DOCSLIB.ORG

Recognized Pathogens

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Recognized Pathogens Recognized Pathogens Abiotrophia Acremonium alabamensis Aeromonas jandaei Abiotrophia adiacens Acremonium kiliense Aeromonas jandei Abiotrophia adjacens Acremonium potroni Aeromonas media Abiotrophia defectiva Acremonium potronii Aeromonas molluscorum Abiotrophia elegans Acremonium recifei Aeromonas popoffii Acanthamoeba Acremonium strictum Aeromonas punctata Acholeplasma Acrotheca aquaspersa Aeromonas salmonicida Acholeplasma laidlawii Actinobacillus Aeromonas salmonicida achromogenes Acholeplasma oculi Actinobacillus actinomycetemcomitans Aeromonas salmonicida masoucida Achromobacter Actinobacillus equuli Aeromonas salmonicida pectinolytica Achromobacter denitrificans Actinobacillus hominis Aeromonas salmonicida salmonicida Achromobacter piechaudii Actinobacillus lignieresii Aeromonas salmonicida smithia Achromobacter ruhlandii Actinobacillus pseudomallei Aeromonas schubertii Achromobacter xylosoxidans Actinobacillus suis Aeromonas shigelloides Achromobacter xylosoxidans xylosoxidans Actinobacillus ureae Aeromonas simiae Achromobacter, group Vd biotype 1 Actinobaculum Aeromonas sobria Achromobacter, group Vd biotype 2 Actinobaculum massiliae Aeromonas trota Acidaminococcus Actinobaculum massiliense Aeromonas tructi Acidaminococcus fermentans Actinobaculum schaalii Aeromonas veronii Acid‐fast bacillus Actinobaculum urinale Aeromonas veronii biovar sobria Acidovorax Actinomadura Aeromonas veronii biovar veronii Acidovorax delafieldii Actinomadura dassonvillei Afipia Acidovorax facilis Actinomadura latina Afipia clevelandensis Acidovorax temperans Actinomadura madurae Afipia felis Acinetobacter Actinomadura pelletieri Aggregatibacter Acinetobacter anitratus Actinomyces asteroides Aggregatibacter actinomycetemcomitans Acinetobacter baumannii Actinomyces brasiliensis Aggregatibacter aphrophilus Acinetobacter calcoaceticus Actinomyces gonidiaformis Aggregatibacter segnis Acinetobacter calcoaceticus anitratus Actinomyces necrophorus Agrobacterium Acinetobacter calcoaceticus lwoffi Actinomyces ramosus Agrobacterium radiobacter Acinetobacter calcoaceticus lwoffii Adenovirus Agromyces Acinetobacter calcoaceticus‐baumannii complex Aerobacter Alcaligenes Acinetobacter genospecies 3 Aerobacter aerogenes Alcaligenes bronchisepticus Acinetobacter haemolyticus Aerobacter cloacae Alcaligenes denitrificans Acinetobacter hemolyticus Aerobe Alcaligenes faecalis Acinetobacter johnsonii Aeromonas Alcaligenes odorans Acinetobacter junii Aeromonas bestiarum Alcaligenes piechaudii Acinetobacter lwoffi Aeromonas caviae Alcaligenes xylosoxidans Acinetobacter lwoffii Aeromonas caviae complex Alcaligenes xylosoxidans denitrificans Acinetobacter radioresistans Aeromonas encheleia Alcaligenes xylosoxidans xylosoxidans Acinetobacter radioresistens Aeromonas enteropelogenes Aleurisma Acinetobacter schindleri Aeromonas eucrenophila Alishewanella Acinetobacter ursingii Aeromonas eucrenophilia Alishewanella fetalis Acladium castellani Aeromonas hydrophila Alistipes Acremonium Aeromonas hydrophila complex Alistipes putredinis Recognized Pathogens Allescheria boydii Arcobacter Azospirillum Alloiococcus Arcobacter butzleri Azospirillum brasilense Alloiococcus otitis Arcobacter cryaerophilus B19 virus Alloscardovia Arcobacter nitrofigilis Babesia Alloscardovia omnicolens Arenavirus Babesia microti Alpha non‐hemolytic streptococcus Arginine positive Pseudomonas stutzeri‐like Bacillus abortus Alpha‐hemolytic streptococcus Arizona hinshawii Bacillus anthracis Alternaria Arthrobacter siderocapsulatus Bacillus violaceus Alternaria alternata Arthroderma Bacterium anitratum Alternaria dianthicola Arthrographis Bacterium lacti Alternaria infectoria Ascaris Bacteroides Alternaria tenuis Aspergillus Bacteroides bivius Alternaria