Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis”

Supplemental material and methods

Cloning of the villin-LMα1 vector

The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega,

Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer:

5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and

5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and

SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme,

Saint Quentin Yvelines, France) was amplified by PCR using primers

5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France).

After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated

1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.

Yurchenco, Piscataway, NJ, USA). The BsiWI-MluI fragment containing the LMα1 cDNA was gel purified and subcloned into the BsiWI-MluI sites of the pBS-villin-promoter-MES-SV40- polyA vector giving rise to plasmid pBS-villin-LMα1.

Generation of vLMα1 transgenic mice and of the vLMα1/APC+/1638 mice

From the pBS vLMα1 plasmid a SalI fragment containing the 9 kb villin promoter region followed by the mouse LMα1 cDNA and the SV40 polyA was obtained, purified and used for injection into pronuclei of fertilized oocytes (F1 hybrid C57Bl/6 x DBA/2, transgenic facility of the IGBMC, Strasbourg, France). Germline transmission was determined by PCR analysis of tail DNA, using the villin1 primer present in the villin promoter

(5’ATAGGAAGCCAGTTTCCCTTC3’) and the LM17 primer present in the 5’ region of the

LMα1 cDNA (5’TGACCCAGAGCACCGAGGCCA3’) generating a fragment of 152 bp. For confirmation a second PCR was done obtaining a 166 bp product with primer LM116 present in the 3’ region of the Lama1 cDNA (5’GCCTCATTCCGGGGCTGTGTG3’) and primer SV40

3’ (5’AATGTGGTATGGCTGATTATG3’) encompassing the SV40 polyA sequence. Two out of 68 villin-LMα1 (vLMα1) founders showed stable integration and expression, and were further used in parallel for all experiments. Heterozygous vLMα1 mice were kept in a CD1 background (Charles River, L'Arbresle Cedex, France). In certain cases, vLMα1 mice were crossed with APC+/1638N mice (1). Double transgenic mice were kept on a CD1 background.

Generation of LMα1 knock-down cells

HEK293T cells (ATCC CRL-3216; cultured in DMEM, 10% FCS, 1% penicillin-streptomycin) were transfected with pGFP-C-sh LAMA1 Lentivector (TL311806D: 5’-

GAGATGTGCAGATGGTTACTATGGAAACC-3’) or pGFP-C-sh control Lentivector

(TR30021) containing non-effective 29-mer scrambled shRNA cassette (OriGene,

2 Cliniscience, Nanterre, France) together with pLP1, pLP2 and pLP/VSVG lentiviral packaging plasmids (Invitrogen, Life Technologies, Saint Aubin, France) to obtain lentiviral particles.

After 48 hours, conditioned media from HEK293T were collected, filtered through a 0.22 µm filter to remove cell debris, and used to transduce HCT116 cells (ATTC CCL-247) cultured in

DMEM supplemented with 10% fetal calf serum and 1% penicillin-streptomycin (Gibco, USA) in the presence of 5µg/mL polybrene (Sigma Aldrich, Lyon, France), followed by selection with puromycin (1.6 µg/mL, Sigma Aldrich, Lyon, France). Expression of LM1 mRNAs and protein was determined by qRT-PCR and ELISA.

Surface Plasmon Resonance

Surface Plasmon Resonance-Binding experiments were performed on a Biacore 2000 instrument (Biacore Inc., GE Healthcare, Velizy-Villacoublay, France) at 25 °C. VEGFA165

(R&D systems, Minneapolis, USA) or VEGFA121 (Prospecbio, East Brunswick, USA) was immobilized (10µl/ml) at high surface density (5.000 response units) on an activated CM5 chip using standard amine-coupling procedures, as described by the manufacturer. LM-111 was injected at a concentration of 10 μg/mL in 10 mM sodium acetate, pH 5.0, and at a flow rate of 5 μL/min during 20 min. Free groups were blocked by injecting 1M ethanolamine. To perform binding assays, LM-111 at different concentrations (from 5 to 20µg in 200µL) was injected in 10 mM MES, pH 6.0, 150 mM NaCl, with 0.005% (v/v) Tween 20, at a flow rate of

10 μL/min. Blank surfaces were used for background corrections. Injections of 10 mM glycine, pH 2.0, at 100 μL/min for 1 min were used to regenerate surfaces between two binding experiments. Steady state analysis was used to estimate the affinity of VEGF165 to

LM-111. Dissociation constants (Kd) were estimated using 1:1 Langmuir association model as described by the manufacturer.

Gene expression analysis

RNA was extracted using the Tri Reagent according to manufacturer’s instructions

(Molecular Research Center Inc., Euromedex, Souffelweyersheim, France). RNA-Seq

3 experiments were performed at the IGBMC Affymetrix Core Facility (Illkirch, France). Library of template molecules suitable for high throughput DNA sequencing was created following the Illumina “Truseq RNA sample preparation low throughput” protocol with some modifications. Briefly, mRNA was purified from 2 µg total RNA using oligo-dT magnetic beads and fragmented using divalent cations at 94°C for 8 minutes. The cleaved mRNA fragments were reverse transcribed into cDNA using random primers, then the second strand of the cDNA was synthesized using Polymerase I and RNase H. The next steps of RNA-Seq

Library preparation were performed in a fully automated system using SPRIworks Fragment

Library System I kit (Beckman Coulter, Fullerton, USA) with the SPRI-TE instrument

(Beckman Coulter). Briefly, in this system double stranded cDNA fragments were blunted, phosphorylated and ligated to indexed adapter dimers, and fragments in the range of ~200-

400 bp were size selected. The automated steps were followed by PCR amplification (30 sec at 98°C; [10 sec at 98°C, 30 sec at 60°C, 30 sec at 72°C] x 12 cycles; 5 min at 72°C), then surplus PCR primers were removed by purification using AMPure XP beads (Agencourt

Biosciences Corporation, Beverly, USA). DNA libraries were checked for quality and quantified using 2100 Bioanalyzer (Agilent, Les Ulis, France). The libraries were loaded in the flow cell at 8pM concentration and clusters generated and sequenced in the Illumina

Genome Analyzer IIX as single-end 72 base reads. The separation of RNA sequencing reads derived from the human tumor cells and the host murine cells was performed in silico using the Xenome software (2) that is designed to discriminate species specific sequences in a xenograft environment. Each Fastq file was separated into mouse specific and human specific sequencing reads. These were subsequently aligned using Tophat2 (3) and processed using the Cufflinks (4) pipeline to generate the final expression files. Three independent subcutaneous tumors generated from control or HT29LMα1 cells were sequenced. Raw data can be found using the GEO accession number GSE84296. Changes in gene expression in dependence of LMα1 are shown as Log2 fold-change (Fc) values. We chose a cutoff with a p-value <0.05, a Log2 difference of +/-0.5 for genes of stromal cells and a cutoff with a p-value <0.01, a Log2 difference of +/-1 for genes of cancer cells.

4 Microarray experiments were performed at the IGBMC Affymetrix Core Facility (Illkirch,

France). Biotinylated single strand cDNA targets were prepared by using 250 ng of total

RNA and the Ambion WT Expression Kit (Ambion, Fisher Scientific, Illkirch-Graffenstaden,

France) or the Affymetrix GeneChip WT Terminal Labeling Kit (Affymetrix, Santa Clara, USA) according to manufacturer`s recommendations. Following fragmentation and end-labelling,

2.07 μg of cDNAs were hybridized for 16 hours at 45oC on GeneChip Human Gene 1.0 ST arrays (Affymetrix) interrogating 28.869 genes represented by approximately 27 probes spread across the full length of the gene. The chips were washed and stained in the

GeneChip® Fluidics Station 450 (Affymetrix) and scanned with the GeneChip Scanner 3000

7G (Affymetrix) at a resolution of 0,7 µm. Raw data (.CEL Intensity files) were extracted from the scanned images using the Affymetrix GeneChip Command Console (AGCC) version 3.1.

CEL files were further processed with Affymetrix Expression Console software version 1. 1 to calculate probe set signal intensities using Robust Multi-array Average (RMA) algorithms with default settings. Three separate hybridizations were performed with independent samples from control or HT29LMα1 cells. Raw data can be found using the GEO accession number GSE83747. Changes in gene expression in dependence of LMα1 are shown as Log2 fold-change (Fc) values. We chose a cutoff with a p-value <0.01, a Log2 difference of +/-1 for genes of cancer cells.

Gene list analysis was done by using the gene ontology online Amigo tool

(http://amigo.geneontology.org/amigo) and the Panther tool

(http://pantherdb.org/webservices/go/overrep.jsp) with default parameters.

For qRT-PCR, RNA was treated with DNase I and reverse transcribed using the High

Capacity cDNA RT Kit. qRT-PCR was performed using the Power SYBR Green PCR Master

Mix or TaqMan Gene Expression Master Mix. All compounds were purchased from Life

Technologies (St Aubin, France). Primer sequences or probes are listed in Supplemental

Table S8. Two sets of primers/probes were used to determine LMα1 expression in human tumors, one located in the 5' (Taqman) and another in the 3' region of the gene, giving similar

5 results. Relative expression level 2e-ΔΔct was calculated for each individual sample. For xenograft analysis, a primer design approach was used to obtain species specific qRT-PCR primers. The coding regions of the mouse and human homologous cDNA sequences were aligned (www.ensembl.org). Regions of low homology were chosen for selection of species specific primers that were always spanning an intron. Primer specificity was confirmed by using cDNA from human or mouse tissues. Only primers giving an efficiency value between

93 to 108% were used. When calculating murine or human gene expression in the xenograft tumors, primers for mouse or human PBDG (porphobilinogen deaminase) were used for normalization, respectively. For colon tumors, data were normalized to the reference gene

GAPDH (Glyceraldehyde 3-phosphate dehydrogenase).

References

1. Fodde R, Edelmann W, Yang K, van Leeuwen C, Carlson C, Renault B, et al. A targeted chain-termination mutation in the mouse Apc gene results in multiple intestinal tumors. ProcNatlAcadSciUSA. 1994;91:8969–73.

2. Conway T, Wazny J, Bromage A, Tymms M, Sooraj D, Williams ED, et al. Xenome—a tool for classifying reads from xenograft samples. Bioinformatics. 2012;28:i172–8.

3. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013;14:R36.

4. Roberts A, Pimentel H, Trapnell C, Pachter L. Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics. 2011;27:2325–9.

