DOCSLIB.ORG

Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis”

Supplemental material and methods

Cloning of the villin-LMα1 vector

The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start

codon of the villin coding sequence using the 5’ phosphorylated primer:

  • 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’.
  • A
  • double strand

  • and
  • annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’

5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and

SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers

5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’

before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France).

After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid

pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated

before the

AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’)

initiation

  • codon
  • and
  • a
  • MluI
  • site
  • (5’
  • phosphorylated

1

CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.

Yurchenco, Piscataway, NJ, USA). The BsiWI-MluI fragment containing the LMα1 cDNA was gel purified and subcloned into the BsiWI-MluI sites of the pBS-villin-promoter-MES-SV40- polyA vector giving rise to plasmid pBS-villin-LMα1.

Generation of vLMα1 transgenic mice and of the vLMα1/APC+/1638 mice

From the pBS vLMα1 plasmid a SalI fragment containing the 9 kb villin promoter region followed by the mouse LMα1 cDNA and the SV40 polyA was obtained, purified and used for

injection into pronuclei of fertilized oocytes (F1 hybrid C57Bl/6 x DBA/2, transgenic facility of the IGBMC, Strasbourg, France). Germline transmission was determined by PCR analysis of

  • tail
  • DNA,
  • using
  • the
  • villin1
  • primer
  • present
  • in
  • the
  • villin
  • promoter

(5’ATAGGAAGCCAGTTTCCCTTC3’) and the LM17 primer present in the 5’ region of the LMα1 cDNA (5’TGACCCAGAGCACCGAGGCCA3’) generating a fragment of 152 bp. For

confirmation a second PCR was done obtaining a 166 bp product with primer LM116 present

in the 3’ region of the Lama1 cDNA (5’GCCTCATTCCGGGGCTGTGTG3’) and primer SV40

3’ (5’AATGTGGTATGGCTGATTATG3’) encompassing the SV40 polyA sequence. Two out

of 68 villin-LMα1 (vLMα1) founders showed stable integration and expression, and were further used in parallel for all experiments. Heterozygous vLMα1 mice were kept in a CD1

background (Charles River, L'Arbresle Cedex, France). In certain cases, vLMα1 mice were crossed with APC+/1638N mice (1). Double transgenic mice were kept on a CD1 background.

Generation of LMα1 knock-down cells

HEK293T cells (ATCC CRL-3216; cultured in DMEM, 10% FCS, 1% penicillin-streptomycin)

  • were
  • transfected
  • with
  • pGFP-C-sh
  • LAMA1
  • Lentivector
  • (TL311806D:

5’-

GAGATGTGCAGATGGTTACTATGGAAACC-3’) or pGFP-C-sh control Lentivector (TR30021) containing non-effective 29-mer scrambled shRNA cassette (OriGene,

2

Cliniscience, Nanterre, France) together with pLP1, pLP2 and pLP/VSVG lentiviral packaging plasmids (Invitrogen, Life Technologies, Saint Aubin, France) to obtain lentiviral particles. After 48 hours, conditioned media from HEK293T were collected, filtered through a 0.22 µm filter to remove cell debris, and used to transduce HCT116 cells (ATTC CCL-247) cultured in DMEM supplemented with 10% fetal calf serum and 1% penicillin-streptomycin (Gibco, USA) in the presence of 5µg/mL polybrene (Sigma Aldrich, Lyon, France), followed by selection with puromycin (1.6 µg/mL, Sigma Aldrich, Lyon, France). Expression of LM1 mRNAs and protein was determined by qRT-PCR and ELISA.

Surface Plasmon Resonance

Surface Plasmon Resonance-Binding experiments were performed on a Biacore 2000 instrument (Biacore Inc., GE Healthcare, Velizy-Villacoublay, France) at 25 °C. VEGFA165 (R&D systems, Minneapolis, USA) or VEGFA121 (Prospecbio, East Brunswick, USA) was immobilized (10µl/ml) at high surface density (5.000 response units) on an activated CM5 chip using standard amine-coupling procedures, as described by the manufacturer. LM-111

was injected at a concentration of 10 μg/mL in 10 mM sodium acetate, pH 5.0, and at a flow rate of 5 μL/min during 20 min. Free groups were blocked by injecting 1M ethanolamine. To

perform binding assays, LM-111 at different concentrations (from 5 to 20µg in 200µL) was injected in 10 mM MES, pH 6.0, 150 mM NaCl, with 0.005% (v/v) Tween 20, at a flow rate of

10 μL/min. Blank surfaces were used for background corrections. Injections of 10 mM glycine, pH 2.0, at 100 μL/min for 1 min were used to regenerate surfaces between two

binding experiments. Steady state analysis was used to estimate the affinity of VEGF165 to LM-111. Dissociation constants (Kd) were estimated using 1:1 Langmuir association model as described by the manufacturer.

