DOCSLIB.ORG

Illumina Respiratory Pathogen ID/AMR Panel Table

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Illumina Respiratory Pathogen ID/AMR Panel Table Illumina Respiratory Pathogen ID/AMR Panel • Identify COVID-19 and determine viral variants and lineages Analysis powered by • Detect both DNA- and RNA-based respiratory pathogens simultaneously • Report full genome coverage of SARS-CoV-2 and Influenza A/B viruses • Profile Antimicrobial resistance (AMR) gene expression concurrently BACTERIA Achromobacter Elizabethkingia Bartonella henselae Cardiobacterium hominis Haemophilus influenzae Mycobacterium gordonae denitrificans meningoseptica Achromobacter Enterobacter cloacae Haemophilus Bartonella quintana Cardiobacterium valvarum Mycobacterium kansasii xylosoxidans complex parahaemolyticus Haemophilus Mycobacterium Acinetobacter baumannii Bordetella bronchiseptica Chlamydia pneumoniae Enterococcus faecalis parainfluenzae malmoense Mycobacterium Acinetobacter lwoffii Bordetella hinzii Chlamydia psittaci Enterococcus faecium Haemophilus pittmaniae parascrofulaceum Acinetobacter Mycobacterium Bordetella holmesii Chlamydia trachomatis Escherichia coli Hafnia alvei nosocomialis scrofulaceum Chromobacterium Acinetobacter pittii Bordetella parapertussis Eubacterium brachy Klebsiella variicola Mycobacterium szulgai violaceum Mycobacterium Actinomyces graevenitzii Bordetella pertussis Citrobacter freundii Eubacterium limosum Kytococcus sedentarius tuberculosis Actinomyces israelii Bordetella petrii Citrobacter koseri Eubacterium nodatum Leclercia adecarboxylata Mycobacterium xenopi Mycobacteroides Corynebacterium abscessus Actinomyces meyeri Brucella abortus Finegoldia magna Legionella anisa diphtheriae (Mycobacterium abscessus) Mycobacteroides chelonae Actinomyces naeslundii Brucella canis Corynebacterium jeikeium Francisella tularensis Legionella feeleii (Mycobacterium chelonae) Mycobacteroides Corynebacterium Fusobacterium immunogenum Actinomyces odontolyticus Brucella melitensis Legionella longbeachae propinquum necrophorum (Mycobacterium immunogenum) Corynebacterium Aeromonas caviae Brucella suis Fusobacterium nucleatum Legionella maceachernii Mycoplasma pneumoniae pseudodiphtheriticum Burkholderia cepacia Corynebacterium Aeromonas hydrophila Gemella haemolysans Legionella pneumophila Neisseria flavescens complex pseudotuberculosis Aeromonas sobria Burkholderia gladioli Corynebacterium striatum Gemella morbillorum Legionella wadsworthii Neisseria lactamica Aeromonas veronii Burkholderia glumae Corynebacterium ulcerans Gordonia araii Leptospira interrogans Neisseria meningitidis Aggregatibacter Burkholderia mallei Coxiella burnetii Gordonia bronchialis Leptotrichia buccalis Neisseria mucosa actinomycetemcomitans Aggregatibacter Burkholderia pseudomallei Cronobacter sakazakii Haemophilus haemolyticus Listeria monocytogenes Nocardia abscessus aphrophilus Arcanobacterium Burkholderia thailandensis Delftia acidovorans Kingella kingae Moraxella catarrhalis Nocardia arthritidis haemolyticum Klebsiella aerogenes Bacillus anthracis Campylobacter concisus Dialister pneumosintes Moraxella osloensis Nocardia beijingensis (Enterobacter aerogenes) Bacillus cereus