6

Table S1 up regulated stromal genes Gene ID Gene Name Log2 Fold Change p_value Lama1 Laminin subunit alpha-1 7.82 226.6 5.00E-05 Fgf1 Fibroblast growth factor 1 5.50 45.3 6.40E-03 Slfn1 Protein Slfn1 3.84 14.4 2.18E-02 Sec1 Galactoside 2-alpha-L-fucosyltransferase 3 3.67 12.7 4.94E-02 Trim30d Protein Trim30d 3.36 10.3 5.00E-05 Gnpda1 Glucosamine-6-phosphate isomerase 1 2.81 7.0 5.00E-05 3830417A13Rik Protein 3830417A13Rik 2.68 6.4 1.77E-02 Zfp949 Protein Zfp949 2.57 5.9 5.00E-05 Il11 Interleukin-11 2.55 5.9 5.50E-04 Cwc22 Pre-mRNA-splicing factor CWC22 homolog 2.53 5.8 5.00E-05 Tnfrsf9 Tumor necrosis factor receptor superfamily member 9 2.50 5.6 5.00E-05 Alas2 5-aminolevulinate synthase, erythroid-specific, mitochondrial 2.43 5.4 5.00E-05 Zfp939 Protein Zfp939 2.30 4.9 2.27E-02 Fosb Protein fosB 2.23 4.7 5.65E-03 Stra6 Stimulated by retinoic acid gene 6 protein 2.22 4.7 5.00E-05 Ptprn Receptor-type tyrosine-protein phosphatase-like N 2.19 4.6 5.00E-05 Tmem26 Transmembrane protein 26 2.07 4.2 3.50E-03 Rpl10a 60S ribosomal protein L10a 2.01 4.0 3.28E-02 Tmem35 Transmembrane protein 35 1.99 4.0 2.78E-02 Cpxm2 Inactive carboxypeptidase-like protein X2 1.94 3.8 5.00E-05 Cyp26a1 Cytochrome P450 26A1 1.82 3.5 6.90E-03 Mgarp Protein MGARP 1.78 3.4 8.30E-03 Ibsp Bone sialoprotein 2 1.75 3.4 2.23E-02 Rps8 40S ribosomal protein S8 1.72 3.3 5.00E-05 Rasl11a Ras-like protein family member 11A 1.68 3.2 2.92E-02 I830012O16Rik Protein I830012O16Rik 1.66 3.2 5.30E-03 Cd69 Early activation antigen CD69 1.64 3.1 3.74E-02 Wt1 Wilms tumor protein homolog 1.64 3.1 2.93E-02 Oasl1 2'-5'-oligoadenylate synthase-like protein 1 1.61 3.0 7.00E-04 Kcng2 Protein Kcng2 1.60 3.0 4.67E-02 Fos Proto-oncogene c-Fos 1.60 3.0 1.00E-04 Pcdh17 Protein Pcdh17 1.59 3.0 3.05E-03 Fgf9 Fibroblast growth factor 9 1.57 3.0 4.31E-02 Nlrp1b NACHT-, LRR-, and PYD-containing protein 1 paralog b splice variant 3 1.56 3.0 4.87E-02 Hhip Hedgehog-interacting protein 1.56 2.9 5.00E-05 Lin7a Protein lin-7 homolog A 1.55 2.9 7.60E-03 Actg2 Actin, gamma-enteric smooth muscle 1.50 2.8 5.00E-05 Vit Vitrin 1.50 2.8 4.62E-02 Edil3 EGF-like repeat and discoidin I-like domain-containing protein 3 1.49 2.8 5.00E-05 Slc2a3 Solute carrier family 2, facilitated glucose transporter member 3 1.48 2.8 5.00E-05 Lag3 Lymphocyte activation gene 3 protein 1.48 2.8 5.80E-03 Cd4 T-cell surface glycoprotein CD4 1.46 2.7 1.90E-03 Baalc Brain and acute leukemia cytoplasmic protein 1.45 2.7 2.46E-02 Wnt5a Protein Wnt-5a 1.44 2.7 5.00E-05 Crlf1 Cytokine receptor-like factor 1 1.43 2.7 5.00E-05 Oas1b Inactive 2'-5'-oligoadenylate synthase 1B 1.42 2.7 4.59E-02 Slc2a1 Solute carrier family 2, facilitated glucose transporter member 1 1.42 2.7 5.00E-05 Fkbp1b Peptidyl-prolyl cis-trans isomerase FKBP1B 1.41 2.7 3.50E-02 Kif1a Kinesin-like protein KIF1A 1.41 2.7 9.30E-03 Il1b Interleukin-1 beta 1.38 2.6 3.50E-04 Grem2 Gremlin-2 1.36 2.6 5.00E-05 Npr3 Atrial natriuretic peptide receptor 3 1.35 2.6 5.00E-05 Prelid2 PRELI domain-containing protein 2 1.35 2.5 3.55E-02 Igfbp2 Insulin-like growth factor-binding protein 2 1.34 2.5 5.00E-05 Brdt Bromodomain testis-specific protein 1.34 2.5 3.82E-02 Ero1l ERO1-like protein alpha 1.33 2.5 5.00E-05 Adamts6 Protein Adamts6 1.33 2.5 4.00E-04 Serpine1 Plasminogen activator inhibitor 1 1.32 2.5 5.00E-05 Gxylt2 Glucoside xylosyltransferase 2 1.31 2.5 1.84E-02 Ccl3 C-C motif chemokine 3 1.31 2.5 3.93E-02 Gm5424 MCG15755 1.31 2.5 3.84E-02 Tnfrsf19 Tumor necrosis factor receptor superfamily member 19 1.31 2.5 3.50E-04 Lingo1 Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1 1.30 2.5 4.17E-02 Angpt2 Angiopoietin-2 1.30 2.5 5.00E-05 Ifit1 Interferon-induced protein with tetratricopeptide repeats 1 1.29 2.4 1.00E-04 Pgf Placenta growth factor 1.29 2.4 8.00E-04 Esm1 Endothelial cell-specific molecule 1 1.29 2.4 1.50E-04 Penk Proenkephalin-A 1.29 2.4 5.00E-05 C1qtnf7 Complement C1q tumor necrosis factor-related protein 7 1.28 2.4 1.37E-02 Mypop Myb-related transcription factor, partner of profilin 1.27 2.4 2.44E-02 Inhba Inhibin beta A chain 1.27 2.4 2.00E-04 Rnf157 RING finger protein 157 1.27 2.4 8.75E-03 Rgs1 Regulator of G-protein signaling 1 1.26 2.4 1.00E-04 Cd209f MCG132033, isoform CRA_a 1.26 2.4 5.00E-05 Vill Villin-like protein 1.25 2.4 1.54E-02 Hspa1a Heat shock 70 kDa protein 1A 1.25 2.4 1.47E-02 Gzmd Granzyme D 1.24 2.4 6.00E-04 Adm ADM 1.24 2.4 1.50E-04 Eno2 Gamma-enolase 1.24 2.4 5.00E-05 Fst Follistatin 1.24 2.4 5.00E-05 Whrn Whirlin 1.23 2.3 4.84E-02 Megf10 Multiple epidermal growth factor-like domains protein 10 1.22 2.3 3.50E-04 Ier3 Radiation-inducible immediate-early gene IEX-1 1.22 2.3 5.00E-05 Gene ID Gene Name Log2 Fold Change p_value Rsad2 Radical S-adenosyl methionine domain-containing protein 2 1.21 2.3 3.00E-04 Rgs16 Regulator of G-protein signaling 16 1.20 2.3 5.00E-05 Osgin1 Oxidative stress induced growth inhibitor 1 1.20 2.3 1.94E-02 Isg15 Ubiquitin-like protein ISG15 1.18 2.3 6.00E-04 Itga11 Integrin alpha-11 1.18 2.3 1.00E-04 Emid1 EMI domain-containing protein 1 1.18 2.3 3.91E-02 Osbp2 Oxysterol-binding protein 2 1.17 2.2 2.40E-02 Pilra Paired immunoglobulin-like type 2 receptor alpha 1.16 2.2 1.95E-03 Lif Leukemia inhibitory factor 1.15 2.2 5.00E-05 Igfbp3 Insulin-like growth factor-binding protein 3 1.15 2.2 5.60E-03 Wdfy2 WD repeat and FYVE domain-containing protein 2 1.12 2.2 4.64E-02 Lrrc55 Leucine-rich repeat-containing protein 55 1.12 2.2 8.50E-03 Mdk Midkine 1.11 2.2 4.00E-04 Unc13a Protein unc-13 homolog A 1.10 2.1 1.18E-02 Hoxd8 Homeobox protein Hox-D8 1.10 2.1 8.65E-03 Dusp4 Dual specificity protein phosphatase 4 1.10 2.1 1.45E-03 B3gnt7 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 1.10 2.1 8.65E-03 Aoah Acyloxyacyl hydrolase 1.09 2.1 2.18E-02 Ifit3 Interferon-induced protein with tetratricopeptide repeats 3 1.09 2.1 1.85E-03 Egln3 Egl nine homolog 3 1.09 2.1 7.50E-04 Nr4a1 Nuclear receptor subfamily 4 group A member 1 1.07 2.1 1.10E-03 Slc13a3 Solute carrier family 13 member 3 1.07 2.1 2.36E-02 Aldh1a2 Retinal dehydrogenase 2 1.06 2.1 4.80E-03 Ankrd37 Ankyrin repeat domain-containing protein 37 1.06 2.1 2.40E-02 Ak4 Adenylate kinase 4, mitochondrial 1.06 2.1 7.55E-03 Trim30a Tripartite motif-containing protein 30A 1.06 2.1 5.00E-05 Kank4 KN motif and ankyrin repeat domain-containing protein 4 1.05 2.1 5.10E-03 Dhfr Dihydrofolate reductase 1.05 2.1 3.86E-02 Eid2 EP300-interacting inhibitor of differentiation 2 1.04 2.1 4.15E-02 Angpt4 Angiopoietin-4 1.03 2.0 2.98E-02 Egr1 Early growth response protein 1 1.02 2.0 5.00E-05 Bcl2a1b B-cell leukemia/lymphoma 2 related protein A1b 1.01 2.0 1.20E-03 Arg1 Arginase-1 1.01 2.0 4.00E-04 1810011H11Rik Protein 1810011H11Rik 1.01 2.0 5.90E-03 Camk2n1 Calcium/calmodulin-dependent protein kinase II inhibitor 1 1.00 2.0 1.35E-03 Pstpip1 Proline-serine-threonine phosphatase-interacting protein 1 1.00 2.0 3.90E-03 Cd72 B-cell differentiation antigen CD72 0.99 2.0 2.53E-02 Mmp17 Matrix metalloproteinase-17 0.99 2.0 1.95E-02 Slc1a4 Neutral amino acid transporter A 0.98 2.0 1.01E-02 Wnt11 Protein Wnt-11 0.98 2.0 1.65E-03 Nphp3 Nephrocystin-3 0.97 2.0 4.55E-02 Hilpda Hypoxia-inducible lipid droplet-associated protein 0.97 2.0 2.75E-03 Maff Transcription factor MafF 0.97 2.0 2.65E-03 Chst11 Carbohydrate sulfotransferase 11 0.96 2.0 2.00E-04 Aldh1a3 Aldehyde dehydrogenase family 1 member A3 0.96 1.9 4.00E-04 Tnfaip3 Tumor necrosis factor alpha-induced protein 3 0.95 1.9 3.30E-03 Samsn1 SAM domain-containing protein SAMSN-1 0.95 1.9 2.08E-02 Abt1 Activator of basal transcription 1 0.94 1.9 3.51E-02 Usp18 Ubl carboxyl-terminal hydrolase 18 0.94 1.9 1.29E-02 Ndufa4l2 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4-like 2 0.93 1.9 1.17E-02 Scara3 Scavenger receptor class A member 3 0.93 1.9 3.00E-04 Clec7a C-type lectin domain family 7 member A 0.93 1.9 9.00E-04 Zfp955a Protein Zfp955a 0.92 1.9 4.67E-02 Apobec1 C-U-editing enzyme APOBEC-1 0.92 1.9 5.00E-04 Otud1 OTU domain-containing protein 1 0.91 1.9 3.62E-02 Adamtsl3 Protein Adamtsl3 0.90 1.9 2.40E-03 Spata13 Spermatogenesis-associated protein 13 0.90 1.9 2.35E-03 Tshz3 Teashirt homolog 3 0.89 1.9 4.75E-03 Lpcat2 Lysophosphatidylcholine acyltransferase 2 0.89 1.9 4.50E-03 Grem1 Gremlin-1 0.89 1.9 2.18E-02 H2-M3 Histocompatibility 2, M region locus 3 0.89 1.8 6.75E-03 Slc16a3 Monocarboxylate transporter 4 0.88 1.8 6.00E-04 Ppp1r15a Protein phosphatase 1 regulatory subunit 15A 0.88 1.8 7.05E-03 Dkk3 Dickkopf-related protein 3 0.88 1.8 8.50E-04 Lepr Leptin receptor 0.88 1.8 1.60E-03 Cnnm4 Metal transporter CNNM4 0.88 1.8 1.89E-02 Wnt2 Protein Wnt-2 0.88 1.8 1.52E-02 Hspa1b Heat shock 70 kDa protein 1B 0.87 1.8 1.55E-02 Ifit2 Interferon-induced protein with tetratricopeptide repeats 2 0.87 1.8 7.00E-04 Hs3st3b1 Heparan sulfate glucosamine 3-O-sulfotransferase 3B1 0.87 1.8 6.10E-03 Cx3cl1 Fractalkine 0.87 1.8 8.00E-04 Ripk2 Receptor-interacting serine/threonine-protein kinase 2 0.87 1.8 2.07E-02 Spry4 Protein sprouty homolog 4 0.86 1.8 2.50E-03 Gpr35 G-protein coupled receptor 35 0.86 1.8 2.65E-03 Lrmp Lymphoid-restricted membrane protein 0.86 1.8 2.51E-02 Hhipl1 HHIP-like protein 1 0.86 1.8 1.06E-02 Csf2rb2 Interleukin-3 receptor class 2 subunit beta 0.86 1.8 1.35E-03 Ndrg1 Protein NDRG1 0.86 1.8 6.50E-04 Slc7a2 Low affinity cationic amino acid transporter 2 0.85 1.8 1.10E-03 Tagln Transgelin 0.85 1.8 2.03E-02 Vegfa Vascular endothelial growth factor A 0.85 1.8 2.20E-03 Fmod Fibromodulin 0.85 1.8 1.85E-03 Has2 Hyaluronan synthase 2 0.85 1.8 2.20E-03 Uxs1 UDP-glucuronic acid decarboxylase 1 0.85 1.8 2.87E-02 Arhgap15 Rho GTPase-activating protein 15 0.84 1.8 4.11E-02 Gene ID Gene Name Log2 Fold Change p_value Fbln1 Fibulin-1 0.84 1.8 1.75E-03 Reck Reversion-inducing cysteine-rich protein with Kazal motifs 0.84 1.8 6.25E-03 Atf3 Cyclic AMP-dependent transcription factor ATF-3 0.84 1.8 6.20E-03 Ppm1h Protein phosphatase 1H 0.84 1.8 6.15E-03 Ptk7 Inactive tyrosine-protein kinase 7 0.84 1.8 7.00E-04 Thsd4 Thrombospondin type-1 domain-containing protein 4 0.84 1.8 4.91E-02 Gpc3 Glypican-3 0.83 1.8 1.10E-03 Cyr61 Protein CYR61 0.83 1.8 2.65E-03 Zfp395 Protein Zfp395 0.82 1.8 4.65E-03 Runx3 Runt-related transcription factor 3 0.82 1.8 1.98E-02 Gadd45a Growth arrest and DNA damage-inducible protein GADD45 alpha 0.82 1.8 2.56E-02 Nr1d1 Nuclear receptor subfamily 1 group D member 1 0.82 1.8 2.30E-03 Mpz Myelin protein P0 0.82 1.8 1.74E-02 Prkar1b cAMP-dependent protein kinase type I-beta regulatory subunit 0.82 1.8 4.83E-02 Papolg Poly(A) polymerase gamma 0.82 1.8 4.59E-02 Ccrl2 C-C chemokine receptor-like 2 0.82 1.8 4.87E-02 Islr Immunoglobulin superfamily containing leucine-rich repeat protein 0.82 1.8 1.30E-03 Tiparp TCDD-inducible poly [ADP-ribose] polymerase 0.82 1.8 2.00E-03 Lgi2 Leucine-rich repeat LGI family member 2 0.82 1.8 3.35E-02 Ccdc85b Coiled-coil domain-containing protein 85B 0.82 1.8 1.02E-02 P4ha2 Prolyl 4-hydroxylase subunit alpha-2 0.81 1.8 1.90E-03 C6 Protein C6 0.80 1.7 1.42E-02 Rtp4 Receptor-transporting protein 4 0.80 1.7 6.05E-03 Was Wiskott-Aldrich syndrome protein homolog 0.80 1.7 1.97E-02 Dnajc18 DnaJ homolog subfamily C member 18 0.80 1.7 9.00E-03 Tor3a Torsin-3A 0.80 1.7 1.55E-03 Mmp9 Matrix metalloproteinase-9 0.79 1.7 2.70E-03 P4ha1 Prolyl 4-hydroxylase subunit alpha-1 0.79 1.7 3.30E-03 Itgal Integrin alpha-L 0.79 1.7 4.11E-02 Tsta3 GDP-L-fucose synthase 0.78 1.7 3.37E-02 Nfkbie NF-kappa-B inhibitor epsilon 0.78 1.7 2.75E-02 Apln Apelin 0.78 1.7 1.95E-03 Fbxo32 F-box only protein 32 0.78 1.7 2.90E-03 Cxcl5 C-X-C motif chemokine 5 0.78 1.7 3.82E-02 Chst1 Carbohydrate sulfotransferase 1 0.78 1.7 8.10E-03 Cd5l CD5 antigen-like 0.78 1.7 1.55E-02 Pcgf2 Polycomb group RING finger protein 2 0.78 1.7 4.43E-02 Dusp1 Dual specificity protein phosphatase 1 0.78 1.7 3.00E-03 Pdgfa Platelet-derived growth factor subunit A 0.77 1.7 3.23E-02 Ikbke Inhibitor of nuclear factor kappa-B kinase subunit epsilon 0.77 1.7 2.49E-02 Pi16 Peptidase inhibitor 16 0.77 1.7 1.01E-02 Adam8 Disintegrin and metalloproteinase domain-containing protein 8 0.77 1.7 2.50E-03 Clec11a C-type lectin domain family 11 member A 0.77 1.7 8.05E-03 Gfra2 GDNF family receptor alpha-2 0.77 1.7 2.96E-02 Ddit4 DNA damage-inducible transcript 4 protein 0.76 1.7 4.55E-03 Kcnj8 ATP-sensitive inward rectifier potassium channel 8 0.76 1.7 1.66E-02 Prokr2 Prokineticin receptor 2 0.76 1.7 4.21E-02 Rftn1 Raftlin 0.76 1.7 3.50E-03 Stc1 Stanniocalcin-1 0.76 1.7 3.96E-02 Zfp36 Tristetraprolin 0.75 1.7 4.20E-03 Nbl1 Neuroblastoma suppressor of tumorigenicity 1 0.75 1.7 3.40E-03 Pdgfb Platelet-derived growth factor subunit B 0.75 1.7 4.90E-03 Dpep2 Dipeptidase 2 0.75 1.7 4.69E-02 Kcnj2 Inward rectifier potassium channel 2 0.75 1.7 4.85E-03 Hist1h1c Histone H1.2 0.75 1.7 4.05E-03 Kcnma1 Calcium-activated potassium channel subunit alpha-1 0.74 1.7 1.61E-02 Inhbb Inhibin beta B chain 0.74 1.7 3.80E-03 Nkd2 Protein naked cuticle homolog 2 0.74 1.7 5.15E-03 Arrdc3 Arrestin domain-containing protein 3 0.74 1.7 3.95E-03 Slamf9 SLAM family member 9 0.74 1.7 1.07E-02 Sik1 Serine/threonine-protein kinase SIK1 0.73 1.7 7.95E-03 Sept4 Septin-4 0.73 1.7 9.00E-03 Relb Transcription factor RelB 0.73 1.7 3.13E-02 Kctd11 BTB/POZ domain-containing protein KCTD11 0.73 1.7 3.80E-03 Ptgis Prostacyclin synthase 0.72 1.6 1.42E-02 Ptch1 Protein patched homolog 1 0.72 1.6 1.00E-02 Nt5e 5'-nucleotidase 0.72 1.6 2.31E-02 Mthfd2 Bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase, mitochondrial 0.71 1.6 4.94E-02 Gadd45g Growth arrest and DNA damage-inducible protein GADD45 gamma 0.71 1.6 8.45E-03 Clec4a1 C-type lectin domain family 4, member a1 0.71 1.6 2.17E-02 Cd86 T-lymphocyte activation antigen CD86 0.71 1.6 1.14E-02 Gpihbp1 Glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1 0.71 1.6 2.13E-02 Ifi44 Interferon-induced protein 44 0.71 1.6 4.65E-03 Trp53i11 Tumor protein p53-inducible protein 11 0.71 1.6 4.65E-03 Megf11 Multiple epidermal growth factor-like domains protein 11 0.71 1.6 6.90E-03 Adam19 Disintegrin and metalloproteinase domain-containing protein 19 0.71 1.6 6.45E-03 Ttll5 Tubulin polyglutamylase TTLL5 0.70 1.6 4.41E-02 Stbd1 Starch-binding domain-containing protein 1 0.70 1.6 4.41E-02 Il33 Interleukin-33 0.70 1.6 2.95E-02 Sema3d Semaphorin-3D 0.69 1.6 2.01E-02 Gadd45b Growth arrest and DNA damage-inducible protein GADD45 beta 0.69 1.6 2.12E-02 Tnfrsf21 Tumor necrosis factor receptor superfamily member 21 0.69 1.6 7.15E-03 Nes Nestin 0.69 1.6 7.95E-03 Nxt2 NTF2-related export protein 2 0.69 1.6 3.95E-02 Epha3 Ephrin type-A receptor 3 0.69 1.6 1.28E-02 Gene ID Gene Name Log2 Fold Change p_value Spon1 Spondin-1 0.69 1.6 2.64E-02 Kif26b Kinesin-like protein KIF26B 0.68 1.6 7.90E-03 Tmem200a Transmembrane protein 200A 0.68 1.6 3.15E-02 Ptbp2 Polypyrimidine tract-binding protein 2 0.68 1.6 3.04E-02 Snx18 Sorting nexin-18 0.68 1.6 7.80E-03 Gzme Granzyme E 0.68 1.6 1.34E-02 Cd83 CD83 antigen 0.68 1.6 1.14E-02 Kif21b Kinesin-like protein KIF21B 0.68 1.6 1.27E-02 Dll4 Delta-like protein 4 0.67 1.6 1.81E-02 Ahr Aryl hydrocarbon receptor 0.67 1.6 1.37E-02 Hcls1 Hematopoietic lineage cell-specific protein 0.67 1.6 8.70E-03 Bhlhe40 Class E basic helix-loop-helix protein 40 0.67 1.6 1.40E-02 Rac2 Ras-related C3 botulinum toxin substrate 2 0.66 1.6 9.85E-03 Leprel2 Prolyl 3-hydroxylase 3 0.66 1.6 8.30E-03 Fibin Fin bud initiation factor homolog 0.66 1.6 1.97E-02 S1pr3 Sphingosine 1-phosphate receptor 3 0.66 1.6 8.25E-03 Mnt Max-binding protein MNT 0.65 1.6 2.74E-02 Mif Macrophage migration inhibitory factor 0.65 1.6 2.51E-02 Fzd1 Frizzled-1 0.65 1.6 2.48E-02 Egr2 E3 SUMO-protein ligase EGR2 0.65 1.6 1.40E-02 Rai14 Ankycorbin 0.65 1.6 1.20E-02 Tfpi Tissue factor pathway inhibitor 0.64 1.6 1.05E-02 Stard13 StAR-related lipid transfer protein 13 0.64 1.6 2.32E-02 Bcl2l11 Bcl-2-like protein 11 0.64 1.6 1.78E-02 Rusc2 Iporin 0.64 1.6 1.31E-02 Adamts7 A disintegrin and metalloproteinase with thrombospondin motifs 7 0.64 1.6 3.54E-02 Cdkn2b Cyclin-dependent kinase 4 inhibitor B 0.64 1.6 1.70E-02 Amz1 Archaemetzincin-1 0.63 1.6 4.65E-02 Hmox1 Heme oxygenase 1 0.63 1.6 1.97E-02 Mical2 Protein-methionine sulfoxide oxidase MICAL2 0.63 1.6 2.38E-02 Slfn2 Protein Slfn2 0.63 1.5 1.45E-02 Kcne3 Potassium voltage-gated channel subfamily E member 3 0.63 1.5 3.45E-02 Cpt1c Carnitine O-palmitoyltransferase 1, brain isoform 0.63 1.5 4.93E-02 Rgs4 Regulator of G-protein signaling 4 0.63 1.5 2.42E-02 Errfi1 ERBB receptor feedback inhibitor 1 0.63 1.5 9.65E-03 Txndc16 Thioredoxin domain-containing protein 16 0.63 1.5 1.95E-02 Cdc42ep3 Cdc42 effector protein 3 0.62 1.5 2.98E-02 Src Neuronal proto-oncogene tyrosine-protein kinase Src 0.62 1.5 1.81E-02 Lrrc32 MCG51019, isoform CRA_b 0.62 1.5 1.32E-02 Plekhb2 Pleckstrin homology domain-containing family B member 2 0.62 1.5 1.42E-02 Tlr2 Toll-like receptor 2 0.62 1.5 1.41E-02 Naglu Alpha-N-acetylglucosaminidase 0.62 1.5 1.62E-02 Fam20a Protein FAM20A 0.62 1.5 2.01E-02 Palld Palladin 0.62 1.5 1.45E-02 Fndc1 Protein Fndc1 0.61 1.5 3.53E-02 Nedd9 Enhancer of filamentation 1 0.61 1.5 1.89E-02 Cx3cr1 CX3C chemokine receptor 1 0.61 1.5 2.93E-02 Vwa1 von Willebrand factor A domain-containing protein 1 0.61 1.5 1.68E-02 Clec5a C-type lectin domain family 5 member A 0.61 1.5 3.09E-02 Esd S-formylglutathione hydrolase 0.60 1.5 2.06E-02 Itga9 Protein Itga9 0.60 1.5 1.85E-02 Fcer1g High affinity immunoglobulin epsilon receptor subunit gamma 0.60 1.5 1.74E-02 Egln1 Egl nine homolog 1 0.60 1.5 