Gene expression analysis

RNA was extracted using the Tri Reagent according to manufacturer’s instructions

(Molecular Research Center Inc., Euromedex, Souffelweyersheim, France). RNA-Seq

3

experiments were performed at the IGBMC Affymetrix Core Facility (Illkirch, France). Library of template molecules suitable for high throughput DNA sequencing was created following

the Illumina “Truseq RNA sample preparation low throughput” protocol with some

modifications. Briefly, mRNA was purified from 2 µg total RNA using oligo-dT magnetic beads and fragmented using divalent cations at 94°C for 8 minutes. The cleaved mRNA fragments were reverse transcribed into cDNA using random primers, then the second strand of the cDNA was synthesized using Polymerase I and RNase H. The next steps of RNA-Seq Library preparation were performed in a fully automated system using SPRIworks Fragment Library System I kit (Beckman Coulter, Fullerton, USA) with the SPRI-TE instrument (Beckman Coulter). Briefly, in this system double stranded cDNA fragments were blunted, phosphorylated and ligated to indexed adapter dimers, and fragments in the range of ~200- 400 bp were size selected. The automated steps were followed by PCR amplification (30 sec at 98°C; [10 sec at 98°C, 30 sec at 60°C, 30 sec at 72°C] x 12 cycles; 5 min at 72°C), then surplus PCR primers were removed by purification using AMPure XP beads (Agencourt Biosciences Corporation, Beverly, USA). DNA libraries were checked for quality and quantified using 2100 Bioanalyzer (Agilent, Les Ulis, France). The libraries were loaded in the flow cell at 8pM concentration and clusters generated and sequenced in the Illumina Genome Analyzer IIX as single-end 72 base reads. The separation of RNA sequencing reads derived from the human tumor cells and the host murine cells was performed in silico using the Xenome software (2) that is designed to discriminate species specific sequences in a xenograft environment. Each Fastq file was separated into mouse specific and human specific sequencing reads. These were subsequently aligned using Tophat2 (3) and processed using the Cufflinks (4) pipeline to generate the final expression files. Three

independent subcutaneous tumors generated from control or HT29LMα1 cells were

sequenced. Raw data can be found using the GEO accession number GSE84296. Changes in gene expression in dependence of LMα1 are shown as Log2 fold-change (Fc) values. We chose a cutoff with a p-value <0.05, a Log2 difference of +/-0.5 for genes of stromal cells and a cutoff with a p-value <0.01, a Log2 difference of +/-1 for genes of cancer cells.

4

Microarray experiments were performed at the IGBMC Affymetrix Core Facility (Illkirch, France). Biotinylated single strand cDNA targets were prepared by using 250 ng of total RNA and the Ambion WT Expression Kit (Ambion, Fisher Scientific, Illkirch-Graffenstaden, France) or the Affymetrix GeneChip WT Terminal Labeling Kit (Affymetrix, Santa Clara, USA) according to manufacturer`s recommendations. Following fragmentation and end-labelling,

2.07 μg of cDNAs were hybridized for 16 hours at 45oC on GeneChip Human Gene 1.0 ST

arrays (Affymetrix) interrogating 28.869 genes represented by approximately 27 probes spread across the full length of the gene. The chips were washed and stained in the GeneChip® Fluidics Station 450 (Affymetrix) and scanned with the GeneChip Scanner 3000 7G (Affymetrix) at a resolution of 0,7 µm. Raw data (.CEL Intensity files) were extracted from the scanned images using the Affymetrix GeneChip Command Console (AGCC) version 3.1. CEL files were further processed with Affymetrix Expression Console software version 1. 1 to calculate probe set signal intensities using Robust Multi-array Average (RMA) algorithms with default settings. Three separate hybridizations were performed with independent

samples from control or HT29LMα1 cells. Raw data can be found using the GEO accession

number GSE83747. Changes in gene expression in dependence of LMα1 are shown as Log2 fold-change (Fc) values. We chose a cutoff with a p-value <0.01, a Log2 difference of +/-1 for genes of cancer cells.

Gene list analysis was done by using the gene ontology online Amigo tool

(http://amigo.geneontology.org/amigo)

  • and
  • the
  • Panther
  • tool

(http://pantherdb.org/webservices/go/overrep.jsp) with default parameters.

For qRT-PCR, RNA was treated with DNase I and reverse transcribed using the High Capacity cDNA RT Kit. qRT-PCR was performed using the Power SYBR Green PCR Master Mix or TaqMan Gene Expression Master Mix. All compounds were purchased from Life Technologies (St Aubin, France). Primer sequences or probes are listed in Supplemental

Table S8. Two sets of primers/probes were used to determine LMα1 expression in human

tumors, one located in the 5' (Taqman) and another in the 3' region of the gene, giving similar

5

results. Relative expression level 2e-ΔΔct was calculated for each individual sample. For xenograft analysis, a primer design approach was used to obtain species specific qRT-PCR primers. The coding regions of the mouse and human homologous cDNA sequences were aligned (www.ensembl.org). Regions of low homology were chosen for selection of species specific primers that were always spanning an intron. Primer specificity was confirmed by using cDNA from human or mouse tissues. Only primers giving an efficiency value between 93 to 108% were used. When calculating murine or human gene expression in the xenograft tumors, primers for mouse or human PBDG (porphobilinogen deaminase) were used for normalization, respectively. For colon tumors, data were normalized to the reference gene GAPDH (Glyceraldehyde 3-phosphate dehydrogenase).