tenuissima Aspergillus candidus Bacteroides buccae Alysiella Aspergillus clavatus Bacteroides buccalis Alysiella crassa Aspergillus deflectus Bacteroides caccae Amycolatopsis Aspergillus flavipes Bacteroides capillosus Amycolatopsis orientalis Aspergillus flavus Bacteroides capillus Anaerobe Aspergillus fumigatus Bacteroides clostridiiformis Anaerobic Gram‐negative bacillus Aspergillus glaucus Bacteroides coagulans Anaerobic Gram‐negative coccobacillus Aspergillus nidulans Bacteroides corporis Anaerobic Gram‐negative coccus Aspergillus niger Bacteroides denticola Anaerobic Gram‐positive bacillus Aspergillus niveus Bacteroides disiens Anaerobic Gram‐positive coccobacillus Aspergillus ochraceus Bacteroides distasonis Anaerobic Gram‐positive coccus Aspergillus oryzae Bacteroides eggerthii Anaerobiospirillum Aspergillus parasiticus Bacteroides endodontalis Anaerobiospirillum succiniciproducens Aspergillus restrictus Bacteroides fragilis Anaerobiospirillum succinoproducens Aspergillus sydowii Bacteroides fragilis a Anaerobiospirillum thomasii Aspergillus terreus Bacteroides fragilis fragilis Anaerococcus Aspergillus ustus Bacteroides fragilis group Anaerococcus hydrogenalis Aspergillus versicolor Bacteroides fragilis group 3452A Anaerococcus lactolyticus Aspergillus wentii Bacteroides fragilis ovatus Anaerococcus octavius Asterococcus laidlawii Bacteroides fragilis thetaiotamicron Anaerococcus prevotii Astroviridae Bacteroides fragilis vulgatus Anaerococcus tetradius Atopobium Bacteroides furcosus Anaerococcus tretradius Atopobium fossor Bacteroides gingivalis Anaerococcus vaginalis Atopobium minutum Bacteroides gracilis Anaerorhabdus Atopobium parvulum Bacteroides heparinolyticus Anaerorhabdus furcosus Atopobium rimae Bacteroides hypermegas Anaplasma Atopobium vaginae Bacteroides intermedius Ancylostoma Aureobasidium Bacteroides levii Aneurinibacillus Aureobasidium pullulans Bacteroides macacae Angiostrongylus Averyella Bacteroides melaninogenicus Apophysomyces Avian Influenza A H1N1 Virus Bacteroides melaninogenicus asaccharolyticus Apophysomyces elegans Avian tubercle bacillus Bacteroides melaninogenicus intermedius Arbovirus group B Avibacterium gallinarum Bacteroides merdae Recognized Pathogens Bacteroides multiacidus Battey bacillus Bordetella Bacteroides necrophorus Beauveria Bordetella avium Bacteroides nodosus Beauveria alba Bordetella bronchiseptica Bacteroides nordii Beauveria bassiana Bordetella hinzii Bacteroides ochraceus Beneckea alginolytica Bordetella holmesii Bacteroides oralis Beneckea harveyi Bordetella parapertussis Bacteroides oris Beneckea parahaemolytica Bordetella pertussis Bacteroides oulorum Beneckea vulnifica Bordetella pertussis rough phase IV Bacteroides ovatus Bergeyella Bordetella petrii Bacteroides pentosaceus Bergeyella zoohelcum Bordetella trematum Bacteroides praeacuta Beta‐hemolytic streptococcus Borrelia Bacteroides praeacutus Beta‐hemolytic Streptococcus, group A Borrelia afzelii Bacteroides putredinis Beta‐hemolytic streptococcus, non‐Group A, non‐Group B Borrelia anserina Bacteroides pyogenes Bifidobacterium Borrelia burgdorferi Bacteroides ruminicola Bifidobacterium adolescentis Borrelia caucasica Bacteroides ruminicola brevis Bifidobacterium angulatum Borrelia coriaceae Bacteroides salivosus Bifidobacterium appendicitis Borrelia crocidurae Bacteroides splanchnicus Bifidobacterium bifidum Borrelia duttoni Bacteroides stercoris Bifidobacterium breve Borrelia duttonii Bacteroides symbiosus Bifidobacterium catenulatum Borrelia garinii Bacteroides tectum Bifidobacterium dentium Borrelia hermsii Bacteroides tectus Bifidobacterium ericksonii Borrelia hispanica Bacteroides thetaiotaomicron Bifidobacterium gallicum Borrelia japonica Bacteroides trichoides Bifidobacterium infantis Borrelia lusitaniae Bacteroides uniformis Bifidobacterium longum Borrelia mazzottii