1.68E-02 Col8a2 Collagen alpha-2(VIII) chain 0.60 1.5 1.62E-02 Cdkn2a Cyclin-dependent kinase inhibitor 2A, isoform 3 0.59 1.5 4.63E-02 Tbl2 Transducin beta-like protein 2 0.59 1.5 4.46E-02 Naga Alpha-N-acetylgalactosaminidase 0.59 1.5 2.61E-02 Fam168a Protein FAM168A 0.59 1.5 1.61E-02 Ptgs2 Prostaglandin G/H synthase 2 0.58 1.5 1.88E-02 Nlgn2 Neuroligin-2 0.58 1.5 2.14E-02 Junb Transcription factor jun-B 0.58 1.5 1.79E-02 Ccdc41 Centrosomal protein of 83 kDa 0.58 1.5 4.47E-02 Acvr1 Activin receptor type-1 0.58 1.5 3.20E-02 Apod Apolipoprotein D 0.57 1.5 2.65E-02 Gaa Lysosomal alpha-glucosidase 0.57 1.5 2.06E-02 Fgfr1 Fibroblast growth factor receptor 1 0.57 1.5 3.41E-02 Dkk2 Dickkopf-related protein 2 0.57 1.5 3.23E-02 Mpzl1 Myelin protein zero-like protein 1 0.57 1.5 2.53E-02 Ncam1 Neural cell adhesion molecule 1 0.57 1.5 3.38E-02 Mxi1 Max-interacting protein 1 0.57 1.5 2.93E-02 Abcc9 ATP-binding cassette sub-family C member 9 0.56 1.5 2.32E-02 Oasl2 2'-5'-oligoadenylate synthase-like protein 2 0.56 1.5 2.75E-02 Tgfb3 Transforming growth factor beta-3 0.56 1.5 4.30E-02 Runx1 Runt-related transcription factor 1 0.56 1.5 3.61E-02 Myo7a Unconventional myosin-VIIa 0.55 1.5 4.60E-02 Fndc3a Fibronectin type-III domain-containing protein 3A 0.55 1.5 2.70E-02 Rgs2 Regulator of G-protein signaling 2 0.55 1.5 3.75E-02 Tgif1 Homeobox protein TGIF1 0.55 1.5 4.66E-02 Rell1 RELT-like protein 1 0.55 1.5 3.13E-02 Meox1 Homeobox protein MOX-1 0.55 1.5 4.49E-02 Ccr5 C-C chemokine receptor type 5 0.55 1.5 3.02E-02 Ifih1 Interferon-induced helicase C domain-containing protein 1 0.55 1.5 4.41E-02 Vash1 Vasohibin-1 0.54 1.5 2.70E-02 Rnf2 E3 ubiquitin-protein ligase RING2 0.54 1.5 3.87E-02 Vcam1 Vascular cell adhesion protein 1 0.54 1.5 3.64E-02 Gene ID Gene Name Log2 Fold Change p_value Apbb2 Amyloid beta A4 precursor protein-binding family B member 2 0.54 1.5 3.39E-02 Arrb2 Beta-arrestin-2 0.53 1.4 2.95E-02 Gab2 GRB2-associated-binding protein 2 0.53 1.4 3.81E-02 Enpp1 Ectonucleotide pyrophosphatase/phosphodiesterase family member 1 0.53 1.4 3.62E-02 Akap12 A-kinase anchor protein 12 0.53 1.4 3.23E-02 Pacs1 Phosphofurin acidic cluster sorting protein 1 0.53 1.4 4.88E-02 Agap1 Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 1 0.53 1.4 4.65E-02 Slc11a1 Natural resistance-associated macrophage protein 1 0.53 1.4 4.05E-02 Fam117b Protein FAM117B 0.53 1.4 3.53E-02 Rnf19a E3 ubiquitin-protein ligase RNF19A 0.53 1.4 3.95E-02 Crispld2 Cysteine-rich secretory protein LCCL domain-containing 2 0.53 1.4 3.56E-02 Dbn1 Drebrin 0.53 1.4 3.92E-02 Pnrc1 MCG12570 0.53 1.4 3.51E-02 Rbpj Recombining binding protein suppressor of hairless 0.52 1.4 4.94E-02 Plod1 Procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 0.52 1.4 3.77E-02 Bnip3 BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 0.52 1.4 4.61E-02 Plk2 Serine/threonine-protein kinase PLK2 0.52 1.4 3.77E-02 Ifi30 Gamma-interferon-inducible lysosomal thiol reductase 0.52 1.4 3.54E-02 Pld4 Phospholipase D4 0.52 1.4 3.65E-02 Steap2 Metalloreductase STEAP2 0.51 1.4 4.82E-02 Ccr1 C-C chemokine receptor type 1 0.51 1.4 4.83E-02 Akr1b8 Aldose reductase-related protein 2 0.51 1.4 4.66E-02 Cxcr4 C-X-C chemokine receptor type 4 0.51 1.4 4.11E-02 Plat Tissue-type plasminogen activator 0.50 1.4 4.48E-02 Table S1 down regulated stromal genes Gene ID Gene Name Log2 Fold Change p_value Krt79 Keratin, type II cytoskeletal 79 -8.91 -480.922 5.50E-03 Cyp2e1 Cytochrome P450 2E1 -8.67 -408.301 1.55E-03 Elovl4 Elongation of very long chain fatty acids protein 4 -8.21 -296.718 4.13E-02 Calm4 Calmodulin-4 -8.20 -293.480 5.50E-03 Krt5 Keratin, type II cytoskeletal 5 -8.05 -265.304 1.76E-02 Krt71 Keratin, type II cytoskeletal 71 -7.80 -223.144 1.18E-02 Krt25 Keratin, type I cytoskeletal 25 -7.79 -221.484 3.84E-02 Pck1 Phosphoenolpyruvate carboxykinase, cytosolic [GTP] -7.62 -196.351 1.60E-03 Fa2h Fatty acid 2-hydroxylase -7.55 -187.994 4.68E-02 Lor Loricrin -7.26 -153.442 5.50E-03 Krt10 Keratin, type I cytoskeletal 10 -7.25 -152.126 5.00E-05 Spink5 Protein Spink5 -7.24 -151.006 5.50E-03 Krt73 Keratin, type II cytoskeletal 73 -7.24 -150.983 5.50E-03 Perp p53 apoptosis effector related to PMP-22 -7.21 -147.910 5.65E-03 Krt14 Keratin, type I cytoskeletal 14 -7.03 -130.909 6.45E-03 Dsc3 Desmocollin-3 -6.97 -125.211 3.84E-02 Cdsn Corneodesmosin -6.96 -124.184 5.50E-03 Krt28 Keratin, type I cytoskeletal 28 -6.81 -112.002 5.50E-03 Krt17 Keratin, type I cytoskeletal 17 -6.77 -108.967 1.19E-02 Adora1 Adenosine receptor A1 -6.72 -105.646 9.50E-03 BC100530 MCG130175, isoform CRA_b -6.62 -98.258 4.72E-02 Krt77 Keratin, type II cytoskeletal 1b -6.60 -96.814 5.50E-03 Dsp Desmoplakin -6.57 -94.717 5.00E-05 Pkp1 Plakophilin-1 -6.49 -90.187 8.70E-03 Thrsp Thyroid hormone-inducible hepatic protein -6.49 -90.137 5.00E-05 Padi3 Protein-arginine deiminase type-3 -6.45 -87.529 5.50E-03 Scel Sciellin -6.41 -85.186 5.50E-03 Plin1 Perilipin-1 -6.35 -81.644 8.00E-04 Asprv1 Retroviral-like aspartic protease 1 -6.30 -78.626 4.83E-02 Clca2 Calcium-activated chloride channel regulator 2 -6.20 -73.294 4.28E-02 Crnn Protein Crnn -6.15 -71.132 5.50E-03 Ephx2 Bifunctional epoxide hydrolase 2 -6.05 -66.077 2.50E-03 Krt34 Keratin, type I cuticular Ha4 -6.01 -64.477 5.50E-03 Cfd Complement factor D -5.96 -62.046 1.01E-02 Ces1d Carboxylesterase 1D -5.75 -53.902 7.50E-04 Pla2g2f Group IIF secretory phospholipase A2 -5.71 -52.365 5.50E-03 Slc36a2 Proton-coupled amino acid transporter 2 -5.64 -49.821 8.00E-04 Cidec Cell death activator CIDE-3 -5.56 -47.306 5.00E-05 Gpd1 Glycerol-3-phosphate dehydrogenase [NAD(+)], cytoplasmic -5.52 -45.773 5.00E-05 Prr9 Proline-rich protein 9 -5.51 -45.688 8.00E-04 Adipoq Adiponectin -5.46 -43.996 5.00E-05 Fasn Fatty acid synthase -5.44 -43.480 5.00E-05 Ucp1 Mitochondrial brown fat uncoupling protein 1 -5.20 -36.884 5.00E-05 Krt15 Keratin, type I cytoskeletal 15 -5.20 -36.715 3.84E-02 Serpinb5 Serpin B5 -5.17 -35.886 2.90E-03 Gsdma Gasdermin-A -5.13 -35.092 4.72E-02 Tmem56 Transmembrane protein 56 -5.11 -34.463 4.23E-02 Mrap Melanocortin-2 receptor accessory protein -5.00 -31.977 7.85E-03 1100001G20RikProtein 1100001G20Rik -4.98 -31.637 5.75E-03 Gys2 Glycogen [starch] synthase, liver -4.97 -31.264 3.84E-02 Glb1l2 Beta-galactosidase-1-like protein 2 -4.89 -29.681 1.50E-03 Plin4 Perilipin-4 -4.87 -29.197 1.00E-04 Trim29 Tripartite motif-containing protein 29 -4.85 -28.819 9.50E-04 Acacb Protein Acacb -4.84 -28.609 5.00E-05 Defb6 Beta-defensin 6 -4.78 -27.400 5.50E-03 Ppl Periplakin -4.70 -26.063 8.50E-04 Epn3 Epsin-3 -4.68 -25.562 5.50E-03 Dgat2 Diacylglycerol O-acyltransferase 2 -4.62 -24.652 5.00E-05 Hp Haptoglobin -4.62 -24.606 5.00E-05 Elovl6 Elongation of very long chain fatty acids protein 6 -4.58 -23.882 5.00E-05 Tst Thiosulfate sulfurtransferase -4.58 -23.859 7.70E-03 Cdo1 Cysteine dioxygenase type 1 -4.55 -23.494 5.00E-05 Adhfe1 Hydroxyacid-oxoacid transhydrogenase, mitochondrial -4.48 -22.262 6.00E-03 Bche Cholinesterase -4.48 -22.257 6.00E-04 Hephl1 Hephaestin-like protein 1 -4.45 -21.848 3.84E-02 Evpl Envoplakin -4.44 -21.637 3.95E-03 Tbx1 T-box transcription factor TBX1 -4.41 -21.198 5.50E-03 Cxadr Coxsackievirus and adenovirus receptor homolog -4.38 -20.793 3.88E-02 Apol6 Protein Apol6 -4.35 -20.343 4.69E-02 Ncan Neurocan core protein -4.34 -20.308 4.72E-02 Adig Adipogenin -4.32 -19.918 6.40E-03 Slc2a4 Solute carrier family 2, facilitated glucose transporter member 4 -4.25 -18.991 5.00E-04 Hmga1 High mobility group protein HMG-I/HMG-Y -4.23 -18.741 5.00E-05 Fam13a Protein FAM13A -4.20 -18.414 1.00E-04 Ldhd Probable D-lactate dehydrogenase, mitochondrial -4.14 -17.675 3.18E-02 Ovol1 Putative transcription factor Ovo-like 1 -4.14 -17.659 4.68E-02 Lad1 Ladinin-1 -4.13 -17.499 7.65E-03 Smoc1 SPARC-related modular calcium-binding protein 1 -4.10 -17.197 3.00E-04 Pvalb Parvalbumin alpha -4.10 -17.121 5.00E-05 Cdcp1 CUB domain-containing protein 1 -4.09 -17.029 4.72E-02 Msx2 Homeobox protein MSX-2 -4.09 -17.010 5.55E-03 Chi3l1 Chitinase-3-like protein 1 -4.08 -16.963 1.59E-02 Dhcr24 Delta(24)-sterol reductase -4.02 -16.219 5.00E-05 Fabp4 Fatty acid-binding protein, adipocyte -3.95 -15.452 1.75E-03 Ampd1 AMP deaminase 1 -3.94 -15.338 2.19E-02 Pdk4 [Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 4, mitochondrial -3.92 -15.174 5.00E-05 Gjb2 Gap junction beta-2 protein -3.90 -14.882 2.00E-04 Gene ID Gene Name Log2 Fold Change p_value Gbp11 MCG3631, isoform CRA_a -3.89 -14.865 3.40E-02 Lipe Endothelial lipase -3.85 -14.459 5.00E-05 Ahsg Alpha-2-HS-glycoprotein -3.78 -13.770 4.70E-03 Clic3 Chloride intracellular channel protein 3 -3.76 -13.536 4.72E-02 Rassf6 Ras association domain-containing protein 6 -3.73 -13.243 5.50E-03 Echdc1 Ethylmalonyl-CoA decarboxylase -3.71 -13.131 2.60E-02 Ckm Creatine kinase M-type -3.71 -13.061 5.00E-05 Mlxipl Carbohydrate-responsive element-binding protein -3.68 -12.807 3.50E-04 Serpina3c Serine protease inhibitor A3C -3.68 -12.794 5.00E-05 Zfp612 Protein Zfp612 -3.66 -12.665 5.70E-03 Me1 NADP-dependent malic enzyme -3.66 -12.621 5.00E-05 Agpat2 1-acyl-sn-glycerol-3-phosphate acyltransferase beta -3.62 -12.301 5.00E-05 Lpl Lipoprotein lipase -3.58 -11.991 5.00E-05 G0s2 G0/G1 switch protein 2 -3.57 -11.836 4.50E-04 Celsr1 Cadherin EGF LAG seven-pass G-type receptor 1 -3.52 -11.488 1.26E-02 Dmkn Dermokine -3.48 -11.196 5.00E-05 Pygm Glycogen phosphorylase, muscle form -3.47 -11.119 5.00E-05 Cox8b Cytochrome c oxidase subunit 8B, mitochondrial -3.46 -11.012 3.00E-04 Chpt1 Cholinephosphotransferase 1 -3.46 -10.996 5.00E-05 Myh4 Myosin-4 -3.44 -10.839 5.00E-05 Casz1 Zinc finger protein castor homolog 1 -3.44 -10.824 4.10E-02 Rdh12 Retinol dehydrogenase 12 -3.42 -10.699 2.43E-02 Acaca Acetyl-CoA carboxylase 1 -3.41 -10.651 5.00E-05 Gpt UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase -3.40 -10.558 6.00E-04 Pnpla2 Patatin-like phospholipase domain-containing protein 2 -3.40 -10.548 5.00E-05 Gadl1 Glutamate decarboxylase-like protein 1 -3.40 -10.526 4.13E-02 Slc1a3 Excitatory amino acid transporter 1 -3.36 -10.272 5.00E-05 Lep Leptin -3.36 -10.259 2.83E-02 Fgf10 Fibroblast growth factor 10 -3.35 -10.191 7.50E-04 Serpina3m Serine protease inhibitor A3M -3.34 -10.120 4.10E-03 Cd36 Platelet glycoprotein 4 -3.31 -9.910 5.00E-05 Rorc Nuclear receptor ROR-gamma -3.31 -9.885 2.35E-02 Cdh1 Cadherin-1 -3.30 -9.878 5.00E-05 Ankrd2 Ankyrin repeat domain-containing protein 2 -3.30 -9.853 2.35E-02 Dlx3 Homeobox protein DLX-3 -3.28 -9.718 1.31E-02 Aldh1l1 Cytosolic 10-formyltetrahydrofolate dehydrogenase -3.27 -9.655 5.00E-05 Tcap Telethonin -3.27 -9.650 3.50E-04 Prkaa2 5'-AMP-activated protein kinase catalytic subunit alpha-2 -3.27 -9.624 1.05E-03 Apobec2 Probable C-U-editing enzyme APOBEC-2 -3.24 -9.451 4.15E-03 Chchd10 Coiled-coil-helix-coiled-coil-helix domain containing 10 -3.23 -9.411 5.00E-05 Acsl1 Long-chain-fatty-acid--CoA ligase 1 -3.23 -9.400 5.00E-05 Nat8l N-acetylaspartate synthetase -3.23 -9.373 5.00E-05 Mtap2 Microtubule-associated protein 2 -3.19 -9.109 6.45E-03 Mpp7 MAGUK p55 subfamily member 7 -3.19 -9.108 2.30E-02 Lcn2 Neutrophil gelatinase-associated lipocalin -3.18 -9.070 5.00E-05 Pfkfb1 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 1 -3.18 -9.056 2.04E-02 Myoz3 Myozenin-3 -3.18 -9.049 3.98E-02 Acpp Prostatic acid phosphatase -3.17 -9.024 4.92E-02 Mylk2 Myosin light chain kinase 2, skeletal/cardiac muscle -3.12 -8.677 5.00E-04 Acss2 Acetyl-coenzyme A synthetase, cytoplasmic -3.10 -8.571 5.00E-05 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 -3.10 -8.545 3.73E-02 Ddo D-aspartate oxidase -3.07 -8.414 3.12E-02 Wfdc18 WAP four-disulfide core domain protein 18 -3.03 -8.140 4.75E-02 Cldn1 Claudin-1 -3.01 -8.050 5.00E-05 Tnni2 Troponin I, fast skeletal muscle -3.00 -8.025 5.00E-05 Mal2 Protein MAL2 -2.98 -7.867 2.09E-02 Slc9a2 Sodium/hydrogen exchanger -2.97 -7.861 1.51E-02 Sctr Secretin receptor -2.97 -7.825 1.29E-02 Kcnk3 Potassium channel subfamily K member 3 -2.96 -7.801 2.55E-02 Hr Protein hairless -2.94 -7.692 5.00E-05 St14 Suppressor of tumorigenicity 14 protein homolog -2.94 -7.691 1.41E-02 Prkcq Protein kinase C theta type -2.93 -7.639 4.25E-02 Obscn Obscurin -2.92 -7.586 5.00E-05 Myoz1 Myozenin-1 -2.92 -7.565 5.00E-05 Klhl31 Kelch-like protein 31 -2.87 -7.336 6.45E-03 Clmn Calmin -2.87 -7.334 2.70E-03 Arhgef16 Rho guanine nucleotide exchange factor 16 -2.85 -7.233 8.40E-03 Cd1d1 Antigen-presenting glycoprotein CD1d1 -2.82 -7.076 3.00E-04 Fsd2 Fibronectin type III and SPRY domain-containing protein 2 -2.82 -7.051 3.19E-02 Tlcd1 TLC domain-containing protein 1 -2.81 -6.995 1.35E-02 Tusc5 Tumor suppressor candidate 5 homolog -2.80 -6.982 5.00E-05 Sntb1 Beta-1-syntrophin -2.80 -6.965 3.50E-02 Actn3 Alpha-actinin-3 -2.75 -6.730 5.00E-05 Mybpc2 Myosin-binding protein C, fast-type -2.74 -6.703 5.00E-05 Abcd2 ATP-binding cassette sub-family D member 2 -2.74 -6.695 5.00E-05 Ky Kyphoscoliosis peptidase -2.74 -6.664 3.24E-02 Cox7a1 Cytochrome c oxidase subunit 7A1, mitochondrial -2.73 -6.643 4.55E-03 Ctnnd2 Catenin delta-2 -2.72 -6.609 1.98E-02 2310015B20RikMCG146286 (Fragment) -2.72 -6.608 1.96E-02 Cpm Carboxypeptidase M -2.72 -6.578 2.30E-03 Agpat9 Glycerol-3-phosphate acyltransferase 3 -2.70 -6.477 4.30E-03 Myot Myotilin -2.69 -6.459 2.50E-04 Rapgefl1 Rap guanine nucleotide exchange factor-like 1 -2.69 -6.451 4.60E-03 Mccc1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial -2.69 -6.438 5.00E-05 Cyp2f2 Cytochrome P450 2F2 -2.68 -6.402 8.00E-04 Agt Angiotensinogen -2.67 -6.358 1.37E-02 Fmo1 Dimethylaniline monooxygenase [N-oxide-forming] 1 -2.67 -6.356 5.00E-05 Eno3 Beta-enolase -2.66 -6.332 5.00E-05 Gene ID Gene Name Log2 Fold Change p_value Ckmt2 Creatine kinase S-type, mitochondrial -2.66 -6.328 4.43E-02 Cmbl Carboxymethylenebutenolidase homolog -2.65 -6.290 2.75E-03 Mylpf Myosin regulatory light chain 2, skeletal muscle isoform -2.65 -6.260 5.00E-05 Hpx Hemopexin -2.63 -6.201 2.90E-03 Mgst3 Microsomal glutathione S-transferase 3 -2.63 -6.189 5.50E-04 Hfe2 Hemojuvelin -2.62 -6.129 1.05E-02 Prodh Proline dehydrogenase 1, mitochondrial -2.60 -6.051 3.90E-03 Endou Poly(U)-specific endoribonuclease -2.59 -6.032 2.70E-03 Mreg Melanoregulin -2.59 -6.012 2.50E-03 Gstz1 Maleylacetoacetate isomerase -2.58 -5.992 5.00E-05 Ldhb L-lactate dehydrogenase B chain -2.57 -5.942 6.50E-04 Pank1 Pantothenate kinase 1 -2.56 -5.886 4.00E-04 Myh2 MCG140437, isoform CRA_d -2.53 -5.781 5.00E-05 Steap4 Metalloreductase STEAP4 -2.51 -5.685 5.00E-05 Aldh6a1 Methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial -2.51 -5.683 5.00E-05 Pgam2 Phosphoglycerate mutase 2 -2.50 -5.655 5.00E-05 Chac1 Cation transport regulator-like protein 1 -2.49 -5.626 1.08E-02 Myh14 Myosin-14 -2.49 -5.599 1.46E-02 Tuba8 Tubulin alpha-8 chain -2.48 -5.569 2.26E-02 Myom2 Myomesin 2 -2.48 -5.560 5.00E-05 Tnnc2 Troponin C, skeletal muscle -2.45 -5.463 5.00E-05 Ppp1r27 Protein phosphatase 1 regulatory subunit 27 -2.44 -5.445 3.47E-02 Actn2 Alpha-actinin-2 -2.44 -5.436 5.00E-05 Prkar2b cAMP-dependent protein kinase type II-beta regulatory subunit -2.44 -5.421 5.00E-05 Clcn1 Chloride channel protein 1 -2.44 -5.414 3.97E-02 Art1 GPI-linked NAD(P)(+)--arginine ADP-ribosyltransferase 1 -2.44 -5.409 1.06E-02 Casq1 Calsequestrin-1 -2.43 -5.404 5.00E-05 Clstn3 Calsyntenin-3 -2.43 -5.385 2.52E-02 Dnase1l2 Deoxyribonuclease-1-like 2 -2.43 -5.384 2.85E-02 Cecr2 Protein Cecr2 -2.42 -5.369 2.73E-02 Slc1a5 Neutral amino acid transporter B(0) -2.40 -5.276 5.00E-05 Adrb3 Beta-3 adrenergic receptor -2.39 -5.259 1.00E-04 Ppp1r3a Protein phosphatase 1 regulatory subunit 3A -2.37 -5.187 3.50E-03 Scn4b Sodium channel subunit beta-4 -2.36 -5.135 3.95E-03 Tmem79 Transmembrane protein 79 -2.35 -5.113 6.05E-03 Enpp2 Ectonucleotide pyrophosphatase/phosphodiesterase family member 2 -2.35 -5.099 5.00E-05 Slc25a35 Solute carrier family 25 member 35 -2.34 -5.065 7.55E-03 Aacs Acetoacetyl-CoA synthetase -2.33 -5.043 5.00E-05 Ldb3 LIM domain-binding protein 3 -2.33 -5.040 5.00E-05 Myom3 Myomesin-3 -2.32 -4.989 1.75E-02 Klf15 Krueppel-like factor 15 -2.32 -4.988 1.02E-02 Sorbs1 Sorbin and SH3 domain-containing protein 1 -2.30 -4.933 5.00E-05 Pxmp2 Peroxisomal membrane protein 2 -2.30 -4.909 2.04E-02 Eef1a2 Elongation factor 1-alpha 2 -2.29 -4.885 1.00E-04 Ryr1 Ryanodine receptor 1 -2.29 -4.877 5.00E-05 Kcnb1 Potassium voltage-gated channel subfamily B member 1 -2.25 -4.760 7.15E-03 Wnt4 Protein Wnt-4 -2.25 -4.760 3.12E-02 Cmya5 Cardiomyopathy-associated protein 5 -2.25 -4.754 5.00E-05 Slc25a1 Protein Slc25a1 -2.25 -4.752 5.00E-05 Crym Ketimine reductase mu-crystallin -2.25 -4.742 3.20E-02 Tob1 Protein Tob1 -2.25 -4.741 5.00E-05 Acat2 Acetyl-CoA acetyltransferase, cytosolic -2.24 -4.738 5.00E-05 Fgfr3 Fibroblast growth factor receptor 3 -2.24 -4.713 2.55E-03 Srl Sarcalumenin -2.20 -4.599 5.00E-05 Fitm2 Fat storage-inducing transmembrane protein 2 -2.18 -4.530 8.50E-04 Srd5a1 3-oxo-5-alpha-steroid 4-dehydrogenase 1 -2.18 -4.528 3.67E-02 Rbp4 Retinol-binding protein 4 -2.18 -4.524 5.00E-05 Ptplb Very-long-chain (3R)-3-hydroxyacyl-[acyl-carrier protein] dehydratase 2 -2.17 -4.494 5.00E-05 Gpam Glycerol-3-phosphate acyltransferase 1, mitochondrial -2.16 -4.457 5.00E-05 Scn4a Sodium channel protein type 4 subunit alpha -2.15 -4.440 1.81E-02 Serpina1b Alpha-1-antitrypsin 1-2 -2.15 -4.437 9.85E-03 Cobl Protein cordon-bleu -2.14 -4.423 3.57E-02 Sdr42e1 Short-chain dehydrogenase/reductase family 42E member 1 -2.14 -4.420 2.95E-03 Neb Protein Neb -2.12 -4.351 