References

1. Fodde R, Edelmann W, Yang K, van Leeuwen C, Carlson C, Renault B, et al. A targeted chain-termination mutation in the mouse Apc gene results in multiple intestinal tumors. ProcNatlAcadSciUSA. 1994;91:8969–73.

2. Conway T, Wazny J, Bromage A, Tymms M, Sooraj D, Williams ED, et al. Xenome—a tool for classifying reads from xenograft samples. Bioinformatics. 2012;28:i172–8.

3. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013;14:R36.

4. Roberts A, Pimentel H, Trapnell C, Pachter L. Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics. 2011;27:2325–9.

6

Table S1 up regulated stromal genes

Gene ID

Lama1 Fgf1 Slfn1 Sec1

  • Gene Name
  • Log2 Fold Change
  • p_value

5.00E-05 6.40E-03 2.18E-02 4.94E-02 5.00E-05 5.00E-05 1.77E-02 5.00E-05 5.50E-04 5.00E-05 5.00E-05 5.00E-05 2.27E-02 5.65E-03 5.00E-05 5.00E-05 3.50E-03 3.28E-02 2.78E-02 5.00E-05 6.90E-03 8.30E-03 2.23E-02 5.00E-05 2.92E-02 5.30E-03 3.74E-02 2.93E-02 7.00E-04 4.67E-02 1.00E-04 3.05E-03 4.31E-02 4.87E-02 5.00E-05 7.60E-03 5.00E-05 4.62E-02 5.00E-05 5.00E-05 5.80E-03 1.90E-03 2.46E-02 5.00E-05 5.00E-05 4.59E-02 5.00E-05 3.50E-02 9.30E-03 3.50E-04 5.00E-05 5.00E-05 3.55E-02 5.00E-05 3.82E-02 5.00E-05 4.00E-04 5.00E-05 1.84E-02 3.93E-02 3.84E-02 3.50E-04 4.17E-02 5.00E-05 1.00E-04 8.00E-04 1.50E-04 5.00E-05 1.37E-02 2.44E-02 2.00E-04 8.75E-03 1.00E-04 5.00E-05 1.54E-02 1.47E-02 6.00E-04 1.50E-04 5.00E-05 5.00E-05 4.84E-02 3.50E-04 5.00E-05
Laminin subunit alpha-1 Fibroblast growth factor 1 Protein Slfn1 Galactoside 2-alpha-L-fucosyltransferase 3 Protein Trim30d
7.82 5.50 3.84 3.67 3.36 2.81 2.68 2.57 2.55 2.53 2.50 2.43 2.30 2.23 2.22 2.19 2.07 2.01 1.99 1.94 1.82 1.78 1.75 1.72 1.68 1.66 1.64 1.64 1.61 1.60 1.60 1.59 1.57 1.56 1.56 1.55 1.50 1.50 1.49 1.48 1.48 1.46 1.45 1.44 1.43 1.42 1.42 1.41 1.41 1.38 1.36 1.35 1.35 1.34 1.34 1.33 1.33 1.32 1.31 1.31 1.31 1.31 1.30 1.30 1.29 1.29 1.29 1.29 1.28 1.27 1.27 1.27 1.26 1.26 1.25 1.25 1.24 1.24 1.24 1.24 1.23 1.22 1.22
226.6 45.3 14.4 12.7 10.3 7.0 6.4 5.9 5.9 5.8 5.6 5.4 4.9 4.7 4.7 4.6 4.2 4.0 4.0 3.8 3.5 3.4 3.4 3.3 3.2 3.2 3.1 3.1 3.0 3.0 3.0 3.0 3.0 3.0 2.9 2.9 2.8 2.8 2.8 2.8 2.8 2.7 2.7 2.7 2.7 2.7 2.7 2.7 2.7 2.6 2.6 2.6 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.4 2.3 2.3 2.3
Trim30d