Bacteroides veroralis Bifidobacterium pseudocatenulatum Borrelia miyamotoi Bacteroides vulgatus Bifidobacterium scardovii Borrelia novyi Bacteroides zoogleoformans Bifidobacterium suis Borrelia obermyeri Balantidium Bilophila Borrelia parkeri Balneatrix Bilophila wadsworthia Borrelia recurrentis Balneatrix alpica Bipolaris Borrelia tanukii Bartonella Bipolaris australiensis Borrelia theileri Bartonella bacilliformis Bipolaris hawaiiense Borrelia turicatae Bartonella clarridgeiae Bipolaris hawaiiensis Borrelia valaisiana Bartonella elizabethae Bipolaris spicifera Borrelia venezuelensis Bartonella henselae BK Polyomavirus Botryodiplodia Bartonella quintana Blastoschizomyces Botryodiplodia theobromae Bartonella vinsonii Blastoschizomyces capitatus Bovine tubercle bacillus Bartonella vinsonii arupensis Blastoschizomyces pseudotrichosporon Brachycladium spiciferum Bartonella vinsonii berkhoffii Blautia Brachyspira Basidiobolus Blautia coccoides Brachyspira aalborgi Basidiobolus haptosporus Blautia hansenii Brachyspira pilosicoli Basidiobolus heterosporus Blautia producta Branhamella catarrhalis Basidiobolus meristosporus Boas‐Oppler bacillus Branhamella cuniculi Basidiobolus ranarum Bocavirus Branhamella ovis Recognized Pathogens Brevundimonas Buttiauxella Campylobacter pyloridis Brevundimonas diminuta Buttiauxella agrestis Campylobacter rectus Brevundimonas vesicularis Buttiauxella brennerae Campylobacter showae Brucella Buttiauxella ferragutiae Campylobacter sputorum Brucella abortus Buttiauxella gaviniae Campylobacter sputorum bubulus Brucella canis Buttiauxella izardii Campylobacter sputorum mucosalis Brucella melitensis Buttiauxella noackiae Campylobacter sputorum sputorum Brucella melitensis biov suis Buttiauxella warmboldiae Campylobacter upsaliensis Brucella melitensis biovar abortus Butyribacterium rettgeri Campylobacter ureolyticus Brucella melitensis biovar canis Butyrivibrio Candida Brucella melitensis biovar neotomae Butyrivibrio fibrisolvens Candida
Load more

Recommended publications
  • Bartonella Apis Sp. Nov., a Honey Bee Gut Symbiont of the Class Alphaproteobacteria
    Serveur Academique´ Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication This paper has been peer-reviewed but does not include the final publisher proof-corrections or journal pagination. Published in final edited form as: Title: Bartonella apis sp. nov., a honey bee gut symbiont of the class Alphaproteobacteria. Authors: Keˇsnerov´aL, Moritz R, Engel P Journal: International journal of systematic and evolutionary microbiology Year: 2016 Jan Issue: 66 Volume: 1 Pages: 414-21 DOI: 10.1099/ijsem.0.000736 In the absence of a copyright statement, users should assume that standard copyright protection applies, unless the article contains an explicit statement to the contrary. In case of doubt, contact the journal publisher to verify the copyright status of an article. 1 Bartonella apis sp. nov., a honey bee gut symbiont of the 2 class Alphaproteobacteria 3 4 Lucie Kešnerová, Roxane Moritz, Philipp Engel* 5 6 Department of Fundamental Microbiology, University of Lausanne, CH-1015 7 Lausanne, Switzerland 8 9 Running title: Description of a bee gut symbiont 10 11 *Correspondence: 12 Prof. Philipp Engel 13 Department of Fundamental Microbiology 14 University of Lausanne, CH-1015 Lausanne, Switzerland 15 Tel.: +41 (0)21 692 56 12 16 e-mail: [email protected] 17 18 Category: New Taxa – Proteobacteria 19 Keywords: Apis mellifera; insect; Bartonella; gut microbiota; Alpha-1 20 21 Sequence deposition: The 16S rRNA gene sequences and protein-coding gene 22 sequences of the bacterial strains PEB0122T, PEB0149, PEB0150, BBC0104, and 23 BBC0108 from Apis mellifera, and the uncultured Rhizobiales bacterium from 24 Herpagnathos saltator are deposited in GenBank with accession numbers KP987849 25 – KP987886 and KT315729 – KT315734.