5.00E-05 Sypl2 Synaptophysin-like protein 2 -2.10 -4.282 1.85E-03 Hip1r Huntingtin-interacting protein 1-related protein -2.09 -4.250 1.15E-03 Hrc Histidine rich calcium binding protein, isoform CRA_a -2.08 -4.230 6.75E-03 Mettl7a1 MCG20149, isoform CRA_a -2.08 -4.216 5.00E-05 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 -2.08 -4.216 5.00E-05 Acad11 Acyl-CoA dehydrogenase family member 11 -2.07 -4.209 5.00E-05 Dbi Acyl-CoA-binding protein -2.06 -4.178 5.00E-05 Tmod4 Tropomodulin-4 -2.05 -4.145 3.05E-03 Acta1 Actin, alpha skeletal muscle -2.05 -4.136 5.00E-05 Nrap Nebulin-related-anchoring protein -2.05 -4.128 5.00E-05 Lpin1 Phosphatidate phosphatase LPIN1 -2.04 -4.111 5.00E-05 Mme Neprilysin -2.03 -4.084 5.00E-05 Dgat1 Diacylglycerol O-acyltransferase 1 -2.02 -4.062 5.00E-05 Rtn2 Reticulon-2 -2.02 -4.062 5.00E-03 Oplah 5-oxoprolinase -2.02 -4.059 5.00E-05 Deptor DEP domain-containing mTOR-interacting protein -2.01 -4.035 1.15E-03 Itga7 Integrin alpha-7 -2.01 -4.027 5.00E-05 Net1 Neuroepithelial cell-transforming gene 1 protein -2.01 -4.021 5.00E-05 Tppp Tubulin polymerization-promoting protein -2.01 -4.019 1.95E-03 Maob Amine oxidase [flavin-containing] B -2.00 -4.000 1.40E-03 Esrp1 Epithelial splicing regulatory protein 1 -2.00 -4.000 3.00E-04 3425401B19RikProtein 3425401B19Rik -2.00 -3.991 2.84E-02 Krt80 Keratin, type II cytoskeletal 80 -2.00 -3.988 1.25E-03 Synpo2l Synaptopodin 2-like protein -1.99 -3.985 2.60E-02 Gene ID Gene Name Log2 Fold Change p_value Tuba4a Tubulin alpha-4A chain -1.99 -3.981 5.00E-04 Ghr Growth hormone receptor -1.99 -3.969 5.00E-05 Tgfa Protransforming growth factor alpha -1.99 -3.967 1.63E-02 Flrt3 Fibronectin leucine rich transmembrane protein 3 -1.99 -3.966 2.26E-02 Pparg Peroxisome proliferator-activated receptor gamma -1.98 -3.955 1.00E-04 Tnnt1 Troponin T, slow skeletal muscle -1.97 -3.926 3.63E-02 Acer2 Alkaline ceramidase 2 -1.97 -3.910 1.30E-03 Cybrd1 Cytochrome b reductase 1 -1.96 -3.900 1.75E-02 Pfkm 6-phosphofructokinase, muscle type -1.96 -3.881 2.00E-04 Trim72 Tripartite motif-containing protein 72 -1.95 -3.877 2.50E-03 Ablim3 Actin-binding LIM protein 3 -1.94 -3.825 4.50E-03 Sort1 Sortilin -1.92 -3.787 5.00E-05 Slc25a10 Mitochondrial dicarboxylate carrier -1.91 -3.766 5.00E-05 Xirp2 Xin actin-binding repeat-containing protein 2 -1.91 -3.757 5.00E-05 Nudt12 Peroxisomal NADH pyrophosphatase NUDT12 -1.89 -3.698 2.43E-02 Shisa2 Protein shisa-2 homolog -1.88 -3.690 4.50E-03 Slc24a3 Sodium/potassium/calcium exchanger 3 -1.87 -3.668 6.80E-03 Slc38a4 Sodium-coupled neutral amino acid transporter 4 -1.87 -3.665 6.05E-03 Txlnb Beta-taxilin -1.87 -3.662 4.55E-03 Vat1l Synaptic vesicle membrane protein VAT-1 homolog-like -1.87 -3.657 4.45E-02 Gata3 Trans-acting T-cell-specific transcription factor GATA-3 -1.87 -3.651 1.90E-03 Rarres1 Protein Rarres1 (Fragment) -1.87 -3.651 1.05E-03 Fam83h Protein FAM83H -1.87 -3.649 6.50E-03 Tmem38a Trimeric intracellular cation channel type A -1.87 -3.644 1.00E-04 Shmt1 Serine hydroxymethyltransferase, cytosolic -1.86 -3.622 2.37E-02 Slc27a1 Long-chain fatty acid transport protein 1 -1.86 -3.621 5.00E-05 Pdzd2 Protein Pdzd2 -1.85 -3.608 5.00E-05 Retsat All-trans-retinol 13,14-reductase -1.85 -3.607 5.00E-05 Echdc2 Enoyl-CoA hydratase domain-containing protein 2, mitochondrial -1.85 -3.605 5.30E-03 Lss Lanosterol synthase -1.84 -3.588 1.70E-03 Cacng1 Voltage-dependent calcium channel gamma-1 subunit -1.83 -3.546 1.26E-02 Acly ATP-citrate synthase -1.82 -3.534 5.00E-05 Sik2 Serine/threonine-protein kinase SIK2 -1.82 -3.524 2.29E-02 9330159F19RikMCG7194, isoform CRA_a -1.82 -3.522 4.01E-02 Spint2 Kunitz-type protease inhibitor 2 -1.81 -3.506 1.60E-03 Acadm Medium-chain specific acyl-CoA dehydrogenase, mitochondrial -1.80 -3.483 5.00E-05 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial -1.78 -3.442 1.00E-04 Nipal2 NIPA-like protein 2 -1.78 -3.427 1.51E-02 Ndrg2 Protein NDRG2 -1.77 -3.406 5.00E-05 Syt7 Synaptotagmin-7 -1.77 -3.401 3.98E-02 Abcb4 Multidrug resistance protein 3 -1.76 -3.388 3.59E-02 Tkt Transketolase -1.75 -3.354 5.00E-05 Myo18b Protein Myo18b -1.74 -3.351 2.65E-03 Hspb6 Heat shock protein beta-6 -1.74 -3.350 5.00E-05 Ccdc69 Coiled-coil domain-containing protein 69 -1.74 -3.342 3.43E-02 Ehhadh Peroxisomal bifunctional enzyme -1.74 -3.333 4.50E-04 Pm20d2 Peptidase M20 domain-containing protein 2 -1.73 -3.327 2.90E-02 Smtnl2 Smoothelin-like protein 2 -1.73 -3.309 3.40E-02 Ano5 Anoctamin-5 -1.72 -3.290 1.42E-02 Gpr126 G-protein coupled receptor 126 -1.72 -3.287 9.60E-03 Pak3 Serine/threonine-protein kinase PAK 3 -1.71 -3.273 2.27E-02 Clu Clustered mitochondria protein homolog -1.70 -3.253 5.00E-05 Mypn Myopalladin -1.69 -3.234 7.35E-03 Pctp Phosphatidylcholine transfer protein -1.69 -3.226 1.00E-03 Arl4a ADP-ribosylation factor-like protein 4A -1.67 -3.190 5.00E-05 Rnf152 E3 ubiquitin-protein ligase RNF152 -1.67 -3.171 1.23E-02 Tns4 Tensin-4 -1.66 -3.163 5.90E-03 Zfp2 Zinc finger protein 2 -1.66 -3.150 2.59E-02 Dhrs9 Dehydrogenase/reductase SDR family member 9 -1.65 -3.136 5.95E-03 Sdcbp2 Syntenin-2 -1.65 -3.135 4.35E-02 Cldn15 Claudin-15 -1.65 -3.135 3.36E-02 Dhdh Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase -1.65 -3.129 2.00E-04 Ptprv Receptor-type tyrosine-protein phosphatase V -1.64 -3.123 6.00E-04 Ankrd35 Protein Ankrd35 -1.64 -3.118 3.38E-02 Slc22a23 Solute carrier family 22 member 23 -1.64 -3.116 6.45E-03 Sbsn Suprabasin -1.64 -3.111 5.00E-05 Mgst1 Microsomal glutathione S-transferase 1 -1.63 -3.095 5.00E-05 Lama3 Laminin subunit alpha-3 -1.63 -3.094 1.38E-02 Gpd2 Glycerol-3-phosphate dehydrogenase, mitochondrial -1.63 -3.090 5.00E-05 Gsta4 Glutathione S-transferase A4 -1.63 -3.085 2.55E-03 Il20rb Protein Il20rb -1.62 -3.081 1.76E-02 Sult1a1 Sulfotransferase 1A1 -1.62 -3.079 2.45E-03 Acox1 Peroxisomal acyl-coenzyme A oxidase 1 -1.62 -3.078 5.00E-05 Hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial -1.61 -3.060 1.50E-04 Tmem143 Transmembrane protein 143 -1.61 -3.057 5.15E-03 Kif21a Kinesin-like protein KIF21A -1.61 -3.048 4.55E-03 Ccl17 Protein Ccl17 -1.60 -3.026 3.74E-02 Csad Cysteine sulfinic acid decarboxylase -1.59 -3.013 5.00E-05 Hadh Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial -1.59 -3.011 5.00E-05 Lmod2 Leiomodin-2 -1.58 -2.980 2.95E-02 Trim68 E3 ubiquitin-protein ligase TRIM68 -1.57 -2.962 2.95E-03 Acadl Long-chain specific acyl-CoA dehydrogenase, mitochondrial -1.56 -2.957 5.00E-05 Art3 Ecto-ADP-ribosyltransferase 3 -1.56 -2.957 5.75E-03 Gnai1 Guanine nucleotide-binding protein G(i) subunit alpha-1 -1.56 -2.955 1.00E-04 Tlcd2 TLC domain-containing protein 2 -1.56 -2.944 1.97E-02 Eci1 Enoyl-CoA delta isomerase 1, mitochondrial -1.56 -2.940 1.00E-04 Cib2 Calcium and integrin-binding family member 2 -1.55 -2.937 8.30E-03 Gpt2 Alanine aminotransferase 2 -1.55 -2.935 5.00E-05 Gene ID Gene Name Log2 Fold Change p_value Adipor2 Adiponectin receptor protein 2 -1.55 -2.923 5.00E-05 D2hgdh D-2-hydroxyglutarate dehydrogenase, mitochondrial -1.54 -2.914 3.94E-02 Fzd10 Frizzled-10 -1.54 -2.910 4.94E-02 Mgl2 MCG21506 -1.54 -2.910 7.00E-03 Lmod3 Protein Lmod3 -1.54 -2.898 2.84E-02 Plcxd2 Plcxd2 protein -1.53 -2.878 4.45E-02 Clic5 Chloride intracellular channel protein 5 -1.52 -2.861 4.25E-03 Reg1 Lithostathine-1 -1.52 -2.860 2.03E-02 Heph Hephaestin -1.51 -2.858 8.50E-04 F830016B08RikInterferon-gamma-inducible GTPase Ifgga4 protein -1.51 -2.849 1.79E-02 Mlf1 Myeloid leukemia factor 1 -1.50 -2.828 3.61E-02 Psat1 Phosphoserine aminotransferase -1.50 -2.826 5.00E-05 Plekhn1 Probable pleckstrin homology domain-containing family N member 1 -1.50 -2.824 2.10E-02 Decr1 2,4-dienoyl-CoA reductase, mitochondrial -1.50 -2.822 5.00E-05 Ggct Gamma-glutamylcyclotransferase -1.50 -2.821 2.18E-02 Ptpn4 Tyrosine-protein phosphatase non-receptor type 4 -1.50 -2.821 1.10E-02 Sqle Squalene monooxygenase -1.49 -2.814 3.50E-04 Ppa1 Inorganic pyrophosphatase -1.48 -2.792 5.00E-05 Slc25a19 Mitochondrial thiamine pyrophosphate carrier -1.48 -2.792 2.00E-03 Akr1c14 3-alpha-hydroxysteroid dehydrogenase type 1 -1.48 -2.792 1.20E-02 Alas1 5-aminolevulinate synthase, nonspecific, mitochondrial -1.48 -2.784 5.00E-05 Cat Catalase -1.47 -2.767 5.00E-05 Cpt2 Carnitine O-palmitoyltransferase 2, mitochondrial -1.46 -2.744 5.00E-05 Hopx Homeodomain-only protein -1.46 -2.742 3.90E-03 Slc4a4 Electrogenic sodium bicarbonate cotransporter 1 -1.45 -2.740 3.00E-04 Glul Glutamine synthetase -1.45 -2.728 2.00E-04 S100a1 Protein S100-A1 -1.45 -2.726 5.00E-05 Mpc1 Mitochondrial pyruvate carrier 1 -1.44 -2.716 1.43E-02 Nudt7 Peroxisomal coenzyme A diphosphatase NUDT7 -1.44 -2.705 1.95E-03 Als2cl ALS2 C-terminal-like protein -1.43 -2.690 1.90E-03 Nrbp2 Nuclear receptor-binding protein 2 -1.43 -2.685 9.00E-04 Fam132a Protein FAM132A -1.42 -2.679 4.90E-03 Aco2 Aconitate hydratase, mitochondrial -1.42 -2.678 5.00E-05 Ralgapa2 Ral GTPase-activating protein subunit alpha-2 -1.42 -2.677 1.70E-03 Acadvl Very long-chain specific acyl-CoA dehydrogenase, mitochondrial -1.42 -2.675 5.00E-05 Agmo Alkylglycerol monooxygenase -1.42 -2.674 2.60E-03 Cish Cytokine-inducible SH2-containing protein -1.41 -2.650 3.95E-03 Crat Carnitine O-acetyltransferase -1.41 -2.648 5.00E-05 Irf4 Interferon regulatory factor 4 -1.40 -2.647 1.90E-03 Tnn Tenascin-N -1.40 -2.644 1.64E-02 Polr3g DNA-directed RNA polymerase III subunit RPC7 -1.39 -2.630 3.00E-02 Hells Lymphocyte-specific helicase -1.39 -2.628 8.85E-03 Msra Mitochondrial peptide methionine sulfoxide reductase -1.39 -2.618 1.40E-03 Met Hepatocyte growth factor receptor -1.38 -2.608 1.60E-03 Vtn Vitronectin -1.38 -2.601 3.40E-02 Anxa8 Annexin A8 -1.37 -2.583 5.00E-05 Tmem120b Transmembrane protein 120B -1.37 -2.578 6.40E-03 Fam126b Protein FAM126B -1.37 -2.578 5.00E-05 Cap2 Adenylyl cyclase-associated protein 2 -1.37 -2.578 1.18E-02 Fam167a Protein FAM167A -1.36 -2.574 1.80E-02 Irx2 Iroquois-class homeodomain protein IRX-2 -1.36 -2.567 1.07E-02 Slc25a23 Calcium-binding mitochondrial carrier protein SCaMC-3 -1.36 -2.563 6.00E-03 Reep1 Receptor expression-enhancing protein 1 -1.36 -2.562 3.38E-02 Alpk3 Alpha-protein kinase 3 -1.35 -2.558 4.33E-02 Bckdha 2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial -1.35 -2.554 5.00E-05 Csl Citrate synthase -1.35 -2.549 5.85E-03 Ptger3 Prostaglandin E2 receptor EP3 subtype -1.35 -2.547 1.60E-03 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial -1.34 -2.540 5.00E-05 Ephb6 Ephrin type-B receptor 6 -1.34 -2.534 4.80E-03 Ppip5k1 Inositol hexakisphosphate and diphosphoinositol-pentakisphosphate kinase 1 -1.34 -2.530 3.35E-02 Prr16 Proline-rich protein 16 -1.33 -2.508 4.10E-02 Dmpk Myotonin-protein kinase -1.32 -2.502 3.50E-04 Pick1 PRKCA-binding protein -1.32 -2.502 3.34E-02 Hemk1 HemK methyltransferase family member 1 -1.32 -2.489 2.24E-02 Tmem41b Transmembrane protein 41B -1.31 -2.488 1.18E-02 Gcat 2-amino-3-ketobutyrate coenzyme A ligase, mitochondrial -1.31 -2.485 4.57E-02 Hsdl2 Hydroxysteroid dehydrogenase-like protein 2 -1.30 -2.461 5.00E-05 Cpa3 Mast cell carboxypeptidase A -1.30 -2.460 5.50E-04 Plekha6 Pleckstrin homology domain-containing family A member 6 -1.29 -2.452 2.17E-02 Jsrp1 Junctional sarcoplasmic reticulum protein 1 -1.29 -2.447 4.20E-02 Nsdhl Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating -1.29 -2.441 8.00E-04 Bckdhb 2-oxoisovalerate dehydrogenase subunit beta, mitochondrial -1.29 -2.439 3.50E-04 Srebf1 Sterol regulatory element-binding protein 1 -1.28 -2.435 4.50E-04 Tbc1d7 TBC1 domain family member 7 -1.28 -2.426 3.42E-02 Pccb Propionyl-CoA carboxylase beta chain, mitochondrial -1.28 -2.423 5.00E-05 Ivd Isovaleryl-CoA dehydrogenase, mitochondrial -1.27 -2.405 5.50E-04 Ispd Isoprenoid synthase domain-containing protein -1.27 -2.405 4.61E-02 Il7r Interleukin-7 receptor subunit alpha -1.26 -2.401 7.50E-04 Sh3tc2 SH3 domain and tetratricopeptide repeat-containing protein 2 -1.26 -2.397 4.91E-02 Des Desmin -1.26 -2.396 5.00E-05 Ppif Peptidyl-prolyl cis-trans isomerase F, mitochondrial -1.26 -2.393 1.89E-02 Nr1h3 Oxysterols receptor LXR-alpha -1.25 -2.386 3.95E-03 Napepld N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D -1.25 -2.381 1.47E-02 Xirp1 Xin actin-binding repeat-containing protein 1 -1.25 -2.376 1.29E-02 Msc Musculin -1.25 -2.375 2.69E-02 Trim12c Protein Trim12c -1.24 -2.368 6.50E-04 Syne2 Nesprin-2 -1.24 -2.363 1.50E-04 Pex16 Peroxisomal membrane protein PEX16 -1.23 -2.345 7.60E-03 Gene ID Gene Name Log2 Fold Change p_value Myh1 Myosin-1 -1.23 -2.344 2.15E-03 Tpsab1 Tryptase -1.23 -2.338 5.00E-04 Abcb8 ATP-binding cassette sub-family B member 8, mitochondrial -1.22 -2.330 6.40E-03 Aim1 Aurora kinase B -1.22 -2.329 2.90E-03 Cpz Carboxypeptidase Z -1.21 -2.320 1.06E-02 Acsbg1 Long-chain-fatty-acid--CoA ligase ACSBG1 -1.21 -2.315 3.46E-02 Insig1 Insulin-induced gene 1 protein -1.21 -2.314 1.00E-04 2310061I04RikProtein 2310061I04Rik -1.21 -2.312 2.91E-02 Ptprd Receptor-type tyrosine-protein phosphatase delta -1.20 -2.302 3.00E-03 Lamc2 Laminin subunit gamma-2 -1.20 -2.298 1.26E-02 Hacl1 2-hydroxyacyl-CoA lyase 1 -1.20 -2.292 1.25E-02 Tmem205 Transmembrane protein 205 -1.19 -2.280 5.15E-03 Eif4a1 Eukaryotic initiation factor 4A-I -1.19 -2.278 5.00E-05 Serpina3n Serine protease inhibitor A3N -1.19 -2.275 5.00E-04 Pop5 Ribonuclease P/MRP protein subunit POP5 -1.19 -2.274 1.45E-02 Scp2 Non-specific lipid-transfer protein -1.18 -2.268 5.00E-05 Sdpr Serum deprivation-response protein -1.18 -2.266 5.00E-05 Xpnpep3 Probable Xaa-Pro aminopeptidase 3 -1.18 -2.261 3.46E-02 Pdhb Pyruvate dehydrogenase E1 component subunit beta, mitochondrial -1.17 -2.257 1.00E-04 Suclg1 Succinyl-CoA ligase [ADP/GDP-forming] subunit alpha, mitochondrial -1.17 -2.257 5.00E-05 Hadhb Trifunctional enzyme subunit beta, mitochondrial -1.17 -2.255 5.85E-03 Bscl2 Seipin -1.17 -2.252 1.00E-04 Phka1 Phosphorylase b kinase regulatory subunit alpha, skeletal muscle isoform -1.17 -2.250 2.25E-03 Mccc2 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial -1.17 -2.248 9.85E-03 Hadha Trifunctional enzyme subunit alpha, mitochondrial -1.17 -2.244 2.50E-04 Rpl35a 60S ribosomal protein L35a -1.16 -2.242 1.01E-02 Aifm2 Apoptosis-inducing factor 2 -1.16 -2.236 3.65E-03 Myom1 Myomesin-1 -1.15 -2.221 1.75E-03 Mmp13 Collagenase 3 -1.15 -2.218 1.00E-04 Etfdh Electron transfer flavoprotein-ubiquinone oxidoreductase, mitochondrial -1.15 -2.216 5.00E-05 Pdlim3 PDZ and LIM domain protein 3 -1.14 -2.208 6.85E-03 Pdk2 [Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 2, mitochondrial -1.14 -2.197 1.55E-03 Tspyl3 Protein Tspyl3 -1.13 -2.193 4.17E-02 Ppp2r5a Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit alpha isoform -1.13 -2.192 8.55E-03 Eepd1 Endonuclease/exonuclease/phosphatase family domain-containing protein 1 -1.13 -2.187 8.55E-03 Fah Fumarylacetoacetase -1.13 -2.185 5.00E-04 Pmvk Phosphomevalonate kinase -1.12 -2.181 1.02E-02 Uck1 Uridine-cytidine kinase 1 -1.12 -2.176 1.46E-02 Etfb Electron transfer flavoprotein subunit beta -1.12 -2.173 3.00E-04 Bcam Basal cell adhesion molecule -1.12 -2.169 2.35E-03 Acsf3 Acyl-CoA synthetase family member 3, mitochondrial -1.11 -2.163 1.57E-02 Dyrk1b Dual specificity tyrosine-phosphorylation-regulated kinase 1B -1.11 -2.162 2.24E-02 Acads Short-chain specific acyl-CoA dehydrogenase, mitochondrial -1.11 -2.160 5.00E-04 Serpina3i Protein Serpina3i -1.11 -2.157 1.94E-02 Echs1 Enoyl-CoA hydratase, mitochondrial -1.11 -2.155 1.00E-04 Coq10a Protein Coq10a -1.10 -2.148 9.10E-03 Idh3g Isocitrate dehydrogenase [NAD] subunit gamma 1, mitochondrial -1.10 -2.148 1.50E-04 Ccdc101 SAGA-associated factor 29 homolog -1.10 -2.147 4.71E-02 Ormdl3 ORM1-like protein 3 -1.10 -2.144 1.00E-04 Smpd3 Sphingomyelin phosphodiesterase 3 -1.10 -2.141 4.35E-02 Pygl Glycogen phosphorylase, liver form -1.09 -2.134 5.00E-04 Mpc2 Mitochondrial pyruvate carrier 2 -1.09 -2.131 1.50E-04 Pkia cAMP-dependent protein kinase inhibitor alpha -1.08 -2.118 2.10E-03 Letmd1 LETM1 domain-containing protein 1 -1.08 -2.108 5.15E-03 Nnmt Nicotinamide N-methyltransferase -1.08 -2.107 5.30E-03 Ube2v2 Ubiquitin-conjugating enzyme E2 variant 2 -1.07 -2.106 3.50E-02 Ndufa1 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1 -1.07 -2.106 8.00E-04 Lrg1 Leucine-rich HEV glycoprotein (Precursor) -1.07 -2.103 6.00E-04 Hint3 Histidine triad nucleotide-binding protein 3 -1.07 -2.103 3.54E-02 Slc27a3 Long-chain fatty acid transport protein 3 -1.07 -2.100 3.47E-02 Bcat2 Branched-chain-amino-acid aminotransferase, mitochondrial -1.07 -2.098 2.50E-04 Ints6 Integrator complex subunit 6 -1.07 -2.097 7.55E-03 Hint2 Histidine triad nucleotide-binding protein 2, mitochondrial -1.07 -2.096 2.48E-02 Coq9 Ubiquinone biosynthesis protein COQ9, mitochondrial -1.07 -2.095 1.00E-03 Dhcr7 7-dehydrocholesterol reductase -1.05 -2.076 4.90E-03 Dhrs7 Dehydrogenase/reductase SDR family member 7 -1.05 -2.076 5.00E-05 Slc25a42 Mitochondrial coenzyme A transporter SLC25A42 -1.05 -2.074 3.72E-02 Mecr Trans-2-enoyl-CoA reductase, mitochondrial -1.05 -2.073 1.76E-02 Zranb3 DNA annealing helicase and endonuclease ZRANB3 -1.05 -2.072 2.59E-02 Fbxo31 F-box only protein 31 -1.05 -2.068 4.20E-03 Gtse1 G2 and S phase-expressed protein 1 -1.05 -2.068 4.07E-02 Cs Citrate synthase, mitochondrial -1.05 -2.067 4.00E-04 Mtg1 Mitochondrial ribosome-associated GTPase 1 -1.05 -2.064 3.95E-02 Cpeb3 Cytoplasmic polyadenylation element-binding protein 3 -1.05 -2.064 3.17E-02 Phkb Phosphorylase b kinase regulatory subunit beta -1.04 -2.062 4.50E-04 