  • Gnpda1
  • Glucosamine-6-phosphate isomerase 1

3830417A13Rik Protein 3830417A13Rik Zfp949 Il11 Cwc22 Tnfrsf9 Alas2 Zfp939 Fosb
Protein Zfp949 Interleukin-11 Pre-mRNA-splicing factor CWC22 homolog Tumor necrosis factor receptor superfamily member 9 5-aminolevulinate synthase, erythroid-specific, mitochondrial Protein Zfp939 Protein fosB
Stra6 Ptprn
Stimulated by retinoic acid gene 6 protein Receptor-type tyrosine-protein phosphatase-like N Transmembrane protein 26 60S ribosomal protein L10a Transmembrane protein 35 Inactive carboxypeptidase-like protein X2 Cytochrome P450 26A1 Protein MGARP Bone sialoprotein 2 40S ribosomal protein S8
Tmem26 Rpl10a Tmem35 Cpxm2 Cyp26a1 Mgarp Ibsp Rps8

  • Rasl11a
  • Ras-like protein family member 11A

I830012O16Rik Protein I830012O16Rik Cd69 Wt1 Oasl1 Kcng2 Fos Pcdh17 Fgf9 Nlrp1b Hhip Lin7a Actg2 Vit Edil3 Slc2a3 Lag3
Early activation antigen CD69 Wilms tumor protein homolog 2'-5'-oligoadenylate synthase-like protein 1 Protein Kcng2 Proto-oncogene c-Fos Protein Pcdh17 Fibroblast growth factor 9 NACHT-, LRR-, and PYD-containing protein 1 paralog b splice variant 3 Hedgehog-interacting protein Protein lin-7 homolog A Actin, gamma-enteric smooth muscle Vitrin EGF-like repeat and discoidin I-like domain-containing protein 3 Solute carrier family 2, facilitated glucose transporter member 3 Lymphocyte activation gene 3 protein T-cell surface glycoprotein CD4 Brain and acute leukemia cytoplasmic protein Protein Wnt-5a Cytokine receptor-like factor 1 Inactive 2'-5'-oligoadenylate synthase 1B Solute carrier family 2, facilitated glucose transporter member 1 Peptidyl-prolyl cis-trans isomerase FKBP1B Kinesin-like protein KIF1A
Cd4 Baalc Wnt5a Crlf1 Oas1b Slc2a1 Fkbp1b Kif1a Il1b Grem2 Npr3 Prelid2 Igfbp2 Brdt Ero1l Adamts6 Serpine1 Gxylt2 Ccl3 Gm5424 Tnfrsf19 Lingo1 Angpt2 Ifit1
Interleukin-1 beta Gremlin-2 Atrial natriuretic peptide receptor 3 PRELI domain-containing protein 2 Insulin-like growth factor-binding protein 2 Bromodomain testis-specific protein ERO1-like protein alpha Protein Adamts6 Plasminogen activator inhibitor 1 Glucoside xylosyltransferase 2 C-C motif chemokine 3 MCG15755 Tumor necrosis factor receptor superfamily member 19 Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1 Angiopoietin-2 Interferon-induced protein with tetratricopeptide repeats 1 Placenta growth factor Endothelial cell-specific molecule 1 Proenkephalin-A Complement C1q tumor necrosis factor-related protein 7 Myb-related transcription factor, partner of profilin Inhibin beta A chain
Pgf Esm1 Penk C1qtnf7 Mypop Inhba Rnf157 Rgs1 Cd209f Vill Hspa1a Gzmd Adm Eno2 Fst Whrn Megf10 Ier3
RING finger protein 157 Regulator of G-protein signaling 1 MCG132033, isoform CRA_a Villin-like protein Heat shock 70 kDa protein 1A Granzyme D ADM Gamma-enolase Follistatin Whirlin Multiple epidermal growth factor-like domains protein 10 Radiation-inducible immediate-early gene IEX-1

