DOCSLIB.ORG

Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening

Gene Symbol

ACVR1B ADCK2 ADCK4 AGK

Gene Description

activin A receptor, type IB aarF domain containing kinase 2 aarF domain containing kinase 4 multiple substrate lipid kinase;MULK

  • AK1
  • adenylate kinase 1

  • AK3
  • adenylate kinase 3 like 1

AK3L1 ALDH18A1 ALK adenylate kinase 3 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 anaplastic lymphoma kinase (Ki-1)
ALPK1 ALPK2 AMHR2 ARAF alpha-kinase 1 alpha-kinase 2 anti-Mullerian hormone receptor, type II v-raf murine sarcoma 3611 viral oncogene homolog 1

  • arylsulfatase G;ARSG
  • ARSG

AURKB AURKC BCKDK BMPR1A BMPR2 BRAF aurora kinase B aurora kinase C branched chain alpha-ketoacid dehydrogenase kinase bone morphogenetic protein receptor, type IA bone morphogenetic protein receptor, type II (serine/threonine kinase) v-raf murine sarcoma viral oncogene homolog B1

  • bromodomain containing 3
  • BRD3

  • BRD4
  • bromodomain containing 4

  • BTK
  • Bruton agammaglobulinemia tyrosine kinase

BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) chromosome 9 open reading frame 98;C9orf98 chaperone, ABC1 activity of bc1 complex like (S. pombe) calmodulin 1 (phosphorylase kinase, delta) calmodulin 2 (phosphorylase kinase, delta) calmodulin 3 (phosphorylase kinase, delta) calcium/calmodulin-dependent protein kinase I calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha calcium/calmodulin-dependent protein kinase (CaM kinase) II beta calcium/calmodulin-dependent protein kinase IV calcium/calmodulin-dependent serine protein kinase (MAGUK family) chemokine (C-C motif) ligand 2;CCL2 chemokine (C-C motif) ligand 4;CCL4 cyclin-dependent kinase 3
BUB1 BUB1B C9orf98 CABC1 CALM1 CALM2 CALM3 CAMK1 CAMK2A CAMK2B CAMK4 CASK CCL2 CCL4 CDK3

  • CDK4
  • cyclin-dependent kinase 4

  • CDK5
  • cyclin-dependent kinase 5

  • CDK5R1
  • cyclin-dependent kinase 5, regulatory subunit 1 (p35)

  • CDK7
  • cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk-activating kinase)

  • cyclin-dependent kinase-like 3
  • CDKL3

CDKL4 CHEK1 CIB1 cyclin-dependent kinase-like 4 CHK1 checkpoint homolog (S. pombe) calcium and integrin binding 1 (calmyrin);CIB1 calcium and integrin binding family member 4;CIB4 creatine kinase, brain
CIB4 CKB

  • CKM
  • creatine kinase, muscle

CKMT1A CKMT2 CKS2 creatine kinase, mitochondrial 1A;CKMT1A creatine kinase, mitochondrial 2 (sarcomeric) CDC28 protein kinase regulatory subunit 2

  • CDC-like kinase 1
  • CLK1

  • CLK2
  • CDC-like kinase 2

COASY CRKL
Coenzyme A synthase;COASY v-crk sarcoma virus CT10 oncogene homolog (avian)-like;CRKL

  • casein kinase 1, delta
  • CSNK1D

CSNK1E CSNK1G1 CSNK1G2 CSNK1G3 CSNK2B DAK casein kinase 1, epsilon casein kinase 1, gamma 1 casein kinase 1, gamma 2 casein kinase 1, gamma 3 casein kinase 2, beta polypeptide dihydroxyacetone kinase 2 homolog (S. cerevisiae);DAK

  • death-associated protein kinase 2
  • DAPK2

DCAKD DCAMKL2 DCK dephospho-CoA kinase domain containing;DCAKD hypothetical protein MGC45428 deoxycytidine kinase

  • DGKB
  • diacylglycerol kinase, beta 90kDa

  • DGKK
  • diacylglycerol kinase, kappa;DGKK

  • deoxyguanosine kinase
  • DGUOK

  • DLG3
  • discs, large homolog 3 (neuroendocrine-dlg, Drosophila);DLG3

deoxythymidylate kinase (thymidylate kinase) dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 eukaryotic elongation factor-2 kinase EPH receptor A2
DTYMK DYRK1B DYRK2 EEF2K EPHA2 EPHB1 EPHB6 ERBB2 ERBB3 ERBB4 ERN1
EPH receptor B1 EPH receptor B6 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) endoplasmic reticulum to nucleus signalling 1

