0.8Rickettsia bellii RML369-C 0.9 Orientia tsutsugamushi Boryong 1 Orientia tsutsugamushi Ikeda Candidatus Pelagibacter ubique HTCC1002 0.8Candidatus Pelagibacter ubique HTCC1062 0.5Candidatus Pelagibacter ubique SAR11 HTCC9565 1 Alphaproteobacteria sp. SAR11 HIMB5 1 0.1 Candidatus Pelagibacter sp HTCC7211 SAR11 group Ib 1 1 SAR193 group Ib alpha proteobacterium SCGC AAA288-G21 1 Unc54443 1 1 0.6 alpha proteobacterium SCGC AAA288-N07 1 AAA240-E13 group Ic 0.2 AAA288-E13 group Ic SAR203 0.2 SAR220 1 Arctic96AD-8 0.1 1 0.8 Arctic95B-1 group II 0.9 1 SAR211 group II Candidatus Pelagibacter sp. IMCC9063 1 OM155 group IIIa 1 alpha proteobacterium sp. SAR11 HIMB114 AAA028-D10 0.9LD12 group IIIb 1 1 Cand Pelagibacter sp Nan172 1 0.21 S9D-28 group IIIb 0.6LSUCC0530 1 AAA280-B11 AAA024-N17 AAA027-C06 0.8AAA280-P20 UncMa833 alpha proteobacterium sp. HIMB59 1 UncMa812 Acetobacter pasteurianus IFO 3283-03 Acetobacter pasteurianus IFO 3283-07 Acetobacter pasteurianus IFO 3283-12 1 Acetobacter pasteurianus IFO 3283-22 1 1 Acetobacter pasteurianus IFO 3283-26 1 Acetobacter pasteurianus IFO 3283-32 1 1 Acetobacter pasteurianus IFO 3283-01-42C 0.9 Acetobacter pasteurianus IFO 3283-01 Gluconobacter oxydans 621H Gluconacetobacter diazotrophicus PAl 5 0.5 Granulobacter bethesdensis CGDNIH1 Acidiphilium cryptum JF-5 Uncult bacterium clone B-123 1 Uncult bacterium clone BP2 Magnetospirillum magneticum AMB-1 1 Magnetospirillum magnetotacticum MS-1 0.5 Rhodospirillum rubrum ATCC 11170 0 0.8 Azospirillum sp. B510 1 Rhodospirillum centenum SW Candidatus Puniceispirillum marinum IMCC1322 1 Nisaea sp. BAL199 Escherichia coli K12 DH10B 1 Vibrio vulnificus YJ016 1 Pasteurella multocida multocida Pm70 1 1 Chromobacterium violaceum ATCC 12472 1 Ralstonia solanacearum GMI1000 Geobacter metallireducens GS-15 0.9 Magnetococcus sp. MC-1 SAR11 intergenic spacer distribution 2000 1500 length 1000 500 0