Palmd Palmdelphin -1.04 -2.059 7.00E-03 Dhrs4 Dehydrogenase/reductase SDR family member 4 -1.04 -2.059 4.50E-03 Arap2 Arf-GAP with Rho-GAP domain, ANK repeat and PH domain-containing protein 2 -1.04 -2.055 1.28E-02 Etfa Electron transfer flavoprotein subunit alpha, mitochondrial -1.04 -2.054 2.00E-04 Slc27a4 Long-chain fatty acid transport protein 4 -1.04 -2.052 6.50E-04 Ankrd23 Ankyrin repeat domain-containing protein 23 -1.04 -2.051 4.10E-03 Pdha1 Pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial -1.03 -2.046 1.05E-03 Polr2h DNA-directed RNA polymerases I, II, and III subunit RPABC3 -1.03 -2.040 4.31E-02 Ifrd2 Interferon-related developmental regulator 2 -1.03 -2.035 2.78E-02 Slc25a20 Mitochondrial carnitine/acylcarnitine carrier protein -1.02 -2.033 1.70E-03 Uqcrfs1 Cytochrome b-c1 complex subunit Rieske, mitochondrial -1.02 -2.028 2.50E-04 Mut Methylmalonyl-CoA mutase, mitochondrial -1.01 -2.020 1.10E-03 Dlat Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex, mitochondrial -1.01 -2.018 3.00E-04 Gene ID Gene Name Log2 Fold Change p_value Abhd5 1-acylglycerol-3-phosphate O-acyltransferase ABHD5 -1.01 -2.015 2.00E-04 Pank3 Pantothenate kinase 3 -1.01 -2.012 6.50E-04 Sod2 Superoxide dismutase [Mn], mitochondrial -1.01 -2.012 1.50E-04 Idh3a Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial -1.00 -2.007 2.50E-04 Tspan12 Tetraspanin-12 -1.00 -2.004 7.00E-04 Adh1 Alcohol dehydrogenase 1 -1.00 -1.998 2.34E-02 Fzd4 Frizzled-4 -1.00 -1.994 7.00E-04 F2rl1 Proteinase-activated receptor 2 -0.99 -1.992 3.49E-02 Mustn1 Musculoskeletal embryonic nuclear protein 1 -0.99 -1.990 7.85E-03 Trit1 tRNA dimethylallyltransferase, mitochondrial -0.99 -1.990 2.42E-02 Nabp1 SOSS complex subunit B2 -0.99 -1.985 1.60E-03 Camk2a Calcium/calmodulin-dependent protein kinase type II subunit alpha -0.99 -1.984 3.65E-02 Dhrs7b Dehydrogenase/reductase SDR family member 7B -0.99 -1.982 4.60E-03 Cox5b Cytochrome c oxidase subunit 5B, mitochondrial -0.99 -1.980 2.64E-02 Rbm47 RNA-binding protein 47 -0.98 -1.979 6.85E-03 C2cd2 Protein C2cd2 -0.98 -1.966 1.40E-03 Osbpl1a Oxysterol-binding protein-related protein 1 -0.97 -1.964 2.95E-03 Dld Dihydrolipoyl dehydrogenase, mitochondrial -0.97 -1.959 4.00E-04 Gm7120 Transmembrane protein C5orf28 homolog -0.97 -1.956 3.35E-02 Arhgap32 Rho GTPase-activating protein 32 -0.97 -1.954 2.15E-03 Prps1 Ribose-phosphate pyrophosphokinase 1 -0.96 -1.950 7.70E-03 Fabp5 Fatty acid-binding protein, epidermal -0.96 -1.947 2.85E-03 Ncapd2 Condensin complex subunit 1 -0.96 -1.939 1.04E-02 Plcb1 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase beta-1 -0.95 -1.930 7.85E-03 Sc5d Lathosterol oxidase -0.94 -1.924 1.77E-02 Hspa4l Heat shock 70 kDa protein 4L -0.94 -1.924 1.50E-02 Acp6 Lysophosphatidic acid phosphatase type 6 -0.94 -1.923 4.34E-02 Limch1 LIM and calponin homology domains-containing protein 1 -0.94 -1.917 1.41E-02 Mgll Monoglyceride lipase -0.94 -1.913 1.45E-03 Gpnmb Transmembrane glycoprotein NMB -0.93 -1.910 2.00E-04 Abcd3 ATP-binding cassette sub-family D member 3 -0.93 -1.903 2.00E-04 Lyrm5 LYR motif-containing protein 5 -0.93 -1.900 6.45E-03 Synm Synemin -0.93 -1.900 1.65E-03 Ndufs1 NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial -0.92 -1.892 9.50E-04 Phtf2 Putative homeodomain transcription factor 2 -0.92 -1.890 8.45E-03 Tmem120a Transmembrane protein 120A -0.91 -1.883 4.40E-03 Mfng Beta-1,3-N-acetylglucosaminyltransferase manic fringe -0.91 -1.881 4.70E-03 D10Jhu81e ES1 protein homolog, mitochondrial -0.91 -1.880 4.40E-03 Pla2g16 HRAS-like suppressor 3 -0.91 -1.873 1.15E-03 Fars2 Phenylalanine--tRNA ligase, mitochondrial -0.91 -1.873 3.09E-02 Ppp2r1b Serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A beta isoform -0.90 -1.872 8.30E-03 Dbt Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial -0.90 -1.870 9.60E-03 Mycbp C-Myc-binding protein -0.90 -1.866 2.84E-02 Lama5 Laminin subunit alpha-5 -0.90 -1.866 3.50E-03 Entpd5 Ectonucleoside triphosphate diphosphohydrolase 5 -0.90 -1.866 1.50E-03 Cdkn2c Cyclin-dependent kinase 4 inhibitor C -0.89 -1.859 3.41E-02 Tacc2 Transforming acidic coiled-coil-containing protein 2 -0.89 -1.858 1.00E-03 Ezr Ezrin -0.89 -1.854 3.50E-03 Zfp449 Protein Zfp449 -0.89 -1.854 4.08E-02 Mrs2 Magnesium transporter MRS2 homolog, mitochondrial -0.88 -1.847 4.22E-02 Uqcrc2 Cytochrome b-c1 complex subunit 2, mitochondrial -0.88 -1.843 1.00E-03 Crls1 Cardiolipin synthase -0.88 -1.843 4.30E-03 Aifm1 Apoptosis-inducing factor 1, mitochondrial -0.88 -1.839 5.30E-03 Sdha Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial -0.88 -1.838 4.70E-03 Lactb2 Beta-lactamase-like protein 2 -0.88 -1.838 1.20E-02 Pde4dip Myomegalin -0.88 -1.837 7.50E-04 Pcyt2 Ethanolamine-phosphate cytidylyltransferase -0.88 -1.836 2.65E-02 Saa3 Serum amyloid A-3 protein -0.88 -1.835 2.70E-03 Elovl5 Elongation of very long chain fatty acids protein 5 -0.87 -1.830 7.00E-04 Acbd4 Protein Acbd4 -0.87 -1.825 2.09E-02 Adssl1 Adenylosuccinate synthetase isozyme 1 -0.87 -1.824 4.70E-03 Gpld1 Phosphatidylinositol-glycan-specific phospholipase D -0.86 -1.819 2.08E-02 Taldo1 Transaldolase -0.86 -1.819 1.65E-03 Trap1 Heat shock protein 75 kDa, mitochondrial -0.86 -1.816 2.10E-03 Mdh1 Malate dehydrogenase, cytoplasmic -0.86 -1.811 1.60E-03 Hibadh 3-hydroxyisobutyrate dehydrogenase, mitochondrial -0.86 -1.810 1.95E-03 Cyb5b Cytochrome b5 type B -0.86 -1.810 7.50E-04 Cd14 Monocyte differentiation antigen CD14 -0.86 -1.809 1.15E-03 Cd109 CD109 antigen -0.86 -1.809 1.10E-03 Acat1 Acetyl-CoA acetyltransferase, mitochondrial -0.85 -1.806 1.40E-03 Pex3 Peroxisomal biogenesis factor 3 -0.85 -1.804 2.51E-02 Pnp2 Purine nucleoside phosphorylase -0.85 -1.803 2.32E-02 Prdx3 Thioredoxin-dependent peroxide reductase, mitochondrial -0.85 -1.803 9.00E-04 Fat4 Protocadherin Fat 4 -0.85 -1.799 1.10E-02 Cyc1 Cytochrome c1, heme protein, mitochondrial -0.85 -1.797 3.25E-03 Sephs2 Selenide, water dikinase 2 -0.85 -1.797 3.85E-03 Dnajc15 DnaJ homolog subfamily C member 15 -0.85 -1.796 1.67E-02 Ptprf Receptor-type tyrosine-protein phosphatase F -0.84 -1.795 4.25E-03 Chchd3 Coiled-coil-helix-coiled-coil-helix domain-containing protein 3, mitochondrial -0.84 -1.790 2.20E-03 Bcl2l13 Bcl-2-like protein 13 -0.84 -1.787 3.40E-03 Cnnm2 Metal transporter CNNM2 -0.83 -1.784 3.64E-02 Ddr1 Epithelial discoidin domain-containing receptor 1 -0.83 -1.780 2.14E-02 Ndufb9 NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 9 -0.83 -1.780 1.85E-03 Mknk2 MAP kinase-interacting serine/threonine-protein kinase 2 -0.83 -1.776 1.60E-03 Hsd17b12 Estradiol 17-beta-dehydrogenase 12 -0.83 -1.776 2.50E-03 Isyna1 Inositol-3-phosphate synthase 1 -0.83 -1.772 6.15E-03 Pex13 Peroxisomal membrane protein PEX13 -0.82 -1.767 1.60E-02 Clpx ATP-dependent Clp protease ATP-binding subunit clpX-like, mitochondrial -0.82 -1.766 6.00E-03 Gene ID Gene Name Log2 Fold Change p_value Hdac6 Histone deacetylase 6 -0.82 -1.766 2.70E-02 Aox1 Aldehyde oxidase 1 -0.82 -1.765 3.87E-02 Mall MAL-like protein -0.82 -1.763 4.79E-02 Ndufb5 NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 5, mitochondrial -0.82 -1.763 2.00E-03 Hmgcr 3-hydroxy-3-methylglutaryl-coenzyme A reductase -0.81 -1.758 3.20E-03 Lyz1 Lysozyme C-1 -0.81 -1.758 1.26E-02 Sfxn1 Sideroflexin-1 -0.81 -1.756 3.25E-03 Nop16 Nucleolar protein 16 -0.81 -1.756 2.41E-02 Npr1 Atrial natriuretic peptide receptor 1 -0.81 -1.754 1.31E-02 Mfn2 Mitofusin-2 -0.81 -1.753 2.65E-03 Tcf7l1 Transcription factor 7-like 1 -0.81 -1.752 3.91E-02 Vdr Vitamin D3 receptor -0.81 -1.752 1.27E-02 Tecr Very-long-chain enoyl-CoA reductase -0.81 -1.751 4.15E-03 Slc39a8 Zinc transporter ZIP8 -0.80 -1.740 1.42E-02 Cgnl1 Cingulin-like protein 1 -0.80 -1.740 4.10E-03 Nat6 N-acetyltransferase 6 -0.80 -1.737 3.24E-02 Ndufv1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial -0.80 -1.736 3.40E-03 Atpaf2 ATP synthase mitochondrial F1 complex assembly factor 2 -0.79 -1.733 3.62E-02 Coasy Bifunctional coenzyme A synthase -0.79 -1.725 2.13E-02 Plk4 Serine/threonine-protein kinase PLK4 -0.78 -1.723 4.80E-02 Gnpat Dihydroxyacetone phosphate acyltransferase -0.78 -1.719 3.90E-03 Rab3d Ras-related protein Rab-3D -0.78 -1.718 4.35E-03 Por NADPH--cytochrome P450 reductase -0.78 -1.716 4.95E-03 Pxmp4 Peroxisomal membrane protein 4 -0.78 -1.715 3.82E-02 Hmgcs1 Hydroxymethylglutaryl-CoA synthase, cytoplasmic -0.78 -1.713 4.30E-03 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 -0.78 -1.713 2.23E-02 Hagh Hydroxyacylglutathione hydrolase, mitochondrial -0.78 -1.712 3.22E-02 Uhrf1 E3 ubiquitin-protein ligase UHRF1 -0.77 -1.711 4.42E-02 Ndufs2 NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial -0.77 -1.709 3.60E-03 Sucla2 Succinyl-CoA ligase [ADP-forming] subunit beta, mitochondrial -0.77 -1.705 4.75E-03 Adcyap1r1 Pituitary adenylate cyclase-activating polypeptide type I receptor -0.77 -1.705 1.71E-02 Atp5h ATP synthase subunit d, mitochondrial -0.77 -1.704 1.58E-02 Hspb7 Heat shock protein beta-7 -0.77 -1.704 4.13E-02 Isoc2a Isochorismatase domain-containing protein 2A, mitochondrial -0.77 -1.701 4.72E-02 Asns Asparagine synthetase [glutamine-hydrolyzing] -0.77 -1.700 1.64E-02 Ogdh 2-oxoglutarate dehydrogenase, mitochondrial -0.76 -1.697 6.95E-03 Ak2 Adenylate kinase 2, mitochondrial -0.76 -1.695 4.35E-03 Sdr39u1 Epimerase family protein SDR39U1 -0.76 -1.694 4.22E-02 Psmb3 Proteasome subunit beta type-3 -0.76 -1.688 3.64E-02 Mrpl37 39S ribosomal protein L37, mitochondrial -0.75 -1.687 2.32E-02 Apoc2 Apolipoprotein C-II -0.75 -1.683 4.25E-02 Ndufa4 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4 -0.75 -1.683 2.90E-03 Aldh2 Aldehyde dehydrogenase, mitochondrial -0.75 -1.679 9.55E-03 Grpel1 GrpE protein homolog 1, mitochondrial -0.75 -1.678 2.21E-02 Nudt5 ADP-sugar pyrophosphatase -0.75 -1.677 4.60E-02 Bcar3 Breast cancer anti-estrogen resistance protein 3 -0.75 -1.676 4.23E-02 Katna1 Katanin p60 ATPase-containing subunit A1 -0.74 -1.675 3.19E-02 Alad Delta-aminolevulinic acid dehydratase -0.74 -1.674 8.10E-03 Atp5b ATP synthase subunit beta, mitochondrial -0.74 -1.670 2.84E-02 Immt Mitochondrial inner membrane protein -0.74 -1.667 3.90E-03 Pth1r Parathyroid hormone/parathyroid hormone-related peptide receptor -0.74 -1.667 4.52E-02 Memo1 Protein MEMO1 -0.74 -1.666 1.06E-02 Agl Protein Agl -0.73 -1.662 7.25E-03 Phlda3 Pleckstrin homology-like domain family A member 3 -0.73 -1.658 4.15E-03 Ipo13 Importin-13 -0.73 -1.656 2.47E-02 Uqcrc1 Cytochrome b-c1 complex subunit 1, mitochondrial -0.73 -1.655 6.85E-03 Abca2 ATP-binding cassette sub-family A member 2 -0.73 -1.653 2.33E-02 Ech1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial -0.72 -1.652 9.15E-03 Jup Junction plakoglobin -0.72 -1.651 5.55E-03 Pnpt1 Polyribonucleotide nucleotidyltransferase 1, mitochondrial -0.72 -1.649 2.24E-02 Ahcyl2 Putative adenosylhomocysteinase 3 -0.72 -1.645 7.65E-03 Idh3b Isocitrate dehydrogenase 3 (NAD+) beta -0.72 -1.644 1.69E-02 Tapt1 Transmembrane anterior posterior transformation protein 1 -0.71 -1.638 9.50E-03 Aldh9a1 4-trimethylaminobutyraldehyde dehydrogenase -0.71 -1.633 1.26E-02 Fam136a Protein FAM136A -0.71 -1.631 4.67E-02 Pnpla8 Calcium-independent phospholipase A2-gamma -0.70 -1.629 6.65E-03 Kalrn Kalirin -0.69 -1.616 4.59E-02 Ngly1 Peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase -0.69 -1.615 3.03E-02 Cox6c Cytochrome c oxidase subunit 6C -0.69 -1.615 7.75E-03 Clip4 CAP-Gly domain-containing linker protein 4 -0.69 -1.613 4.43E-02 Letm1 LETM1 and EF-hand domain-containing protein 1, mitochondrial -0.69 -1.613 1.78E-02 Cebpa CCAAT/enhancer-binding protein alpha -0.69 -1.610 1.04E-02 Cox6a1 Cytochrome c oxidase subunit 6A1, mitochondrial -0.69 -1.610 8.00E-03 Tpm2 Tropomyosin beta chain -0.69 -1.609 1.30E-02 Aasdhppt L-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase -0.69 -1.608 3.33E-02 Aco1 Cytoplasmic aconitate hydratase -0.68 -1.605 1.12E-02 Pim3 Serine/threonine-protein kinase pim-3 -0.68 -1.604 2.33E-02 Csnk2a2 Casein kinase II subunit alpha' -0.68 -1.603 4.16E-02 Mrpl9 39S ribosomal protein L9, mitochondrial -0.68 -1.599 4.30E-02 Rhou Rho-related GTP-binding protein RhoU -0.67 -1.595 1.83E-02 Pycard Apoptosis-associated speck-like protein containing a CARD -0.67 -1.595 3.18E-02 Atp5a1 ATP synthase subunit alpha, mitochondrial -0.67 -1.592 2.39E-02 S100a4 Protein S100-A4 -0.67 -1.588 9.00E-03 Prkar2a cAMP-dependent protein kinase type II-alpha regulatory subunit -0.66 -1.583 9.60E-03 Pgm2 Phosphoglucomutase-2 -0.66 -1.583 1.74E-02 Ide Insulin-degrading enzyme -0.66 -1.583 1.01E-02 Plin2 Perilipin-2 -0.66 -1.582 1.61E-02 Itih5 Inter-alpha-trypsin inhibitor heavy chain H5 -0.66 -1.581 2.52E-02 Gene ID Gene Name Log2 Fold Change p_value Eif4ebp2 Eukaryotic translation initiation factor 4E-binding protein 2 -0.66 -1.578 2.17E-02 Nr2c1 Nuclear receptor subfamily 2 group C member 1 -0.66 -1.575 4.81E-02 Tmem134 Transmembrane protein 134 -0.65 -1.572 1.95E-02 Polr1a DNA-directed RNA polymerase I subunit RPA1 -0.65 -1.572 4.95E-02 Mmd Monocyte to macrophage differentiation factor -0.65 -1.571 3.00E-02 Ndufa9 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial -0.65 -1.570 1.63E-02 Nova1 RNA-binding protein Nova-1 -0.65 -1.570 4.03E-02 Mcm3 DNA replication licensing factor MCM3 -0.65 -1.568 3.11E-02 Phyh Phytanoyl-CoA dioxygenase, peroxisomal -0.65 -1.567 1.07E-02 Acad9 Acyl-CoA dehydrogenase family member 9, mitochondrial -0.64 -1.563 2.91E-02 Got2 Aspartate aminotransferase, mitochondrial -0.64 -1.562 3.28E-02 Serpinb1a Leukocyte elastase inhibitor A -0.64 -1.560 2.93E-02 Ndufb8 NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 8, mitochondrial -0.64 -1.558 1.36E-02 Chchd2 Coiled-coil-helix-coiled-coil-helix domain-containing protein 2, mitochondrial -0.63 -1.552 1.39E-02 Topbp1 DNA topoisomerase 2-binding protein 1 -0.63 -1.551 1.58E-02 Ablim1 Actin-binding LIM protein 1 -0.63 -1.550 1.22E-02 Mtx2 Metaxin-2 -0.63 -1.549 2.83E-02 Fads3 Fatty acid desaturase 3 -0.63 -1.548 1.63E-02 Wdr61 WD repeat-containing protein 61 -0.63 -1.548 3.23E-02 Timm44 Mitochondrial import inner membrane translocase subunit TIM44 -0.63 -1.545 3.14E-02 Tmem38b Trimeric intracellular cation channel type B -0.63 -1.543 4.82E-02 Plbd1 Phospholipase B-like 1 -0.62 -1.539 2.57E-02 Atp9a Probable phospholipid-transporting ATPase IIA -0.62 -1.538 2.48E-02 Cox7b Cytochrome c oxidase subunit 7B, mitochondrial -0.62 -1.537 1.56E-02 Hsd11b1 Corticosteroid 11-beta-dehydrogenase isozyme 1 -0.62 -1.537 2.26E-02 Uqcrb Cytochrome b-c1 complex subunit 7 -0.62 -1.536 3.82E-02 Pmpcb Mitochondrial-processing peptidase subunit beta -0.62 -1.534 3.21E-02 Notch1 Neurogenic locus notch homolog protein 1 -0.62 -1.534 1.57E-02 Lrpprc Leucine-rich PPR motif-containing protein, mitochondrial -0.62 -1.533 4.11E-02 Cav2 Caveolin-2 -0.62 -1.533 2.20E-02 Cdon Cell adhesion molecule-related/down-regulated by oncogenes -0.62 -1.533 2.62E-02 Ppp2r3a 3222402P14Rik protein -0.62 -1.532 2.92E-02 Pex19 Peroxisomal biogenesis factor 19 -0.61 -1.531 1.63E-02 Eed Polycomb protein EED -0.61 -1.530 3.96E-02 Nfib Nuclear factor 1 B-type -0.61 -1.528 1.63E-02 Cav1 Caveolin-1 -0.61 -1.527 3.99E-02 Eif4e3 Eukaryotic translation initiation factor 4E type 3 -0.61 -1.527 3.97E-02 Tmem135 Transmembrane protein 135 -0.61 -1.524 2.51E-02 Cyb5 Cytochrome b5 -0.61 -1.522 1.79E-02 Glrx5 Glutaredoxin-related protein 5, mitochondrial -0.61 -1.521 4.29E-02 Cmah Cytidine monophosphate-N-acetylneuraminic acid hydroxylase -0.60 -1.519 2.78E-02 Slc25a5 ADP/ATP translocase 2 -0.60 -1.517 1.58E-02 Cox5a Cytochrome c oxidase subunit 5A, mitochondrial -0.60 -1.517 1.80E-02 Eda2r Tumor necrosis factor receptor superfamily member 27 -0.60 -1.512 4.44E-02 Cox7a2 Cytochrome c oxidase subunit 7A2, mitochondrial -0.59 -1.508 2.07E-02 Angel2 Protein angel homolog 2 -0.59 -1.508 2.65E-02 Idh1 Isocitrate dehydrogenase [NADP] cytoplasmic -0.59 -1.507 1.81E-02 Slc12a2 Solute carrier family 12 member 2 -0.59 -1.506 2.71E-02 Ndufa2 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2 -0.59 -1.502 4.35E-02 Slc31a2 Probable low affinity copper uptake protein 2 -0.59 -1.500 4.60E-02 Ncoa1 Nuclear receptor coactivator 1 -0.59 -1.500 4.67E-02 Lonp2 Lon protease homolog 2, peroxisomal -0.58 -1.497 3.45E-02 Ginm1 Glycoprotein integral membrane protein 1 -0.58 -1.492 2.54E-02 Isoc1 Isochorismatase domain-containing protein 1 -0.57 -1.486 2.60E-02 Aoc3 Membrane primary amine oxidase -0.57 -1.486 3.64E-02 Flnc Filamin-C -0.57 -1.485 3.29E-02 Nfia Nuclear factor 1 A-type -0.57 -1.483 3.91E-02 Slc16a1 Monocarboxylate transporter 1 -0.57 -1.481 4.25E-02 Prkaca cAMP-dependent protein kinase catalytic subunit alpha -0.56 -1.477 2.78E-02 Per3 Period circadian protein homolog 3 -0.56 -1.475 3.93E-02 Ndufa10 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 10, mitochondrial -0.56 -1.473 3.06E-02 Agpat3 1-acyl-sn-glycerol-3-phosphate acyltransferase gamma -0.55 -1.465 3.89E-02 Chl1 Neural cell adhesion molecule L1-like protein -0.54 -1.457 4.82E-02 Fblim1 Filamin-binding LIM protein 1 -0.53 -1.446 3.14E-02 Kif1b Kinesin-like protein KIF1B -0.53 -1.443 3.70E-02 Kdm4a Lysine-specific demethylase 4A -0.52 -1.439 4.71E-02 Tenc1 Tensin-like C1 domain-containing phosphatase -0.52 -1.439 4.16E-02 Cox6b1 Cytochrome c oxidase subunit 6B1 -0.52 -1.432 3.57E-02 Sdhb Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial -0.51 -1.422 4.44E-02 Table S1. Complete list of RNAseq data for stromal specific genes differentially expressed in