  • ethanolamine kinase 2
  • ETNK2

  • FASTK
  • FAST kinase

FASTKD1 FASTKD5 FER
FAST kinase domains 1;FASTKD1 FAST kinase domains 5;FASTKD5 fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94)

  • fibroblast growth factor receptor 2
  • FGFR2

FGFRL1 FGGY fibroblast growth factor receptor-like 1;FGFRL1 hypothetical protein FLJ10986;FLJ10986 Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog hypothetical protein FLJ23356
FGR FLJ23356 FLJ25006 FLJ40852 FLT3 hypothetical protein FLJ25006 hypothetical protein FLJ40852 fms-related tyrosine kinase 3

  • FN3K
  • fructosamine 3 kinase

  • FXN
  • frataxin;FXN

GALK1 GALK2 GRK7 galactokinase 1 galactokinase 2 G protein-coupled receptor kinase 7
GSK3A GSK3B glycogen synthase kinase 3 alpha glycogen synthase kinase 3 beta
GTF2H1 HCK general transcription factor IIH, polypeptide 1, 62kDa;GTF2H1 hemopoietic cell kinase

  • HIPK1
  • homeodomain interacting protein kinase 1

homeodomain interacting protein kinase 3 homeodomain interacting protein kinase 4 inositol hexaphosphate kinase 3
HIPK3 HIPK4 IHPK3

  • IKBKE
  • inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon

  • insulin receptor-related receptor
  • INSRR

  • IRAK2
  • interleukin-1 receptor-associated kinase 2

interleukin-1 receptor-associated kinase 4 integrin beta 1 binding protein 3;ITGB1BP3 inositol 1,4,5-trisphosphate 3-kinase B ketohexokinase (fructokinase)
IRAK4 ITGB1BP3 ITPKB KHK

  • KSR2
  • kinase suppressor of Ras-2

  • LATS1
  • LATS, large tumor suppressor, homolog 1 (Drosophila)

  • LIM domain kinase 1
  • LIMK1

LOC388957 LOC389599 LOC54103 LOC646505 LOC647279 LOC648152 LOC652799 LOC653052 LOC653155 similar to BMP2 inducible kinase similar to amyotrophic lateral sclerosis 2 chromosome region hypothetical protein LOC54103;LOC54103 similar to Dual specificity protein kinase CLK3 (CDC-like kinase 3) similar to MAP/microtubule affinity-regulating kinase 3 similar to ataxia telangiectasia and Rad3 related protein similar to Mast/stem cell growth factor receptor precursor (SCFR) similar to Homeodomain-interacting protein kinase 2 (hHIPk2) similar to PRP4 pre-mRNA processing factor 4 homolog B
LOC727761 LOC732306 LOC91461 LRGUK LRPPRC LYN similar to deoxythymidylate kinase (thymidylate kinase) similar to vaccinia related kinase 2 hypothetical protein BC007901 leucine-rich repeats and guanylate kinase domain containing;LRGUK leucine-rich PPR-motif containing;LRPPRC v-yes-1 Yamaguchi sarcoma viral related oncogene homolog

  • male germ cell-associated kinase
  • MAK

MAP2K1 MAP2K1IP1 MAP2K2 MAP2K5 MAP2K6 MAP3K11 MAP3K14 MAP3K2 MAP3K6 MAP3K8 MAP4K1 MAP4K5 MAPK1 MAPK12 MAPK13 MAPK14 MAPK3 MAPK6 MAPK9 MAPKAPK2 MARK2 MARK3 MAST2 MASTL MATK mitogen-activated protein kinase kinase 1 mitogen-activated protein kinase kinase 1 interacting protein 1 mitogen-activated protein kinase kinase 2 mitogen-activated protein kinase kinase 5 mitogen-activated protein kinase kinase 6 mitogen-activated protein kinase kinase kinase 11 mitogen-activated protein kinase kinase kinase 14 mitogen-activated protein kinase kinase kinase 2 mitogen-activated protein kinase kinase kinase 6 mitogen-activated protein kinase kinase kinase 8 mitogen-activated protein kinase kinase kinase kinase 1 mitogen-activated protein kinase kinase kinase kinase 5 mitogen-activated protein kinase 1 mitogen-activated protein kinase 12 mitogen-activated protein kinase 13 mitogen-activated protein kinase 14;p38 mitogen-activated protein kinase 3 mitogen-activated protein kinase 6 mitogen-activated protein kinase 9 mitogen-activated protein kinase-activated protein kinase 2 MAP/microtubule affinity-regulating kinase 2 MAP/microtubule affinity-regulating kinase 3 microtubule associated serine/threonine kinase 2 microtubule associated serine/threonine kinase-like megakaryocyte-associated tyrosine kinase

