DOCSLIB.ORG

Mechanistic Evaluation of Inhibitors Against Mycobacterium Tuberculosis Shikimate Kinase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mechanistic Evaluation of Inhibitors Against Mycobacterium Tuberculosis Shikimate Kinase Transition from classical methods to new strategies: Mechanistic evaluation of inhibitors against Mycobacterium tuberculosis shikimate kinase by Ngolui René Fuanta A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 4, 2018 Keywords: Kinetics, spectrometry, tuberculosis, spectrofluorimetry, dissociation constants Copyright 2018 by Ngolui René Fuanta. Approved by Douglas Goodwin, Chair, Associate Professor, Chemistry and Biochemistry Holly Ellis, Professor, Chemistry and Biochemistry Chris Easley, Professor, Chemistry and Biochemistry Steve Mansoorabadi, Assistant Professor, Chemistry and Biochemistry Angela Calderón, Associate Professor, Drug Discovery and Development Abstract Tuberculosis (TB) still stands as one of the leading causes of mortality resulting from an infectious agent. In part, this stems from the emergence of multidrug and extensive drug-resistant strains of tubercle bacilli, demonstrating the pressing need for the development of novel anti tubercular agents. Interestingly, the shikimate pathway, found in plants, bacteria, fungi and algae, is essential for the survival of Mycobacterium tuberculosis. This pathway produces precursors to aromatic amino acids and other aromatic cellular metabolites. Fortunately, it has no mammalian analogue. This makes the enzymes of this pathway suitable targets for the development of novel anti-microbial agents. The research presented in this dissertation focuses on Mycobacterium tuberculosis shikimate kinase (MtSK). Our objectives were to develop LC- MS-based screening and characterization of potential anti tubercular agents – natural, synthetic or semi synthetic, develop fluorescence methods for rapid mechanistic evaluation of MtSK inhibitors and strategies for screening out promiscuous inhibitors. Using mass spectrometry, we characterized a group of marine derived compounds, manzamine alkaloids. These inhibitors showed mixed-noncompetitive mode of inhibition, with time-dependent and slow-binding components. Of this group, one, 6-cyclohexamidomanzamine A, a derivative of the parent manzamine A scaffold, showed slow, tight-binding kinetics with an inhibition constant in the nanomolar range. Another marine-derived inhibitor we characterized was ilimaquinone, which showed irreversible inhibition evident from formation of a covalent adducts with primarily serines and threonines, and to a lesser extent lysines and tyrosines. It is worth noting that due to ii the nonspecific nature of this inhibitor, as it has shown to modify other proteins (not only MtSK), further exploitation of this molecule as a potential antibacterial, antiviral, or anticancer agent should be approached with great care. With respect to developing rapid screening tools, we have generated a panel of MtSK variants with intrinsic fluorescent properties. Substitutions were made on the lid domain, V116W, the adenine binding domain, N151W, and the shikimate binding domain, E54W. These variants show differential responses to substrates and inhibitors. Interestingly, we noted that the binding of one of the substrates, shikimate produced changes in fluorescence in only one of the variants, supporting previously reported data that substrate binding induces conformational changes. Using these, we evaluated the inhibition kinetics of previously characterized inhibitor, so-called Compound 1. Our data supported a mixed-type mode of inhibition, with a slow, reversible component. Competition experiments indicated Compound 1 binds at or near the shikimate binding site, evident from spectral shifts in E54W in the presence of the inhibitor. Together, we have shown that the 6-cyclohexamido derivative of manzamine A is a potent inhibitor of MtSK, and this may be an indication of potential success in later drug discovery stages. The use of ilimaquinone for further drug screening and discovery purposes is at the discretion of the investigator. Our combinatorial approach to weeding out nonspecific inhibitors together with our panel of variants would increase turnover in the early drug screening stages and prevent wastage of long hours on fruitless drug investigations. Lastly, our panel of variants shows great potential for further development into high throughput screen platforms and possibly as sensors. iii Acknowledgments I dedicate this piece to my amazing parents Mr. and Mrs. Ngolui Stephen. Your encouragements and prayers have seen me through life, I stand tall because I stand on your shoulders. You are the very best a son could ever ask for. I love you. I want to give special thanks to my advisor Dr. Goodwin Douglas aka Good Doc for his tremendous support and insight into my graduate school career. You pushed and supported me when all experiments seem to give up on me and still you pointed me to the light at the end of the tunnel. It is a rare privilege and an inexplicable experience to have been under your supervision. You