DOCSLIB.ORG

The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG (Under the Direction of Maor Bar-Peled) ABSTRACT The synthesis of polysaccharides, glycoproteins, glycolipids, glycosylated secondary metabolites and hormones requires a large number of glycosyltransferases and a constant supply of nucleotide sugars. In plants, photosynthesis and the NDP-sugar inter-conversion pathway are the major entry points to form NDP-sugars. In addition to these pathways is the salvage pathway, a less understood metabolism that provides the flux of NDP-sugars. This latter pathway involves the hydrolysis of glycans to free sugars, sugar transport, sugar phosphorylation and nucleotidylation. The balance between glycan synthesis and recycling as well as its regulation at various plant developmental stages remains elusive as many of the molecular components are unknown. To understand how the salvage pathway contributes to the sugar flux and cell wall biosynthesis, my research focused on the functional identification of salvage pathway sugar kinases and NDP-sugar pyrophosphorylases. This research led to the first identification and enzymatic characterization of galacturonic acid kinase (GalA kinase), galactokinase (GalK), a broad UDP-sugar pyrophosphorylase (sloppy), two promiscuous UDP-GlcNAc pyrophosphorylases (GlcNAc-1-P uridylyltransferases), as well as UDP-sugar pyrophosphorylase paralogs from Trypanosoma cruzi and Leishmania major. To evaluate the salvage pathway in plant biology, we further investigated a sugar kinase mutant: galacturonic acid kinase mutant (galak) and determined if and how galak KO mutant affects the synthesis of glycans in Arabidopsis. Feeding galacturonic acid to the seedlings exhibited a 40-fold accumulation of free GalA in galak mutant, while the wild type (WT) plant readily metabolizes the fed-sugar. These findings suggest that in vivo, the GalAK gene product functions to salvage GalA in Arabidopsis. Interestingly, the galak mutant showed no visible morphological phenotype compared to WT, and the cell wall sugar composition was not affected in the mutant. Immunohistochemical analysis of galak indicated no glycan structural changes in galak. The information gained indicates that the gene encoding GalAK is required for proper recycling of GalA in plant cell. However, knocking out GalAK is not detrimental for plant cell wall synthesis, plant growth and development. INDEX WORDS: Nucleotide sugar, Salvage pathway, Sugar kinase, Nucleotide sugar pyrophosphorylase, Galacturonic acid kinase, Galactokinase, GlcNAc-1-P uridylyltransferase, UDP-GlcNAc pyrophosphorylase, Sloppy, Arabidopsis thaliana THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG B.S., Jilin University, China, 2006 A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY ATHENS, GEORGIA 2011 © 2011 TING YANG All Rights Reserved THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG Major Professor: Maor Bar-Peled Committee: Kelley Moremen Michael Tiemeyer Zachary Wood Electronic Version Approved: Maureen Grasso Dean of the Graduate School The University of Georgia August 2011 DEDICATION I dedicate this work to my parents, for their love and encouragement; and to my husband, Tianhao He, for his caring support in my life. iv ACKNOWLEDGEMENTS I am deeply thankful to my major professor, Dr. Maor Bar-Peled, for his endless guidance and enthusiasm motivated me to the research. I would like to give my many thanks to all my committee members: Dr. Michael Tiemeyer, Dr. Kelley Moremen and Dr. Zachary Wood, for their support and valuable advice in my research. I am grateful for the help I received from Dr. John Glushka, for his guidance and assistance with the NMR experiments, I have learned much from him; I would also like to acknowledge Dr. Utku Avci, for his help with the immunohistochemistry assays; Dr. Yanbin Yin, for his help with the phylogeny analysis; Dr. Siva Kuma, for his help with the glycome profiling; I would also like to thank Dr. Malcolm O‟Neill for his assistance with the glycan analysis. In addition, I would like to thank all the present and former lab members who have shared their ideas with me, especially Dr. Xiaogang Gu, Dr. Yingnan Jiang and James Amor Smith, for their encouragement and great help in the research. I would like to show my gratitude to many undergraduate students who have worked with me: Andy Martin, Sung G Lee, Lindsey Gebhart and Ben Mullenbach; and to my best friends. v TABLE OF CONTENTS Page ACKNOWLEDGEMENTS .............................................................................................................v CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW .....................................................1 PART I: NUCLEOTIDE SUGAR BIOSYNTHETIC SALVAGE PATHWAY ....1 PART II: THE EFFECTS OF MUTANTS IN THE SALVAGE PATHWAY ON PLANT DEVELOPMENT ....................................................................................31 PART III: COMPARATIVE ANALYSIS OF PROTEIN DOMAINS OF SUGAR KINASES AND NUCLEOTIDE SUGAR PYROPHOSPHORYLASES IN PLANTS ................................................................................................................36 PART IV: THESIS OVERVIEW ..........................................................................54 2 IDENTIFICATION OF GALACTURONIC ACID-1-PHOSPHATE KINASE, A NEW MEMBER OF THE GHMP KINASE SUPERFAMILY IN PLANTS, AND COMPARISON WITH GALACTOSE-1-PHOSPHATE KINASE ......................55 ABSTRACT ...........................................................................................................56 INTRODUCTION .................................................................................................57 EXPERIMENTAL PROCEDURES ......................................................................58 RESULTS ..............................................................................................................66 DISCUSSION ........................................................................................................91 vi 3 IDENTIFICATION OF A NOVEL UDP-SUGAR PYROPHOSPHORYLASE WITH A BROAD SUBSTRATE SPECIFICITY IN TRYPANOSOMA CRUZI ..............96 ABSTRACT ...........................................................................................................97 INTRODUCTION .................................................................................................98 EXPERIMENTAL PROCEDURES ....................................................................100 RESULTS ............................................................................................................105 DISCUSSION ......................................................................................................127 4 IDENTIFICATION AND CHARACTERIZATION OF A STRICT AND OF A PROMISCUOUS N-ACETYLGLUCOSAMINE-1-P URIDYLYLTRANSFERASES IN ARABIDOPSIS ............................................132 ABSTRACT .........................................................................................................133 INTRODUCTION ...............................................................................................134 EXPERIMENTAL PROCEDURES ....................................................................138 RESULTS ............................................................................................................143 DISCUSSION ......................................................................................................169 5 THE ROLE OF GALAK IN GLYCAN METABOLISM .........................................173 ABSTRACT .........................................................................................................174 INTRODUCTION ...............................................................................................175 EXPERIMENTAL PROCEDURES ....................................................................176 RESULTS ............................................................................................................184 DISCUSSION ......................................................................................................202 6 CONCLUSIONS........................................................................................................205 REFERENCES ............................................................................................................................207 vii APPENDICES A SUPPLEMENTAL FIGURES AND TABLES .........................................................232 B SUMMARY OF PRIMERS, ANTIBODIES, CLONING CONSTRUCTS AND TRANSGENIC PLANTS .........................................................................................260 viii CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW PART I: NUCLEOTIDE SUGAR BIOSYNTHETIC SALVAGE PATHWAY Introduction - Multiple routes for the synthesis of NDP-sugars Nucleotide sugars (Fig. 1.1, abbreviated NDP-sugars) are the substrates for the synthesis of polysaccharides, glycoproteins, glycolipids, glycoside-linked secondary metabolites and hormones. The biosynthesis of nucleotide sugars in plants is complicated and can be achieved via several pathways (Fig. 1.2): the inter-conversion pathway converts pre-existing NDP-sugars to other NDP-sugars (Reiter and Vanzin, 2001; Mohnen, 2002; Bar-Peled
Load more

Recommended publications
  • Bacteria Belonging to Pseudomonas Typographi Sp. Nov. from the Bark Beetle Ips Typographus Have Genomic Potential to Aid in the Host Ecology
    insects Article Bacteria Belonging to Pseudomonas typographi sp. nov. from the Bark Beetle Ips typographus Have Genomic Potential to Aid in the Host Ecology Ezequiel Peral-Aranega 1,2 , Zaki Saati-Santamaría 1,2 , Miroslav Kolaˇrik 3,4, Raúl Rivas 1,2,5 and Paula García-Fraile 1,2,4,5,* 1 Microbiology and Genetics Department, University of Salamanca, 37007 Salamanca, Spain; [email protected] (E.P.-A.); [email protected] (Z.S.-S.); [email protected] (R.R.) 2 Spanish-Portuguese Institute for Agricultural Research (CIALE), 37185 Salamanca, Spain 3 Department of Botany, Faculty of Science, Charles University, Benátská 2, 128 01 Prague, Czech Republic; [email protected] 4 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the Academy of Sciences of the Czech Republic, 142 20 Prague, Czech Republic 5 Associated Research Unit of Plant-Microorganism Interaction, University of Salamanca-IRNASA-CSIC, 37008 Salamanca, Spain * Correspondence: [email protected] Received: 4 July 2020; Accepted: 1 September 2020; Published: 3 September 2020 Simple Summary: European Bark Beetle (Ips typographus) is a pest that affects dead and weakened spruce trees. Under certain environmental conditions, it has massive outbreaks, resulting in attacks of healthy trees, becoming a forest pest. It has been proposed that the bark beetle’s microbiome plays a key role in the insect’s ecology, providing nutrients, inhibiting pathogens, and degrading tree defense compounds, among other probable traits. During a study of bacterial associates from I. typographus, we isolated three strains identified as Pseudomonas from different beetle life stages. In this work, we aimed to reveal the taxonomic status of these bacterial strains and to sequence and annotate their genomes to mine possible traits related to a role within the bark beetle holobiont.