Gene ID

Rsad2 Rgs16 Osgin1 Isg15

  • Gene Name
  • Log2 Fold Change
  • p_value

3.00E-04 5.00E-05 1.94E-02 6.00E-04 1.00E-04 3.91E-02 2.40E-02 1.95E-03 5.00E-05 5.60E-03 4.64E-02 8.50E-03 4.00E-04 1.18E-02 8.65E-03 1.45E-03 8.65E-03 2.18E-02 1.85E-03 7.50E-04 1.10E-03 2.36E-02 4.80E-03 2.40E-02 7.55E-03 5.00E-05 5.10E-03 3.86E-02 4.15E-02 2.98E-02 5.00E-05 1.20E-03 4.00E-04 5.90E-03 1.35E-03 3.90E-03 2.53E-02 1.95E-02 1.01E-02 1.65E-03 4.55E-02 2.75E-03 2.65E-03 2.00E-04 4.00E-04 3.30E-03 2.08E-02 3.51E-02 1.29E-02 1.17E-02 3.00E-04 9.00E-04 4.67E-02 5.00E-04 3.62E-02 2.40E-03 2.35E-03 4.75E-03 4.50E-03 2.18E-02 6.75E-03 6.00E-04 7.05E-03 8.50E-04 1.60E-03 1.89E-02 1.52E-02 1.55E-02 7.00E-04 6.10E-03 8.00E-04 2.07E-02 2.50E-03 2.65E-03 2.51E-02 1.06E-02 1.35E-03 6.50E-04 1.10E-03 2.03E-02 2.20E-03 1.85E-03 2.20E-03 2.87E-02 4.11E-02
Radical S-adenosyl methionine domain-containing protein 2 Regulator of G-protein signaling 16 Oxidative stress induced growth inhibitor 1 Ubiquitin-like protein ISG15
1.21 1.20 1.20 1.18 1.18 1.18 1.17 1.16 1.15 1.15 1.12 1.12 1.11 1.10 1.10 1.10 1.10 1.09 1.09 1.09 1.07 1.07 1.06 1.06 1.06 1.06 1.05 1.05 1.04 1.03 1.02 1.01 1.01 1.01 1.00 1.00 0.99 0.99 0.98 0.98 0.97 0.97 0.97 0.96 0.96 0.95 0.95 0.94 0.94 0.93 0.93 0.93 0.92 0.92 0.91 0.90 0.90 0.89 0.89 0.89 0.89 0.88 0.88 0.88 0.88 0.88 0.88 0.87 0.87 0.87 0.87 0.87 0.86 0.86 0.86 0.86 0.86 0.86 0.85 0.85 0.85 0.85 0.85 0.85 0.84
2.3 2.3 2.3 2.3 2.3 2.3 2.2 2.2 2.2 2.2 2.2 2.2 2.2 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.9 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8 1.8
Itga11 Emid1 Osbp2 Pilra
Integrin alpha-11 EMI domain-containing protein 1 Oxysterol-binding protein 2 Paired immunoglobulin-like type 2 receptor alpha

  • Leukemia inhibitory factor
  • Lif

Igfbp3 Wdfy2 Lrrc55 Mdk
Insulin-like growth factor-binding protein 3 WD repeat and FYVE domain-containing protein 2 Leucine-rich repeat-containing protein 55 Midkine
Unc13a Hoxd8 Dusp4 B3gnt7 Aoah
Protein unc-13 homolog A Homeobox protein Hox-D8 Dual specificity protein phosphatase 4 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 Acyloxyacyl hydrolase

  • Ifit3
  • Interferon-induced protein with tetratricopeptide repeats 3

Egl nine homolog 3 Nuclear receptor subfamily 4 group A member 1 Solute carrier family 13 member 3 Retinal dehydrogenase 2 Ankyrin repeat domain-containing protein 37 Adenylate kinase 4, mitochondrial Tripartite motif-containing protein 30A KN motif and ankyrin repeat domain-containing protein 4 Dihydrofolate reductase
Egln3 Nr4a1 Slc13a3 Aldh1a2 Ankrd37 Ak4 Trim30a Kank4 Dhfr Eid2 Angpt4 Egr1 Bcl2a1b Arg1
EP300-interacting inhibitor of differentiation 2 Angiopoietin-4 Early growth response protein 1 B-cell leukemia/lymphoma 2 related protein A1b Arginase-1
1810011H11Rik Protein 1810011H11Rik Camk2n1 Pstpip1 Cd72 Mmp17 Slc1a4 Wnt11 Nphp3 Hilpda Maff
Calcium/calmodulin-dependent protein kinase II inhibitor 1 Proline-serine-threonine phosphatase-interacting protein 1 B-cell differentiation antigen CD72 Matrix metalloproteinase-17 Neutral amino acid transporter A Protein Wnt-11 Nephrocystin-3 Hypoxia-inducible lipid droplet-associated protein Transcription factor MafF
Chst11 Aldh1a3 Tnfaip3 Samsn1 Abt1 Usp18 Ndufa4l2 Scara3 Clec7a Zfp955a Apobec1 Otud1
Carbohydrate sulfotransferase 11 Aldehyde dehydrogenase family 1 member A3 Tumor necrosis factor alpha-induced protein 3 SAM domain-containing protein SAMSN-1 Activator of basal transcription 1 Ubl carboxyl-terminal hydrolase 18 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4-like 2 Scavenger receptor class A member 3 C-type lectin domain family 7 member A Protein Zfp955a C-U-editing enzyme APOBEC-1 OTU domain-containing protein 1 Protein Adamtsl3 Spermatogenesis-associated protein 13 Teashirt homolog 3
Adamtsl3 Spata13 Tshz3 Lpcat2 Grem1 H2-M3 Slc16a3 Ppp1r15a Dkk3
Lysophosphatidylcholine acyltransferase 2 Gremlin-1 Histocompatibility 2, M region locus 3 Monocarboxylate transporter 4 Protein phosphatase 1 regulatory subunit 15A Dickkopf-related protein 3

  • Lepr
  • Leptin receptor

Cnnm4 Wnt2
Metal transporter CNNM4 Protein Wnt-2
Hspa1b Ifit2 Hs3st3b1 Cx3cl1 Ripk2
Heat shock 70 kDa protein 1B Interferon-induced protein with tetratricopeptide repeats 2 Heparan sulfate glucosamine 3-O-sulfotransferase 3B1 Fractalkine Receptor-interacting serine/threonine-protein kinase 2