    [Show full text]
  • Genomics 98 (2011) 370–375
    Genomics 98 (2011) 370–375 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Whole-genome comparison clarifies close phylogenetic relationships between the phyla Dictyoglomi and Thermotogae Hiromi Nishida a,⁎, Teruhiko Beppu b, Kenji Ueda b a Agricultural Bioinformatics Research Unit, Graduate School of Agricultural and Life Sciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan b Life Science Research Center, College of Bioresource Sciences, Nihon University, Fujisawa, Japan article info abstract Article history: The anaerobic thermophilic bacterial genus Dictyoglomus is characterized by the ability to produce useful Received 2 June 2011 enzymes such as amylase, mannanase, and xylanase. Despite the significance, the phylogenetic position of Accepted 1 August 2011 Dictyoglomus has not yet been clarified, since it exhibits ambiguous phylogenetic positions in a single gene Available online 7 August 2011 sequence comparison-based analysis. The number of substitutions at the diverging point of Dictyoglomus is insufficient to show the relationships in a single gene comparison-based analysis. Hence, we studied its Keywords: evolutionary trait based on whole-genome comparison. Both gene content and orthologous protein sequence Whole-genome comparison Dictyoglomus comparisons indicated that Dictyoglomus is most closely related to the phylum Thermotogae and it forms a Bacterial systematics monophyletic group with Coprothermobacter proteolyticus (a constituent of the phylum Firmicutes) and Coprothermobacter proteolyticus Thermotogae. Our findings indicate that C. proteolyticus does not belong to the phylum Firmicutes and that the Thermotogae phylum Dictyoglomi is not closely related to either the phylum Firmicutes or Synergistetes but to the phylum Thermotogae. © 2011 Elsevier Inc.
    [Show full text]
  • Differences in Genotype, Clinical Features, and Inflammatory
    RESEARCH Differences in Genotype, Clinical Features, and Inflammatory Potential of Borrelia burgdorferi sensu stricto Strains from Europe and the United States Tjasa Cerar,1 Franc Strle,1 Dasa Stupica, Eva Ruzic-Sabljic, Gail McHugh, Allen C. Steere, Klemen Strle Borrelia burgdorferi sensu stricto isolates from patients with B. afzelii, which usually remains localized to the skin, with erythema migrans in Europe and the United States and B. garinii, which is usually associated with nervous were compared by genotype, clinical features of infection, system involvement (1). B. burgdorferi infection is rare in and inflammatory potential. Analysis of outer surface pro- Europe; little is known about its clinical course there. In tein C and multilocus sequence typing showed that strains the United States, B. burgdorferi is the sole agent of Lyme from these 2 regions represent distinct genotypes. Clinical borreliosis; in the northeastern United States, it is particu- features of infection with B. burgdorferi in Slovenia were similar to infection with B. afzelii or B. garinii, the other 2 larly arthritogenic (1,2). For all 3 species, the first sign of Borrelia spp. that cause disease in Europe, whereas B. infection is often an erythema migrans lesion. However, B. burgdorferi strains from the United States were associ- burgdorferi infection in the United States is associated with ated with more severe disease. Moreover, B. burgdorferi a greater number of disease-associated symptoms and more strains from the United States induced peripheral blood frequent hematogenous dissemination than B. afzelii or B. mononuclear cells to secrete higher levels of cytokines garinii infection in Europe (4–7).