IIIa IIIb 60 70 80 90 100 A strain LSUCC0530 Feitsui Reservoir-July2007 Genome Size=1.16mbp B strain LSUCC0530 Lake Gatun Genome Size=1.16mbp Candidatus Pelagibacter ubique HTCC1040 Candidatus Pelagibacter ubique SAR11 HTCC1013 0.30.9 Candidatus Pelagibacter ubique HTCC1002 0.8Candidatus Pelagibacter ubique HTCC1062 1 0.9 Candidatus Pelagibacter ubique SAR11 HTCC9565 0.6 Candidatus Pelagibacter ubique HTCC1016 0.7 0.7 Pelagibacteraceae bacterium BACL20 MAG-120920-bin64 0.8 SAR11 cluster bacterium JGI GoM 375m 188 A02 0.9 Alphaproteobacteria sp SAR11 HIMB5 0.5 Candidatus Pelagibacter sp HIMB1321 1 Candidatus Pelagibacter-like SAR11 HIMB4 1 0.9 SAR11 cluster bacterium JGI GoM 1m 182 G01 SAR11 cluster bacterium JGI GoM 1m 182 F07 Candidatus Pelagibacter sp HTCC7211 Candidatus Pelagibacter ubique HTCC7217 1 Candidatus Pelagibacter ubique HTCC7214 0.8 Pelagibacteraceae bacterium BACL5 MAG-121015-bin10 1 Candidatus Pelagibacter sp HIMB122 0.9 Candidatus Pelagibacter-like SAR11 HIMB140 0.7 Candidatus Pelagibacter-like SAR11 HIMB083 1 Candidatus Pelagibacter ubique SAR11 HTCC8051 1 Candidatus Pelagibacter ubique SAR11 HTCC9022 alpha proteobacterium SCGC AAA288-E13 0.90.8alpha proteobacterium SCGC AAA288-N07 0.7 alpha proteobacterium SCGC AAA288-G21 0.9 1 SAR11 cluster bacterium JGI GoM 375m 188 D08 alpha proteobacterium SCGC AAA240-E13 1 SAR11 cluster bacterium JGI GoM 1470m 185 D04 SAR11 cluster bacterium JGI GoM 375m 188 H08 1 uncultured marine microorganism HF4000 097M14 0.7 SAR11 cluster bacterium JGI ETNP 125m 186 C10 Actinobacteria bacterium BACL4 MAG-120813-bin39 1 alpha proteobacterium QL1 1 Candidatus Fonsibacter ubiquis LSUCC0530 Reanalysis Geobacillus kaustophilus GBlys Geobacillus sp WSUCF1 1 Geobacillus sp C56-T3 0.20 Geobacillus vulcani 1 Geobacillus thermoleovorans 0.3 Geobacillus thermoleovorans CCB US3 UF5 0.9 Geobacillus kaustophilus Geobacillus sp 12AMOR1 0.90.8Geobacillus sp CAMR5420 0.5 Geobacillus icigianus 0.4 Geobacillus sp JF8 0.9Geobacillus subterraneus Geobacillus caldoxylosilyticus 0.8 Geobacillus stearothermophilus 0.50.90.90.9 Geobacillus thermoglucosidasius Geobacillus sp WCH70 Anoxybacillus sp ATCC BAA-2555 0.5 Anoxybacillus tepidamans Anoxybacillus gonensis 0 Anoxybacillus sp DT3-1 0.9Anoxybacillus ayderensis 0.9 1 0.80 Anoxybacillus thermarum 0.9 1 Anoxybacillus sp KU2-611 0.9 0.5 Anoxybacillus suryakundensis Anoxybacillus sp SK3-4 Anoxybacillus flavithermus Bacillus alveayuensis Bacillus koreensis 0.6 Bacillus azotoformans Bacillus azotoformans MEV2011 0.5 1 Bacillus sp ZYK 0.60.7 Bacillus timonensis Salsuginibacillus kocurii Planomicrobium sp ES2 0.8 0.8 Bacillus bataviensis 1 0.60.8 0.3 Bacillus rubiinfantis 0.90.5 Bacillus sp X12014 0.9 Bacillus sp LF1 Bacillus massiliosenegalensis Oceanobacillus iheyensis 1 Oceanobacillus kimchii Bacillus clausii Aneurinibacillus sp XH2 Bacillus mannanilyticus Caldalkalibacillus thermarum Brevibacillus brevis 0.9 Brevibacillus sp Leaf182 0.80.8Brevibacillus formosus 0.9 1 Bacillus sp FJAT-27238 Brevibacillus reuszeri Effusibacillus pohliae 1 Chloroflexus aggregans Chloroflexus aggregans DSM 9485 0.5 1 Chloroflexus 0.2Chloroflexus aurantiacus J-10-fl bacterium JKG1 Paenibacillus alginolyticus 1 0.9 Paenibacillus sp Root444D2 1 Paenibacillus sp Soil787 0.9 Paenibacillus naphthalenovorans 0.9 Paenibacillus larvae Paenibacillus elgii 1 0.9 Paenibacillus sp A3 1 Paenibacillus ehimensis Paenibacillus dendritiformis 1 Paenibacillus popilliae 0.9 Cohnella sp VKM B-2846 0.9 Paenibacillus darwinianus Oscillochloris trichoides 0.01 Oscillochloris trichoides DG-6 Bacillus bataviensis 0.4 Bacillus rubiinfantis 1 Bacillus sp FF4 0.8 Bacillus selenatarsenatis 0.21 1 Bacillus sp 17376 Bacillus smithii 0.1 Bacillus sp FJAT-27916 0.9 Bacillus sp SIT10 Bacillus cereus 0.9 0.8Bacillus mycoides 0.90.9Bacillus sp