  • MET
  • met proto-oncogene (hepatocyte growth factor receptor)

  • hypothetical protein MGC16169
  • MGC16169

  • MINK1
  • misshapen/NIK-related kinase

MKNK1 MKNK2 MORN2 MOS
MAP kinase interacting serine/threonine kinase 1 MAP kinase interacting serine/threonine kinase 2 MORN repeat containing 2;MORN2 v-mos Moloney murine sarcoma viral oncogene homolog membrane protein, palmitoylated 1, 55kDa;MPP1 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2);MPP2 membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3);MPP3 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5);MPP5
MPP1 MPP2 MPP3 MPP5

  • MVK
  • mevalonate kinase (mevalonic aciduria)

  • myosin light chain kinase (MLCK)
  • MYLK3

  • NADK
  • NAD kinase

NEK11 NEK2
NIMA (never in mitosis gene a)- related kinase 11 NIMA (never in mitosis gene a)-related kinase 2 NIMA (never in mitosis gene a)-related kinase 3 NIMA (never in mitosis gene a)- related kinase 8 NIMA (never in mitosis gene a)- related kinase 9 nucleoside-diphosphate kinase 1
NEK3 NEK8 NEK9 NME1 NME1-NME2 NME2
NME1-NME2 protein;NME1-NME2 nucleoside-diphosphate kinase 2

  • NME6
  • non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)

non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) nuclear receptor binding protein
NME7 NRBP NUP62 NYD-SP25 PAK1 nucleoporin 62kDa;NUP62 protein kinase NYD-SP25 p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)

  • p21(CDKN1A)-activated kinase 7
  • PAK7

PANK2 PANK3 PANK4 PAPSS2 PCK2 pantothenate kinase 2 (Hallervorden-Spatz syndrome) pantothenate kinase 3 pantothenate kinase 4 3'-phosphoadenosine 5'-phosphosulfate synthase 2;PAPSS2 phosphoenolpyruvate carboxykinase 2 (mitochondrial)

  • PDLIM1 interacting kinase 1 like
  • PDIK1L

  • PDK1
  • pyruvate dehydrogenase kinase, isoenzyme 1

pyruvate dehydrogenase kinase, isoenzyme 2 pyruvate dehydrogenase kinase, isoenzyme 3 pyruvate dehydrogenase kinase, isoenzyme 4 pyridoxal (pyridoxine, vitamin B6) kinase phosphofructokinase, liver
PDK2 PDK3 PDK4 PDXK PFKL

  • PFKM
  • phosphofructokinase, muscle

  • PFKP
  • phosphofructokinase, platelet

PHKG1 PHKG2 PI4K2B PI4KII phosphorylase kinase, gamma 1 (muscle) phosphorylase kinase, gamma 2 (testis) phosphatidylinositol 4-kinase type-II beta phosphatidylinositol 4-kinase type II
PIK3C3 PIK3CB PIK3CG PIK3R4 PIK4CA PIK4CB PIM1 phosphoinositide-3-kinase, class 3 phosphoinositide-3-kinase, catalytic, beta polypeptide phosphoinositide-3-kinase, catalytic, gamma polypeptide phosphoinositide-3-kinase, regulatory subunit 4, p150 phosphatidylinositol 4-kinase, catalytic, alpha polypeptide phosphatidylinositol 4-kinase, catalytic, beta polypeptide pim-1 oncogene

  • PINK1
  • PTEN induced putative kinase 1

PIP5K1B PIP5K2A PIP5K2C PIP5K3 PKLR phosphatidylinositol-4-phosphate 5-kinase, type I, beta phosphatidylinositol-4-phosphate 5-kinase, type II, alpha phosphatidylinositol-4-phosphate 5-kinase, type II, gamma phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III pyruvate kinase, liver and RBC
PKMYT1 PLAU membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase plasminogen activator, urokinase

  • PLK1
  • polo-like kinase 1 (Drosophila)

PLXNA3 PLXNB2 PMVK plexin A3;PLXNA3 plexin B2;PLXNB2 phosphomevalonate kinase

  • PNKP
  • polynucleotide kinase 3'-phosphatase

PRKACA PRKACB PRKACG PRKAG2 PRKAG3 protein kinase, cAMP-dependent, catalytic, alpha protein kinase, cAMP-dependent, catalytic, beta protein kinase, cAMP-dependent, catalytic, gamma protein kinase, AMP-activated, gamma 2 non-catalytic subunit protein kinase, AMP-activated, gamma 3 non-catalytic subunit protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher

  • 1)
  • PRKAR1A

PRKAR1B PRKAR2B PRKCB1 PRKCE PRKCQ PRKCZ PRKD1 PRKD2 PRKG1 PRKR protein kinase, cAMP-dependent, regulatory, type I, beta protein kinase, cAMP-dependent, regulatory, type II, beta protein kinase C, beta 1 protein kinase C, epsilon protein kinase C, theta protein kinase C, zeta protein kinase D1 protein kinase D2 protein kinase, cGMP-dependent, type I protein kinase, interferon-inducible double stranded RNA dependent

  • protein kinase, X-linked
  • PRKX

  • PRKY
  • protein kinase, Y-linked

PRPF4B PRPS1 PRPS2 PSKH1 PTK6
PRP4 pre-mRNA processing factor 4 homolog B (yeast) phosphoribosyl pyrophosphate synthetase 1;PRPS1 phosphoribosyl pyrophosphate synthetase 2;PRPS2 protein serine kinase H1 PTK6 protein tyrosine kinase 6

  • PXK
  • PX domain containing serine/threonine kinase

  • RIO kinase 1 (yeast)
  • RIOK1

  • RIOK3
  • RIO kinase 3 (yeast)

RKHD3 ROR2 ring finger and KH domain containing 3;RKHD3 receptor tyrosine kinase-like orphan receptor 2 ribosomal protein S6 kinase, 90kDa, polypeptide 1 ribosomal protein S6 kinase, 70kDa, polypeptide 1
RPS6KA1 RPS6KB1 RPS6KB2 SCYL2 SCYL3 SGK ribosomal protein S6 kinase, 70kDa, polypeptide 2 hypothetical protein FLJ10074 ezrin-binding partner PACE-1 serum/glucocorticoid regulated kinase serum/glucocorticoid regulated kinase-like SH3-binding domain protein 5-like;SH3BP5L SLAM family member 6;SLAMF6 sphingosine kinase 1
SGK3 SH3BP5L SLAMF6 SPHK1 SPHK2 SRC sphingosine kinase 2 v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)

  • SFRS protein kinase 1
  • SRPK1

SRPK2 STK16 STK17B STK3
SFRS protein kinase 2 serine/threonine kinase 16 serine/threonine kinase 17b (apoptosis-inducing) serine/threonine kinase 3 (STE20 homolog, yeast)

  • serine/threonine kinase 32A
  • STK32A

STK32C STK33 STK40 STYK1 SYK serine/threonine kinase 32C serine/threonine kinase 33 Ser/Thr-like kinase protein kinase STYK1 spleen tyrosine kinase
TAOK3 TEC
TAO kinase 3 tec protein tyrosine kinase
TESK1 TESK2 TGFBR3 TK1 testis-specific kinase 1 testis-specific kinase 2 transforming growth factor, beta receptor III (betaglycan, 300kDa);TGFBR3 thymidine kinase 1, soluble

  • TLK1
  • tousled-like kinase 1

TP53RK TRIB1 TRIB2 TSSK1 TSSK3 TTK
TP53 regulating kinase tribbles homolog 1 (Drosophila) tribbles homolog 2 (Drosophila) serine/threonine kinase 22D (spermiogenesis associated) serine/threonine kinase 22C (spermiogenesis associated) TTK protein kinase

  • TXK
  • TXK tyrosine kinase

TXNDC3 TYK2 thioredoxin domain containing 3 (spermatozoa);TXNDC3 tyrosine kinase 2

  • ULK2
  • unc-51-like kinase 2 (C. elegans)

  • vaccinia related kinase 1
  • VRK1

WNK1 WNK4 ZAK protein kinase, lysine deficient 1 protein kinase, lysine deficient 4 sterile alpha motif and leucine zipper containing kinase AZK

  • zeta-chain (TCR) associated protein kinase 70kDa
  • ZAP70

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Reframing Psychiatry for Precision Medicine