Capnocytophaga gingivalis Dolosigranulum pigrum Klebsiella oxytoca Morganella morganii Nocardia brasiliensis Capnocytophaga Mycobacterium avium Bacillus thuringiensis Eikenella corrodens Klebsiella pneumoniae Nocardia cyriacigeorgica leadbetteri complex Capnocytophaga Klebsiella Bacteroides fragilis Elizabethkingia anophelis Mycobacterium fortuitum Nocardia farcinica sputigena quasipneumoniae For Research Use Only. Not for use in diagnostic procedures. BACTERIA, cont. Nocardia nova Pediococcus acidilactici Pseudomonas aeruginosa Serratia marcescens Streptococcus intermedius Ureaplasma urealyticum Peptostreptococcus Nocardia otitidiscaviarum Pseudomonas fluorescens Shewanella putrefaciens Streptococcus mitis Veilonella parvula anaerobius Streptococcus Nocardia transvalensis Prevotella buccae Pseudomonas stutzeri Slackia exigua Williamsia muralis pneumoniae Sphingomonas Nocardia veterana Prevotella intermedia Ralstonia pickettii Streptococcus pyogenes Yersinia enterocolitica paucimobilis Tatlockia micdadei Ochrobactrum anthropi Prevotella melaninogenica Raoultella ornithinolytica Staphylococcus aureus Yersinia pestis (Legionella micdadei) Stenotrophomonas Orientia tsutsugamushi Prevotella pleuritidis Raoultella planticola Treponema denticola maltophilia Pandoraea pulmonicola Proteus mirabilis Rhodococcus hoagii Streptococcus agalactiae Tropheryma whipplei Pantoea agglomerans Proteus penneri Rickettsia rickettsii Streptococcus anginosus Tsukamurella pulmonis Tsukamurella Parvimonas micra Proteus vulgaris Rothia mucilaginosa Streptococcus constellatus tyrosinosolvens Streptococcus Pasteurella multocida Providencia stuartii Salmonella enterica Ureaplasma parvum dysgalactiae VIRUSES Coxsackievirus A HHV6 Human Coronavirus NL63 Human parechovirus Influenza C virus Rhinovirus A Coxsackievirus B Human adenovirus B Human Coronavirus OC43 Influenza A virus (H1N1) Measles Virus Rhinovirus B MERS coronavirus (MERS- Cytomegalovirus (CMV) Human adenovirus C Human metapneumovirus Influenza A virus (H3N2) Rhinovirus C CoV) Human parainfluenza EBV Human adenovirus E Influenza A virus (H5N1) Mumps virus Rubella virus virus 1 Human parainfluenza Enterovirus A71 Human bocavirus 1 Influenza A virus (H7N9) Parvovirus B19 SARS coronavirus virus 2 Human parainfluenza Respiratory Syncytial Enterovirus D68 Human Coronavirus 229E Influenza A virus (H9N2) SARS-CoV-2 (2019-nCoV) virus 3 Virus A Herpes simplex virus 1 Human parainfluenza Respiratory Syncytial Varicella-zoster virus Human Coronavirus HKU1 Influenza B virus (HSV-1) virus 4 Virus B (HHV-3) FUNGI Lomentospora prolificans Sarocladium kiliense Alternaria alternata Blastomyces dermatitidis Curvularia lunata Pneumocystis jirovecii (Scedosporium prolificans) (Acremonium kiliense) Microascus cinereus Scedosporium Alternaria infectoria Candida auris Exophiala dermatitidis Purpureocillium lilacinum (Scopulariopsis cinereus) apiospermum Microascus cirrosus Apophysomyces elegans Cladophialophora bantiana Fusarium oxysporum Rasamsonia aegroticola Schizophyllum commune (Scopulariopsis paisii) Microasucus paisii Aspergillus flavus Coccidioides immitis Fusarium proliferatum Rasamsonia argillacea Scopulariopsis brevicaulis (Scopulariopsis brumptii) Aspergillus