Studies on Central Carbon Metabolism and Respiration of Gluconobacter Oxydans 621H
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Bacterial Oxidases of the Cytochrome Bd Family: Redox Enzymes of Unique Structure, Function, and Utility As Drug Targets
Published in "Antioxidants & Redox Signaling doi: 10.1089/ars.2020.8039, 2020" which should be cited to refer to this work. Bacterial Oxidases of the Cytochrome bd Family: Redox Enzymes of Unique Structure, Function, and Utility As Drug Targets Vitaliy B. Borisov,1 Sergey A. Siletsky,1 Alessandro Paiardini,2 David Hoogewijs,3 Elena Forte,2 Alessandro Giuffre`,4 and Robert K. Poole5 Abstract Significance: Cytochrome bd is a ubiquinol:oxygen oxidoreductase of many prokaryotic respiratory chains with a unique structure and functional characteristics. Its primary role is to couple the reduction of molecular oxygen, even at submicromolar concentrations, to water with the generation of a proton motive force used for adenosine triphosphate production. Cytochrome bd is found in many bacterial pathogens and, surprisingly, in bacteria for- mally denoted as anaerobes. It endows bacteria with resistance to various stressors and is a potential drug target. Recent Advances: We summarize recent advances in the biochemistry, structure, and physiological functions of cytochrome bd in the light of exciting new three-dimensional structures of the oxidase. The newly discovered roles of cytochrome bd in contributing to bacterial protection against hydrogen peroxide, nitric oxide, perox- ynitrite, and hydrogen sulfide are assessed. Critical Issues: Fundamental questions remain regarding the precise delineation of electron flow within this multihaem oxidase and how the extraordinarily high affinity for oxygen is accomplished, while endowing bacteria with resistance to other small ligands. Future Directions: It is clear that cytochrome bd is unique in its ability to confer resistance to toxic small molecules, a property that is significant for understanding the propensity of pathogens to possess this oxidase. -
Multi-Omic Understanding of the Evolution of Xenobiotic Tolerance in Bacterial Isolates and Communities
Washington University in St. Louis Washington University Open Scholarship Arts & Sciences Electronic Theses and Dissertations Arts & Sciences Summer 8-15-2019 Multi-omic Understanding of the Evolution of Xenobiotic Tolerance in Bacterial Isolates and Communities Tayte Paul Campbell Washington University in St. Louis Follow this and additional works at: https://openscholarship.wustl.edu/art_sci_etds Part of the Bioinformatics Commons, Biology Commons, and the Microbiology Commons Recommended Citation Campbell, Tayte Paul, "Multi-omic Understanding of the Evolution of Xenobiotic Tolerance in Bacterial Isolates and Communities" (2019). Arts & Sciences Electronic Theses and Dissertations. 1888. https://openscholarship.wustl.edu/art_sci_etds/1888 This Dissertation is brought to you for free and open access by the Arts & Sciences at Washington University Open Scholarship. It has been accepted for inclusion in Arts & Sciences Electronic Theses and Dissertations by an authorized administrator of Washington University Open Scholarship. For more information, please contact [email protected]. WASHINGTON UNIVERSITY IN ST. LOUIS Division of Biology and Biomedical Sciences Plant and Microbial Biosciences Dissertation Examination Committee: Gautam Dantas, Chair Arpita Bose Andrew Kau Audrey Odom-John Himadri Pakrasi Fuzhong Zhang Multi-omic Understanding of the Evolution of Xenobiotic Tolerance in Bacterial Isolates and Communities by Tayte P. Campbell A dissertation presented to The Graduate School of Washington University in partial fulfillment -
(12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun. -
In-Vitro Synthesis and Reconstitution of Cytochrome Bo3 Ubiquinol Oxidase in Artificial Membranes