    [Show full text]
  • Fluorinated Mannosides Inhibit Cellular Fucosylation
    Fluorinated mannosides inhibit cellular fucosylation. Johan F.A. Pijnenborg[a],†, Emiel Rossing[a],†, Marek Noga[b], Willem Titulaer[a], Raisa Veizaj[c], Dirk J. Lefeber[b,c] and Thomas J. Boltje*[a] [a] J.F.A. Pijnenborg, E. Rossing, W. Titulaer, Dr. T.J. Boltje Department of Synthetic Organic Chemistry Institute for Molecules and Materials, Radboud University Heyendaalseweg 135, 6525AJ, Nijmegen, The Netherlands [email protected] [b] Dr. M. Noga, Prof. D.J. Lefeber Department of Laboratory Medicine, Translational Metabolic Laboratory Radboud Institute for Molecular Life Sciences, Radboud University Medical Center Geert Grooteplein Zuid 10, 6525GA, Nijmegen, The Netherlands [c] R. Veizaj, Prof. D.J. Lefeber Department of Neurology Donders Institute for Brain, Cognition and Behavior, Radboud University Medical Center Geert Grooteplein Zuid 10, 6525GA, Nijmegen, The Netherlands [†] These authors contributed equally to this work. Supporting information for this article is given via a link at the end of the document. Abstract: Fucose sugars are expressed on mammalian cell L-Fucose (Fuc) is a 6-deoxyhexose expressed at the termini of glycan membranes as part of glycoconjugates and mediates essential chains that decorate cell surface proteins and lipids.1 The fucose physiological processes. The aberrant expression of fucosylated residues on glycoconjugates are essential mediators of physiological glycans has been linked to pathologies such as cancer, inflammation, processes. For example, the fucose moiety in the tetrasaccharide infection, and genetic disorders. Tools to modulate fucose expression sialyl Lewisx (sLex) expressed on leukocytes is recognized by selectin on living cells are needed to elucidate the biological role of fucose receptors that regulate leukocyte recruitment and extravasation.
    [Show full text]
  • Interaction of Shikimic Acid with Shikimate Kinase
    BBRC Biochemical and Biophysical Research Communications 325 (2004) 10–17 www.elsevier.com/locate/ybbrc Interaction of shikimic acid with shikimate kinase Jose´ Henrique Pereiraa, Jaim Simo˜es de Oliveirab, Fernanda Canduria,c, Marcio Vinicius Bertacine Diasa,Ma´rio Se´rgio Palmac,d, Luiz Augusto Bassob, Walter Filgueira de Azevedo Jr.a,d,*, Dio´genes Santiago Santose,* a Department of Physics, UNESP, Sa˜o Jose´ do Rio Preto, SP 15054-000, Brazil b Rede Brasileira de Pesquisa em Tuberculose Grupo de Microbiologia Molecular e Funcional, Departamento de Biologia Molecular e Biotecnologia, UFRGS, Porto Alegre, RS 91501-970, Brazil c Center for Applied Toxinology, Institute Butantan, Sa˜o Paulo, SP 05503-900, Brazil d Laboratory of Structural Biology and Zoochemistry, CEIS/Department of Biology, Institute of Biosciences, UNESP, Rio Claro, SP 13506-900, Brazil e Centro de Pesquisa e Desenvolvimento em Biologia Molecular e Funcional, Pontifı´cia Universidade Cato´lica do Rio Grande do Sul, Porto Alegre, RS 90619-900, Brazil Received 24 September 2004 Available online 19 October 2004 Abstract The crystal structure of shikimate kinase from Mycobacterium tuberculosis (MtSK) complexed with MgADP and shikimic acid (shikimate) has been determined at 2.3 A˚ resolution, clearly revealing the amino acid residues involved in shikimate binding. In MtSK, the Glu61 strictly conserved in SK forms a hydrogen bond and salt-bridge with Arg58 and assists in positioning the guan- idinium group of Arg58 for shikimate binding. The carboxyl group of shikimate interacts with Arg58, Gly81, and Arg136, and hydroxyl groups with Asp34 and Gly80. The crystal structure of MtSK–MgADP–shikimate will provide crucial information for elucidation of the mechanism of SK-catalyzed reaction and for the development of a new generation of drugs against tuberculosis.