fumigatus Coccidioides posadasii Fusarium solani Mucor circinelloides Rhizomucor pusillus Sporothrix schenckii Syncephalastrum Aspergillus nidulans Cryptococcus gattii Fusarium verticillioides Mucor indicus Rhizopus azygosporus racemosum Aspergillus niger Cryptococcus neoformans Histoplasma capsulatum Mucor racemosus Rhizopus microsporus Talaromyces marneffei Cunninghamella Aspergillus terreus Lichtheimia corymbifera Paecilomyces variotii Rhizopus oryzae Trichosporon asahii bertholletiae Paracoccidioides Aspergillus versicolor Curvularia geniculata Lichtheimia ramosa Saksenaea vasiformis brasiliensis For Research Use Only. Not for use in diagnostic procedures. AMR markers on the Respiratory Pathogen ID/AMR Panel Gentamicin, Plazomicin, Paromomycin, Tobramycin, Streptomycin, Spectinomycin, Amikacin, Aminoglycosides Neomycin Beta-Lactam + Beta-Lactamase Amoxicillin + Clavulanic Acid, Ampicillin + Sublactam, Piperacillin + Tazobactam Inhibitor Carbapenems Ertapenem, Meropenem, Imipenem Cephalosporins (1st generaton) Cefazolin, Cefalexin Cephalosporins (2nd generaton) Cefaclor, Cefoxitin A. baumannii Cephalosporins (3rd generaton) Ceftazidime, Ceftriaxone, Cefotaxime, Cefixime E. faecalis E. faecium Cephalosporins (4th generaton Cefepime E. cloacae complex Diaminopyrimidine Trimethoprim E. coli K. pneumoniae Fluoroquinolones Ciprofloxacin, Norfloxacin, Levofloxacin, Ofloxacin, Moxifloxacin Bacteria P. aeruginosa Fosfomycin Fosfomycin S. aureus Antibacterials S. maltophilia Glycopeptides Vancomycin S. pneumoniae Lincosamides Clindamycin, Lincomycin Macrolides Clarithromycin, Azithromycin, Erythromycin Oxazolidinones Linezolid Penicillins Amoxicillin, Ampicillin, Methicillin, Oxacillin, Penicillin Polymyxins Colistin Sulfonamides Sulfamethoxazole Tetracyclines Tetracycline, Doxycycline First-line: Isoniazids Polyamine Antibiotics Isoniazid, Ethambutol, Pyrazinamide, Rifampin, Rifampicin Pyrazinamides M. tuberculosis complex Rifamycin Antibiotics M. abscessus Second-line: Ethionamides Mycobacteria Ethionamide, Para-Aminosalicylic Acid, Amikacin, Kanamycin, Streptomycin, Capreomycin, Para-Aminosalicylic Acids Antimycobacterials Ciprofloxacin, Levofloxacin, Moxifloxacin, Norfloxacin, Ofloxacin Aminoglycosides Fluoroquinolones Influenza A (H1N1) Neuraminidase Inhibitors Oseltamivir, Zanamivir, Peramivir, Laninamivir Influenza A (H3N2) Influenza A (H5N1) Viruses Endonuclease Inhibitors Baloxavir Influenza A H7N9) Antivirals Learn more For more information, visit www.illumina.com/products/by-type/sequencing-kits/library-prep-kits/respiratory-pathogen-id-panel.html To learn more about SARS-CoV-2 variant analysis with the Explify Respiratory Pathogen ID/AMR Panel Data Analysis Solution, see www.idbydna.com/rpipvariantsflyer Explore the IDbyDNA Explify Platform at www.idbydna.com/explify-platform/ Illumina • 1.800.809.4566 toll-free (US) • +1.858.202.4566 tel • [email protected] • www.illumina.com © 2021 Illumina, Inc. All rights reserved. All trademarks are the property of Illumina, Inc. or their respective owners. For specific trademark information, see www.illumina.com/company/legal.html. M-GL-00115 v1.0 For Research Use Only. Not for use in diagnostic procedures..