In-vitro Synthesis and Reconstitution of Cytochrome bo3 Ubiquinol Oxidase in Artificial Membranes Dissertation Zur Erlangung des Grades Doktor der Naturwissenschaften Am Fachbereich Biologie Der Johannes Gutenberg-Universität Mainz Ahu ARSLAN YILDIZ geboren am 20.12.1980 in Turkey Mainz, 2010 Dekan: Prof. Dr. Erwin Schmidt 1. Berichterstatter: Prof. Dr. Eva K. Sinner 2. Berichterstatter: Prof. Dr. Harald Paulsen 3. Prüfer: Prof. Dr. Wolfgang Knoll 4. Prüfer: Prof. Dr. Elmar Jaenicke Tag der mündlichen Prüfung: 29.01.2010 Abbreviations ATP Adenosine triphosphate PD Parkinson’s Disease Cyt-bo3 Cytochrome bo3 ubiquinol oxidase NADH Nicotinamide adenine dinucleotide UQ Ubiquinone UQH2 Ubiquinol Cyt-c Cytochrome c E.coli Escherichia coli Heme Heme or Haem molecule Cyt-bd Cytochrome bd ubiquinol oxidase cyo Cytochrome encoding operon CuA Copper site in subunit II CuB Copper of binuclear site CFPS Cell-free protein synthesis tRNA Transfer RNA GTP Guanidine triphosphate BLMs Black lipid membranes sBLM Supported bilayer lipid membrane tBLM Tethered lipid bilayer membrane SPR Surface Plasmon Resonance Spectroscopy SPFS Surface Plasmon Enhanced Fluorescence Spectroscopy θc Critical angle θm Minimum angle TIR Total internal reflection εd Dielectric constant n Refractive index CA Contact angle pJRHisA Subunit II histidine tagged enzyme with natural promoter pRCO3 Fused subunit II-I-III enzyme with natural promoter pETcyo Subunit II histidine tagged enzyme with T7 promoter LB Luria Bertani media ii KOH Potassium hydroxide PES Polyethylene sulfonate -
Metabolic and Regulatory Rearrangements Underlying Glycerol Metabolism in 3 Pseudomonas Putida KT2440 4 5 by 6 7 Pablo I
1 1 2 Metabolic and regulatory rearrangements underlying glycerol metabolism in 3 Pseudomonas putida KT2440 4 5 by 6 7 Pablo I. Nikel, Juhyun Kim, and Víctor de Lorenzo* 8 9 Systems and Synthetic Biology Program, Centro Nacional de Biotecnología (CNB-CSIC), 10 Madrid 28049, Spain 11 12 13 14 Running Title: Glycerol metabolism in P. putida 15 Keywords: Glycerol, Pseudomonas putida, central metabolism, Entner-Doudoroff pathway, redox 16 homeostasis, transcriptional regulation 17 18 19 20 _________________________________________________________________________________ 21 22 * Corresponding author V. de Lorenzo 23 Systems and Synthetic Biology Program 24 Centro Nacional de Biotecnología (CNB-CSIC) 25 Darwin 3, Campus de Cantoblanco 26 Madrid 28049, Spain 27 Phone: +34 91 585 4536 28 Fax: +34 91 585 4506 29 E-mail: [email protected] 30 2 1 SUMMARY 2 3 While the natural niches of the soil bacterium Pseudomonas putida are unlikely to include significant 4 amounts of free glycerol as a growth substrate, this bacterium is genetically equipped with the functions 5 required for its metabolism. We have resorted to deep sequencing of the transcripts in glycerol-grown 6 P. putida KT2440 cells to gain an insight into the biochemical and regulatory components involved in 7 the shift between customary C sources (e.g., glucose or succinate) to the polyol. Transcriptomic results 8 were contrasted with key enzymatic activities under the same culture conditions. Cognate expression 9 profiles revealed that genes encoding enzymes of the Entner-Doudoroff route and other catabolic 10 pathways, e.g., the gluconate and 2-ketogluconate loops, were significantly down-regulated on glycerol. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Differential Effects of Epinephrine, Norepinephrine, and Indole