  • Protein sprouty homolog 4
  • Spry4

Gpr35 Lrmp Hhipl1 Csf2rb2 Ndrg1
G-protein coupled receptor 35 Lymphoid-restricted membrane protein HHIP-like protein 1 Interleukin-3 receptor class 2 subunit beta Protein NDRG1
Slc7a2 Tagln
Low affinity cationic amino acid transporter 2 Transgelin
Vegfa Fmod
Vascular endothelial growth factor A Fibromodulin

  • Has2
  • Hyaluronan synthase 2

Uxs1 Arhgap15
UDP-glucuronic acid decarboxylase 1 Rho GTPase-activating protein 15

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
  • Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks

    Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks

    906 • The Journal of Neuroscience, January 25, 2017 • 37(4):906–921 Systems/Circuits Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks X Laurence D. Picton, XFilipe Nascimento, XMatthew J. Broadhead, XKeith T. Sillar, and XGareth B. Miles School of Psychology and Neuroscience, University of St Andrews, St Andrews KY16 9JP, United Kingdom Ubiquitously expressed sodium pumps are best known for maintaining the ionic gradients and resting membrane potential required for generating action potentials. However, activity- and state-dependent changes in pump activity can also influence neuronal firing and regulate rhythmic network output. Here we demonstrate that changes in sodium pump activity regulate locomotor networks in the spinal cord of neonatal mice. The sodium pump inhibitor, ouabain, increased the frequency and decreased the amplitude of drug-induced locomotor bursting, effects that were dependent on the presence of the neuromodulator dopamine. Conversely, activating the pump with the sodium ionophore monensin decreased burst frequency. When more “natural” locomotor output was evoked using dorsal-root stimulation, ouabain increased burst frequency and extended locomotor episode duration, whereas monensin slowed and shortened episodes. Decreasing the time between dorsal-root stimulation, and therefore interepisode interval, also shortened and slowed activity, suggesting that pump activity encodes information about past network output and contributes to feedforward control of subsequent locomotor bouts. Using whole-cell patch-clamp recordings from spinal motoneurons and interneurons, we describe a long-duration (ϳ60 s), activity-dependent, TTX- and ouabain-sensitive, hyperpolarization (ϳ5 mV), which is mediated by spike-dependent increases in pump activity. The duration of this dynamic pump potential is enhanced by dopamine.
  • Gelişimsel Çocuk Nörolojisi 2017

    Gelişimsel Çocuk Nörolojisi 2017

    Baskı Mart, 2017 Bu yayının telif hakları Düzen Laboratuvarlar Grubu’na aittir. Bu yayının tümü ya da bir bölümü Düzen Laboratuvarlar Grubu’nun yazılı izni olmadan kopya edilemez. Bu yayın Düzen Laboratuvarlar Grubu tarafından tanıtım ve bilgilendirme amacıyla hazırlanmış olup hazırlanma ve basım esnasında metin ya da grafiklerde oluşabilecek her türlü hata ve eksikliklerden Düzen Laboratuvarlar Grubu sorumlu tutulamaz. Kaynak göstermek ve Düzen Laboratuvarlar Grubu’ndan yazılı izin almak suretiyle bu yayında alıntı yapılabilir. Düzen Laboratuvarlar Grubu Tunus Cad. No. 95 Kavaklıdere Çankaya 06680 Ankara www.duzen.com.tr VİZYONUMUZ Hasta haklarına saygılı, bilgilendirmeyi esas alan, testleri en doğru, izlenebilir ve tekrarlanabilir yöntemlerle çalışmak ve en az hatayı esas kabul edip, iç ve dış kalite kontrolleri ile bu kavramın gerçekleştiğini göstermektedir. MİSYONUMUZ Test sonuçları üzerinde laboratuvarmızın sorumluluğu, testin klinik laboratuvarcılık standartları ve iyi laboratuvar uygulamaları sınırları içinde, tüm kontoller yapılarak çalışılması ile sınırlıdır. Test sonuçları klinik bulgular ve diğer tüm yardımcı veriler dikkate alınarak değerlendirilmektedir. AKREDİTASYON Laboratuvarımız 2004 yılında Türk Akreditasyon Kurumu (TÜRKAK) tarafından TS EN IS IEC 17025 kapsamında akredite edilmiş, 2011 yılından itibaren ise ISO15189 kapsamında akreditasyona hak kazanmıştır. Hasta kayıt, numune alma, raporlama, kurumsal hizmetler ve tüm işletim sistemi akreditasyon kapsamındadır. GÜVENİRLİLİK Laboratuvarımız CLSI programlarına üyedir
  • P-Glycoprotein-Mediated Chemoresistance Is Reversed by Carbonic Anhydrase XII Inhibitors