    [Show full text]
  • View Tickborne Diseases Sample Report
    1360 Bayport Ave, Ste B. San Carlos, CA 94070 1(866) 364-0963 | [email protected] | www. vibrant-wellness.com PATIENT PROVIDER NAME: DEMO REPORT GENDER: Male PRACTICE NAME: Vibrant IT4 Practice DATE OF BIRTH: 04/14/1998 AGE: 22 PROVIDER NAME: Demo Client, DDD (999994) ADDRESS: TEST STREET, TEST CITY, KY- 42437. ACCESSION ID: 2009220006 PHLEBOTOMIST: 607 SPECIMEN COLLECTION TIME: 09-21-2020 11:14 SPECIMEN RECEIVED TIME: 09-22-2020 05:14 FINAL REPORT TIME: 09-25-2020 15:56 FASTING: FASTING Your Vibrant Wellness TickBorne 2.0 panel results are enclosed. These results are intended to aid in the diagnosis of tickborne diseases by your healthcare provider. The Vibrant Tickborne Diseases panel tests for IgG and IgM antibodies for Borreliosis/Lyme disease as well as co-infection(s) and opportunistic infections with other tick-borne illnesses along with detection of DNA of the species causing these infections. The Vibrant Immunochip test is a semiquantitative assay that detects IgG and IgM antibodies in human serum. The PCR Test is a real-time PCR Assay designed for qualitative detection of infectious group- specific DNA in clinical samples. Interpretation of Report: The test results of antibody levels to the individual antigens are calculated by comparing the average intensity of the individual antibody to that of a reference population and cut-off chosen for each protein. Reference ranges have been established using a well characterized set of more than 300 serum samples and antibodies to specific bacteria tested. The results are displayed as In Control, Moderate, or High Risk.for each antigen tested.
    [Show full text]
  • Characterization of Endophytic Bacterial Strains Isolated from Rice Grain Discoloration
    Characterization of Endophytic Bacterial Strains Isolated from Rice Grain Discoloration Muhammad Ashfaq*, Muhammad Saleem Haider, Amna Ali, Sehrish Mushtaq, Muhammad Ali and Urooj Mubashar Institute of Agricultural Sciences. University of the Punjab, Quaid-E-Azam campus, Lahore 54590 Pakistan. Government Elementary Teachers Education College,Ghakkhar Mandi, Gujranwala, Pakistan Corresponding author email: [email protected] ABSTRACT The present study was conducted to isolate bacterial species obtained from different rice varieties: Kainat, Basmati-385, Super basmati, Basmati 86, KSK-133, Basmati-198, Basmati- 2000x1053-2-2, Kasur, Stg 567989 and Basmati-2000x33797-1 collected from all agro ecological zones of Pakistan. When plated infected grain samples gave various bacterial colonies on Luria Bertani (L.B) agar medium. The isolates were identified on the basis of various morphological and biochemical features. Out of 22 isolates, five showed rod cell shape in microscope. Sixteen biochemical tests were conducted to characterize 22 isolates of bacteria. Gram stain demonstrated that three isolates were gram positive and rod shaped. All other isolates were gram negative. The presence of bacteria was also estimated in ten different varieties of rice. The highest presence of bacteria was observed in KSK-133, Kainat and Stg 567989. Burkholderia species and Enterobacter species have high frequency almost in all tested rice varieties. The overall objective of this study was to screen, classify and associate the bacterial species present on the basis of various morphological characteristics isolated from diverse rice [SYLWAN., 158(8)]. ISI Indexed 165 genotype. The results demonstrated that collected and investigated rice varieties have a diverse range of bacterial species, some of which are considered as severe pathogens for plants.