truly stand out. My sincere thanks to my committee members; Holly Ellis for her helpful and comforting words through the trials of graduate school, Chris Easley for impacting your total knowledge of fluorimetry and analytical thinking unto me, and Steven Mansoorabadi aka Dr. Man, you made me feel like I was an expert in enzyme mechanisms and arrow pushing. Thank you for all the random visits you let me pay to your offices. I salute you. Many thanks to Dr. Angela Calderón for her continuous support and encouragements even when nothing seemed to work. Your positive attitude and outlook for better results and ground breaking findings didn‟t go without recognition. Thank you for the experience. I also want to thank former and current members of our group; Drs. Elizabeth Ndontsa (aka Prof), Haijun Duan (aka Diesel), Olive Njuma (aka Miss Olive/Lab machine/proximal iv tryptophan). I won‟t and can‟t leave out Dr. Johayra aka PI/PIC (Partner In Crime) for walking me through the intricacies of this research project. Hui Xu (aka Cong Cong), Jessica Krewall, Tarfi Azis, Rejaul Islam, Callie Jackson. Undergrads; Ethan McCurdy, Gobind Gill, Lauren Barr, Teddy Childers, Olivia Snider, Theresa Simermeyer, Michael Skinner, Daniel Zieman, Patrick Sarhmann and Kirklin McWhorter. With deep gratitude, I extend sincere appreciations to Mr. and Mrs. Soweh. Thank you for opening your home for me and for supporting all the way. You are truly an invaluable part of my achievement and I cannot thank you enough. Uncle Jonathan Tingume, Raymond Tingume, Daniel Weafua, my siblings - Marcellen Nian (aka capitaine), Alain Ngolui, Cpt. Serge Nsanyui, Emile Ngolui and Edmond Ngolui. Your support and guide throughout childhood days and even now has been impeccable. I would choose you again if asked for a second time. To all who have graced my life over the years. I say special thank you. To the friends I made in graduate school; Diana Forbes, Shamim Iqbal, Thankhoe Rantso, Mansour Alturki, Ibtisam Ibtisam, Katie Stanford, Claire Graham. Thank you for being a part of my experience and for sharing your story with me. You are boldly inscribed in my heart. Special thanks to the ladies of the chemistry office. Carol Nixon (retired), Lynn Walker (retired), Lavvorn Howard. You all have been inspirational to me throughout my stay here. You ladies rock! To Mark and Susie, you showed me great love and I am greatly indebted. Many a thank you to Auburn University, department of Chemistry and Biochemistry for accepting and believing in me. That a „crude‟ microbiologist could survive the storms of chemistry. v All in all, from the beginning to the end, THANKS go unto He who sits far above the heavens. For the Lord is good and His mercies endure forever. Gloria in excelsis! vi Table of Contents Chapter 1 ......................................................................................................................................... 1 Literature review ............................................................................................................................. 1 1.1 Overview of tuberculosis (TB) pathology ................................................................................ 1 1.2 Kinases: Phosphorylation of small molecules to proteins ........................................................ 2 1.2.1 Protein kinases.................................................................................................................... 4 1.2.2 Kinase groups and folds ..................................................................................................... 7 1.2.3 Nucleoside monophosphate (NMP) kinases .................................................................... 16 1.2.3.1. Shikimate kinase .......................................................................................................... 20 1.3 Shikimate pathway .................................................................................................................. 23 1.4 Natural products and drug discovery ...................................................................................... 26 1.4.1 By total synthesis ............................................................................................................. 26 1.4.2 By modification of existing scaffolds .............................................................................. 27 1.4.3 By immunoconjugation .................................................................................................... 28 1.4.4 Total synthesis of unmodified
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Interaction of Shikimic Acid with Shikimate Kinase