    P-Glycoprotein-Mediated Chemoresistance Is Reversed by Carbonic Anhydrase XII Inhibitors

    www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2016 P-glycoprotein-mediated chemoresistance is reversed by carbonic anhydrase XII inhibitors Joanna Kopecka1, Gregory M. Rankin2, Iris C. Salaroglio1, Sally-Ann Poulsen2,*, Chiara Riganti1,* 1Department of Oncology, University of Torino, 10126 Torino, Italy 2Eskitis Institute for Drug Discovery, Griffith University, Brisbane, Nathan, Queensland, 4111, Australia *These authors contributed equally to this work Correspondence to: Sally-Ann Poulsen, email: [email protected] Chiara Riganti, email: [email protected] Keywords: carbonic anhydrase XII, P-glycoprotein, doxorubicin, chemoresistance, intracellular pH Received: August 26, 2016 Accepted: October 28, 2016 Published: November 03, 2016 ABSTRACT Carbonic anhydrase XII (CAXII) is a membrane enzyme that maintains pH homeostasis and sustains optimum P-glycoprotein (Pgp) efflux activity in cancer cells. Here, we investigated a panel of eight CAXII inhibitors (compounds 1–8), for their potential to reverse Pgp mediated tumor cell chemoresistance. Inhibitors (5 nM) were screened in human and murine cancer cells (colon, lung, breast, bone) with different expression levels of CAXII and Pgp. We identified three CAXII inhibitors (compounds 1, 2 and 4) that significantly (≥ 2 fold) increased the intracellular retention of the Pgp-substrate and chemotherapeutic doxorubicin, and restored its cytotoxic activity. The inhibitors lowered intracellular pH to indirectly impair Pgp activity. Ca12-knockout assays confirmed that the chemosensitizing property of the compounds was dependent on active CAXII. Furthermore, in a preclinical model of drug-resistant breast tumors compound 1 (1900 ng/kg) restored the efficacy of doxorubicin to the same extent as the direct Pgp inhibitor tariquidar. The expression of carbonic anhydrase IX had no effect on the intracellular doxorubicin accumulation.
  • Prox1regulates the Subtype-Specific Development of Caudal Ganglionic

    Prox1regulates the Subtype-Specific Development of Caudal Ganglionic

    The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP).
  • Coupling of Autism Genes to Tissue-Wide Expression and Dysfunction of Synapse, Calcium Signalling and Transcriptional Regulation

    Coupling of Autism Genes to Tissue-Wide Expression and Dysfunction of Synapse, Calcium Signalling and Transcriptional Regulation

    PLOS ONE RESEARCH ARTICLE Coupling of autism genes to tissue-wide expression and dysfunction of synapse, calcium signalling and transcriptional regulation 1 2,3 4 1,5 Jamie ReillyID *, Louise Gallagher , Geraldine Leader , Sanbing Shen * 1 Regenerative Medicine Institute, School of Medicine, Biomedical Science Building, National University of a1111111111 Ireland (NUI) Galway, Galway, Ireland, 2 Discipline of Psychiatry, School of Medicine, Trinity College Dublin, Dublin, Ireland, 3 Trinity Translational Medicine Institute, Trinity Centre for Health SciencesÐTrinity College a1111111111 Dublin, St. James's Hospital, Dublin, Ireland, 4 Irish Centre for Autism and Neurodevelopmental Research a1111111111 (ICAN), Department of Psychology, National University of Ireland (NUI) Galway, Galway, Ireland, a1111111111 5 FutureNeuro Research Centre, Royal College of Surgeons in Ireland (RCSI), Dublin, Ireland a1111111111 * [email protected] (JR); [email protected] (SS) Abstract OPEN ACCESS Citation: Reilly J, Gallagher L, Leader G, Shen S Autism Spectrum Disorder (ASD) is a heterogeneous disorder that is often accompanied (2020) Coupling of autism genes to tissue-wide with many co-morbidities. Recent genetic studies have identified various pathways from expression and dysfunction of synapse, calcium hundreds of candidate risk genes with varying levels of association to ASD. However, it is signalling and transcriptional regulation. PLoS ONE unknown which pathways are specific to the core symptoms or which are shared by the co- 15(12): e0242773. https://doi.org/10.1371/journal. pone.0242773 morbidities. We hypothesised that critical ASD candidates should appear widely across dif- ferent scoring systems, and that comorbidity pathways should be constituted by genes Editor: Nirakar Sahoo, The University of Texas Rio Grande Valley, UNITED STATES expressed in the relevant tissues.
  • 1 Silencing Branched-Chain Ketoacid Dehydrogenase Or

