Bacterial Diversity Within the Human Subgingival Crevice
Total Page：16
File Type：pdf, Size：1020Kb
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln U.S. Department of Veterans Affairs Staff Publications U.S. Department of Veterans Affairs 12-7-1999 Bacterial diversity within the human subgingival crevice Ian Kroes Stanford University School of Medicine Paul W. Lepp Stanford University School of Medicine, [email protected] David A. Relman Stanford University School of Medicine, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/veterans Kroes, Ian; Lepp, Paul W.; and Relman, David A., "Bacterial diversity within the human subgingival crevice" (1999). U.S. Department of Veterans Affairs Staff Publications. 18. https://digitalcommons.unl.edu/veterans/18 This Article is brought to you for free and open access by the U.S. Department of Veterans Affairs at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in U.S. Department of Veterans Affairs Staff Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Bacterialdiversity within the human subgingivalcrevice Ian Kroes, Paul W. Lepp, and David A. Relman* Departmentsof Microbiologyand Immunology,and Medicine,Stanford University School of Medicine,Stanford, CA 94305, and VeteransAffairs Palo Alto HealthCare System, Palo Alto,CA 94304 Editedby Stanley Falkow, Stanford University, Stanford, CA, and approvedOctober 15, 1999(received for review August 2, 1999) Molecular, sequence-based environmental surveys of microorgan- associated with disease (9-11). However, a directcomparison isms have revealed a large degree of previously uncharacterized between cultivation-dependentand -independentmethods has diversity. However, nearly all studies of the human endogenous not been described. In this study,we characterizedbacterial bacterial flora have relied on cultivation and biochemical charac- diversitywithin a specimenfrom the humansubgingival crevice terization of the resident organisms. We used molecular methods byusing both methods. Our resultsreveal a significantlybroader to characterize the breadth of bacterial diversitywithin the human diversityof bacterial16S rDNA sequence types(phylotypes) by subgingival crevice by comparing 264 small subunit rDNA se- using the cultivation-independentapproach, although each quences from 21 clone libraries created with products amplified method identifiedpreviously uncharacterized phylotypes and directlyfrom subgingival plaque, with sequences obtained from should be viewed as complementary. bacteria that were cultivated from the same specimen, as well as with sequences available in public databases. The majority(52.5%) Materialsand Methods of the directlyamplified 16S rRNAsequences were <99% identical SpecimenCollection. Subgingival plaque was collected fromthe to sequences within public databases. In contrast, only 21.4% of mesial surfaceof tooth 3 and the mesial and distal surfacesof the sequences recovered from cultivated bacteria showed this tooth30 of a 39-year-oldCaucasian male, in accordance witha degree of variability.The 16S rDNA sequences recovered by direct protocol approved by the StanfordAdministrative Panel on amplification were also more deeply divergent; 13.5% of the Human Subjects in Medical Research. The subjectwas a non- amplified sequences were more than 5% nonidentical to any smokerwith mild gingivitis and no recordof antibioticuse during known sequence, a level of dissimilarity that is often found the previous3 months.The plaque materialwas dispersedin 1.3 between members of differentgenera. None of the cultivated ml of reduced Treponeme broth(Anaerobe Systems,San Jose, sequences exhibited this degree of sequence dissimilarity.Finally, CA). The vial was flushedwith an anaerobic gas mixture(80% k2 directamplification of 16S rDNAyielded a more diverse view of the N/10% H2/10% CO2) and was maintainedon ice for1 hrbefore 0 subgingival bacterial flora than did cultivation. Our data suggest processing. -j do that a significantproportion of the resident human bacterial flora a remain poorly characterized, even within this well studied and Cultivationand PhenotypicAnalysis of Bacteriafrom Subgingival 2 familiar microbial environment. Specimen.The plaque suspensionwas diluted 1:2 and 1:20 in reduced Treponeme broth.A 100-,ulaliquot of the 1:2 dilution The endogenousbacterial flora in man is thoughtto playa role was examinedby dark field microscopyimmediately and after in nutrition,carcinogenesis, and resistanceto colonizationby 24-hrincubation for the presence of spirochetes.The diluted pathogens,and to harborpotential opportunistic pathogens (1). An sampleswere used to inoculate a wide range of routineclinical accurate understandingof these roles, and the nature of the microbiologicalmedia (see supplementalmaterial on the PNAS interactionsamong and betweenindividual members and thehost, web site,www.pnas.org). Isolates were chosen forfurther char- requires as a firststep knowledgeof the compositionof the acterizationbased on differencesin colonymorphology and were microbialcommunity. Many studiesof environmentalmicrobial identifiedby using routineclinical microbiologicalassays (see communitieshave demonstratedthe limitationsof cultivation- supplementalmaterial). dependentmethods in determiningcommunity composition. En- vironmentalsurveys based on acquisitionof phylogenetically useful SpecimenDigestion and DNAExtraction. An undiluted100-,ul ali- microbialsequences (2-4) suchas thatof the 16S rRNA gene (16S quot of the suspended plaque materialwas added to an equal rDNA) have revealed a great deal of previouslyunsuspected volume of lysis buffer[400 ,ug/mlproteinase K (Boehringer bacterialand archaeal diversity.In mostinstances, the cultivated Mannheim)/2% Laureth-12 (Mazer Chemicals, Gurnee, IL)/ membersrepresent <1% of the total extantpopulation. Broad 100 mM Tris-HCl, pH 8.5/2 mM EDTA] and was incubated range small subunitrDNA PCR methods have also revealed overnightat 554C.The digestwas thensonicated for 2 minat 120 cultivation-resistantpathogens in disease settings(5). W in a bath sonicator(cell disrupterW185; Branson). One half Despite the limitationsof thisapproach, most surveysof the ofthe digested sample was purifiedand precipitatedwith phenol, human endogenous bacterial flora have relied on cultivation. chloroform,and ethanol by using standardprotocols. The re- Nonetheless,nearly 500 bacterial strainshave been recovered mainderof the digestwas centrifugedat 1,200 x g for2 min,and fromthe subgingival crevice, a particularlywell studiedmicrobial the supernatantwas used directlyin PCR. niche. Many of these strainsare thoughtto be commensals,and a smallernumber, opportunistic pathogens (6, 7). Local disease, including dental caries, gingivitis, and periodontitis, has This paper was submitted directly(Track II) to the PNAS office. promptedmost examinationsof the oral bacterialflora. These Data deposition: The sequences reported inthis paper have been deposited in the GenBank diseases are associated with changes in both local bacterial database (accession nos. AF201965-AF202029). densityand species composition(8). *To whom reprintrequests should be addressed at: Veterans AffairsPalo Alto Health Care Few efforts System 154T, 3801 Miranda Avenue, Palo Alto, CA 94304. E-mail: relman@cmgm. have been undertakento characterizehuman stanford.edu. endogenousmicrobial communities using broad-based molecu- The publication costs of this article were defrayed in part by page charge payment. This lar methods.A smallnumber of 16S rDNA sequences have been article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. characterizedafter direct amplificationfrom oral specimens ?1734 solely to indicate this fact. PNAS I December7, 1999 | vol. 96 | no. 25 | 14547-14552 Proceedings of the National Academy of Sciences of the United States of America,Vol. 96, No. 25 (Dec. 7, 1999), pp. 14547-14552 Table 1. Oligonucleotideprimers and probe Sequences with ?99% identitywere considered as a single Primers/probe* Sequence (5' -- 3') Ref. phylotype.A single representativeclone fromeach phylotype was chosen forfurther phylogenetic analysis. SDBactO338aA18t ACTCCTACGGGAGGCAGC 12 The phylogeneticassociations of all representativesequences SDBactO515aA19 GTGCCSGCMGCCGCGGTAA 13t were determinedfrom 100 bootstrappedreplicates (18) byusing SDBactO515aS19 TTACCGCGGCMGCSGGCAC 13t a maximum-likelihoodalgorithm (19). These associationswere SDBactl371 aS20 AGGCCCGGGAACGTATTCAC 14 confirmedby using a least-squares fit (20) of evolutionary SDBactl 525aS17 AAGGAGGTGATCCAGCC 15$ distances(with Jukes-Cantor correction) and byusing parsimony SDBactl 529aS17 YAKAAAGGAGGTGWTCC Thisstudy algorithms.More detailed phylogeneticanalyses based on 864 SGTrepOO08aA20 AGAGTTTGATCMTGGCTCAG 9 and 894 masked positions of Low GC Gram Positive and SGStrpl264aS22? AGAGATTAGCTTGCCGTCACCG Thisstudy Actinobacteriasequences, respectively, were performed by using the same methods.Coverage of clone librarieswas calculated *Primersand probesare namedaccording to OligonucleotideProbe Database convention(16). The namesincorporate the 5' terminalposition (E. coli 16S accordingto the methodof Good (21), and an estimateof the rRNAnumbering convention) and primerlength in nucleotides. numberof unseen species was obtained by using a parametric tOrientationindicates PCR primer sequence. Reverse complement sequence model (22). used forin situprobing. tModifiedfrom indicated reference. In SituHybridization and Enumeration.A 50-,ulaliquot