Load more

Recommended publications
  • BD-CS-057, REV 0 | AUGUST 2017 | Page 1
    EXPLIFY RESPIRATORY PATHOGENS BY NEXT GENERATION SEQUENCING Limitations Negative results do not rule out viral, bacterial, or fungal infections. Targeted, PCR-based tests are generally more sensitive and are preferred when specific pathogens are suspected, especially for DNA viruses (Adenovirus, CMV, HHV6, HSV, and VZV), mycobacteria, and fungi. The analytical sensitivity of this test depends on the cellularity of the sample and the concentration of all microbes present. Analytical sensitivity is assessed using Internal Controls that are added to each sample. Sequencing data for Internal Controls is quantified. Samples with Internal Control values below the validated minimum may have reduced analytical sensitivity or contain inhibitors and are reported as ‘Reduced Analytical Sensitivity’. Additional respiratory pathogens to those reported cannot be excluded in samples with ‘Reduced Analytical Sensitivity’. Due to the complexity of next generation sequencing methodologies, there may be a risk of false-positive results. Contamination with organisms from the upper respiratory tract during specimen collection can also occur. The detection of viral, bacterial, and fungal nucleic acid does not imply organisms causing invasive infection. Results from this test need to be interpreted in conjunction with the clinical history, results of other laboratory tests, epidemiologic information, and other available data. Confirmation of positive results by an alternate method may be indicated in select cases. Validated Organisms BACTERIA Achromobacter
    [Show full text]
  • Genetic Diversity of Bartonella Species in Small Mammals in the Qaidam
    www.nature.com/scientificreports OPEN Genetic diversity of Bartonella species in small mammals in the Qaidam Basin, western China Huaxiang Rao1, Shoujiang Li3, Liang Lu4, Rong Wang3, Xiuping Song4, Kai Sun5, Yan Shi3, Dongmei Li4* & Juan Yu2* Investigation of the prevalence and diversity of Bartonella infections in small mammals in the Qaidam Basin, western China, could provide a scientifc basis for the control and prevention of Bartonella infections in humans. Accordingly, in this study, small mammals were captured using snap traps in Wulan County and Ge’ermu City, Qaidam Basin, China. Spleen and brain tissues were collected and cultured to isolate Bartonella strains. The suspected positive colonies were detected with polymerase chain reaction amplifcation and sequencing of gltA, ftsZ, RNA polymerase beta subunit (rpoB) and ribC genes. Among 101 small mammals, 39 were positive for Bartonella, with the infection rate of 38.61%. The infection rate in diferent tissues (spleens and brains) (χ2 = 0.112, P = 0.738) and gender (χ2 = 1.927, P = 0.165) of small mammals did not have statistical diference, but that in diferent habitats had statistical diference (χ2 = 10.361, P = 0.016). Through genetic evolution analysis, 40 Bartonella strains were identifed (two diferent Bartonella species were detected in one small mammal), including B. grahamii (30), B. jaculi (3), B. krasnovii (3) and Candidatus B. gerbillinarum (4), which showed rodent-specifc characteristics. B. grahamii was the dominant epidemic strain (accounted for 75.0%). Furthermore, phylogenetic analysis showed that B. grahamii in the Qaidam Basin, might be close to the strains isolated from Japan and China.
    [Show full text]
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Phenotypic and Genomic Analyses of Burkholderia Stabilis Clinical Contamination, Switzerland Helena M.B
    RESEARCH Phenotypic and Genomic Analyses of Burkholderia stabilis Clinical Contamination, Switzerland Helena M.B. Seth-Smith, Carlo Casanova, Rami Sommerstein, Dominik M. Meinel,1 Mohamed M.H. Abdelbary,2 Dominique S. Blanc, Sara Droz, Urs Führer, Reto Lienhard, Claudia Lang, Olivier Dubuis, Matthias Schlegel, Andreas Widmer, Peter M. Keller,3 Jonas Marschall, Adrian Egli A recent hospital outbreak related to premoistened gloves pathogens that generally fall within the B. cepacia com- used to wash patients exposed the difficulties of defining plex (Bcc) (1). Burkholderia bacteria have large, flexible, Burkholderia species in clinical settings. The outbreak strain multi-replicon genomes, a large metabolic repertoire, vari- displayed key B. stabilis phenotypes, including the inabil- ous virulence factors, and inherent resistance to many anti- ity to grow at 42°C; we used whole-genome sequencing to microbial drugs (2,3). confirm the pathogen was B. stabilis. The outbreak strain An outbreak of B. stabilis was identified among hos- genome comprises 3 chromosomes and a