UNC437CL72CviS29 1 0.9 Bacillus sp FJAT-13831 0.9 Bacillus cytotoxicus 0.9 Bacillus sp UNC322MFChir41 Planococcus donghaensis 1 Planococcus rifietoensis 1 Bhargavaea cecembensis 0.7 Sporosarcina koreensis Bacillus okhensis 1 Bacillus wakoensis 0.9 Bacillus ligniniphilus 0.70.4 Clostridium 1 1 Thermicanus aegyptius 1 Fictibacillus gelatini bacterium JKG1 1 Thermogemmatispora carboxidivorans 0.2 Aneurinibacillus aneurinilyticus 1 Aneurinibacillus migulanus 0.8 10.9 Aneurinibacillus terranovensis 0.3 Aneurinibacillus sp XH2 0.7 Caldalkalibacillus thermarum 0.5 Effusibacillus pohliae Aeribacillus pallidus 0.9 1 Brevibacillus thermoruber 0.9 Alicyclobacillus hesperidum 0.4 1 Alicyclobacillus tengchongensis 1 1 Alicyclobacillus acidocaldarius 1 Alicyclobacillus macrosporangiidus 1 Alicyclobacillus ferrooxydans Kyrpidia tusciae 1 Kyrpidia tusciae DSM 2912 0.1 Alicyclobacillus herbarius Alicyclobacillus contaminans 1 Alicyclobacillus pomorum 0.51 Acidobacteria bacterium KBS 146 1 Acidobacteriaceae bacterium TAA166 0.8 0.9 Terriglobus saanensis 0.51 Acidobacteriaceae bacterium KBS 83 Acidobacteriaceae bacterium KBS 89 10 0.9 1 Reyranella massiliensis Herpetosiphon aurantiacus DSM 785 1 Herpetosiphon geysericola Pedosphaera parvula Beggiatoa alba 1 Beggiatoa leptomitiformis 1 Gammaproteobacteria bacterium SG8 31 Chloroflexus sp MS-G 1 Chloroflexus sp Y-396-1 10.4Chloroflexus aggregans 1 Chloroflexus aurantiacus J-10-fl Oscillochloris trichoides 1 Betaproteobacteria bacterium SG8 39 1 Burkholderia sp 0.3 Betaproteobacteria bacterium SG8 40 0.6 Ferrovum sp JA12 Deltaproteobacteria bacterium SG8 13 0.80.4 Desulfosarcina cetonica 1 Desulfococcus multivorans Desulfatitalea tepidiphila Bosea sp UNC402CLCol 0.4Methylobacterium sp ZNC0032 11 Bosea sp Root670 0.80.9 Bosea thiooxidans Bosea sp Root483D1 1 Bosea sp WAO 1 1 Bosea sp AAP35 1 0.7 0.41 Bosea vaviloviae 0.7 Bosea sp Root381 0.9 Bosea sp Leaf344 Bosea sp LC85 Rhodovulum sp PH10 Phenylobacterium zucineum Coccomyxa subellipsoidea C-169 Chlorogloeopsis fritschii 11 cyanobacterium PCC 7702 1 Fischerella sp PCC 9605 Pleurocapsa minor Nevskia soli Saprolegnia diclina VS20 1 Saprolegnia parasitica CBS 22365 0.6 Flammeovirga sp OC4 alpha proteobacterium SCGC AAA028-C07 0.9alpha proteobacterium SCGC AAA028-D10 0.9Candidatus Fonsibacter ubiquis LSUCC0530 Reanalysis 0.1 0.90.6alpha proteobacterium SCGC AAA027-J10 0.8alpha proteobacterium SCGC AAA027-L15 alpha proteobacterium SCGC AAA280-P20 alpha proteobacterium SCGC AAA027-C06 Candidatus Pelagibacter ubique HTCC7214 0.5Candidatus Pelagibacter ubique HTCC7217 1 Candidatus Pelagibacter sp HTCC7211 1 Candidatus Pelagibacter ubique SAR11 HTCC8051 0.9Candidatus Pelagibacter ubique SAR11 HTCC9022 0.9 Candidatus Pelagibacter sp HIMB122 0.91 Candidatus Pelagibacter-like SAR11 HIMB140 0.81 Candidatus Pelagibacter-like SAR11 HIMB083 1 SAR11 cluster bacterium JGI ETNP 60m 184 G07 Alphaproteobacteria sp SAR11 HIMB5 0.51 SAR11 cluster bacterium JGI GoM 1m 182 F07 1 0.2 SAR11 cluster bacterium JGI GoM 1m 182 D02 1 SAR11 cluster bacterium JGI GoM 1m 182 G01 Candidatus Pelagibacter ubique HTCC1016 0Candidatus Pelagibacter ubique SAR11 HTCC1013 0.9 1 0.81 Candidatus Pelagibacter ubique HTCC1062 1 Candidatus Pelagibacter ubique HTCC1040 Candidatus Pelagibacter ubique HTCC1002 Candidatus Pelagibacter ubique SAR11 HTCC9565 Candidatus Pelagibacter sp HIMB1321 1 Candidatus Pelagibacter-like SAR11 HIMB4 Candidatus Pelagibacter sp IMCC9063 1 Rickettsiales sp HIMB114 alpha proteobacterium SCGC AAA240-E13 0.5alpha proteobacterium SCGC AAA288-G21 0.8 0.90.6alpha proteobacterium SCGC AAA288-E13 1 SAR11 cluster bacterium JGI GoM 375m 188 D08 0.8 SAR11 cluster bacterium JGI GoM 375m 188 H08 SAR11 cluster bacterium JGI GoM 1470m 185 D04 0.1 SAR11 cluster bacterium JGI GoM 1470m 185 E04 malate synthase (red) A 0.4 1.4 2.9