    [Show full text]
  • Genetic Diversity of Bartonella Species in Small Mammals in the Qaidam
    www.nature.com/scientificreports OPEN Genetic diversity of Bartonella species in small mammals in the Qaidam Basin, western China Huaxiang Rao1, Shoujiang Li3, Liang Lu4, Rong Wang3, Xiuping Song4, Kai Sun5, Yan Shi3, Dongmei Li4* & Juan Yu2* Investigation of the prevalence and diversity of Bartonella infections in small mammals in the Qaidam Basin, western China, could provide a scientifc basis for the control and prevention of Bartonella infections in humans. Accordingly, in this study, small mammals were captured using snap traps in Wulan County and Ge’ermu City, Qaidam Basin, China. Spleen and brain tissues were collected and cultured to isolate Bartonella strains. The suspected positive colonies were detected with polymerase chain reaction amplifcation and sequencing of gltA, ftsZ, RNA polymerase beta subunit (rpoB) and ribC genes. Among 101 small mammals, 39 were positive for Bartonella, with the infection rate of 38.61%. The infection rate in diferent tissues (spleens and brains) (χ2 = 0.112, P = 0.738) and gender (χ2 = 1.927, P = 0.165) of small mammals did not have statistical diference, but that in diferent habitats had statistical diference (χ2 = 10.361, P = 0.016). Through genetic evolution analysis, 40 Bartonella strains were identifed (two diferent Bartonella species were detected in one small mammal), including B. grahamii (30), B. jaculi (3), B. krasnovii (3) and Candidatus B. gerbillinarum (4), which showed rodent-specifc characteristics. B. grahamii was the dominant epidemic strain (accounted for 75.0%). Furthermore, phylogenetic analysis showed that B. grahamii in the Qaidam Basin, might be close to the strains isolated from Japan and China.
    [Show full text]
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Novel Small Rnas Expressed by Bartonella Bacilliformis Under Multiple Conditions 2 Reveal Potential Mechanisms for Persistence in the Sand Fly Vector and Human 3 Host
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.04.235903; this version posted August 4, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Novel small RNAs expressed by Bartonella bacilliformis under multiple conditions 2 reveal potential mechanisms for persistence in the sand fly vector and human 3 host 4 5 6 Shaun Wachter1, Linda D. Hicks1, Rahul Raghavan2 and Michael F. Minnick1* 7 8 9 10 1 Program in Cellular, Molecular & Microbial Biology, Division of Biological Sciences, 11 University of Montana, Missoula, Montana, United States of America 12 2 Department of Biology and Center for Life in Extreme Environments, Portland State 13 University, Portland, Oregon, United States of America 14 15 16 17 * Corresponding author 18 E-mail: [email protected] (MFM) 19 20 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.04.235903; this version posted August 4, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 21 Abstract 22 Bartonella bacilliformis, the etiological agent of Carrión’s disease, is a Gram-negative, 23 facultative intracellular alphaproteobacterium. Carrión’s disease is an emerging but neglected 24 tropical illness endemic to Peru, Colombia, and Ecuador. B. bacilliformis is spread between 25 humans through the bite of female phlebotomine sand flies.
    [Show full text]
  • 09 Piqueras.Qxp
    PERSPECTIVES INTERNATIONAL MICROBIOLOGY (2007) 10:217-226 DOI: 10.2436/20.1501.01.30 ISSN: 1139-6709 www.im.microbios.org Microbiology: a dangerous profession? Mercè Piqueras President, Catalan Association for Science Communication (ACCC), Barcelona, Spain The history of science contains many cases of researchers eases in Minorca from the year 1744 to 1749 to which is pre- who have died because of their professional activity. In the fixed, a short account of the climate, productions, inhabi- field of microbiology, some have died or have come close to tants, and endemical distempers of that island (T. Cadell, D. death from infection by agents that were the subject of their Wilson and G. Nicol, London, 1751), which he dedicated to research (Table 1). Infections that had a lethal outcome were the Society of Surgeons of His Majesty’s Royal Navy. usually accidental. Sometimes, however, researchers inocu- Minorcan historian of science Josep M. Vidal Hernández has lated themselves with the pathogen or did not take preventive described and carefully analyzed Cleghorn’s work in measures against the potential pathogen because they wanted Minorca and his report [43]. According to Vidal, what to prove their hypotheses—or disprove someone else’s— Cleghorn describes is “tertian” fever, which was the name regarding the origin of the infection. Here is an overview of given at the time to fever caused by malaria parasites with a several episodes in the history of microbiology since the mid periodicity of 48 hours. In fact, Cleghorn used quinine to nineteenth century involving researchers or workers in fields treat tertian fever (i.e, malaria), which was not eradicated related to microbiology who have become infected.