HT29LMα1 and HT29 control tumors.

For all genes up, a filter of Log2>0.5 and a pValue<0.05 was used.

For all genes down, a filter of Log2<0.5 and a pValue<0.05 was used.

Table S2 up regulated cancer genes Gene ID Gene name Log2 Fold Change p_value DMBT1 Deleted in malignant brain tumors 1 protein 7.97 250.9 5.00E-05 DEFA5 Defensin-5 6.54 93.1 8.40E-03 GJA1 Gap junction alpha-1 protein 5.23 37.5 2.50E-04 NOS2 Nitric oxide synthase, inducible 5.22 37.3 5.55E-03 NPSR1 Neuropeptide S receptor 4.61 24.4 4.50E-03 HOXD13 Homeobox protein Hox-D13 4.55 23.5 5.00E-05 NPY6R Putative neuropeptide Y receptor type 6 4.42 21.4 2.00E-04 IFI16 Gamma-interferon-inducible protein 16 4.40 21.1 5.00E-05 PCSK1 Neuroendocrine convertase 1 4.38 20.8 7.10E-03 WIPF3 WAS/WASL-interacting protein family member 3 4.29 19.5 5.00E-05 TNFAIP2 Tumor necrosis factor alpha-induced protein 2 4.19 18.3 5.00E-05 KIAA0226L Uncharacterized protein KIAA0226-like 4.15 17.8 5.00E-05 ATP11C Probable phospholipid-transporting ATPase IG 4.07 16.8 5.00E-05 DEFA6 Defensin-6 3.96 15.5 5.00E-05 CFI Complement factor I 3.91 15.0 5.00E-05 GABRA3 Gamma-aminobutyric acid receptor subunit alpha-3 3.87 14.6 5.00E-05 N4BP2L1 NEDD4-binding protein 2-like 1 3.84 14.3 6.50E-04 APOBEC3C DNA dC-dU-editing enzyme APOBEC-3C 3.78 13.8 5.00E-05 ZNF503-AS2 Putative uncharacterized protein encoded by ZNF503-AS2 3.75 13.4 1.70E-03 TM4SF20 Transmembrane 4 L6 family member 20 3.72 13.1 5.00E-05 C10orf99 Putative uncharacterized protein C10orf99 3.66 12.7 5.00E-05 PIGR Polymeric immunoglobulin receptor 3.61 12.2 5.00E-05 STRA6 Stimulated by retinoic acid gene 6 protein homolog 3.54 11.6 5.00E-05 PRUNE2 Protein prune homolog 2 3.48 11.1 5.00E-05 MAGEA12 Melanoma-associated antigen 12 3.47 11.1 5.00E-05 CEACAM7 Carcinoembryonic antigen-related cell adhesion molecule 7 3.46 11.0 5.00E-05 MS4A12 Membrane-spanning 4-domains subfamily A member 12 3.40 10.5 5.00E-05 SLC16A10 Monocarboxylate transporter 10 3.38 10.4 6.75E-03 ADH4 Alcohol dehydrogenase 4 3.37 10.3 1.20E-03 UBD Ubiquitin D 3.36 10.3 5.00E-05 GATA2 Endothelial transcription factor GATA-2 3.30 9.8 5.00E-05 ABCB1 Multidrug resistance protein 1 3.27 9.6 5.00E-05 LYPD8 Ly6/PLAUR domain-containing protein 8 3.26 9.6 5.00E-05 RAMP2 Receptor activity-modifying protein 2 3.24 9.4 3.50E-03 PTPN7 Tyrosine-protein phosphatase non-receptor type 7 3.23 9.4 5.00E-05 MAGEA3 Melanoma-associated antigen 3 3.21 9.2 5.00E-05 CCDC33 Coiled-coil domain-containing protein 33 3.18 9.1 1.65E-03 LMO2 Rhombotin-2 3.18 9.1 5.00E-05 AMOT Angiomotin 3.16 8.9 5.00E-05 TSPAN32 Tetraspanin-32 3.13 8.8 5.80E-03 CADPS Calcium-dependent secretion activator 1 3.12 8.7 5.00E-05 SLC22A15 Solute carrier family 22 member 15 3.11 8.6 1.75E-03 PLCG2 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase gamma-2 3.10 8.6 1.85E-03 REN Renin 3.09 8.5 8.50E-04 MMRN2 Multimerin-2 3.09 8.5 5.00E-05 PRSS3P2 Putative trypsin-6 3.09 8.5 5.00E-05 CSAG1 Putative chondrosarcoma-associated gene 1 protein 3.07 8.4 5.00E-05 TRPM6 Transient receptor potential cation channel subfamily M member 6 3.05 8.3 5.00E-05 PLEKHS1 Pleckstrin homology domain-containing family S member 1 3.02 8.1 5.00E-05 MAGEA6 Melanoma-associated antigen 6 3.00 8.0 5.00E-05 SLC7A9 b(0,+)-type amino acid transporter 1 3.00 8.0 5.00E-05 IFITM1 Interferon-induced transmembrane protein 1 2.99 8.0 5.00E-05 GJB6 Gap junction beta-6 protein 2.96 7.8 5.00E-05 AGXT2 Alanine--glyoxylate aminotransferase 2, mitochondrial 2.95 7.7 5.00E-04 NNMT Nicotinamide N-methyltransferase 2.94 7.7 5.00E-05 CCDC85A Coiled-coil domain-containing protein 85A 2.94 7.7 9.00E-04 DNAJC6 Putative tyrosine-protein phosphatase auxilin 2.92 7.5 5.00E-05 PLA1A Phospholipase A1 member A 2.90 7.5 1.50E-03 HLA-DMB HLA class II histocompatibility antigen, DM beta chain 2.90 7.4 9.60E-03 WWC3 Protein WWC3 2.88 7.4 3.00E-04 PPFIA2 Liprin-alpha-2 2.85 7.2 1.00E-04 NKD1 Protein naked cuticle homolog 1 2.85 7.2 5.00E-05 GBP4 Guanylate-binding protein 4 2.83 7.1 5.00E-05 KCNJ15 ATP-sensitive inward rectifier potassium channel 15 2.83 7.1 8.90E-03 KIRREL Kin of IRRE-like protein 1 2.82 7.1 5.00E-05 TGM2 Protein-glutamine gamma-glutamyltransferase 2 2.80 7.0 5.00E-05 ZDHHC11B Probable palmitoyltransferase ZDHHC11B 2.78 6.9 7.60E-03 PIFO Protein pitchfork 2.78 6.9 5.35E-03 DYNC1I1 Cytoplasmic dynein 1 intermediate chain 1 2.78 6.8 1.00E-04 CASP1 Caspase-1 2.77 6.8 5.00E-05 TDRD12 Putative ATP-dependent RNA helicase TDRD12 2.77 6.8 9.70E-03 THBS4 Thrombospondin-4 2.77 6.8 2.90E-03 Gene ID Gene name Log2 Fold Change p_value ZNF503 Zinc finger protein 503 2.76 6.8 7.90E-03 GRIP1 Glutamate receptor-interacting protein 1 2.74 6.7 5.00E-05 ISX Intestine-specific homeobox 2.74 6.7 1.25E-03 SRPX2 Sushi repeat-containing protein SRPX2 2.73 6.7 7.00E-04 ANPEP Aminopeptidase N 2.73 6.6 5.00E-05 HLA-B HLA class I histocompatibility antigen, B-73 alpha chain 2.72 6.6 5.00E-05 TMEM252 Transmembrane protein 252 2.72 6.6 3.50E-04 SNCG Gamma-synuclein 2.69 6.5 5.00E-05 KLRC2 NKG2-C type II integral membrane protein 2.69 6.5 5.00E-05 CLCA4 Calcium-activated chloride channel regulator 4 2.68 6.4 7.55E-03 SLC28A1 Sodium/nucleoside cotransporter 1 2.68 6.4 5.15E-03 NR1H4 Bile acid receptor 2.67 6.4 5.00E-05 VWA5A von Willebrand factor A domain-containing protein 5A 2.66 6.3 5.00E-05 IFI44L Interferon-induced protein 44-like 2.65 6.3 5.00E-05 SLC16A14 Monocarboxylate transporter 14 2.64 6.2 3.50E-04 HCP5 HLA class I histocompatibility antigen protein P5 2.64 6.2 5.00E-05 RASSF5 Ras association domain-containing protein 5 2.62 6.2 2.00E-04 SCN3A Sodium channel protein type 3 subunit alpha 2.62 6.1 5.00E-05 CEP85L Centrosomal protein of 85 kDa-like 2.62 6.1 2.25E-03 PPP1R14C Protein phosphatase 1 regulatory subunit 14C 2.61 6.1 5.00E-05 SCG2 Secretogranin-2 2.61 6.1 5.00E-05 HMCN1 Hemicentin-1 2.58 6.0 9.40E-03 C20orf202 Uncharacterized protein C20orf202 2.56 5.9 2.50E-04 ANXA6 Annexin A6 2.55 5.9 7.20E-03 EPHB2 Ephrin type-B receptor 2 2.53 5.8 5.00E-05 FAM83F Protein FAM83F 2.53 5.8 5.00E-05 RTP4 Receptor-transporting protein 4 2.52 5.7 5.00E-05 NRXN2 Neurexin-2 2.51 5.7 2.00E-04 ANKRD30B Ankyrin repeat domain-containing protein 30B 2.51 5.7 1.00E-04 ACOX2 Peroxisomal acyl-coenzyme A oxidase 2 2.50 5.7 1.50E-04 DPYD Dihydropyrimidine dehydrogenase [NADP(+)] 2.49 5.6 1.80E-03 SLC7A8 Large neutral amino acids transporter small subunit 2 2.48 5.6 5.00E-05 PPP4R4 Serine/threonine-protein phosphatase 4 regulatory subunit 4 2.48 5.6 3.50E-04 EPSTI1 Epithelial-stromal interaction protein 1 2.48 5.6 5.00E-05 CDH5 Cadherin-5 2.47 5.5 7.40E-03 SPATA6 Spermatogenesis-associated protein 6 2.46 5.5 5.00E-05 ADRBK2 Beta-adrenergic receptor kinase 2 2.45 5.5 5.00E-05 BEND7 BEN domain-containing protein 7 2.45 5.5 5.00E-05 KIAA1456 Putative methyltransferase KIAA1456 2.43 5.4 5.00E-05 MAGEC2 Melanoma-associated antigen C2 2.43 5.4 2.20E-03 SERPINA3 Alpha-1-antichymotrypsin 2.40 5.3 1.35E-03 CHRD Chordin 2.40 5.3 2.90E-03 C1QTNF5 Complement C1q tumor necrosis factor-related protein 5 2.40 5.3 4.00E-04 P2RY1 P2Y purinoceptor 1 2.39 5.3 5.00E-05 RGCC Regulator of cell cycle RGCC 2.37 5.2 5.00E-05 SYNPO Synaptopodin 2.35 5.1 5.00E-05 ENPP5 Ectonucleotide pyrophosphatase/phosphodiesterase family member 5 2.35 5.1 5.00E-05 FAHD2B Fumarylacetoacetate hydrolase domain-containing protein 2B 2.33 5.0 1.20E-03 DMKN Dermokine 2.32 5.0 5.00E-05 FGF17 Fibroblast growth factor 17 2.31 5.0 4.65E-03 IL24 Interleukin-24 2.31 5.0 8.50E-04 ARL4D ADP-ribosylation factor-like protein 4D 2.28 4.8 5.00E-05 BATF2 Basic leucine zipper transcriptional factor ATF-like 2 2.27 4.8 5.00E-05 NTF4 Neurotrophin-4 2.27 4.8 2.00E-04 PSMB9 Proteasome subunit beta type-9 2.27 4.8 5.00E-05 FRY Protein furry homolog 2.26 4.8 5.00E-05 WFDC2 WAP four-disulfide core domain protein 2 2.24 4.7 5.00E-05 UCN3 Urocortin-3 2.24 4.7 3.00E-04 SERPINA6 Corticosteroid-binding globulin 2.22 4.7 5.00E-05 IL1R1 Interleukin-1 receptor type 1 2.22 4.7 5.00E-05 VAV1 Proto-oncogene vav 2.22 4.6 3.40E-03 PRSS1 Trypsin-1 2.21 4.6 5.00E-05 FGF9 Fibroblast growth factor 9 2.20 4.6 5.00E-05 PTHLH Parathyroid hormone-related protein 2.18 4.5 5.00E-05 GATA3 Trans-acting T-cell-specific transcription factor GATA-3 2.16 4.5 5.00E-05 SCG3 Secretogranin-3 2.16 4.5 5.00E-05 PLEKHF1 Pleckstrin homology domain-containing family F member 1 2.15 4.4 2.50E-04 CPVL Probable serine carboxypeptidase CPVL 2.14 4.4 2.95E-03 CX3CL1 Fractalkine 2.13 4.4 5.00E-05 PLA2G4D Cytosolic phospholipase A2 delta 2.13 4.4 6.05E-03 SLC26A3 Chloride anion exchanger 2.13 4.4 5.50E-04 GPR155 Integral membrane protein GPR155 2.13 4.4 9.00E-04 LOXL4 Lysyl oxidase homolog 4 2.13 4.4 5.00E-05 Gene ID Gene name Log2 Fold Change p_value GABRA2 Gamma-aminobutyric acid receptor subunit alpha-2 2.13 4.4 5.00E-05 SESN3 Sestrin-3 2.12 4.3 5.00E-05 ACACB Acetyl-CoA carboxylase 2 2.11 4.3 5.00E-05 MCOLN2 Mucolipin-2 2.09 4.2 5.00E-05 ADRA2A Alpha-2A adrenergic receptor 2.09 4.2 5.00E-05 BPIFB2 BPI fold-containing family B member 2 2.07 4.2 4.50E-03 GPX3 Glutathione peroxidase 3 2.07 4.2 5.00E-05 TPPP3 Tubulin polymerization-promoting protein family member 3 2.06 4.2 5.00E-05 FAM134B Protein FAM134B 2.05 4.1 5.00E-05 UBE2L6 Ubiquitin/ISG15-conjugating enzyme E2 L6 2.05 4.1 5.00E-05 XAF1 XIAP-associated factor 1 2.04 4.1 5.00E-05 ZNF467 Zinc finger protein 467 2.04 4.1 5.00E-05 RORC Nuclear receptor ROR-gamma 2.03 4.1 5.00E-05 KCNQ1 Potassium voltage-gated channel subfamily KQT member 1 2.03 4.1 5.00E-05 GMPR GMP reductase 1 2.02 4.1 4.10E-03 PCDHB13 Protocadherin beta-13 2.02 4.0 5.00E-05 C11orf21 Uncharacterized protein C11orf21 2.01 4.0 2.15E-03 DKFZP667F0711Putative uncharacterized protein DKFZp667F0711 (Fragment) 2.01 4.0 4.50E-04 SERPINA5 Plasma serine protease inhibitor 2.01 4.0 5.00E-05 TPPP Tubulin polymerization-promoting protein 2.01 4.0 5.00E-05 MS4A8 Membrane-spanning 4-domains subfamily A member 8 2.01 4.0 5.00E-05 MUC12 Mucin-12 2.00 4.0 5.00E-05 GIMAP2 GTPase IMAP family member 2 2.00 4.0 5.00E-05 RSAD2 Radical S-adenosyl methionine domain-containing protein 2 2.00 4.0 5.00E-05 OAS2 2'-5'-oligoadenylate synthase 2 1.98 3.9 1.00E-04 SST Somatostatin 1.97 3.9 5.00E-05 PANX2 Pannexin-2 1.97 3.9 1.50E-04 IFITM3 Interferon-induced transmembrane protein 3 1.97 3.9 5.00E-05 TGFBR3 Transforming growth factor beta receptor type 3 1.97 3.9 5.00E-05 MT3 Metallothionein-3 1.96 3.9 3.50E-04 ZBP1 Z-DNA-binding protein 1 1.96 3.9 5.00E-05 APOBR Apolipoprotein B receptor 1.94 3.8 5.00E-03 TRIB2 Tribbles homolog 2 1.93 3.8 5.00E-05 PTGS1 Prostaglandin G/H synthase 1 1.91 3.8 5.00E-05 CABP1 Calcium-binding protein 1 1.90 3.7 5.00E-05 SLC28A3 Solute carrier family 28 member 3 1.90 3.7 5.00E-05 MCAM Cell surface glycoprotein MUC18 1.89 3.7 5.00E-05 COL18A1 Collagen alpha-1(XVIII) chain 1.89 3.7 1.00E-04 SLC51B Organic solute transporter subunit beta 1.89 3.7 5.00E-05 PCDHB15 Protocadherin beta-15 1.88 3.7 5.50E-04 ITGB2 Integrin beta-2 1.87 3.7 1.40E-03 CSF1 Macrophage colony-stimulating factor 1 1.87 3.7 5.00E-05 CAPN3 Calpain-3 1.87 3.7 2.45E-03 COL1A1 Collagen alpha-1(I) chain 1.87 3.6 1.50E-04 CYP4F2 Leukotriene-B(4) omega-hydroxylase 1 1.86 3.6 5.00E-05 SEPT5 Septin-5 1.85 3.6 1.60E-03 CYFIP2 Cytoplasmic FMR1-interacting protein 2 1.85 3.6 5.00E-05 CMPK2 UMP-CMP kinase 2, mitochondrial 1.85 3.6 5.00E-05 PRDM1 PR domain zinc finger protein 1 1.84 3.6 3.00E-04 PRLR Prolactin receptor 1.84 3.6 5.00E-05 SLITRK6 SLIT and NTRK-like protein 6 1.83 3.6 5.00E-05 ALDH1L1 Cytosolic 10-formyltetrahydrofolate dehydrogenase 1.83 3.6 5.00E-04 SERPINB7 Serpin B7 1.83 3.5 6.75E-03 HLA-F HLA class I histocompatibility antigen, alpha chain F 1.82 3.5 5.00E-05 GPX8 Probable glutathione peroxidase 8 1.82 3.5 5.00E-05 CFB Complement factor B 1.81 3.5 5.00E-05 KRT23 Keratin, type I cytoskeletal 23 1.81 3.5 5.00E-05 TMEM63C Transmembrane protein 63C 1.80 3.5 2.95E-03 GABRP Gamma-aminobutyric acid receptor subunit pi 1.80 3.5 5.00E-05 CYBRD1 Cytochrome b reductase 1 1.80 3.5 5.00E-05 CDX2 Homeobox protein CDX-2 1.79 3.5 5.00E-05 IFI6 Interferon alpha-inducible protein 6 1.79 3.5 5.00E-05 FABP1 Fatty acid-binding protein, liver 1.79 3.5 5.00E-05 HPN Serine protease hepsin 1.79 3.4 5.00E-05 ALPI Intestinal-type alkaline phosphatase 1.78 3.4 5.00E-05 TMEM145 Transmembrane protein 145 1.78 3.4 5.00E-05 CNN3 Calponin-3 1.78 3.4 5.00E-05 TGFB2 Transforming growth factor beta-2 1.78 3.4 5.00E-05 PPP1R1B Protein phosphatase 1 regulatory subunit 1B 1.78 3.4 5.00E-05 PTP4A3 Protein tyrosine phosphatase type IVA 3 1.77 3.4 5.00E-05 FAM131C Protein FAM131C 1.76 3.4 5.00E-05 LEMD1 LEM domain-containing protein 1 1.76 3.4 5.00E-05 NES Nestin 1.76 3.4 8.50E-04 Gene ID Gene name Log2 Fold Change p_value TRPA1 Transient receptor potential cation channel subfamily A member 1 1.76 3.4 5.00E-05 KIF21B Kinesin-like protein KIF21B 1.76 3.4 5.00E-05 ADH6 Alcohol dehydrogenase 6 1.75 3.4 5.00E-05 GBP1 Interferon-induced guanylate-binding protein 1 1.74 3.3 5.00E-05 BRSK2 Serine/threonine-protein kinase BRSK2 1.74 3.3 5.00E-05 FXYD2 Sodium/potassium-transporting ATPase subunit gamma 1.74 3.3 5.50E-03 UGT1A10 UDP-glucuronosyltransferase 1-10 1.74 3.3 5.00E-05 ATP6V1B1 V-type proton ATPase subunit B, kidney isoform 1.73 3.3 3.85E-03 SHC2 SHC-transforming protein 2 1.73 3.3 5.00E-05 TMEM74B Transmembrane protein 74B 1.72 3.3 5.00E-05 TLE2 Transducin-like enhancer protein 2 1.71 3.3 5.00E-05 GRIN3A Glutamate receptor ionotropic, NMDA 3A 1.71 3.3 3.75E-03 LYPD6 Ly6/PLAUR domain-containing protein 6 1.71 3.3 5.00E-05 CYP39A1 24-hydroxycholesterol 7-alpha-hydroxylase 1.71 3.3 5.00E-05 SLC25A27 Mitochondrial uncoupling protein 4 1.71 3.3 5.00E-05 ESRRG Estrogen-related receptor gamma 1.70 3.2 3.00E-04 SAMD14 Sterile alpha motif domain-containing protein 14 1.70 3.2 7.95E-03 GLIPR2 Golgi-associated plant pathogenesis-related protein 1 1.70 3.2 7.15E-03 ZIC2 Zinc finger protein ZIC 2 1.69 3.2 3.50E-04 AQP1 Aquaporin-1 1.69 3.2 5.00E-05 APLP1 Amyloid-like protein 1 1.68 3.2 5.00E-05 SSC5D Soluble scavenger receptor cysteine-rich domain-containing protein SSC5D 1.68 3.2 5.00E-04 LGALS9C Galectin-9C 1.68 3.2 3.70E-03 KIF26B Kinesin-like protein KIF26B 1.68 3.2 5.00E-05 MROH7 Maestro heat-like repeat-containing protein family member 7 1.67 3.2 7.50E-04 IGF2 Insulin-like growth factor II 1.67 3.2 5.00E-05 OLFML3 Olfactomedin-like protein 3 1.67 3.2 3.00E-04 CECR6 Cat eye syndrome critical region protein 6 1.66 3.2 6.00E-04 KLRK1 NKG2-D type II integral membrane protein 1.65 3.1 7.15E-03 MAGEA1 Melanoma-associated antigen 1 1.65 3.1 5.00E-05 SLC19A3 Thiamine transporter 2 1.65 3.1 5.00E-05 CDHR2 Cadherin-related family member 2 1.65 3.1 5.00E-05 IFIT1 Interferon-induced protein with tetratricopeptide repeats 1 1.64 3.1 1.00E-04 SLC46A3 Solute carrier family 46 member 3 1.64 3.1 5.00E-05 FCAMR High affinity immunoglobulin alpha and immunoglobulin mu Fc receptor 1.63 3.1 5.00E-05 RGS4 Regulator of G-protein signaling 4 1.63 3.1 8.50E-04 NKD2 Protein naked cuticle homolog 2 1.63 3.1 5.00E-05 WISP1 WNT1-inducible-signaling pathway protein 1 1.63 3.1 7.40E-03 ADAMTS6 A disintegrin and metalloproteinase with thrombospondin motifs 6 1.63 3.1 5.00E-05 UBA7 Ubiquitin-like modifier-activating enzyme 7 1.62 3.1 5.00E-05 MEP1A Meprin A subunit alpha 1.62 3.1 5.00E-05 NEK5 Serine/threonine-protein kinase Nek5 1.62 3.1 5.00E-05 TNNC2 Troponin C, skeletal muscle 1.62 3.1 5.00E-05 CCDC108 Coiled-coil domain-containing protein 108 1.62 3.1 5.00E-05 C4A Complement C4-A 1.61 3.1 5.65E-03 DEFB1 Beta-defensin 1 1.60 3.0 1.50E-04 NHLRC1 E3 ubiquitin-protein ligase NHLRC1 1.60 3.0 2.00E-04 GPR128 Probable G-protein coupled receptor 128 1.60 3.0 1.50E-04 ENPP2 Ectonucleotide pyrophosphatase/phosphodiesterase family member 2 1.60 3.0 5.00E-05 TMOD2 Tropomodulin-2 1.59 3.0 5.00E-05 DYRK3 Dual specificity tyrosine-phosphorylation-regulated kinase 3 1.59 3.0 5.00E-05 ITGAM Integrin alpha-M 1.58 3.0 5.00E-05 ALDOB Fructose-bisphosphate aldolase B 1.58 3.0 5.00E-05 P4HA2 Prolyl 4-hydroxylase subunit alpha-2 1.58 3.0 5.00E-05 SEC16B Protein transport protein Sec16B 1.57 3.0 1.60E-03 ANK2 Ankyrin-2 1.57 3.0 2.00E-04 GJB2 Gap junction beta-2 protein 1.56 3.0 5.00E-05 CTSO Cathepsin O 1.56 3.0 5.00E-05 PLEKHG4B Pleckstrin homology domain-containing family G member 4B 1.56 2.9 3.85E-03 CYP3A4 Cytochrome P450 3A4 1.55 2.9 5.00E-05 EVX1 Homeobox even-skipped homolog protein 1 1.55 2.9 1.50E-04 SHANK3 SH3 and multiple ankyrin repeat domains protein 3 1.55 2.9 3.50E-04 SOSTDC1 Sclerostin domain-containing protein 1 1.55 2.9 5.00E-05 PPAP2A Lipid phosphate phosphohydrolase 1 1.54 2.9 7.50E-04 KIAA0319 Dyslexia-associated protein KIAA0319 1.54 2.9 3.20E-03 TBX10 T-box transcription factor TBX10 1.54 2.9 5.00E-05 UPK3A Uroplakin-3a 1.53 2.9 1.00E-03 SEMA6A Semaphorin-6A 1.53 2.9 5.00E-05 ARHGAP30 Rho GTPase-activating protein 30 1.53 2.9 5.00E-05 TMEM8B Transmembrane protein 8B 1.53 2.9 5.00E-05 RNF208 RING finger protein 208 1.53 2.9 5.00E-05 PLEKHG1 Pleckstrin homology domain-containing family G member 1 1.52 2.9 5.00E-05 TTLL7 Tubulin polyglutamylase TTLL7 1.52 2.9 5.00E-05 Gene ID Gene name Log2 Fold Change p_value PADI1 Protein-arginine deiminase type-1 1.52 2.9 3.50E-04 SH3RF3 SH3 domain-containing RING finger protein 3 1.52 2.9 5.00E-05 ADAMTS15 A disintegrin and metalloproteinase with thrombospondin motifs 15 1.51 2.9 5.00E-05 HSPA6 Heat shock 70 kDa protein 6 1.51 2.9 5.00E-05 TM6SF2 Transmembrane 6 superfamily member 2 1.51 2.9 1.50E-03 CCL20 C-C motif chemokine 20 1.51 2.8 5.00E-05 SETBP1 SET-binding protein 1.50 2.8 5.00E-05 IFITM2 Interferon-induced transmembrane protein 2 1.50 2.8 5.00E-05 BAIAP3 BAI1-associated protein 3 1.50 2.8 2.45E-03 GATM Glycine amidinotransferase, mitochondrial 1.50 2.8 5.00E-05 RASL11A Ras-like protein family member 11A 1.50 2.8 5.00E-05 CDRT4 CMT1A duplicated region transcript 4 protein 1.50 2.8 3.15E-03 CD14 Monocyte differentiation antigen CD14 1.50 2.8 5.00E-05 MAPT Microtubule-associated protein tau 1.50 2.8 5.00E-05 SOD3 Extracellular superoxide dismutase [Cu-Zn] 1.50 2.8 5.00E-05 WNT11 Protein Wnt-11 1.50 2.8 5.00E-05 MAMSTR MEF2-activating motif and SAP domain-containing transcriptional regulator 1.50 2.8 4.50E-04 ESPN Espin 1.49 2.8 1.95E-03 TAP1 Antigen peptide transporter 1 1.49 2.8 5.00E-05 ELF5 ETS-related transcription factor Elf-5 1.49 2.8 5.00E-05 GUCY1B2 Guanylate cyclase soluble subunit beta-2 1.48 2.8 5.00E-05 MMP1 Interstitial collagenase 1.47 2.8 5.00E-05 CASP5 Caspase-5 1.47 2.8 2.50E-04 SLC4A4 Electrogenic sodium bicarbonate cotransporter 1 1.46 2.8 5.00E-05 ADC Arginine decarboxylase 1.46 2.8 9.50E-04 NOXO1 NADPH oxidase organizer 1 1.46 2.8 1.45E-03 IFI44 Interferon-induced protein 44 1.46 2.8 5.00E-05 USH2A Usherin 1.46 2.7 5.60E-03 MAP2 Microtubule-associated protein 2 1.46 2.7 5.00E-05 SECTM1 Secreted and transmembrane protein 1 1.46 2.7 5.00E-05 CATSPER1 Cation channel sperm-associated protein 1 1.45 2.7 1.75E-03 NOV Protein NOV homolog 1.45 2.7 5.00E-05 KSR2 Kinase suppressor of Ras 2 1.45 2.7 5.00E-05 LRRC16B Leucine-rich repeat-containing protein 16B 1.45 2.7 5.00E-05 SLFN5 Schlafen family member 5 1.45 2.7 5.00E-05 NDNF Protein NDNF 1.45 2.7 5.00E-05 ALDH8A1 Aldehyde dehydrogenase family 8 member A1 1.44 2.7 5.00E-04 NEURL3 E3 ubiquitin-protein ligase NEURL3 1.44 2.7 2.65E-03 PRKCG Protein kinase C gamma type 1.44 2.7 2.35E-03 SORBS1 Sorbin and SH3 domain-containing protein 1 1.43 2.7 5.00E-05 PGF Placenta growth factor 1.42 2.7 8.00E-04 UTRN Utrophin 1.41 2.7 5.00E-05 MX2 Interferon-induced GTP-binding protein Mx2 1.41 2.7 5.00E-05 FUT3 Galactoside 3(4)-L-fucosyltransferase 1.41 2.7 5.00E-05 SCN9A Sodium channel protein type 9 subunit alpha 1.41 2.7 5.00E-05 HLA-C HLA class I histocompatibility antigen, Cw-17 alpha chain 1.40 2.6 5.00E-05 VGLL1 Transcription cofactor vestigial-like protein 1 1.40 2.6 5.00E-05 KLHDC7A Kelch domain-containing protein 7A 1.40 2.6 5.00E-05 CDH4 Cadherin-4 1.40 2.6 1.00E-04 MCOLN3 Mucolipin-3 1.39 2.6 5.00E-05 AMY2B Alpha-amylase 2B 1.39 2.6 4.50E-04 FZD7 Frizzled-7 1.39 2.6 5.00E-05 MYO3B Myosin-IIIb 1.38 2.6 8.40E-03 RAMP1 Receptor activity-modifying protein 1 1.38 2.6 5.00E-05 CMTM3 CKLF-like MARVEL transmembrane domain-containing protein 3 1.38 2.6 5.00E-05 RUNDC3A RUN domain-containing protein 3A 1.37 2.6 5.00E-05 TRPM5 Transient receptor potential cation channel subfamily M member 5 1.37 2.6 8.50E-04 XDH Xanthine dehydrogenase/oxidase 1.37 2.6 5.00E-05 MAP1A Microtubule-associated protein 1A 1.37 2.6 5.00E-05 KRT40 Keratin, type I cytoskeletal 40 1.37 2.6 5.00E-05 SBSPON Somatomedin-B and thrombospondin type-1 domain-containing protein 1.37 2.6 5.00E-05 FRMD6 FERM domain-containing protein 6 1.37 2.6 1.35E-03 PTK7 Inactive tyrosine-protein