    Reframing Psychiatry for Precision Medicine

    Reframing Psychiatry for Precision Medicine Elizabeth B Torres 1,2,3* 1 Rutgers University Department of Psychology; [email protected] 2 Rutgers University Center for Cognitive Science (RUCCS) 3 Rutgers University Computer Science, Center for Biomedicine Imaging and Modelling (CBIM) * Correspondence: [email protected]; Tel.: (011) +858-445-8909 (E.B.T) Supplementary Material Sample Psychological criteria that sidelines sensory motor issues in autism: The ADOS-2 manual [1, 2], under the “Guidelines for Selecting a Module” section states (emphasis added): “Note that the ADOS-2 was developed for and standardized using populations of children and adults without significant sensory and motor impairments. Standardized use of any ADOS-2 module presumes that the individual can walk independently and is free of visual or hearing impairments that could potentially interfere with use of the materials or participation in specific tasks.” Sample Psychiatric criteria from the DSM-5 [3] that does not include sensory-motor issues: A. Persistent deficits in social communication and social interaction across multiple contexts, as manifested by the following, currently or by history (examples are illustrative, not exhaustive, see text): 1. Deficits in social-emotional reciprocity, ranging, for example, from abnormal social approach and failure of normal back-and-forth conversation; to reduced sharing of interests, emotions, or affect; to failure to initiate or respond to social interactions. 2. Deficits in nonverbal communicative behaviors used for social interaction, ranging, for example, from poorly integrated verbal and nonverbal communication; to abnormalities in eye contact and body language or deficits in understanding and use of gestures; to a total lack of facial expressions and nonverbal communication.
  • Familial Juvenile Polyposis Syndrome with a De Novo Germline Missense Variant in BMPR1A Gene: a Case Report Qing Liu, Mengling Liu, Tianshu Liu and Yiyi Yu*

    Familial Juvenile Polyposis Syndrome with a De Novo Germline Missense Variant in BMPR1A Gene: a Case Report Qing Liu, Mengling Liu, Tianshu Liu and Yiyi Yu*

    Liu et al. BMC Medical Genetics (2020) 21:196 https://doi.org/10.1186/s12881-020-01135-6 CASE REPORT Open Access Familial juvenile polyposis syndrome with a de novo germline missense variant in BMPR1A gene: a case report Qing Liu, Mengling Liu, Tianshu Liu and Yiyi Yu* Abstract Background: Juvenile polyposis syndrome (JPS) is a rare autosomal dominant hereditary disorder characterized by the development of multiple distinct juvenile polyps in the gastrointestinal tract with an increased risk of colorectal cancer. Germline mutations in two genes, SMAD4 and BMPR1A, have been identified to cause JPS. Case presentation: Here, we report a germline heterozygous missense variant (c.299G > A) in exon 3 BMPR1A gene in a family with juvenile polyposis. This variant was absent from the population database, and concluded as de novo compared with the parental sequencing. Further sequencing of the proband’s children confirmed the segregation of this variant with the disease, while the variant was also predicted to have damaging effect based on online prediction tools. Therefore, this variant was classified as likely pathogenic according to the American College of Medical Genetics and Genomics (ACMG) guidelines. Conclusions: Germline genetic testing revealed a de novo germline missense variant in BMPR1A gene in a family with juvenile polyposis. Identification of the pathogenic variant facilitates the cancer risk management of at-risk family members, and endoscopic surveillance is recommended for mutation carriers. Keywords: Juvenile polyposis syndrome, BMPR1A gene, De novo germline variant, Missense variant Background two genes, SMAD4 and BMPR1A, have been identi- Juvenile polyposis syndrome (JPS) is a rare autosomal fied to cause JPS [5].
  • ACVR1 Antibody Cat

    ACVR1 Antibody Cat

    ACVR1 Antibody Cat. No.: 4791 Western blot analysis of ACVR1 in A549 cell lysate with ACVR1 antibody at 1 μg/mL in (A) the absence and (B) the presence of blocking peptide. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse HOMOLOGY: Predicted species reactivity based on immunogen sequence: Bovine: (100%), Rat: (93%) ACVR1 antibody was raised against a 14 amino acid synthetic peptide near the amino terminus of the human ACVR1. IMMUNOGEN: The immunogen is located within the first 50 amino acids of ACVR1. TESTED APPLICATIONS: ELISA, WB ACVR1 antibody can be used for detection of ACVR1 by Western blot at 1 μg/mL. APPLICATIONS: Antibody validated: Western Blot in human samples. All other applications and species not yet tested. At least four isoforms of ACVR1 are known to exist. This antibody is predicted to have no SPECIFICITY: cross-reactivity to ACVR1B or ACVR1C. POSITIVE CONTROL: 1) Cat. No. 1203 - A549 Cell Lysate Properties October 1, 2021 1 https://www.prosci-inc.com/acvr1-antibody-4791.html PURIFICATION: ACVR1 Antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: ACVR1 Antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL ACVR1 antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year. As with all antibodies care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: ACVR1 ACVR1 Antibody: FOP, ALK2, SKR1, TSRI, ACTRI, ACVR1A, ACVRLK2, Activin receptor type-1, ALTERNATE NAMES: Activin receptor type I, ACTR-I ACCESSION NO.: NP_001096 PROTEIN GI NO.: 4501895 GENE ID: 90 USER NOTE: Optimal dilutions for each application to be determined by the researcher.
  • The Prevalence of MADH4 and BMPR1A Mutations in Juvenile Polyposis and Absence of BMPR2, BMPR1B, and ACVR1 Mutations