plasmid, shar- ing an average nucleotide identity of 98.4% with B. stabilis pitalized patients across several cantons in Switzerland ATCC27515 BAA-67, but with 13% novel coding sequenc- during 2015–2016 (4). The bacterium caused bloodstream es. The genome lacks identifiable virulence factors and has infections, noninvasive infections, and wound contamina- no apparent increase in encoded antimicrobial drug resis- tions. The source of the infection was traced to contaminat- tance, few insertion sequences, and few pseudogenes, ed commercially available, premoistened washing gloves suggesting this outbreak was an opportunistic infection by used for bedridden patients. After hospitals discontinued an environmental strain not adapted to human pathogenic- use of these gloves, the outbreak resolved.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]
  • Bartonella Henselae • Fleas and Black-Legged Ticks (Also Called Deer Ticks) of the Genus Ixodes May Serve As Vectors, but This Has Not Disease Agent: Been Proven
    APPENDIX 2 Bartonella henselae • Fleas and black-legged ticks (also called deer ticks) of the genus Ixodes may serve as vectors, but this has not Disease Agent: been proven. • Bartonella henselae Blood Phase: Disease Agent Characteristics: • Agent found in endothelial cells and associated with RBCs in symptomatic cases • Gram-negative bacillus or coccobacillus, aerobic, • Occult bacteremia sometimes occurs in the absence nonmotile, nonspore-forming, facultatively intracel- of specific antibodies. lular bacterium • Order: Rhizobiales; Family: Bartonellaceae Survival/Persistence in Blood Products: • Size: 0.3-0.6 ¥ 0.3-1.0 mm • Nucleic acid: Approximately 1900 kb of DNA • A spiking study suggests that B. henselae added to RBCs can be recovered on solid media through 35 Disease Name: days of storage at 4°C. • Cat scratch disease • Cat scratch fever Transmission by Blood Transfusion: • Bacillary angiomatosis • Theoretical • Bacillary peliosis Cases/Frequency in Population: Priority Level: • 22,000 cases per year estimated in the US • Scientific/Epidemiologic evidence regarding blood • 2-6% in US blood donors safety: Theoretical • Cumulative seroprevalence of 7.1% to B. henselae and • Public perception and/or regulatory concern regard- B. quintana in US veterinary professionals ing blood safety: Absent • Public concern regarding disease agent: Very low Incubation Period: Background: • 3-10 days to appearance of papule at inoculation site; regional adenopathy may follow after a few weeks • In 1909,ALBartondescribed organisms that adhered to RBCs. Likelihood of Clinical Disease: • The name Bartonella bacilliformis was used for the • Relatively benign and self-limiting, lasting 6-12 weeks only member of the group identified before 1993. in the absence of antibiotic therapy • Several other species of Bartonella are known to infect humans, but at present, B.
    [Show full text]
  • Leprae by Means of Cytoplasmic Antigens
    Bull. Org. mond. Santt 1972, 46, 509-513 Bull. Wld Hlth Org. Immunological determination of Mycobacterium leprae by means of cytoplasmic antigens J. B. G. KWAPINSKI,1 J. 0. DE ALMEIDA,2 & E. H. KWAPINSKI 3 Mycobacterium leprae was isolated and purified from lepromas, the spleen, and the liver of leprosy patients. An immunodiffusion analysis of the cytoplasms obtained from four lots of M. leprae and M. lepraemurium, 295 strains of different actinomycetales, and 12 other bacteria was performed with the use ofthe cytoplasm antisera. Immunological relationships were revealed between the cytoplasms of M. leprae, M. lepraemurium, M. avium, M. gallinarum, M. tuberculosis, M. simiae, M. kansasii, M. chitae, M. cap- sulatum, Actinomyces israelii, A. naeslundii, and some strains of saprophytic myco- bacteria. These studies led to the proposed concept of the immunological evolution of M. leprae and M. lepraemurium and an Actinomyces-like progenitor through M. avium- M. gallinarum and to a proposal for the polyvalent vaccine currently being developed by this research group. Most of the past immunological research on lep- help to elucidate the immunogenicity of M. leprae rosy dealt with the skin or serum reactions of leprosy and would be useful for the preparation of an anti- patients with different mycobacterial antigen prepa- leprosy vaccine. rations. Almost all of these data were critically re- viewed by Bechelli (1971) and by de Almeida.4 More recently, the cross-reactions given by polysaccharide- MATERIALS AND METHODS protein complexes purified from M. leprae with the Sources of M. leprae and M. lepraemurium sera obtained from human leprosy, tuberculosis, and nocardiosis were revealed by Estrada-Parra (1970).