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Texas A&M University INFECTION AND IMMUNITY, Sept. 2007, p. 4597–4607 Vol. 75, No. 9 0019-9567/07/$08.00ϩ0 doi:10.1128/IAI.00630-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved. Differential Effects of Epinephrine, Norepinephrine, and Indole on Escherichia coli O157:H7 Chemotaxis, Colonization, and Gene Expressionᰔ Tarun Bansal, Derek Englert, Jintae Lee, Manjunath Hegde, Thomas K. Wood, and Arul Jayaraman* Artie McFerrin Department of Chemical Engineering, Texas A&M University, College Station, Texas 77843-3122 Received 3 May 2007/Returned for modification 4 June 2007/Accepted 13 June 2007 During infection in the gastrointestinal tract, enterohemorrhagic Escherichia coli (EHEC) O157:H7 is exposed to a wide range of signaling molecules, including the eukaryotic hormones epinephrine and norepi- nephrine, and bacterial signal molecules such as indole. Since these signaling molecules have been shown to be involved in the regulation of phenotypes such as motility and virulence that are crucial for EHEC infections, we hypothesized that these molecules also govern the initial recognition of the large intestine environment and attachment to the host cell surface. Here, we report that, compared to indole, epinephrine and norepinephrine exert divergent effects on EHEC chemotaxis, motility, biofilm formation, gene expression, and colonization of HeLa cells. Using a novel two-fluorophore chemotaxis assay, it was found that EHEC is attracted to epineph- rine and norepinephrine while it is repelled by indole. In addition, epinephrine and norepinephrine also increased EHEC motility and biofilm formation while indole attenuated these phenotypes. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Davidge JBC Supplementary.Pdf
promoting access to White Rose research papers Universities of Leeds, Sheffield and York http://eprints.whiterose.ac.uk/ White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/7923/ (includes links to Main Article, Supplementary Material and Figures) Published paper Davidge, K.S., Sanguinetti, G., Yee, C.H., Cox, A.G., McLeod, C.W., Monk, C.E., Mann, B.E., Motterlini, R. and Poole, R.K. (2009) Carbon monoxide-releasing antibacterial molecules target respiration and global transcriptional regulators. Journal of Biological Chemistry, 284 (7). pp. 4516-4524. http://dx.doi.org/10.1074/jbc.M808210200 Supplementary Material White Rose Research Online [email protected] Supplementary Material Carbon monoxide-releasing antibacterial molecules target respiration and global transcriptional regulators Kelly S Davidge, Guido Sanguinetti, Chu Hoi Yee, Alan G Cox, Cameron W McLeod, Claire E Monk, Brian E Mann, Roberto Motterlini and Robert K Poole Contents Page Number Supplementary Figure S1 3 Inhibition by CORM-3 of E. coli cultures grown in defined medium anaerobically and aerobically Supplementary Figure S2 4 Viability assays showing survival of anaerobically and aerobically E. coli in defined growth medium Supplementary Figure S3 5 Reaction of terminal oxidases in vivo on addition of RuCl2(DMSO)4 to intact cells in a dual-wavelength spectrophotometer Supplementary Figure S4 6 CORM-3 generates carbonmonoxycytochrome bd in vivo and depresses synthesis of cytochrome bo' Supplementary Figure S5 7 Expression of spy-lacZ activity -
Letters to Nature
letters to nature Received 7 July; accepted 21 September 1998. 26. Tronrud, D. E. Conjugate-direction minimization: an improved method for the re®nement of macromolecules. Acta Crystallogr. A 48, 912±916 (1992). 1. Dalbey, R. E., Lively, M. O., Bron, S. & van Dijl, J. M. The chemistry and enzymology of the type 1 27. Wolfe, P. B., Wickner, W. & Goodman, J. M. Sequence of the leader peptidase gene of Escherichia coli signal peptidases. Protein Sci. 6, 1129±1138 (1997). and the orientation of leader peptidase in the bacterial envelope. J. Biol. Chem. 258, 12073±12080 2. Kuo, D. W. et al. Escherichia coli leader peptidase: production of an active form lacking a requirement (1983). for detergent and development of peptide substrates. Arch. Biochem. Biophys. 303, 274±280 (1993). 28. Kraulis, P.G. Molscript: a program to produce both detailed and schematic plots of protein structures. 