    The Prevalence of MADH4 and BMPR1A Mutations in Juvenile Polyposis and Absence of BMPR2, BMPR1B, and ACVR1 Mutations

    484 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.2004.018598 on 2 July 2004. Downloaded from The prevalence of MADH4 and BMPR1A mutations in juvenile polyposis and absence of BMPR2, BMPR1B, and ACVR1 mutations J R Howe, M G Sayed, A F Ahmed, J Ringold, J Larsen-Haidle, A Merg, F A Mitros, C A Vaccaro, G M Petersen, F M Giardiello, S T Tinley, L A Aaltonen, H T Lynch ............................................................................................................................... J Med Genet 2004;41:484–491. doi: 10.1136/jmg.2004.018598 Background: Juvenile polyposis (JP) is an autosomal dominant syndrome predisposing to colorectal and gastric cancer. We have identified mutations in two genes causing JP, MADH4 and bone morphogenetic protein receptor 1A (BMPR1A): both are involved in bone morphogenetic protein (BMP) mediated signalling and are members of the TGF-b superfamily. This study determined the prevalence of mutations See end of article for in MADH4 and BMPR1A, as well as three other BMP/activin pathway candidate genes in a large number authors’ affiliations ....................... of JP patients. Methods: DNA was extracted from the blood of JP patients and used for PCR amplification of each exon of Correspondence to: these five genes, using primers flanking each intron–exon boundary. Mutations were determined by Dr J R Howe, Department of Surgery, 4644 JCP, comparison to wild type sequences using sequence analysis software. A total of 77 JP cases were University of Iowa College sequenced for mutations in the MADH4, BMPR1A, BMPR1B, BMPR2, and/or ACVR1 (activin A receptor) of Medicine, 200 Hawkins genes. The latter three genes were analysed when MADH4 and BMPR1A sequencing found no mutations.
  • Mtor Coordinates Transcriptional Programs and Mitochondrial Metabolism of Activated Treg Subsets to Protect Tissue Homeostasis

    Mtor Coordinates Transcriptional Programs and Mitochondrial Metabolism of Activated Treg Subsets to Protect Tissue Homeostasis

    ARTICLE DOI: 10.1038/s41467-018-04392-5 OPEN mTOR coordinates transcriptional programs and mitochondrial metabolism of activated Treg subsets to protect tissue homeostasis Nicole M. Chapman1, Hu Zeng 1, Thanh-Long M. Nguyen1, Yanyan Wang1, Peter Vogel 2, Yogesh Dhungana1, Xiaojing Liu3, Geoffrey Neale 4, Jason W. Locasale 3 & Hongbo Chi1 1234567890():,; Regulatory T (Treg) cells derived from the thymus (tTreg) and periphery (pTreg) have central and distinct functions in immunosuppression, but mechanisms for the generation and acti- vation of Treg subsets in vivo are unclear. Here, we show that mechanistic target of rapamycin (mTOR) unexpectedly supports the homeostasis and functional activation of tTreg and pTreg cells. mTOR signaling is crucial for programming activated Treg-cell function to protect immune tolerance and tissue homeostasis. Treg-specific deletion of mTOR drives sponta- neous effector T-cell activation and inflammation in barrier tissues and is associated with reduction in both thymic-derived effector Treg (eTreg) and pTreg cells. Mechanistically, mTOR functions downstream of antigenic signals to drive IRF4 expression and mitochondrial metabolism, and accordingly, deletion of mitochondrial transcription factor A (Tfam) severely impairs Treg-cell suppressive function and eTreg-cell generation. Collectively, our results show that mTOR coordinates transcriptional and metabolic programs in activated Treg subsets to mediate tissue homeostasis. 1 Department of Immunology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, MS 351, Memphis, TN 38105, USA. 2 Department of Pathology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, MS 250, Memphis, TN 38105, USA. 3 Department of Pharmacology & Cancer Biology, Duke University School of Medicine, Levine Science Research Center C266, Box 3813, Durham, NC 27710, USA.
  • Supervised Group Lasso with Applications to Microarray Data Analysis