    [Show full text]
  • Delineation of Aeromonas Hydrophila Pathotypes by Dectection of Putative Virulence Factors Using Polymerase Chain Reaction and N
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by DigitalCommons@Kennesaw State University Kennesaw State University DigitalCommons@Kennesaw State University Master of Science in Integrative Biology Theses Biology & Physics Summer 7-20-2015 Delineation of Aeromonas hydrophila Pathotypes by Dectection of Putative Virulence Factors using Polymerase Chain Reaction and Nematode Challenge Assay John Metz Kennesaw State University, [email protected] Follow this and additional works at: http://digitalcommons.kennesaw.edu/integrbiol_etd Part of the Integrative Biology Commons Recommended Citation Metz, John, "Delineation of Aeromonas hydrophila Pathotypes by Dectection of Putative Virulence Factors using Polymerase Chain Reaction and Nematode Challenge Assay" (2015). Master of Science in Integrative Biology Theses. Paper 7. This Thesis is brought to you for free and open access by the Biology & Physics at DigitalCommons@Kennesaw State University. It has been accepted for inclusion in Master of Science in Integrative Biology Theses by an authorized administrator of DigitalCommons@Kennesaw State University. For more information, please contact [email protected]. Delineation of Aeromonas hydrophila Pathotypes by Detection of Putative Virulence Factors using Polymerase Chain Reaction and Nematode Challenge Assay John Michael Metz Submitted in partial fulfillment of the requirements for the Master of Science Degree in Integrative Biology Thesis Advisor: Donald J. McGarey, Ph.D Department of Molecular and Cellular Biology Kennesaw State University ABSTRACT Aeromonas hydrophila is a Gram-negative, bacterial pathogen of humans and other vertebrates. Human diseases caused by A. hydrophila range from mild gastroenteritis to soft tissue infections including cellulitis and acute necrotizing fasciitis. When seen in fish it causes dermal ulcers and fatal septicemia, which are detrimental to aquaculture stocks and has major economic impact to the industry.
    [Show full text]
  • Phylogenomic Networks Reveal Limited Phylogenetic Range of Lateral Gene Transfer by Transduction
    The ISME Journal (2017) 11, 543–554 OPEN © 2017 International Society for Microbial Ecology All rights reserved 1751-7362/17 www.nature.com/ismej ORIGINAL ARTICLE Phylogenomic networks reveal limited phylogenetic range of lateral gene transfer by transduction Ovidiu Popa1, Giddy Landan and Tal Dagan Institute of General Microbiology, Christian-Albrechts University of Kiel, Kiel, Germany Bacteriophages are recognized DNA vectors and transduction is considered as a common mechanism of lateral gene transfer (LGT) during microbial evolution. Anecdotal events of phage- mediated gene transfer were studied extensively, however, a coherent evolutionary viewpoint of LGT by transduction, its extent and characteristics, is still lacking. Here we report a large-scale evolutionary reconstruction of transduction events in 3982 genomes. We inferred 17 158 recent transduction events linking donors, phages and recipients into a phylogenomic transduction network view. We find that LGT by transduction is mostly restricted to closely related donors and recipients. Furthermore, a substantial number of the transduction events (9%) are best described as gene duplications that are mediated by mobile DNA vectors. We propose to distinguish this type of paralogy by the term autology. A comparison of donor and recipient genomes revealed that genome similarity is a superior predictor of species connectivity in the network in comparison to common habitat. This indicates that genetic similarity, rather than ecological opportunity, is a driver of successful transduction during microbial evolution. A striking difference in the connectivity pattern of donors and recipients shows that while lysogenic interactions are highly species-specific, the host range for lytic phage infections can be much wider, serving to connect dense clusters of closely related species.