    [Show full text]
  • An Atpase Domain Common to Prokaryotic Cell Cycle Proteins
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 7290-7294, August 1992 Biochemistry An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp7O heat shock proteins (structural comparison/property pattern/remote homology) PEER BORK, CHRIS SANDER, AND ALFONSO VALENCIA European Molecular Biology Laboratory, D-6900 Heidelberg, Federal Republic of Germany Communicated by Russell F. Doolittle, March 6, 1992 ABSTRACT The functionally diverse actin, hexokinase, and hsp7O protein families have in common an ATPase domain of known three-dimensional structure. Optimal superposition ofthe three structures and alignment ofmany sequences in each of the three families has revealed a set of common conserved residues, distributed in five sequence motifs, which are in- volved in ATP binding and in a putative interdomain hinge. From the multiple sequence aliment in these motifs a pattern of amino acid properties required at each position is defined. The discriminatory power of the pattern is in part due to the use of several known three-dimensional structures and many sequences and in part to the "property" method ofgeneralizing from observed amino acid frequencies to amino acid fitness at each sequence position. A sequence data base search with the pattern significantly matches sugar kinases, such as fuco-, glucono-, xylulo-, ribulo-, and glycerokinase, as well as the prokaryotic cell cycle proteins MreB, FtsA, and StbA. These are predicted to have subdomains with the same tertiary structure as the ATPase subdomains Ia and Ha of hexokinase, actin, and Hsc7O, a very similar ATP binding pocket, and the capacity for interdomain hinge motion accompanying func- tional state changes.
    [Show full text]
  • Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of
    Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress.
    [Show full text]
  • Adaptive Laboratory Evolution Enhances Methanol Tolerance and Conversion in Engineered Corynebacterium Glutamicum
    ARTICLE https://doi.org/10.1038/s42003-020-0954-9 OPEN Adaptive laboratory evolution enhances methanol tolerance and conversion in engineered Corynebacterium glutamicum Yu Wang 1, Liwen Fan1,2, Philibert Tuyishime1, Jiao Liu1, Kun Zhang1,3, Ning Gao1,3, Zhihui Zhang1,3, ✉ ✉ 1234567890():,; Xiaomeng Ni1, Jinhui Feng1, Qianqian Yuan1, Hongwu Ma1, Ping Zheng1,2,3 , Jibin Sun1,3 & Yanhe Ma1 Synthetic methylotrophy has recently been intensively studied to achieve methanol-based biomanufacturing of fuels and chemicals. However, attempts to engineer platform micro- organisms to utilize methanol mainly focus on enzyme and pathway engineering. Herein, we enhanced methanol bioconversion of synthetic methylotrophs by improving cellular tolerance to methanol. A previously engineered methanol-dependent Corynebacterium glutamicum is subjected to adaptive laboratory evolution with elevated methanol content. Unexpectedly, the evolved strain not only tolerates higher concentrations of methanol but also shows improved growth and methanol utilization. Transcriptome analysis suggests increased methanol con- centrations rebalance methylotrophic metabolism by down-regulating glycolysis and up- regulating amino acid biosynthesis, oxidative phosphorylation, ribosome biosynthesis, and parts of TCA cycle. Mutations in the O-acetyl-L-homoserine sulfhydrylase Cgl0653 catalyzing formation of L-methionine analog from methanol and methanol-induced membrane-bound transporter Cgl0833 are proven crucial for methanol tolerance. This study demonstrates the importance of
    [Show full text]
  • Supplementary Material Gram-Scale Production of Sugar Nucleotides And
    Electronic Supplementary Material (ESI) for Green Chemistry. This journal is © The Royal Society of Chemistry 2021 Supplementary Material Gram-scale production of sugar nucleotides and their derivatives Shuang Li[a]#, Shuaishuai Wang[b]#, Yaqian Wang[a], Jingyao Qu[c], Xian-wei Liu[a], Peng George Wang[d], and Junqiang Fang*[a] [a] Junqiang Fang, Shuang Li, Yaqian Wang, Xian-wei Liu National Glycoengineering Research Center, Shandong Provincial Key Laboratory of Glycochemistry and Glycobiology, Shandong University, Qingdao, Shandong 266237, People’s Republic of China *Email: [email protected] [b] Shuaishuai Wang Department of Chemistry, George State University, Atlanta, GA, 30302-4098, US [c] Jingyao Qu State Key Laboratory of Microbial Technology, Shandong University, Qingdao, Shandong 266237, People’s