kinase 7 1.36 2.6 5.00E-05 IGSF10 Immunoglobulin superfamily member 10 1.36 2.6 5.00E-05 TCF21 Transcription factor 21 1.36 2.6 5.00E-05 PLK1S1 Centrosomal protein kizuna 1.36 2.6 5.00E-05 GPC4 Glypican-4 1.36 2.6 5.00E-05 MAPK11 Mitogen-activated protein kinase 11 1.36 2.6 1.50E-04 GNG4 Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4 1.35 2.6 5.00E-05 TMEM136 Transmembrane protein 136 1.35 2.6 5.00E-05 ELMO1 Engulfment and cell motility protein 1 1.35 2.5 5.00E-05 CSRNP3 Cysteine/serine-rich nuclear protein 3 1.35 2.5 5.00E-05 IRS2 Insulin receptor substrate 2 1.35 2.5 5.00E-05 Gene ID Gene name Log2 Fold Change p_value ZNF585B Zinc finger protein 585B 1.34 2.5 9.70E-03 TMEM176A Transmembrane protein 176A 1.34 2.5 5.00E-05 MOGAT2 2-acylglycerol O-acyltransferase 2 1.34 2.5 5.00E-05 SERPINA4 Kallistatin 1.34 2.5 5.00E-05 SLC3A1 Neutral and basic amino acid transport protein rBAT 1.33 2.5 2.50E-04 UBL3 Ubiquitin-like protein 3 1.33 2.5 5.00E-05 POU2F3 POU domain, class 2, transcription factor 3 1.33 2.5 9.50E-04 NOTUM Protein notum homolog 1.33 2.5 5.00E-05 B4GALNT2 Beta-1,4 N-acetylgalactosaminyltransferase 2 1.33 2.5 8.70E-03 CHN1 N-chimaerin 1.32 2.5 1.80E-03 RBMS1 RNA-binding motif, single-stranded-interacting protein 1 1.32 2.5 5.00E-05 GSTM4 Glutathione S-transferase Mu 4 1.32 2.5 5.00E-05 LRRIQ1 Leucine-rich repeat and IQ domain-containing protein 1 1.32 2.5 2.45E-03 PRSS27 Serine protease 27 1.32 2.5 7.50E-03 GPNMB Transmembrane glycoprotein NMB 1.32 2.5 6.50E-04 B3GALTL Beta-1,3-glucosyltransferase 1.32 2.5 5.00E-05 SESN1 Sestrin-1 1.32 2.5 5.00E-05 IFIT2 Interferon-induced protein with tetratricopeptide repeats 2 1.31 2.5 7.40E-03 LRRC6 Protein tilB homolog 1.31 2.5 5.00E-05 GCGR Glucagon receptor 1.31 2.5 5.00E-05 SKAP1 Src kinase-associated phosphoprotein 1 1.31 2.5 5.00E-05 TCN2 Transcobalamin-2 1.31 2.5 8.50E-04 MAST4 Microtubule-associated serine/threonine-protein kinase 4 1.30 2.5 5.00E-05 PARP8 Poly [ADP-ribose] polymerase 8 1.30 2.5 5.00E-05 ARHGAP22 Rho GTPase-activating protein 22 1.29 2.5 8.45E-03 ACE Angiotensin-converting enzyme 1.29 2.5 5.00E-05 ICAM2 Intercellular adhesion molecule 2 1.29 2.4 2.70E-03 LEPREL2 Prolyl 3-hydroxylase 3 1.29 2.4 5.00E-05 CRYL1 Lambda-crystallin homolog 1.29 2.4 5.00E-05 CHP2 Calcineurin B homologous protein 2 1.28 2.4 5.00E-05 CREB5 Cyclic AMP-responsive element-binding protein 5 1.28 2.4 5.00E-05 PTPN13 Tyrosine-protein phosphatase non-receptor type 13 1.28 2.4 5.00E-05 GDPD5 Glycerophosphodiester phosphodiesterase domain-containing protein 5 1.28 2.4 5.00E-05 GNAO1 Guanine nucleotide-binding protein G(o) subunit alpha 1.27 2.4 3.00E-04 GLDN Gliomedin 1.27 2.4 5.00E-05 HLA-H Putative HLA class I histocompatibility antigen, alpha chain H 1.27 2.4 5.00E-05 IFIT3 Interferon-induced protein with tetratricopeptide repeats 3 1.27 2.4 1.50E-04 GRAMD2 GRAM domain-containing protein 2 1.27 2.4 5.00E-05 FAM83C Protein FAM83C 1.27 2.4 1.50E-04 PXDC1 PX domain-containing protein 1 1.27 2.4 5.00E-05 SRPK3 SRSF protein kinase 3 1.26 2.4 4.40E-03 CHST6 Carbohydrate sulfotransferase 6 1.26 2.4 1.70E-03 ICAM1 Intercellular adhesion molecule 1 1.26 2.4 1.00E-04 TAC1 Protachykinin-1 1.26 2.4 2.70E-03 RAB8B Ras-related protein Rab-8B 1.25 2.4 5.00E-05 TNS1 Tensin-1 1.25 2.4 5.00E-05 BHLHE41 Class E basic helix-loop-helix protein 41 1.25 2.4 5.00E-05 PTGES Prostaglandin E synthase 1.25 2.4 2.50E-04 XPNPEP2 Xaa-Pro aminopeptidase 2 1.25 2.4 5.00E-05 SALL4 Sal-like protein 4 1.25 2.4 5.00E-05 COL5A2 Collagen alpha-2(V) chain 1.25 2.4 9.55E-03 ZBTB10 Zinc finger and BTB domain-containing protein 10 1.25 2.4 5.00E-05 MAP3K1 Mitogen-activated protein kinase kinase kinase 1 1.25 2.4 5.00E-05 SNPH Syntaphilin 1.25 2.4 2.20E-03 FBXO44 F-box only protein 44 1.25 2.4 4.00E-04 TMEM176B Transmembrane protein 176B 1.24 2.4 5.00E-05 DOCK4 Dedicator of cytokinesis protein 4 1.24 2.4 5.00E-05 SEPP1 Selenoprotein P 1.24 2.4 5.00E-05 FGFR2 Fibroblast growth factor receptor 2 1.23 2.4 5.00E-05 SLC25A42 Mitochondrial coenzyme A transporter SLC25A42 1.23 2.3 2.50E-04 SDPR Serum deprivation-response protein 1.23 2.3 5.05E-03 ATP10B Probable phospholipid-transporting ATPase VB 1.23 2.3 5.00E-05 TRIM31 E3 ubiquitin-protein ligase TRIM31 1.23 2.3 5.00E-05 SEMA4F Semaphorin-4F 1.23 2.3 5.00E-05 SCG5 Neuroendocrine protein 7B2 1.22 2.3 5.00E-05 SKOR1 SKI family transcriptional corepressor 1 1.22 2.3 3.05E-03 RASA4 Ras GTPase-activating protein 4 1.22 2.3 1.25E-03 MX1 Interferon-induced GTP-binding protein Mx1 1.22 2.3 5.00E-05 KCTD12 BTB/POZ domain-containing protein KCTD12 1.22 2.3 5.00E-05 VLDLR Very low-density lipoprotein receptor 1.22 2.3 5.00E-05 KCNH8 Potassium voltage-gated channel subfamily H member 8 1.22 2.3 5.00E-05 POTEKP Putative beta-actin-like protein 3 1.21 2.3 4.65E-03 FAIM3 Fas apoptotic inhibitory molecule 3 1.21 2.3 2.45E-03 Gene ID Gene name Log2 Fold Change p_value MAN1A1 Mannosyl-oligosaccharide 1,2-alpha-mannosidase IA 1.21 2.3 5.00E-05 GPR110 Probable G-protein coupled receptor 110 1.20 2.3 5.00E-05 CDHR5 Cadherin-related family member 5 1.20 2.3 5.00E-05 FAM229B Protein FAM229B 1.20 2.3 4.30E-03 ASCL2 Achaete-scute homolog 2 1.20 2.3 8.00E-04 HIVEP3 Transcription factor HIVEP3 1.20 2.3 5.00E-05 C1orf115 Uncharacterized protein C1orf115 1.20 2.3 5.00E-05 NCMAP Noncompact myelin-associated protein 1.19 2.3 5.00E-05 TGFBI Transforming growth factor-beta-induced protein ig-h3 1.19 2.3 5.00E-05 HERC5 E3 ISG15--protein ligase HERC5 1.19 2.3 4.70E-03 DSG4 Desmoglein-4 1.19 2.3 7.50E-04 SHISA4 Protein shisa-4 1.19 2.3 4.50E-04 NDUFA4L2 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4-like 2 1.19 2.3 4.95E-03 CDK8 Cyclin-dependent kinase 8 1.19 2.3 5.00E-05 APOL3 Apolipoprotein L3 1.18 2.3 5.00E-05 DAPK2 Death-associated protein kinase 2 1.18 2.3 5.00E-05 TLR3 Toll-like receptor 3 1.18 2.3 5.00E-05 COL16A1 Collagen alpha-1(XVI) chain 1.18 2.3 2.50E-04 TLE4 Transducin-like enhancer protein 4 1.17 2.3 5.00E-05 TMEM92 Transmembrane protein 92 1.17 2.3 5.00E-05 AREG Amphiregulin 1.17 2.3 7.25E-03 STARD8 StAR-related lipid transfer protein 8 1.17 2.2 8.50E-03 AKAP12 A-kinase anchor protein 12 1.17 2.2 5.00E-05 PROX1 Prospero homeobox protein 1 1.17 2.2 5.00E-05 ACADSB Short/branched chain specific acyl-CoA dehydrogenase, mitochondrial 1.16 2.2 5.00E-05 SAMHD1 Deoxynucleoside triphosphate triphosphohydrolase SAMHD1 1.16 2.2 5.00E-05 ZNF704 Zinc finger protein 704 1.16 2.2 5.00E-05 SLC11A2 Natural resistance-associated macrophage protein 2 1.16 2.2 5.00E-05 TMEM86A Lysoplasmalogenase-like protein TMEM86A 1.16 2.2 6.00E-04 CLGN Calmegin 1.16 2.2 5.00E-05 HLA-A HLA class I histocompatibility antigen, A-68 alpha chain 1.16 2.2 5.00E-05 ATP7B Copper-transporting ATPase 2 1.16 2.2 5.00E-05 ALG5 Dolichyl-phosphate beta-glucosyltransferase 1.16 2.2 5.00E-05 CD74 HLA class II histocompatibility antigen gamma chain 1.16 2.2 5.00E-05 TSC22D1 TSC22 domain family protein 1 1.16 2.2 5.00E-05 FREM2 FRAS1-related extracellular matrix protein 2 1.15 2.2 5.00E-05 BIRC7 Baculoviral IAP repeat-containing protein 7 1.15 2.2 5.00E-05 KCNH2 Potassium voltage-gated channel subfamily H member 2 1.15 2.2 5.00E-05 ITPR1 Inositol 1,4,5-trisphosphate receptor type 1 1.15 2.2 5.00E-05 SUPT20H Transcription factor SPT20 homolog 1.15 2.2 5.00E-05 TYMP Thymidine phosphorylase 1.15 2.2 9.20E-03 MUC16 Mucin-16 1.15 2.2 5.00E-05 TMEM173 Stimulator of interferon genes protein 1.15 2.2 5.00E-05 STARD13 StAR-related lipid transfer protein 13 1.15 2.2 5.00E-05 ANKRD44 Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit B 1.15 2.2 5.50E-04 PATL2 Protein PAT1 homolog 2 1.15 2.2 3.50E-04 COL9A2 Collagen alpha-2(IX) chain 1.14 2.2 4.65E-03 RGS16 Regulator of G-protein signaling 16 1.14 2.2 5.00E-05 B2M Beta-2-microglobulin 1.14 2.2 5.00E-05 ZDHHC1 Probable palmitoyltransferase ZDHHC1 1.14 2.2 5.00E-05 CLIP2 CAP-Gly domain-containing linker protein 2 1.14 2.2 5.00E-05 AKAP2 A-kinase anchor protein 2 1.14 2.2 5.00E-05 ZNF608 Zinc finger protein 608 1.14 2.2 5.00E-05 VWA7 von Willebrand factor A domain-containing protein 7 1.14 2.2 5.00E-05 FSCN1 Fascin 1.13 2.2 5.00E-05 SLC5A9 Sodium/glucose cotransporter 4 1.13 2.2 5.00E-05 CCDC113 Coiled-coil domain-containing protein 113 1.13 2.2 5.00E-05 EPHX4 Epoxide hydrolase 4 1.13 2.2 5.00E-05 TNFSF13B Tumor necrosis factor ligand superfamily member 13B 1.13 2.2 4.05E-03 PCDHB10 Protocadherin beta-10 1.13 2.2 2.45E-03 ICA1L Islet cell autoantigen 1-like protein 1.13 2.2 8.00E-04 FLYWCH2 FLYWCH family member 2 1.13 2.2 1.30E-03 TMEM37 Voltage-dependent calcium channel gamma-like subunit 1.12 2.2 5.00E-05 NCALD Neurocalcin-delta 1.12 2.2 1.00E-04 CCDC88A Girdin 1.12 2.2 5.50E-04 PPM1K Protein phosphatase 1K, mitochondrial 1.12 2.2 5.00E-05 TRIM54 Tripartite motif-containing protein 54 1.12 2.2 5.00E-05 BAAT Bile acid-CoA:amino acid N-acyltransferase 1.12 2.2 2.00E-04 CDKN1C Cyclin-dependent kinase inhibitor 1C 1.12 2.2 5.00E-05 KCNH6 Potassium voltage-gated channel subfamily H member 6 1.12 2.2 4.50E-04 TMPRSS13 Transmembrane protease serine 13 1.11 2.2 5.00E-05 ULBP2 NKG2D ligand 2 1.11 2.2 1.35E-03 METTL7A Methyltransferase-like protein 7A 1.11 2.2 5.00E-05 Gene ID Gene name Log2 Fold Change p_value TNFSF10 Tumor necrosis factor ligand superfamily member 10 1.11 2.2 5.00E-05 IL8 Interleukin-8 1.11 2.2 5.00E-05 KLF15 Krueppel-like factor 15 1.11 2.2 2.15E-03 WBP5 WW domain-binding protein 5 1.11 2.2 5.00E-05 TANC2 Protein TANC2 1.11 2.2 5.00E-05 SLC6A14 Sodium- and chloride-dependent neutral and basic amino acid transporter B(0+) 1.11 2.2 5.00E-05 TFR2 Transferrin receptor protein 2 1.11 2.2 4.00E-04 EDN2 Endothelin-2 1.11 2.2 5.00E-04 RNASE1 Ribonuclease pancreatic 1.11 2.2 5.00E-05 NR5A2 Nuclear receptor subfamily 5 group A member 2 1.11 2.2 5.00E-05 CHST3 Carbohydrate sulfotransferase 3 1.10 2.1 4.30E-03 IGFBP6 Insulin-like growth factor-binding protein 6 1.10 2.1 5.00E-05 PDK4 [Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 4, mitochondrial 1.10 2.1 5.00E-05 SPTLC3 Serine palmitoyltransferase 3 1.09 2.1 5.00E-05 NOS3 Nitric oxide synthase, endothelial 1.09 2.1 5.00E-04 LIMS2 LIM and senescent cell antigen-like-containing domain protein 2 1.09 2.1 5.00E-05 BCAM Basal cell adhesion molecule 1.09 2.1 5.00E-05 UGT2B17 UDP-glucuronosyltransferase 2B17 1.09 2.1 5.00E-05 OBSL1 Obscurin-like protein 1 1.09 2.1 4.00E-04 IL2RG Cytokine receptor common subunit gamma 1.09 2.1 5.00E-05 SPTBN4 Spectrin beta chain, non-erythrocytic 4 1.09 2.1 2.00E-03 ABCG2 ATP-binding cassette sub-family G member 2 1.08 2.1 5.00E-05 RGS7 Regulator of G-protein signaling 7 1.08 2.1 5.05E-03 MAGT1 Magnesium transporter protein 1 1.08 2.1 5.00E-05 GRID2IP Delphilin 1.08 2.1 8.10E-03 POLR1D DNA-directed RNA polymerases I and III subunit RPAC2 1.08 2.1 5.00E-05 HHEX Hematopoietically-expressed homeobox protein HHEX 1.08 2.1 5.75E-03 PCDHB14 Protocadherin beta-14 1.08 2.1 5.00E-05 PAX4 Paired box protein Pax-4 1.08 2.1 5.00E-05 JAK3 Tyrosine-protein kinase JAK3 1.08 2.1 4.00E-04 TBKBP1 TANK-binding kinase 1-binding protein 1 1.08 2.1 3.00E-04 SERPINA1 Alpha-1-antitrypsin 1.07 2.1 5.00E-05 TSPAN9 Tetraspanin-9 1.07 2.1 4.55E-03 CYR61 Protein CYR61 1.07 2.1 5.00E-05 ANKH Progressive ankylosis protein homolog 1.07 2.1 5.00E-05 IL33 Interleukin-33 1.07 2.1 1.00E-04 NAALADL2 Inactive N-acetylated-alpha-linked acidic dipeptidase-like protein 2 1.06 2.1 9.85E-03 RFXAP Regulatory factor X-associated protein 1.06 2.1 5.00E-05 CNTNAP1 Contactin-associated protein 1 1.06 2.1 4.65E-03 RPL21 60S ribosomal protein L21 1.06 2.1 5.00E-05 ABCB4 Multidrug resistance protein 3 1.06 2.1 9.45E-03 UGT2A3 UDP-glucuronosyltransferase 2A3 1.06 2.1 5.00E-05 KRT13 Keratin, type I cytoskeletal 13 1.06 2.1 5.00E-05 PDZK1IP1 PDZK1-interacting protein 1 1.06 2.1 5.00E-05 SPATA17 Spermatogenesis-associated protein 17 1.06 2.1 1.00E-03 ATP7A Copper-transporting ATPase 1 1.06 2.1 5.00E-05 SPRY3 Protein sprouty homolog 3 1.06 2.1 5.00E-05 PAN3 PAB-dependent poly(A)-specific ribonuclease subunit PAN3 1.06 2.1 5.00E-05 MAOB Amine oxidase [flavin-containing] B 1.06 2.1 5.00E-05 SV2A Synaptic vesicle glycoprotein 2A 1.05 2.1 2.15E-03 PDGFC Platelet-derived growth factor C 1.05 2.1 5.00E-05 SMAD9 Mothers against decapentaplegic homolog 9 1.05 2.1 5.00E-05 NLRC5 Protein NLRC5 1.05 2.1 5.00E-05 SP5 Transcription factor Sp5 1.05 2.1 5.00E-05 EIF4E3 Eukaryotic translation initiation factor 4E type 3 1.05 2.1 5.00E-05 PHEX Phosphate-regulating neutral endopeptidase 1.04 2.1 4.00E-04 LCN2 Neutrophil gelatinase-associated lipocalin 1.04 2.1 5.00E-05 CLIP4 CAP-Gly domain-containing linker protein 4 1.04 2.1 5.00E-05 PTAFR Platelet-activating factor receptor 1.04 2.1 6.50E-04 ENPEP Glutamyl aminopeptidase 1.04 2.1 5.00E-05 PBX1 Pre-B-cell leukemia transcription factor 1 1.04 2.1 5.00E-05 SLC26A2 Sulfate transporter 1.04 2.1 5.70E-03 CA12 Carbonic anhydrase 12 1.04 2.1 5.00E-05 NLRP3 NACHT, LRR and PYD domains-containing protein 3 1.04 2.1 1.50E-04 GTF3A Transcription factor IIIA 1.03 2.0 5.00E-05 VNN2 Vascular non-inflammatory molecule 2 1.03 2.0 5.00E-05 PSMB8 Proteasome subunit beta type-8 1.03 2.0 5.00E-05 SEZ6L2 Seizure 6-like protein 2 1.03 2.0 5.00E-05 DDX60 Probable ATP-dependent RNA helicase DDX60 1.03 2.0 5.00E-05 NOX1 NADPH oxidase 1 1.03 2.0 5.00E-05 CACNA1A Voltage-dependent P/Q-type calcium channel subunit alpha-1A 1.03 2.0 1.00E-04 SCD5 Stearoyl-CoA desaturase 5 1.03 2.0 7.55E-03 TBX3 T-box transcription factor TBX3 1.02 2.0 5.00E-05 Gene ID Gene name Log2 Fold Change p_value GPRIN3 G protein-regulated inducer of neurite outgrowth 3 1.02 2.0 5.00E-05 TNFAIP3 Tumor necrosis factor alpha-induced protein 3 1.02 2.0 5.00E-05 EXOSC8 Exosome complex component RRP43 1.02 2.0 1.00E-04 TNNT1 Troponin T, slow skeletal muscle 1.02 2.0 5.00E-05 LNX2 Ligand of Numb protein X 2 1.01 2.0 5.00E-05 USP12 Ubiquitin carboxyl-terminal hydrolase 12 1.01 2.0 5.00E-05 MYADM Myeloid-associated differentiation marker 1.01 2.0 5.00E-05 EDN1 Endothelin-1 1.01 2.0 5.00E-05 LRFN3 Leucine-rich repeat and fibronectin type-III domain-containing protein 3 1.01 2.0 5.00E-05 TMEM17 Transmembrane protein 17 1.00 2.0 8.55E-03 SRCIN1 SRC kinase signaling inhibitor 1 1.00 2.0 5.00E-05 Table S2 down regulated cancer genes Gene ID Gene Name Log2 Fold Change p_value AUTS2 Autism susceptibility gene 2 protein -4.86 -29.026 5.00E-05 GALC Galactocerebrosidase -4.74 -26.656 5.00E-05 VSIG1 V-set and immunoglobulin domain-containing protein 1 -4.49 -22.471 5.00E-05 SLCO1B3 Solute carrier organic anion transporter family member 1B3 -4.23 -18.808 5.00E-05 PCSK9 Proprotein convertase subtilisin/kexin type 9 -4.04 -16.480 5.00E-05 IRF8 Interferon regulatory factor 8 -3.88 -14.717 3.95E-03 CCDC149 Coiled-coil domain-containing protein 149 -3.50 -11.299 5.50E-03 MUC5AC Mucin-5AC (Fragments) -3.47 -11.110 5.00E-05 TRAT1 T-cell receptor-associated transmembrane adapter 1 -3.44 -10.834 5.00E-05 NEBL Nebulette -3.35 -10.186 5.00E-05 MVB12B Multivesicular body subunit 12B -3.25 -9.500 1.00E-04 CLDN18 Claudin-18 -3.07 -8.370 5.00E-05 OR51E2 Olfactory receptor 51E2 -3.03 -8.186 5.00E-05 LSP1 Lymphocyte-specific protein 1 -2.93 -7.601 5.00E-05 REG4 Regenerating islet-derived protein 4 -2.65 -6.272 5.00E-05 SLC16A9 Monocarboxylate transporter 9 -2.52 -5.750 5.00E-05 GLI2 Zinc finger protein GLI2 -2.46 -5.497 5.00E-05 PEG10 Retrotransposon-derived protein PEG10 -2.44 -5.419 1.65E-03 FMNL2 Formin-like protein 2 -2.39 -5.241 5.00E-05 FER1L6 Fer-1-like protein 6 -2.27 -4.839 5.00E-05 CAPN9 Calpain-9 -2.22 -4.662 5.00E-05 NR1I3 Nuclear receptor subfamily 1 group I member 3 -2.21 -4.622 5.00E-05 SPIRE1 Protein spire homolog 1 -2.19 -4.563 5.00E-05 SULT1E1 Estrogen sulfotransferase -2.16 -4.481 5.00E-05 B3GNT6 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 -2.05 -4.152 5.00E-05 INSC Protein inscuteable homolog -2.04 -4.118 5.00E-05 MMP28 Matrix metalloproteinase-28 -2.02 -4.050 4.15E-03 MSLNL Mesothelin-like protein -1.92 -3.784 3.00E-03 ST6GAL1 Beta-galactoside alpha-2,6-sialyltransferase 1 -1.90 -3.723 5.00E-05 ADCY7 Adenylate cyclase type 7 -1.90 -3.719 1.80E-03 NLRP1 NACHT, LRR and PYD domains-containing protein 1 -1.89 -3.704 4.00E-04 CPT1C Carnitine O-palmitoyltransferase 1, brain isoform -1.87 -3.666 1.70E-03 DHRS9 Dehydrogenase/reductase SDR family member 9 -1.84 -3.590 5.00E-05 NBPF7 Putative neuroblastoma breakpoint family member 7 -1.84 -3.587 5.00E-05 FOXL1 Forkhead box protein L1 -1.84 -3.577 6.00E-03 TENM3 Teneurin-3 -1.81 -3.511 5.00E-05 DES Desmin -1.76 -3.390 2.05E-03 CEACAM6 Carcinoembryonic antigen-related cell adhesion molecule 6 -1.69 -3.232 5.00E-05 HAVCR1 Hepatitis A virus cellular receptor 1 -1.65 -3.141 4.65E-03 SULT1B1 Sulfotransferase family cytosolic 1B member 1 -1.63 -3.090 5.00E-05 DNAH8 Dynein heavy chain 8, axonemal -1.62 -3.073 4.80E-03 LYN Tyrosine-protein kinase Lyn -1.61 -3.045 5.00E-05 FCGBP IgGFc-binding protein -1.53 -2.888 5.00E-05 EGR1 Early growth response protein 1 -1.53 -2.883 5.00E-05 SLC6A7 Sodium-dependent proline transporter -1.52 -2.872 5.00E-05 COTL1 Coactosin-like protein -1.52 -2.860 5.00E-05 MT1G Metallothionein-1G -1.50 -2.837 5.00E-05 TEX40 Testis-expressed sequence 40 protein -1.49 -2.814 4.50E-04 SIPA1L2 Signal-induced proliferation-associated 1-like protein 2 -1.48 -2.788 5.00E-05 KCTD15 BTB/POZ domain-containing protein KCTD15 -1.47 -2.770 5.00E-05 GALNT5 Polypeptide N-acetylgalactosaminyltransferase 5 -1.44 -2.704 5.00E-05 MDFI MyoD family inhibitor -1.43 -2.694 5.00E-05 PTPRM Receptor-type tyrosine-protein phosphatase mu -1.39 -2.622 6.15E-03 ARL9 ADP-ribosylation factor-like protein 9 -1.39 -2.622 4.00E-04 CA2 Carbonic anhydrase 2 -1.38 -2.606 5.00E-05 RASAL1 RasGAP-activating-like protein 1 -1.35 -2.548 5.00E-05 HR Protein hairless -1.34 -2.532 5.00E-05 PLAT Tissue-type plasminogen activator -1.34 -2.531 2.60E-03 SPINK5 Serine protease inhibitor Kazal-type 5 -1.33 -2.512 1.40E-03 CALB2 Calretinin -1.30 -2.468 5.00E-05 AKR1B10 Aldo-keto reductase family 1 member B10 -1.28 -2.421 5.00E-05 TFF1 Trefoil factor 1 -1.25 -2.382 5.00E-05 PLXDC2 Plexin domain-containing protein 2 -1.25 -2.380 5.00E-05 STOM Erythrocyte band 7 integral membrane protein -1.24 -2.365 2.50E-04 Gene ID Gene Name Log2 Fold Change p_value ATP13A4 Probable cation-transporting ATPase 13A4 -1.20 -2.304 2.00E-03 MT2A Metallothionein-2 -1.17 -2.252 5.00E-05 GJA3 Gap junction alpha-3 protein -1.17 -2.251 5.00E-05 PRKACB cAMP-dependent protein kinase catalytic subunit beta -1.16 -2.241 5.00E-05 JPH1 Junctophilin-1 -1.14 -2.197 5.00E-05 KCNN4 Intermediate conductance calcium-activated potassium channel protein 4 -1.13 -2.195 5.00E-05 GPR115 Probable G-protein coupled receptor 115 -1.13 -2.184 5.00E-05 SGSM1 Small G protein signaling modulator 1 -1.13 -2.183 2.75E-03 DKK1 Dickkopf-related protein 1 -1.12 -2.180 5.00E-05 KPNA7 Importin subunit alpha-8 -1.12 -2.178 7.50E-04 LRP4 Low-density lipoprotein receptor-related protein 4 -1.12 -2.176 1.15E-03 CIDEC Cell death activator CIDE-3 -1.12 -2.169 5.00E-05 NETO2 Neuropilin and tolloid-like protein 2 -1.12 -2.169 5.00E-05 FGFBP1 Fibroblast growth factor-binding protein 1 -1.12 -2.168 4.50E-03 ZG16 Zymogen granule membrane protein 16 -1.12 -2.168 5.00E-05 C17orf51 Uncharacterized protein C17orf51 -1.11 -2.163 7.65E-03 PPP4R1L Putative serine/threonine-protein phosphatase 4 regulatory subunit 1-like -1.10 -2.147 5.00E-05 PRODH Proline dehydrogenase 1, mitochondrial -1.10 -2.141 5.00E-05 VILL Villin-like protein -1.10 -2.140 5.00E-05 VGLL3 Transcription cofactor vestigial-like protein 3 -1.09 -2.136 1.50E-04 DHRS2 Dehydrogenase/reductase SDR family member 2, mitochondrial -1.08 -2.113 5.00E-05 CLSPN Claspin -1.08 -2.108 5.00E-05 UGT2B15 UDP-glucuronosyltransferase 2B15 -1.07 -2.096 5.00E-05 MSLN Mesothelin -1.07 -2.092 5.00E-05 SLMO1 Protein slowmo homolog 1 -1.06 -2.088 5.00E-05 TNNI2 Troponin I, fast skeletal muscle -1.06 -2.087 3.00E-04 IRX5 Iroquois-class homeodomain protein IRX-5 -1.05 -2.072 5.00E-05 TMEM52 Transmembrane protein 52 -1.05 -2.069 9.95E-03 FOSL1 Fos-related antigen 1 -1.04 -2.052 5.00E-05 SEMA6B Semaphorin-6B -1.04 -2.050 2.20E-03 CAMK2B Calcium/calmodulin-dependent protein kinase type II subunit beta -1.03 -2.037 4.50E-04 KIAA1549L UPF0606 protein KIAA1549L -1.03 -2.036 5.00E-05 SLC9A2 Sodium/hydrogen exchanger 2 -1.02 -2.027 5.00E-05 TLN2 Talin-2 -1.01 -2.019 5.00E-05 HABP2 Hyaluronan-binding protein 2 -1.01 -2.018 5.00E-05 ST6GALNAC1Alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 -1.01 -2.010 5.00E-05 ANO1 Anoctamin-1 -1.01 -2.010 5.00E-05 ALDH3A1 Aldehyde dehydrogenase, dimeric NADP-preferring -1.00 -2.005 5.00E-05 Table S2. Complete list of RNAseq data of cancer cell specific genes differentially expressed in HT29LMα1 and HT29 tumors.