    Supervised Group Lasso with Applications to Microarray Data Analysis

    SUPERVISED GROUP LASSO WITH APPLICATIONS TO MICROARRAY DATA ANALYSIS Shuangge Ma1, Xiao Song2, and Jian Huang3 1Department of Epidemiology and Public Health, Yale University 2Department of Health Administration, Biostatistics and Epidemiology, University of Georgia 3Departments of Statistics and Actuarial Science, and Biostatistics, University of Iowa March 2007 The University of Iowa Department of Statistics and Actuarial Science Technical Report No. 375 1 Supervised group Lasso with applications to microarray data analysis Shuangge Ma¤1 Xiao Song 2and Jian Huang 3 1 Department of Epidemiology and Public Health, Yale University, New Haven, CT 06520, USA 2 Department of Health Administration, Biostatistics and Epidemiology, University of Georgia, Athens, GA 30602, USA 3 Department of Statistics and Actuarial Science, University of Iowa, Iowa City, IA 52242, USA Email: Shuangge Ma¤- [email protected]; Xiao Song - [email protected]; Jian Huang - [email protected]; ¤Corresponding author Abstract Background: A tremendous amount of e®orts have been devoted to identifying genes for diagnosis and prognosis of diseases using microarray gene expression data. It has been demonstrated that gene expression data have cluster structure, where the clusters consist of co-regulated genes which tend to have coordinated functions. However, most available statistical methods for gene selection do not take into consideration the cluster structure. Results: We propose a supervised group Lasso approach that takes into account the cluster structure in gene expression data for gene selection and predictive model building. For gene expression data without biological cluster information, we ¯rst divide genes into clusters using the K-means approach and determine the optimal number of clusters using the Gap method.
  • Advancing a Clinically Relevant Perspective of the Clonal Nature of Cancer

    Advancing a Clinically Relevant Perspective of the Clonal Nature of Cancer

    Advancing a clinically relevant perspective of the clonal nature of cancer Christian Ruiza,b, Elizabeth Lenkiewicza, Lisa Eversa, Tara Holleya, Alex Robesona, Jeffrey Kieferc, Michael J. Demeurea,d, Michael A. Hollingsworthe, Michael Shenf, Donna Prunkardf, Peter S. Rabinovitchf, Tobias Zellwegerg, Spyro Moussesc, Jeffrey M. Trenta,h, John D. Carpteni, Lukas Bubendorfb, Daniel Von Hoffa,d, and Michael T. Barretta,1 aClinical Translational Research Division, Translational Genomics Research Institute, Scottsdale, AZ 85259; bInstitute for Pathology, University Hospital Basel, University of Basel, 4031 Basel, Switzerland; cGenetic Basis of Human Disease, Translational Genomics Research Institute, Phoenix, AZ 85004; dVirginia G. Piper Cancer Center, Scottsdale Healthcare, Scottsdale, AZ 85258; eEppley Institute for Research in Cancer and Allied Diseases, Nebraska Medical Center, Omaha, NE 68198; fDepartment of Pathology, University of Washington, Seattle, WA 98105; gDivision of Urology, St. Claraspital and University of Basel, 4058 Basel, Switzerland; hVan Andel Research Institute, Grand Rapids, MI 49503; and iIntegrated Cancer Genomics Division, Translational Genomics Research Institute, Phoenix, AZ 85004 Edited* by George F. Vande Woude, Van Andel Research Institute, Grand Rapids, MI, and approved June 10, 2011 (received for review March 11, 2011) Cancers frequently arise as a result of an acquired genomic insta- on the basis of morphology alone (8). Thus, the application of bility and the subsequent clonal evolution of neoplastic cells with purification methods such as laser capture microdissection does variable patterns of genetic aberrations. Thus, the presence and not resolve the complexities of many samples. A second approach behaviors of distinct clonal populations in each patient’s tumor is to passage tumor biopsies in tissue culture or in xenografts (4, 9– may underlie multiple clinical phenotypes in cancers.
  • Coupling of Autism Genes to Tissue-Wide Expression and Dysfunction of Synapse, Calcium Signalling and Transcriptional Regulation

    Coupling of Autism Genes to Tissue-Wide Expression and Dysfunction of Synapse, Calcium Signalling and Transcriptional Regulation