    [Show full text]
  • Motiliproteus Sediminis Gen. Nov., Sp. Nov., Isolated from Coastal Sediment
    Antonie van Leeuwenhoek (2014) 106:615–621 DOI 10.1007/s10482-014-0232-2 ORIGINAL PAPER Motiliproteus sediminis gen. nov., sp. nov., isolated from coastal sediment Zong-Jie Wang • Zhi-Hong Xie • Chao Wang • Zong-Jun Du • Guan-Jun Chen Received: 3 April 2014 / Accepted: 4 July 2014 / Published online: 20 July 2014 Ó Springer International Publishing Switzerland 2014 Abstract A novel Gram-stain-negative, rod-to- demonstrated that the novel isolate was 93.3 % similar spiral-shaped, oxidase- and catalase- positive and to the type strain of Neptunomonas antarctica, 93.2 % facultatively aerobic bacterium, designated HS6T, was to Neptunomonas japonicum and 93.1 % to Marino- isolated from marine sediment of Yellow Sea, China. bacterium rhizophilum, the closest cultivated rela- It can reduce nitrate to nitrite and grow well in marine tives. The polar lipid profile of the novel strain broth 2216 (MB, Hope Biol-Technology Co., Ltd) consisted of phosphatidylethanolamine, phosphatidyl- with an optimal temperature for growth of 30–33 °C glycerol and some other unknown lipids. Major (range 12–45 °C) and in the presence of 2–3 % (w/v) cellular fatty acids were summed feature 3 (C16:1 NaCl (range 0.5–7 %, w/v). The pH range for growth x7c/iso-C15:0 2-OH), C18:1 x7c and C16:0 and the main was pH 6.2–9.0, with an optimum at 6.5–7.0. Phylo- respiratory quinone was Q-8. The DNA G?C content genetic analysis based on 16S rRNA gene sequences of strain HS6T was 61.2 mol %. Based on the phylogenetic, physiological and biochemical charac- teristics, strain HS6T represents a novel genus and The GenBank accession number for the 16S rRNA gene T species and the name Motiliproteus sediminis gen.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bartonella Henselae • Fleas and Black-Legged Ticks (Also Called Deer Ticks) of the Genus Ixodes May Serve As Vectors, but This Has Not Disease Agent: Been Proven
    APPENDIX 2 Bartonella henselae • Fleas and black-legged ticks (also called deer ticks) of the genus Ixodes may serve as vectors, but this has not Disease Agent: been proven. • Bartonella henselae Blood Phase: Disease Agent Characteristics: • Agent found in endothelial cells and associated with RBCs in symptomatic cases • Gram-negative bacillus or coccobacillus, aerobic, • Occult bacteremia sometimes occurs in the absence nonmotile, nonspore-forming, facultatively intracel- of specific antibodies. lular bacterium • Order: Rhizobiales; Family: Bartonellaceae Survival/Persistence in Blood Products: • Size: 0.3-0.6 ¥ 0.3-1.0 mm • Nucleic acid: Approximately 1900 kb of DNA • A spiking study suggests that B. henselae added to RBCs can be recovered on solid media through 35 Disease Name: days of storage at 4°C. • Cat scratch disease • Cat scratch fever Transmission by Blood Transfusion: • Bacillary angiomatosis • Theoretical • Bacillary peliosis Cases/Frequency in Population: Priority Level: • 22,000 cases per year estimated in the US • Scientific/Epidemiologic evidence regarding blood • 2-6% in US blood donors safety: Theoretical • Cumulative seroprevalence of 7.1% to B. henselae and • Public perception and/or regulatory concern regard- B. quintana in US veterinary professionals ing blood safety: Absent • Public concern regarding disease agent: Very low Incubation Period: Background: • 3-10 days to appearance of papule at inoculation site; regional adenopathy may follow after a few weeks • In 1909,ALBartondescribed organisms that adhered to RBCs. Likelihood of Clinical Disease: • The name Bartonella bacilliformis was used for the • Relatively benign and self-limiting, lasting 6-12 weeks only member of the group identified before 1993. in the absence of antibiotic therapy • Several other species of Bartonella are known to infect humans, but at present, B.
    [Show full text]