For all genes up, a filter of Log2>1 and a pValue<0.01 was used.

For all genes down, a filter of Log2<-1 and a pValue<0.01 was used. Table S3 up regulated genes in cell culture Gene ID Gene Description Log2 Fold Change p_value GABRA3 gamma-aminobutyric acid (GABA) A receptor, alpha 3 2.76 6.8 8.54E-05 MAGEA3 melanoma antigen family A, 3 2.14 4.4 6.65E-05 CSAG1 chondrosarcoma associated gene 1 2.12 4.3 4.79E-04 GJB6 gap junction protein, beta 6, 30kDa 2.03 4.1 1.02E-04 APOBEC3C apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C 2.01 4.0 2.18E-04 MGP matrix Gla protein 1.84 3.6 2.11E-04 CST1 cystatin SN 1.81 3.5 1.87E-04 MAGI2 membrane associated guanylate kinase, WW and PDZ domain containing 2 1.79 3.5 1.03E-06 CSAG2 CSAG family, member 2 1.61 3.1 3.24E-05 ATP11C ATPase, class VI, type 11C 1.58 3.0 3.87E-04 CSAG2 CSAG family, member 2 1.57 3.0 6.75E-05 CXCL10 chemokine (C-X-C motif) ligand 10 1.38 2.6 2.07E-03 LGR5 leucine-rich repeat-containing G protein-coupled receptor 5 1.38 2.6 1.39E-04 C8orf84 chromosome 8 open reading frame 84 1.34 2.5 6.76E-06 FRY furry homolog (Drosophila) 1.29 2.4 4.08E-05 IFITM1 interferon induced transmembrane protein 1 (9-27) 1.24 2.4 2.68E-03 MAGEA12 melanoma antigen family A, 12 1.23 2.3 1.34E-04 MAGEA6 melanoma antigen family A, 6 1.19 2.3 6.78E-04 DDX26B DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B 1.18 2.3 6.10E-04 APOBEC3F apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F 1.18 2.3 1.14E-04 VTRNA1-2 vault RNA 1-2 5.00 2.3 1.93E-03 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif, 6 1.17 2.2 1.02E-04 IGFL4 IGF-like family member 4 1.17 2.2 6.57E-04 GRIP1 glutamate receptor interacting protein 1 1.15 2.2 1.78E-03 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) 1.14 2.2 7.05E-04 GJA5 gap junction protein, alpha 5, 40kDa 1.13 2.2 6.18E-04 ACOXL acyl-CoA oxidase-like 1.11 2.2 6.78E-04 DMKN dermokine 1.11 2.2 5.51E-05 ELF5 E74-like factor 5 (ets domain transcription factor) 1.10 2.1 1.31E-03 UCA1 urothelial cancer associated 1 (non-protein coding) 1.08 2.1 5.85E-06 TSPAN12 tetraspanin 12 1.08 2.1 1.00E-03 NNMT nicotinamide N-methyltransferase 1.08 2.1 6.98E-03 SNORD102 small nucleolar RNA, C/D box 102 1.07 2.1 6.83E-03 B3GALTL beta 1,3-galactosyltransferase-like 1.06 2.1 1.69E-05 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1.04 2.1 1.57E-03 APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G 1.01 2.0 2.11E-03 Gene ID Gene Description Log2 Fold Change p_value SLCO1B3 solute carrier organic anion transporter family, member 1B3 -3.45 -10.90 5.09E-04 HEPACAM2 HEPACAM family member 2 -3.40 -10.58 3.76E-06 REG4 regenerating islet-derived family, member 4 -2.52 -5.72 1.93E-04 FMNL2 formin-like 2 -2.46 -5.48 2.54E-05 ATOH1 atonal homolog 1 (Drosophila) -2.43 -5.40 3.80E-05 MUC2 mucin 2, oligomeric mucus/gel-forming -2.20 -4.60 2.76E-06 AUTS2 autism susceptibility candidate 2 -1.84 -3.57 1.11E-05 PLXDC2 plexin domain containing 2 -1.78 -3.44 1.05E-05 PRKACB protein kinase, cAMP-dependent, catalytic, beta -1.75 -3.36 1.29E-03 OR51E1 olfactory receptor, family 51, subfamily E, member 1 -1.73 -3.31 1.03E-03 TOX3 TOX high mobility group box family member 3 -1.66 -3.17 9.47E-06 LST-3TM12 organic anion transporter LST-3b -1.66 -3.17 3.64E-04 CDH17 cadherin 17, LI cadherin (liver-intestine) -1.65 -3.14 2.35E-05 TFF3 trefoil factor 3 (intestinal) -1.60 -3.04 3.13E-04 ANXA13 annexin A13 -1.57 -2.97 1.34E-04 CAP2 CAP, adenylate cyclase-associated protein, 2 (yeast) -1.55 -2.93 2.42E-05 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 -1.51 -2.85 3.58E-05 RETNLB resistin like beta -1.50 -2.82 1.08E-05 SPINK4 serine peptidase inhibitor, Kazal type 4 -1.49 -2.81 1.30E-04 SLC38A11 solute carrier family 38, member 11 -1.48 -2.79 3.03E-04 JPH1 junctophilin 1 -1.48 -2.79 1.50E-05 USP17L6P ubiquitin specific peptidase 17-like 6 (pseudogene) -1.48 -2.79 7.18E-06 CEACAM6 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) -1.42 -2.68 1.29E-03 ADH6 alcohol dehydrogenase 6 (class V) -1.35 -2.55 1.11E-04 ADH1C alcohol dehydrogenase 1C (class I), gamma polypeptide -1.35 -2.55 4.79E-05 DKK1 dickkopf homolog 1 (Xenopus laevis) -1.35 -2.54 7.24E-04 C9orf150 chromosome 9 open reading frame 150 -1.34 -2.53 1.42E-04 SIPA1L2 signal-induced proliferation-associated 1 like 2 -1.31 -2.47 9.97E-05 CD200 CD200 molecule -1.28 -2.43 1.67E-04 MMP7 matrix metallopeptidase 7 (matrilysin, uterine) -1.28 -2.42 2.84E-05 NEUROG3 neurogenin 3 -1.22 -2.34 3.76E-04 USP17 ubiquitin specific peptidase 17 -1.18 -2.27 1.07E-05 DPP4 dipeptidyl-peptidase 4 -1.17 -2.25 1.35E-04 CEACAM5 carcinoembryonic antigen-related cell adhesion molecule 5 -1.17 -2.24 4.35E-05 USP17 ubiquitin specific peptidase 17 -1.16 -2.24 2.29E-05 AGR2 anterior gradient homolog 2 (Xenopus laevis) -1.16 -2.23 8.24E-04 PLD1 phospholipase D1, phosphatidylcholine-specific -1.15 -2.22 7.95E-04 LGR4 leucine-rich repeat-containing G protein-coupled receptor 4 -1.15 -2.21 1.81E-04 GNAI1 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 -1.11 -2.16 3.72E-04 DDC dopa decarboxylase (aromatic L-amino acid decarboxylase) -1.11 -2.15 3.88E-04 IGFBP2 insulin-like growth factor binding protein 2, 36kDa -1.11 -2.15 3.58E-05 MYO1B myosin IB -1.10 -2.14 9.87E-04 ANG angiogenin, ribonuclease, RNase A family, 5 -1.05 -2.07 8.93E-04 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog -1.04 -2.06 1.37E-03 DEPDC6 DEP domain containing 6 -1.04 -2.06 2.24E-04 RFX6 regulatory factor X, 6 -1.03 -2.04 2.22E-04 TOX thymocyte selection-associated high mobility group box -1.01 -2.02 2.82E-03 DSEL dermatan sulfate epimerase-like -1.01 -2.02 2.08E-04 Table S3. Complete list of Affymetrix data of genes differentially expressed genes in cultured

HT29LMα1 and HT29 control cells.

For all genes up, a filter of Log2>1 and a pValue<0.01 was used.

For all genes down, a filter of Log2<-1 and a pValue<0.01 was used.

Supplementary Table S4: Stromal (murine) angiogenesis-related genes upregulated by LMα1 Gene ID Name Log2 fold change p value Lama1 Laminin subunit alpha-1 7.82 226.62 0.0001 Fgf1 Fibroblast growth factor 1 5.50 45.31 0.0064 Stra6 Stimulated by retinoic acid gene 6 protein 2.22 4.67 0.0001 Wt1 Wilms tumor protein homolog 1.64 3.11 0.0293 Fgf9 Fibroblast growth factor 9 1.57 2.97 0.0430 Wnt5a Protein Wnt-5a 1.44 2.71 0.0001 Il1b Interleukin-1 beta 1.38 2.60 0.0003 Serpine1 Plasminogen activator inhibitor 1 1.32 2.49 0.0001 Angpt2 Angiopoietin-2 1.30 2.46 0.0001 Pgf Placenta growth factor 1.29 2.45 0.0008 Esm1 Endothelial cell-specific molecule 1 1.29 2.45 0.0001 Adm Adrenomedullin 1.24 2.37 0.0001 Lif Leukemia inhibitory factor 1.15 2.23 0.0001 Nr4a1 Nuclear receptor subfamily 4 group A member 1 1.07 2.10 0.0011 Aldh1a2 Retinal dehydrogenase 2 1.06 2.09 0.0048 Angpt4 Angiopoietin-4 1.03 2.05 0.0297 Egr1 Early growth response protein 1 1.02 2.03 0.0001 Arg1 Arginase-1 1.01 2.01 0.0004 Wnt11 Protein Wnt-11 0.98 1.97 0.0016 Nphp3 Nephrocystin-3 0.97 1.96 0.0455 Grem1 Gremlin-1 0.89 1.85 0.0218 Lepr Leptin receptor 0.88 1.84 0.0016 Wnt2 Protein Wnt-2 0.88 1.83 0.0152 Cx3cl1 Fractalkine 0.87 1.82 0.0008 Vegfa Vascular endothelial growth factor A 0.85 1.81 0.0022 Has2 Hyaluronan synthase 2 0.85 1.80 0.0022 Reck Reversion-inducing cysteine-rich protein with Kazal motifs 0.84 1.79 0.0062 Gpc3 Glypican-3 0.83 1.78 0.0011 Cyr61 Protein CYR61 0.83 1.78 0.0026 Tiparp TCDD-inducible poly [ADP-ribose] polymerase 0.82 1.76 0.0020 C6 Protein C6 0.80 1.74 0.0142 Mmp9 Matrix metalloproteinase-9 0.79 1.73 0.0027 Pdgfa Platelet-derived growth factor subunit A 0.77 1.71 0.0323 Pi16 Peptidase inhibitor 16 0.77 1.71 0.0100 Adam8 Disintegrin and metalloproteinase domain-containing protein 8 0.77 1.71 0.0025 Kcnj8 ATP-sensitive inward rectifier potassium channel 8 0.76 1.69 0.0166 Pdgfb Platelet-derived growth factor subunit B 0.75 1.68 0.0049 Sik1 Serine/threonine-protein kinase SIK1 0.73 1.66 0.0079 Ptgis Prostacyclin synthase 0.72 1.64 0.0141 Ptch1 Protein patched homolog 1 0.72 1.64 0.0100 Adam19 Disintegrin and metalloproteinase domain-containing protein 19 0.71 1.63 0.0065 Epha3 Ephrin type-A receptor 3 0.69 1.61 0.0128 Dll4 Delta-like protein 4 0.67 1.60 0.0181 Ahr Aryl hydrocarbon receptor 0.67 1.59 0.0137 Fzd1 Frizzled-1 0.65 1.57 0.0248 Hmox1 Heme oxygenase 1 0.63 1.55 0.0196 Errfi1 ERBB receptor feedback inhibitor 1 0.63 1.55 0.0096 Cx3cr1 CX3C chemokine receptor 1 0.61 1.52 0.0293 Egln1 Egl nine homolog 1 0.60 1.51 0.0168 Col8a2 Collagen alpha-2(VIII) chain 0.60 1.51 0.0162 Ptgs2 Prostaglandin G/H synthase 2 0.58 1.50 0.0187 Junb Transcription factor jun-B 0.58 1.49 0.0179 Acvr1 Activin receptor type-1 0.58 1.49 0.0319 Gaa Lysosomal alpha-glucosidase 0.57 1.49 0.0206 Fgfr1 Fibroblast growth factor receptor 1 0.57 1.49 0.0340 Ncam1 Neural cell adhesion molecule 1 0.57 1.48 0.0338 Runx1 Runt-related transcription factor 1 0.56 1.47 0.0361 Ccr5 C-C chemokine receptor type 5 0.55 1.46 0.0301 Vash1 Vasohibin-1 0.54 1.46 0.0269 Vcam1 Vascular cell adhesion protein 1 0.54 1.45 0.0364 Rbpj Recombining binding protein suppressor of hairless 0.52 1.44 0.0493 Cxcr4 C-X-C chemokine receptor type 4 0.51 1.42 0.0411 Table S4. List of pro-angiogenic LMα1-induced stromal genes

List of upregulated stromal (murine) genes in HT29LMα1 tumors extracted from the RNAseq data from HT29 tumors, with an anticipated role in angiogenesis according to the gene ontology classification and Amigo and Panther online tools. Three tumors per group were analyzed with a cutoff of log2>0.5 and p<0.05.

Supplementary Table S5: Tumoral (human) angiogenesis-related genes upregulated by LMα1 Gene ID Name Log2 fold change p value TNFAIP2 Tumor necrosis factor alpha-induced protein 2 4.19 18.31 0.0001 STRA6 Stimulated by retinoic acid gene 6 protein homolog 3.54 11.61 0.0001 RAMP2 Receptor activity-modifying protein 2 3.24 9.44 0.0035 AMOT Angiomotin 3.16 8.94 0.0001 MMRN2 Multimerin-2 3.09 8.53 0.0001 SRPX2 Sushi repeat-containing protein SRPX2 2.73 6.65 0.0007 ANPEP Aminopeptidase N 2.73 6.65 0.0001 SCG2 Secretogranin-2 2.61 6.09 0.0001 EPHB2 Ephrin type-B receptor 2 2.53 5.77 0.0001 CDH5 Cadherin-5 2.47 5.55 0.0074 FGF9 Fibroblast growth factor 9 2.20 4.60 0.0001 CX3CL1 Fractalkine 2.13 4.38 0.0001 MCAM Cell surface glycoprotein MUC18 1.89 3.72 0.0001 COL18A1 Collagen alpha-1(XVIII) chain 1.89 3.72 0.0001 COL1A1 Collagen alpha-1(I) chain 1.87 3.65 0.0002 PRDM1 PR domain zinc finger protein 1 1.84 3.58 0.0003 CDX2 Homeobox protein CDX-2 1.79 3.47 0.0001 TGFB2 Transforming growth factor beta-2 1.78 3.43 0.0001 AQP1 Aquaporin-1 1.69 3.22 0.0001 WNT11 Protein Wnt-11 1.50 2.83 0.0001 PGF Placenta growth factor 1.42 2.67 0.0008 RAMP1 Receptor activity-modifying protein 1 1.38 2.60 0.0001 TCF21 Transcription factor 21 1.36 2.57 0.0001 ARHGAP22 Rho GTPase-activating protein 22 1.29 2.45 0.0085 FGFR2 Fibroblast growth factor receptor 2 1.23 2.35 0.0001 TGFBI Transforming growth factor-beta-induced protein ig-h3 1.19 2.29 0.0001 PROX1 Prospero homeobox protein 1 1.17 2.24 0.0001 TYMP Thymidine phosphorylase 1.15 2.22 0.0092 IL8 Interleukin-8 1.11 2.16 0.0001 NOS3 Nitric oxide synthase, endothelial 1.09 2.13 0.0005 HHEX Hematopoietically-expressed homeobox protein HHEX 1.08 2.11 0.0058 CYR61 Protein CYR61 1.07 2.10 0.0001 ATP7A Copper-transporting ATPase 1 1.06 2.08 0.0001 ENPEP Glutamyl aminopeptidase 1.04 2.06 0.0001 NOX1 NADPH oxidase 1 1.03 2.04 0.0001 TBX3 T-box transcription factor TBX3 1.02 2.03 0.0001 EDN1 Endothelin-1 1.01 2.01 0.0001 Table S5. List of pro-angiogenic LMα1-induced tumor cell specific genes

List of upregulated cancer (human) genes in HT29LMα1 tumors extracted from the RNAseq data from HT29 tumors, with an anticipated role in angiogenesis according to the gene ontology classification and Amigo and Panther on line tools. 3 tumors per group were analyzed with a cutoff of log2>1 and p<0.01.

Supplementary Table S6: Correlation between LMα1 mRNA expression in human colorectal tumors and clinicopathological characteristics Sex Age Localisation Tumoral stage RER status LMα1 fold change F 81 caecum pT3N1M0 RER+ 51.0 H 82 caecum pT3N1M0 RER+ 60.0 F 83 caecum pT3N0M0 RER+ 1.5 H 56 caecum pT3N0M0 RER+ 7.1 H 69 colon pT4N2M1 RER- 84.7 H 73 colon pT4N2M1 RER+ 6.3 H 56 colon pT4N2M1 RER- 43.7 F 50 colon pT4N1M1 RER- 29.9 F 57 colon pT4N0M1 RER- 85.0 H 65 colon pT4N0M0 RER- 77.6 M 73 colon pT3N2M1 RER- 67.2 H 58 colon pT3N2M1 RER- 16.2 H 62 colon pT3N1M1 RER- 2.9 F 57 colon pT3N1M1 RER- 22.7 F 81 colon pT3N1M0 RER- 15.7 M 77 colon pT3N1M0 RER- 3.8 F 88 colon pT3N1M0 RER- 2.3 H 79 colon pT3N1M0 RER- 5.7 F 83 colon pT3N1M0 RER- 6.5 H 72 colon pT3N1M0 RER+ 17.7 F 91 colon pT3N1M0 RER- 2.9 H 65 colon pT3N0M1 RER- 8.3 M 74 colon pT3N0M0 RER+ 7.0 H 68 colon pT3N0M0 RER- 70.9 F 71 colon pT3N0M0 RER- 24.7 H 82 colon pT3N0M0 RER- 16.8 F 57 colon pT2N1M0 RER- 43.5 H 57 colon pT2N0M0 RER- 5.4 H 66 colon pT2N0M0 RER+ 52.7 H 71 colon pT2N0M0 RER- 4.2 H 57 colon pT2N0M0 RER- 3.0 H 66 colon pT2N0M0 RER+ 1.3 H 71 colon pT2N0M0 RER+ 3.5 F 55 colon pT1N0M0 RER- 15.1 H 77 colon pT1N0M0 RER- 5.2 H 67 rectum pT3N0M0 RER- 11.5 H 74 rectum pT2N0M0 RER- 7.3 F 59 rectum pT1N0M0 RER- 84.9 F 62 rectum pT1N0M0 RER- 6.4 Table S6. Human tumor patient data

Assortment according to localisation of tumor to caecum, colon or rectum starting with the lowest tumor stage per category (PTM classification), depicting gender, age, RER

(replication error) and relative LMα1 expression. No correlation of LMα1 expression with tumor localisation, gender, age nor tumor stage was noted.

Supplementary Table S7: Descriptions of the antibodies used Antigen recognized Antibody Species recognized Type Dilution Use Source/reference Actin C4 mouse, human mouse mAB 1/15000 WB Chemicon Millipore αSMA 1A4 mouse mouse mAB 1/200 IF Sigma Aldrich αSMA E184 mouse rabbit mAB 1/500 IF Chemicon Millipore CD31 73117 mouse rat mAB 1/500 IF Pharmingen CXCR4 ab2074 mouse, human rabbit pAB 1/100 Duolink Abcam Integrin α2 BHA2.1 human mouse mAB 10µg/mL Blocking Millipore Integrin α2 BHA2.1 human mouse mAB 1/100 Duolink Millipore Integrin α6 GoH3 human rat mAB 10µg/mL Blocking Santa Cruz Biotechnology Integrin β1 4B4 human mouse mAB 10µg/mL Blocking Beckman Coulter Ki67 RM-9106 mouse rabbit pAB 1/200 IHC Thermo Scientific LMα1 1057 mouse rabbit pAB 1/500 IF Sasaki et al., 2002 LMα1 Tiger II human rabbit pAB 1/200 IF Tiger et al.,1997 LMα1 200 mouse rat mAB 1/200 IF Sorokin et al.,1992 LMα1 YY4 mouse rabbit pAB 1/500 WB gift from Hynda Kleinman NG2 AB5320 mouse, human rabbit pAB 1/200 IF Chemicon Millipore S100A4 8828 mouse rabbit pAB 1/500 IF gift from Nona Ambartsumian Table S7. List of antibodies used for immunoblotting, tissue and cell staining mAB, monoclonal antibody; pAB, polyclonal antibody; IF, immunofluorescence; IHC, immunohistochemistry; WB, western blot; Duolink, proximity ligation assay.

Supplementary Table S8: Sequences of the primers used for qRTPCR Name Sequence 5'-3' Forward Sequence 5'-3' Reverse h VEGFA AAGGAGGAGGGCAGAATCAT CCAGGCCCTCGTCATTG h LMα1 HS00300550_M1 (TAQMAN PROBE, APPLIED) h LMα1 GACAGCCCGGTGTCTGCCTTCACG GTGGCGGTTTTGGGCTCATATGCA h LMα2 ATGCAATGCGTTTGTTGGT CACGTACAGCATCAGCCTTC h LMα3 TGCCCATGTCCTCACACTAA CACGTCTCCCCCATTCAC hLMα4 ACCTCCTCAATCAAGCCAGA TCAGCCACTGCTTCATCACT h LMα5 TCCCCTACTGCGAAGCTG CCTCAGGAAGGGCAGGAT h LMβ1 CCACTGAAAAACATTGGGAATC TGAGCCATCATCATTTCTGTAACATC h LMβ2 GAGGCTGAGCAGCTGCTACGCGGT CCCGTCCAACTGGGCTGCCTTACT h LMβ3 GAAGATGTCAGACGCACACG GCATCAGTGTCGGGGTCT h LMβ4 GATCAGCCCTCAATCAGACC GGACACTCCATGGGACTCAC h LMγ1 CACAGAGGCCAAGAACAAGG CTTGGTGCTGGTGGCATT h LMγ2 GATGCACAGAGGGCAAAGAATGGG GGAAAGCTTCTGCTCCAGTAAGAC h LMγ3 AGACGAGGAGGAGCTCACAG TATGAGGGGCTGCCCATAG h CXCR4 Hs00607978_s1 (TAQMAN PROBE, APPLIED) h GAPDH HS99999905_M1 (TAQMAN PROBE, APPLIED) h PBGD QT00014462 (QUIAGEN) m VEGFA GTACCTCCACCATGCCAAGT TGGGACTTCTGCTCTCCTTC m LMα1 CCGACAACCTCCTCTTCTACC TCTCCACTGCGAGAAAGTCA m GAPDH MM99999915_G1 (TAQMAN PROBE, APPLIED) m PBGD QT00494130 (QUIAGEN) Table S8. List of primers used in qRT-PCR h, human specific; m, mouse specific

1