    [Show full text]
  • Bartonella Henselae Detected in Malignant Melanoma, a Preliminary Study
    pathogens Article Bartonella henselae Detected in Malignant Melanoma, a Preliminary Study Marna E. Ericson 1, Edward B. Breitschwerdt 2 , Paul Reicherter 3, Cole Maxwell 4, Ricardo G. Maggi 2, Richard G. Melvin 5 , Azar H. Maluki 4,6 , Julie M. Bradley 2, Jennifer C. Miller 7, Glenn E. Simmons, Jr. 5 , Jamie Dencklau 4, Keaton Joppru 5, Jack Peterson 4, Will Bae 4, Janet Scanlon 4 and Lynne T. Bemis 5,* 1 T Lab Inc., 910 Clopper Road, Suite 220S, Gaithersburg, MD 20878, USA; [email protected] 2 Intracellular Pathogens Research Laboratory, Comparative Medicine Institute, College of Veterinary Medicine, North Carolina State University, Raleigh, NC 27607, USA; [email protected] (E.B.B.); [email protected] (R.G.M.); [email protected] (J.M.B.) 3 Dermatology Clinic, Truman Medical Center, University of Missouri, Kansas City, MO 64108, USA; [email protected] 4 Department of Dermatology, University of Minnesota, Minneapolis, MN 55455, USA; [email protected] (C.M.); [email protected] (A.H.M.); [email protected] (J.D.); [email protected] (J.P.); [email protected] (W.B.); [email protected] (J.S.) 5 Department of Biomedical Sciences, Duluth Campus, Medical School, University of Minnesota, Duluth, MN 55812, USA; [email protected] (R.G.M.); [email protected] (G.E.S.J.); [email protected] (K.J.) 6 Department of Dermatology, College of Medicine, University of Kufa, Kufa 54003, Iraq 7 Galaxy Diagnostics Inc., Research Triangle Park, NC 27709, USA; [email protected] Citation: Ericson, M.E.; * Correspondence: [email protected]; Tel.: +1-720-560-0278; Fax: +1-218-726-7906 Breitschwerdt, E.B.; Reicherter, P.; Maxwell, C.; Maggi, R.G.; Melvin, Abstract: Bartonella bacilliformis (B.
    [Show full text]
  • Experimental Infection of Aeromonas Hydrophila in Pangasius J Sarker1, MAR Faruk*
    Progressive Agriculture 27 (3): 392-399, 2016 ISSN: 1017 - 8139 Experimental infection of Aeromonas hydrophila in pangasius J Sarker1, MAR Faruk* Department of Aquaculture, Bangladesh Agricultural University, Mymensingh 2202, Bangladesh, 1Department of Aquaculture, Chittagong Veterinary and Animal Sciences University, Khulshi, Chittagong, Bangladesh Abstract Experimental infections of Aeromonas hydrophila in juvenile pangasius (Pangasianodon hypophthalmus) were studied. Five different challenge routes included intraperitoneal (IP) injection, intramuscular (IM) injection, oral administration, bath and agar implantation were used with different preparations of the bacteria to infect fish. The challenge experiments were continued for 15 days. A challenge dose of 4.6×106 colony forming unit (cfu) fish-1 was used for IP and IM injection and oral administration method. Generally, IP route was found more effective for infecting and reproducing clinical signs in fish that caused 100% mortality at the end of challenge. IM injection, oral and bath administration routes were also found effective for infecting and reproducing the clinical signs in fish to some extent. Agar implantation with fresh colonies of bacteria also caused 100% mortality of challenged fish very quickly with no visible clinical signs in fish. The major clinical signs of challenged fish included reddening around eyes and mouth, bilateral exophthalmia, hemorrhage and ulceration at fin bases and fin erosion. Key words: Experimental infection, Aeromonas hydrophila, pangasius Progressive Agriculturists. All rights reserve *Corresponding Author: [email protected] Introduction Bacterial diseases are the most common infectious fishes in different locations of Bangladesh (Rahman problem of commercial fish farms causing much and Chowdhury, 1996; Sarker et al., 2000; Alam, mortality. Among the bacterial genera, Aeromonas spp.
    [Show full text]