    BBRC Biochemical and Biophysical Research Communications 325 (2004) 10–17 www.elsevier.com/locate/ybbrc Interaction of shikimic acid with shikimate kinase Jose´ Henrique Pereiraa, Jaim Simo˜es de Oliveirab, Fernanda Canduria,c, Marcio Vinicius Bertacine Diasa,Ma´rio Se´rgio Palmac,d, Luiz Augusto Bassob, Walter Filgueira de Azevedo Jr.a,d,*, Dio´genes Santiago Santose,* a Department of Physics, UNESP, Sa˜o Jose´ do Rio Preto, SP 15054-000, Brazil b Rede Brasileira de Pesquisa em Tuberculose Grupo de Microbiologia Molecular e Funcional, Departamento de Biologia Molecular e Biotecnologia, UFRGS, Porto Alegre, RS 91501-970, Brazil c Center for Applied Toxinology, Institute Butantan, Sa˜o Paulo, SP 05503-900, Brazil d Laboratory of Structural Biology and Zoochemistry, CEIS/Department of Biology, Institute of Biosciences, UNESP, Rio Claro, SP 13506-900, Brazil e Centro de Pesquisa e Desenvolvimento em Biologia Molecular e Funcional, Pontifı´cia Universidade Cato´lica do Rio Grande do Sul, Porto Alegre, RS 90619-900, Brazil Received 24 September 2004 Available online 19 October 2004 Abstract The crystal structure of shikimate kinase from Mycobacterium tuberculosis (MtSK) complexed with MgADP and shikimic acid (shikimate) has been determined at 2.3 A˚ resolution, clearly revealing the amino acid residues involved in shikimate binding. In MtSK, the Glu61 strictly conserved in SK forms a hydrogen bond and salt-bridge with Arg58 and assists in positioning the guan- idinium group of Arg58 for shikimate binding. The carboxyl group of shikimate interacts with Arg58, Gly81, and Arg136, and hydroxyl groups with Asp34 and Gly80. The crystal structure of MtSK–MgADP–shikimate will provide crucial information for elucidation of the mechanism of SK-catalyzed reaction and for the development of a new generation of drugs against tuberculosis.
    [Show full text]
  • Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing
    [Show full text]
  • Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase
    J. Microbiol. Biotechnol. (2015), 25(12), 2034–2042 http://dx.doi.org/10.4014/jmb.1506.06020 Research Article Review jmb Enzymatic Manufacture of Deoxythymidine-5’-Triphosphate with Permeable Intact Cells of E. coli Coexpressing Thymidylate Kinase and Acetate Kinase Jiao Zhang, Yahui Qian, Qingbao Ding*, and Ling Ou* State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, P.R. China Received: June 8, 2015 Revised: July 26, 2015 A one-pot process of enzymatic synthesis of deoxythymidine-5’-triphosphate (5’-dTTP) Accepted: September 11, 2015 employing whole cells of recombinant Escherichia coli coexpressing thymidylate kinase (TMKase) and acetate kinase (ACKase) was developed. Genes tmk and ack from E. coli were First published online cloned and inserted into pET28a(+), and then transduced into E. coli BL21 (DE3) to form September 15, 2015 recombinant strain pTA in which TMKase and ACKase were simultaneously overexpressed. It *Corresponding authors was found that the relative residual specific activities of TMKase and ACKase, in pTA Q.D. pretreated with 20 mM ethylene diamine tetraacetic acid (EDTA) at 25oC for 30 min, were 94% Phone: +86-21-64250676; Fax: +86-21-64250676; and 96%, respectively. The yield of 5’-dTTP reached above 94% from 5 mM deoxythymidine E-mail: [email protected] 5’-monophosphate (5’-dTMP) and 15 mM acetyl phosphate catalyzed with intact cells of pTA L.O. Phone: +86-21-64253257; pretreated with EDTA. The process was so effective that only 0.125 mM adenosine-5’- Fax: +86-21-64253257; triphosphate was sufficient to deliver the phosphate group from acetyl phosphate to dTMP E-mail: [email protected] and dTDP.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Erwinia Chrysanthemi the Facts
    Erwinia chrysanthemi (Dickeya spp.) The Facts Compiled for the British Potato Council by; Dr John Elphinstone, Central Science Laboratory Dr Ian Toth, Scottish Crop Research Institute Erwinia chrysanthemi (Dickeya spp.) – The Facts Contents Executive Summary 1. Introduction 2. The pathogen 3. Symptoms • Distinction from symptoms caused by P. atrosepticum and P. carotovorum • Distinction from other diseases 4. Geographical distribution • Presence in GB • Europe • Overseas 5. Biology, survival and dissemination of the pathogen • Factors influencing disease development • Dissemination • Survival 6. Assessment of Risk and Economic Loss • Quarantine status • Potential GB economic impact • Economic impact to overseas markets 7. Control • Statutory (certification) • On farm • Specific approaches and control measures in other countries • Best practice guide 8. Diagnostic methods 9. Knowledge gaps 10. Threats, Opportunities and Recommendations 11. References 12. Glossary of terms 2 © British Potato Council 2007 Erwinia chrysanthemi (Dickeya spp.) – The Facts Executive Summary The pathogen Erwinia chrysanthemi (Echr) is a complex of different bacteria now reclassified as species of Dickeya. While D. dadantii and D. zeae (formerly Echr biovar 3 or 8) are pathogens of potato in warmer countries, D. dianthicola (formerly Echr biovar 1 and 7) appears to be spreading on potatoes in Europe. The revised nomenclature of these pathogens has distinguished them from other soft rot erwiniae (including P. atrosepticum and P. carotovorum). Symptoms Symptoms of soft rot disease on potato tubers are similar whether caused by Dickeya or Pectobacterium spp. In the field, disease develops following movement of either pathogen from the stem base. Whereas P. atrosepticum typically causes blackleg symptoms under cool wet conditions, symptoms due to Dickeya spp.