Republic of China [d] Peng George Wang School of Medicine, Southern University of Science and Technology, Shenzhen, Guangdong 518055, People’s Republic of China # These authors contributed equally to this paper. I. Supplementary Figures..................................................................................................................................1 Figure S1. Effects of GlcNAc substrate concentration on conversion rate of UDP-GlcNAc......................1 Figure S2. Effect of buffer sytem on enzymatic conversion rate of UDP-GlcNAc.....................................1 Figure S3. Evaluation of recovery and recyclability of enzymes for UDP-GlcNAc...................................1 Table S1. Enzymes used in this work
    [Show full text]
  • Mrna Vaccine Era—Mechanisms, Drug Platform and Clinical Prospection
    International Journal of Molecular Sciences Review mRNA Vaccine Era—Mechanisms, Drug Platform and Clinical Prospection 1, 1, 2 1,3, Shuqin Xu y, Kunpeng Yang y, Rose Li and Lu Zhang * 1 State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200438, China; [email protected] (S.X.); [email protected] (K.Y.) 2 M.B.B.S., School of Basic Medical Sciences, Peking University Health Science Center, Beijing 100191, China; [email protected] 3 Shanghai Engineering Research Center of Industrial Microorganisms, Shanghai 200438, China * Correspondence: [email protected]; Tel.: +86-13524278762 These authors contributed equally to this work. y Received: 30 July 2020; Accepted: 30 August 2020; Published: 9 September 2020 Abstract: Messenger ribonucleic acid (mRNA)-based drugs, notably mRNA vaccines, have been widely proven as a promising treatment strategy in immune therapeutics. The extraordinary advantages associated with mRNA vaccines, including their high efficacy, a relatively low severity of side effects, and low attainment costs, have enabled them to become prevalent in pre-clinical and clinical trials against various infectious diseases and cancers. Recent technological advancements have alleviated some issues that hinder mRNA vaccine development, such as low efficiency that exist in both gene translation and in vivo deliveries. mRNA immunogenicity can also be greatly adjusted as a result of upgraded technologies. In this review, we have summarized details regarding the optimization of mRNA vaccines, and the underlying biological mechanisms of this form of vaccines. Applications of mRNA vaccines in some infectious diseases and cancers are introduced. It also includes our prospections for mRNA vaccine applications in diseases caused by bacterial pathogens, such as tuberculosis.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • Downloaded in February 2021) (Boeckmann Et Al., 2003)
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.16.456528; this version posted August 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Deciphering Rubber Tree Growth Using Network-Based Multi Omics Approaches Felipe Roberto Francisco1†, Alexandre Hild Aono 1†, Carla Cristina da Silva1, Paulo de Souza Gonçalves2, Erivaldo José Scaloppi Junior2, Vincent Le Guen3, Roberto Fritsche Neto4, Livia Moura Souza1,5, Anete Pereira de Souza1,6* 1Molecular Biology and Genetic Engineering Center (CBMEG), University of Campinas (UNICAMP), Campinas, Brazil 2Center of Rubber Tree and Agroforestry Systems, Agronomic Institute (IAC), Votuporanga, Brazil 3Centre de Coopération Internationale en Recherche Agronomique pour le Développement (CIRAD), UMR AGAP, Montpellier, France 4Department of Genetics, Luiz de Queiroz College of Agriculture (ESALQ), University of São Paulo (USP), Piracicaba, São Paulo, Brazil 5São Francisco University (USF), Itatiba, Brazil 6Department of Plant Biology, Biology Institute, University of Campinas (UNICAMP), Campinas, Brazil †These authors have contributed equally to this work * Correspondence: Anete Pereira de Souza [email protected] Number of Words: 8909 Number of Figures: 7 Number of Tables: 1 Keywords: GBS, GWAS, Hevea brasiliensis, linkage disequilibrium, metabolic networks, QTL, RNA-Seq, WGCNA Abstract Hevea brasiliensis (rubber tree) is a large tree species of the Euphorbiaceae family with inestimable economic importance. Rubber tree breeding programs currently aim to improve growth and production, and the use of early genotype selection technologies can accelerate such processes, mainly with the incorporation of genomic tools, such as marker-assisted selection (MAS).
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]