3. Tschantz, W. R. et al. Characterization of a soluble, catalytically active form of Escherichia coli leader J. Appl. Crystallogr. 24, 946±950 (1991). peptidase: requirement of detergent or phospholipid for optimal activity. Biochemistry 34, 3935±3941 29. Nicholls, A., Sharp, K. A. & Honig, B. Protein folding and association: insights from the interfacial and (1995). the thermodynamic properties of hydrocarbons. Proteins Struct. Funct. Genet. 11, 281±296 (1991). 4. Allsop, A. E. et al.inAnti-Infectives, Recent Advances in Chemistry and Structure-Activity Relationships 30. Meritt, E. A. & Bacon, D. J. Raster3D: photorealistic molecular graphics. Methods Enzymol. 277, 505± (eds Bently, P. H. & O'Hanlon, P. J.) 61±72 (R. Soc. Chem., Cambridge, 1997). -
Solarbio Catalogue with PRICES
CAS Name Grade Purity Biochemical Reagent Biochemical Reagent 75621-03-3 C8390-1 3-((3-Cholamidopropyl)dimethylammonium)-1-propanesulfonateCHAPS Ultra Pure Grade 1g 75621-03-3 C8390-5 3-((3-Cholamidopropyl)dimethylammonium)-1-propanesulfonateCHAPS 5g 57-09-0 C8440-25 Cetyl-trimethyl Ammonium Bromide CTAB High Pure Grade ≥99.0% 25g 57-09-0 C8440-100 Cetyl-trimethyl Ammonium Bromide CTAB High Pure Grade ≥99.0% 100g 57-09-0 C8440-500 Cetyl-trimethyl Ammonium Bromide CTAB High Pure Grade ≥99.0% 500g E1170-100 0.5M EDTA (PH8.0) 100ml E1170-500 0.5M EDTA (PH8.0) 500ml 6381-92-6 E8030-100 EDTA disodium salt dihydrate EDTA Na2 Biotechnology Grade ≥99.0% 100g 6381-92-6 E8030-500 EDTA disodium salt dihydrate EDTA Na2 Biotechnology Grade ≥99.0% 500g 6381-92-6 E8030-1000 EDTA disodium salt dihydrate EDTA Na2 Biotechnology Grade ≥99.0% 1kg 6381-92-6 E8030-5000 EDTA disodium salt dihydrate EDTA Na2 Biotechnology Grade ≥99.0% 5kg 60-00-4 E8040-100 Ethylenediaminetetraacetic acid EDTA Ultra Pure Grade ≥99.5% 100g 60-00-4 E8040-500 Ethylenediaminetetraacetic acid EDTA Ultra Pure Grade ≥99.5% 500g 60-00-4 E8040-1000 Ethylenediaminetetraacetic acid EDTA Ultra Pure Grade ≥99.5% 1kg 67-42-5 E8050-5 Ethylene glycol-bis(2-aminoethylether)-N,N,NEGTA′,N′-tetraacetic acid Ultra Pure Grade ≥97.0% 5g 67-42-5 E8050-10 Ethylene glycol-bis(2-aminoethylether)-N,N,NEGTA′,N′-tetraacetic acid Ultra Pure Grade ≥97.0% 10g 50-01-1 G8070-100 Guanidine Hydrochloride Guanidine HCl ≥98.0%(AT) 100g 50-01-1 G8070-500 Guanidine Hydrochloride Guanidine HCl ≥98.0%(AT) 500g 56-81-5 -
Product Sheet Info
Master Clone List for NR-19279 ® Vibrio cholerae Gateway Clone Set, Recombinant in Escherichia coli, Plates 1-46 Catalog No. NR-19279 Table 1: Vibrio cholerae Gateway® Clones, Plate 1 (NR-19679) Clone ID Well ORF Locus ID Symbol Product Accession Position Length Number 174071 A02 367 VC2271 ribD riboflavin-specific deaminase NP_231902.1 174346 A03 336 VC1877 lpxK tetraacyldisaccharide 4`-kinase NP_231511.1 174354 A04 342 VC0953 holA DNA polymerase III, delta subunit NP_230600.1 174115 A05 388 VC2085 sucC succinyl-CoA synthase, beta subunit NP_231717.1 174310 A06 506 VC2400 murC UDP-N-acetylmuramate--alanine ligase NP_232030.1 174523 A07 132 VC0644 rbfA ribosome-binding factor A NP_230293.2 174632 A08 322 VC0681 ribF riboflavin kinase-FMN adenylyltransferase NP_230330.1 174930 A09 433 VC0720 phoR histidine protein kinase PhoR NP_230369.1 174953 A10 206 VC1178 conserved hypothetical protein NP_230823.1 174976 A11 213 VC2358 hypothetical protein NP_231988.1 174898 A12 369 VC0154 trmA tRNA (uracil-5-)-methyltransferase NP_229811.1 174059 B01 73 VC2098 hypothetical protein NP_231730.1 174075 B02 82 VC0561 rpsP ribosomal protein S16 NP_230212.1 174087 B03 378 VC1843 cydB-1 cytochrome d ubiquinol oxidase, subunit II NP_231477.1 174099 B04 383 VC1798 eha eha protein NP_231433.1 174294 B05 494 VC0763 GTP-binding protein NP_230412.1 174311 B06 314 VC2183 prsA ribose-phosphate pyrophosphokinase NP_231814.1 174603 B07 108 VC0675 thyA thymidylate synthase NP_230324.1 174474 B08 466 VC1297 asnS asparaginyl-tRNA synthetase NP_230942.2 174933 B09 198