1e+07

1e+05 Replicate

2 4.68 5.8 8.7 3 1e+07 4

5 1e+05 6

11.6 23.2 34.8 8

9 1e+07 10 )

-1 1e+05

-400 0 400 -400 0 400 -400 0 400

B 5°C 12°C 23°C

Cell Count (cells mL 1e+07

1e+05 Replicate

30°C 35°C 40°C 3

1e+07 4

1e+05

-500 0 500 -500 0 500 -500 0 500 Time (Hours) 0.15 y=0.0899-0.00415x Other SAR11 R2=0.62 0.3 OTU7 (LD12) 0.10 0.05

0.00 Relative Abundance 0 10 20 Salinity 0.2

Relative Abundance 0.1

0.0 CJ (24.63) LKB (2.87) ARD (1.72) FWC (5.39) JLB2 (6.89) JLB (26.01) CJ2 (22.16) CJ3 (23.69) LKB2 (2.39) LKB3 (3.55) ARD2 (0.18) ARD3 (3.72) FWC2 (20.9) JLB3 (12.38) Tbon2 (14.2) Tbon3 (17.7) FWC3 (17.98) Environment Baltic Sea Coastal A Rivers and Lakes 85% RPKM Plot

LSUCC0530 RPKM 1 IIIb.C 20 IIIb.B 40 IIIb.A 60 B11

90% RPKM Plot B RPKM LSUCC0530 1 IIIb.C 20 IIIb.B 40 IIIb.A 60 B11

92% RPKM Plot C RPKM

LSUCC0530LD12 Micro cluster 1 IIIb.C 20 40 IIIb.B 60 IIIb.A B11

98% RPKM Plot D RPKM LSUCC0530 1 10 IIIb.C 20 IIIb.B 30 IIIb.A 40 B11

E 100% RPKM Plot

LSUCC0530 RPKM 1 IIIb.C 5 IIIb.B 10 IIIb.A 15 B11

Salinities 0-0.1 Salinities 2.9-5.75 Salinities 6.89-20.22 Salinities 23.2-34.35