    [Show full text]
  • Genome-Scale Fitness Profile of Caulobacter Crescentus Grown in Natural Freshwater
    Supplemental Material Genome-scale fitness profile of Caulobacter crescentus grown in natural freshwater Kristy L. Hentchel, Leila M. Reyes Ruiz, Aretha Fiebig, Patrick D. Curtis, Maureen L. Coleman, Sean Crosson Tn5 and Tn-Himar: comparing gene essentiality and the effects of gene disruption on fitness across studies A previous analysis of a highly saturated Caulobacter Tn5 transposon library revealed a set of genes that are required for growth in complex PYE medium [1]; approximately 14% of genes in the genome were deemed essential. The total genome insertion coverage was lower in the Himar library described here than in the Tn5 dataset of Christen et al (2011), as Tn-Himar inserts specifically into TA dinucleotide sites (with 67% GC content, TA sites are relatively limited in the Caulobacter genome). Genes for which we failed to detect Tn-Himar insertions (Table S13) were largely consistent with essential genes reported by Christen et al [1], with exceptions likely due to differential coverage of Tn5 versus Tn-Himar mutagenesis and differences in metrics used to define essentiality. A comparison of the essential genes defined by Christen et al and by our Tn5-seq and Tn-Himar fitness studies is presented in Table S4. We have uncovered evidence for gene disruptions that both enhanced or reduced strain fitness in lake water and M2X relative to PYE. Such results are consistent for a number of genes across both the Tn5 and Tn-Himar datasets. Disruption of genes encoding three metabolic enzymes, a class C β-lactamase family protein (CCNA_00255), transaldolase (CCNA_03729), and methylcrotonyl-CoA carboxylase (CCNA_02250), enhanced Caulobacter fitness in Lake Michigan water relative to PYE using both Tn5 and Tn-Himar approaches (Table S7).
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Identification of Active Molecules Against Mycobacterial Shikimate
    Identification of active molecules against Mycobacterial Shikimate Kinase from Chemical library and their affinity with different domains Sapna Pandey1, Ekta Dhamija1, Sanjay Kumar1, Pragya Yadav1, Tadigopula Narender1, Arnava Dasgupta1, Ravishankar Ramachandran1, and KISHORE SRIVASTAVA1 1Central Drug Research Institute November 9, 2020 Abstract Tuberculosis (TB), regardless of being the oldest disease is still a menace that humans have not been able to control. With the advancement in the drug discovery programme, target-based drug discovery appears to be one of the promising techniques for the development of future therapeutics. It involves identifying an essential gene involved in the pathogenesis of the disease and then targeting the protein against a defined chemical library. Shikimate kinase is one such validated target in mycobacterium. It is vital for the growth of bacteria and is absent in mammals, making it an ideal drug target. Here 6427 compounds were screened through structure based virtual screening where compound S-014-1049 was found active against H37Rv and proven non-cytotoxic in in vitro studies. It specifically binds to the core domain of MTSK. Introduction The development of drug resistance is a severe threat to public health. Presently, use of antibiotics targets bacterial structure and essential functions. Due to the well-identified anti-mycobacterial resistance, there has been an increased interest in the discovery of novel drugs to target other essential processes of bacterial survival. Currently, target-based drug screening is promising and efficient way for development of therapeutic agents. In recent years, extensive efforts have been made for the discovery of inhibitors of enzymes involved in the biosynthesis of aromatic amino acids.
    [Show full text]