    1 Silencing Branched-Chain Ketoacid Dehydrogenase Or

    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Silencing branched-chain ketoacid dehydrogenase or treatment with branched-chain ketoacids ex vivo inhibits muscle insulin signaling Running title: BCKAs impair insulin signaling Dipsikha Biswas1, PhD, Khoi T. Dao1, BSc, Angella Mercer1, BSc, Andrew Cowie1 , BSc, Luke Duffley1, BSc, Yassine El Hiani2, PhD, Petra C. Kienesberger1, PhD, Thomas Pulinilkunnil1†, PhD 1Department of Biochemistry and Molecular Biology, Dalhousie Medicine New Brunswick, Saint John, New Brunswick, Canada, 2Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada. †Correspondence to Thomas Pulinilkunnil, PhD Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dalhousie University Dalhousie Medicine New Brunswick, 100 Tucker Park Road, Saint John E2L4L5, New Brunswick, Canada. Telephone: (506) 636-6973; Fax: (506) 636-6001; email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International
  • Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
  • Conservation and Divergence of ADAM Family Proteins in the Xenopus Genome

    Conservation and Divergence of ADAM Family Proteins in the Xenopus Genome

    Wei et al. BMC Evolutionary Biology 2010, 10:211 http://www.biomedcentral.com/1471-2148/10/211 RESEARCH ARTICLE Open Access ConservationResearch article and divergence of ADAM family proteins in the Xenopus genome Shuo Wei*1, Charles A Whittaker2, Guofeng Xu1, Lance C Bridges1,3, Anoop Shah1, Judith M White1 and Douglas W DeSimone1 Abstract Background: Members of the disintegrin metalloproteinase (ADAM) family play important roles in cellular and developmental processes through their functions as proteases and/or binding partners for other proteins. The amphibian Xenopus has long been used as a model for early vertebrate development, but genome-wide analyses for large gene families were not possible until the recent completion of the X. tropicalis genome sequence and the availability of large scale expression sequence tag (EST) databases. In this study we carried out a systematic analysis of the X. tropicalis genome and uncovered several interesting features of ADAM genes in this species. Results: Based on the X. tropicalis genome sequence and EST databases, we identified Xenopus orthologues of mammalian ADAMs and obtained full-length cDNA clones for these genes. The deduced protein sequences, synteny and exon-intron boundaries are conserved between most human and X. tropicalis orthologues. The alternative splicing patterns of certain Xenopus ADAM genes, such as adams 22 and 28, are similar to those of their mammalian orthologues. However, we were unable to identify an orthologue for ADAM7 or 8. The Xenopus orthologue of ADAM15, an active metalloproteinase in mammals, does not contain the conserved zinc-binding motif and is hence considered proteolytically inactive. We also found evidence for gain of ADAM genes in Xenopus as compared to other species.
  • IHC Test Menu

    IHC Test Menu

    Immunohistochemistry Test Menu A Alpha fetoprotein [I AFP] CD99 Ewings sarcoma PNET [I CD99] Anaplastic lymphoma kinase -1 [I ALK] CD103 Integrin alpha E [I CD103] Androgen receptor [I ANDRO]* CD117 C-Kit, myeloid, mast cells, GIST [I CD117] Annexin A1, hairy cell, B cell lymphoma [I ANXA1] CD138 plasma cells, subset epithelial cells [I CD138] Anti-Arginase-1 [I ARGINASE] CD163 histiocytes [I CD163] CDK4 cyclin-depdendent kinase-4, clone DCS-31 [I CDK4] B CDX2 colorectal carcinoma [I CDX2] BCL2 follicular lymphoma, apoptosis inhibiting protein [I BCL2] Chromogranin A [I CHROGRAN] BCL6 follicle center B-cell [I BCL6] CMYC C-MYC oncoprotein [I CMYC] BER EP4 Epithelial antigen [I BER EP4] Collagen IV, basement membrane protein [I CLLGIV] BRAF [I V600E] Cyclin D1/PRAD1 mantle cell lymphoma [I CYCLIN] Cytokeratin 5/6, squamous, mesothelial [I CK5/6] C Cytokeratin 7, 54kD [I CK7] CA 19-9 pancreas, liver, ovary, lung tumors [I CA19 9] Cytokeratin 7/8 CAM5.2 [I CAM 5.2] CA 125 epitheliod malignancies ovary, breast [I CA125] Cytokeratin 8, 35BH11 [I CK8] Calcitonin [I CALCT] Cytokeratin 8/18, adenocarcinoma [I CK8/18] Caldesmon, smooth muscle [I CALDSM] Cytokeratin 19 [I CK19] Calretinin; Calcium binding protein [I CALRT] Cytokeratin 20 [I CK20] CAM 5.2 Cytokeratin 7/Cytokeratin 8 [I CAM 5.2] Cytokeratin cocktail, PAN (AE1/AE3) [I AE1/AE3] Carcinoembryonic antigen (CEA) [I CEA] Cytokeratin high molecular weight; 34BE12 [I CK HMW] Cathepsin D, breast carcinoma [I CATHD] Cytomegalovirus [I CMV] CD1a cortical thymocyctes, Langerhans cells [I CD1a]