    PLOS ONE RESEARCH ARTICLE Coupling of autism genes to tissue-wide expression and dysfunction of synapse, calcium signalling and transcriptional regulation 1 2,3 4 1,5 Jamie ReillyID *, Louise Gallagher , Geraldine Leader , Sanbing Shen * 1 Regenerative Medicine Institute, School of Medicine, Biomedical Science Building, National University of a1111111111 Ireland (NUI) Galway, Galway, Ireland, 2 Discipline of Psychiatry, School of Medicine, Trinity College Dublin, Dublin, Ireland, 3 Trinity Translational Medicine Institute, Trinity Centre for Health SciencesÐTrinity College a1111111111 Dublin, St. James's Hospital, Dublin, Ireland, 4 Irish Centre for Autism and Neurodevelopmental Research a1111111111 (ICAN), Department of Psychology, National University of Ireland (NUI) Galway, Galway, Ireland, a1111111111 5 FutureNeuro Research Centre, Royal College of Surgeons in Ireland (RCSI), Dublin, Ireland a1111111111 * [email protected] (JR); [email protected] (SS) Abstract OPEN ACCESS Citation: Reilly J, Gallagher L, Leader G, Shen S Autism Spectrum Disorder (ASD) is a heterogeneous disorder that is often accompanied (2020) Coupling of autism genes to tissue-wide with many co-morbidities. Recent genetic studies have identified various pathways from expression and dysfunction of synapse, calcium hundreds of candidate risk genes with varying levels of association to ASD. However, it is signalling and transcriptional regulation. PLoS ONE unknown which pathways are specific to the core symptoms or which are shared by the co- 15(12): e0242773. https://doi.org/10.1371/journal. pone.0242773 morbidities. We hypothesised that critical ASD candidates should appear widely across dif- ferent scoring systems, and that comorbidity pathways should be constituted by genes Editor: Nirakar Sahoo, The University of Texas Rio Grande Valley, UNITED STATES expressed in the relevant tissues.
  • Support Info

    Support Info

    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2014 Supporting Information Design and synthesis of pyrrole–5-(2,6-dichlorobenzyl)sulfonylindolin-2-ones with C- 3’ side chains as potent Met kinase inhibitors Chia-Wei Liu,a Chun-Liang Lai,a Yu-Hsiang Lin,a Li-Wei Teng,a Sheng-chuan Yang,a Win-Yin Wei,a Shu Fu Lin,a Ju-Ying Yang,a Hung-Jyun Huang,a Ru-Wen Wang,a Chao-Cheng Chiang,a Mei-Hui Lee,a Yu- Chuan Wang,b Shih-Hsien Chuang,a Jia-Ming Chang,a Ying-Shuan E. Lee,a and Jiann-Jyh Huang*a,b aDevelopment Center for Biotechnology, No. 101, Lane 169, Kangning St., Xizhi District, New Taipei City 22180, Taiwan bDepartment of Applied Chemistry, National Chiayi University, No. 300, Syuefu Rd., Chiayi City 60004, Taiwan *Corresponding Author. Tel.: +886 5 271 7959; Fax: +886 5 271 7901. E-mail address: [email protected] (J.-J. Huang) Table of Contents: Page Supporting Figure. Ligplot diagrams of the ATP binding site of Met S2 complexed with compounds 2 and 20. Supporting Table. Kinase profiling data of compound 20. S3 References S10 - S1 - Supporting Figure. Ligplot diagrams1 of the ATP binding site of Met complexed with compounds 2 and 20: (A) Met with 2, and (B) Met with 20. - S2 - Supporting Table. Kinase profiling data of 20. Ambit KinomeScan Kinase Profiling (1.0 μM test concentration): Percentage of Percentage of Ambit Gene Symbol control (%) Ambit Gene Symbol control (%) 20 20 AAK1 68 ARK5 27 ABL1(E255K)-phosphorylated 85 ASK1 100 ABL1(F317I)-nonphosphorylated 78 ASK2 67
  • Profiling Data

    Profiling Data

    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
  • 1 Silencing Branched-Chain Ketoacid Dehydrogenase Or

    1 Silencing Branched-Chain Ketoacid Dehydrogenase Or

    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Silencing branched-chain ketoacid dehydrogenase or treatment with branched-chain ketoacids ex vivo inhibits muscle insulin signaling Running title: BCKAs impair insulin signaling Dipsikha Biswas1, PhD, Khoi T. Dao1, BSc, Angella Mercer1, BSc, Andrew Cowie1 , BSc, Luke Duffley1, BSc, Yassine El Hiani2, PhD, Petra C. Kienesberger1, PhD, Thomas Pulinilkunnil1†, PhD 1Department of Biochemistry and Molecular Biology, Dalhousie Medicine New Brunswick, Saint John, New Brunswick, Canada, 2Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada. †Correspondence to Thomas Pulinilkunnil, PhD Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dalhousie University Dalhousie Medicine New Brunswick, 100 Tucker Park Road, Saint John E2L4L5, New Brunswick, Canada. Telephone: (506) 636-6973; Fax: (506) 636-6001; email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International