Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Total Page：16
File Type：pdf, Size：1020Kb
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. Yurchenco, Piscataway, NJ, USA). The BsiWI-MluI fragment containing the LMα1 cDNA was gel purified and subcloned into the BsiWI-MluI sites of the pBS-villin-promoter-MES-SV40- polyA vector giving rise to plasmid pBS-villin-LMα1. Generation of vLMα1 transgenic mice and of the vLMα1/APC+/1638 mice From the pBS vLMα1 plasmid a SalI fragment containing the 9 kb villin promoter region followed by the mouse LMα1 cDNA and the SV40 polyA was obtained, purified and used for injection into pronuclei of fertilized oocytes (F1 hybrid C57Bl/6 x DBA/2, transgenic facility of the IGBMC, Strasbourg, France). Germline transmission was determined by PCR analysis of tail DNA, using the villin1 primer present in the villin promoter (5’ATAGGAAGCCAGTTTCCCTTC3’) and the LM17 primer present in the 5’ region of the LMα1 cDNA (5’TGACCCAGAGCACCGAGGCCA3’) generating a fragment of 152 bp. For confirmation a second PCR was done obtaining a 166 bp product with primer LM116 present in the 3’ region of the Lama1 cDNA (5’GCCTCATTCCGGGGCTGTGTG3’) and primer SV40 3’ (5’AATGTGGTATGGCTGATTATG3’) encompassing the SV40 polyA sequence. Two out of 68 villin-LMα1 (vLMα1) founders showed stable integration and expression, and were further used in parallel for all experiments. Heterozygous vLMα1 mice were kept in a CD1 background (Charles River, L'Arbresle Cedex, France). In certain cases, vLMα1 mice were crossed with APC+/1638N mice (1). Double transgenic mice were kept on a CD1 background. Generation of LMα1 knock-down cells HEK293T cells (ATCC CRL-3216; cultured in DMEM, 10% FCS, 1% penicillin-streptomycin) were transfected with pGFP-C-sh LAMA1 Lentivector (TL311806D: 5’- GAGATGTGCAGATGGTTACTATGGAAACC-3’) or pGFP-C-sh control Lentivector (TR30021) containing non-effective 29-mer scrambled shRNA cassette (OriGene, 2 Cliniscience, Nanterre, France) together with pLP1, pLP2 and pLP/VSVG lentiviral packaging plasmids (Invitrogen, Life Technologies, Saint Aubin, France) to obtain lentiviral particles. After 48 hours, conditioned media from HEK293T were collected, filtered through a 0.22 µm filter to remove cell debris, and used to transduce HCT116 cells (ATTC CCL-247) cultured in DMEM supplemented with 10% fetal calf serum and 1% penicillin-streptomycin (Gibco, USA) in the presence of 5µg/mL polybrene (Sigma Aldrich, Lyon, France), followed by selection with puromycin (1.6 µg/mL, Sigma Aldrich, Lyon, France). Expression of LM1 mRNAs and protein was determined by qRT-PCR and ELISA. Surface Plasmon Resonance Surface Plasmon Resonance-Binding experiments were performed on a Biacore 2000 instrument (Biacore Inc., GE Healthcare, Velizy-Villacoublay, France) at 25 °C. VEGFA165 (R&D systems, Minneapolis, USA) or VEGFA121 (Prospecbio, East Brunswick, USA) was immobilized (10µl/ml) at high surface density (5.000 response units) on an activated CM5 chip using standard amine-coupling procedures, as described by the manufacturer. LM-111 was injected at a concentration of 10 μg/mL in 10 mM sodium acetate, pH 5.0, and at a flow rate of 5 μL/min during 20 min. Free groups were blocked by injecting 1M ethanolamine. To perform binding assays, LM-111 at different concentrations (from 5 to 20µg in 200µL) was injected in 10 mM MES, pH 6.0, 150 mM NaCl, with 0.005% (v/v) Tween 20, at a flow rate of 10 μL/min. Blank surfaces were used for background corrections. Injections of 10 mM glycine, pH 2.0, at 100 μL/min for 1 min were used to regenerate surfaces between two binding experiments. Steady state analysis was used to estimate the affinity of VEGF165 to LM-111. Dissociation constants (Kd) were estimated using 1:1 Langmuir association model as described by the manufacturer. Gene expression analysis RNA was extracted using the Tri Reagent according to manufacturer’s instructions (Molecular Research Center Inc., Euromedex, Souffelweyersheim, France). RNA-Seq 3 experiments were performed at the IGBMC Affymetrix Core Facility (Illkirch, France). Library of template molecules suitable for high throughput DNA sequencing was created following the Illumina “Truseq RNA sample preparation low throughput” protocol with some modifications. Briefly, mRNA was purified from 2 µg total RNA using oligo-dT magnetic beads and fragmented using divalent cations at 94°C for 8 minutes. The cleaved mRNA fragments were reverse transcribed into cDNA using random primers, then the second strand of the cDNA was synthesized using Polymerase I and RNase H. The next steps of RNA-Seq Library preparation were performed in a fully automated system using SPRIworks Fragment Library System I kit (Beckman Coulter, Fullerton, USA) with the SPRI-TE instrument (Beckman Coulter). Briefly, in this system double stranded cDNA fragments were blunted, phosphorylated and ligated to indexed adapter dimers, and fragments in the range of ~200- 400 bp were size selected. The automated steps were followed by PCR amplification (30 sec at 98°C; [10 sec at 98°C, 30 sec at 60°C, 30 sec at 72°C] x 12 cycles; 5 min at 72°C), then surplus PCR primers were removed by purification using AMPure XP beads (Agencourt Biosciences Corporation, Beverly, USA). DNA libraries were checked for quality and quantified using 2100 Bioanalyzer (Agilent, Les Ulis, France). The libraries were loaded in the flow cell at 8pM concentration and clusters generated and sequenced in the Illumina Genome Analyzer IIX as single-end 72 base reads. The separation of RNA sequencing reads derived from the human tumor cells and the host murine cells was performed in silico using the Xenome software (2) that is designed to discriminate species specific sequences in a xenograft environment. Each Fastq file was separated into mouse specific and human specific sequencing reads. These were subsequently aligned using Tophat2 (3) and processed using the Cufflinks (4) pipeline to generate the final expression files. Three independent subcutaneous tumors generated from control or HT29LMα1 cells were sequenced. Raw data can be found using the GEO accession number GSE84296. Changes in gene expression in dependence of LMα1 are shown as Log2 fold-change (Fc) values. We chose a cutoff with a p-value <0.05, a Log2 difference of +/-0.5 for genes of stromal cells and a cutoff with a p-value <0.01, a Log2 difference of +/-1 for genes of cancer cells. 4 Microarray experiments were performed at the IGBMC Affymetrix Core Facility (Illkirch, France). Biotinylated single strand cDNA targets were prepared by using 250 ng of total RNA and the Ambion WT Expression Kit (Ambion, Fisher Scientific, Illkirch-Graffenstaden, France) or the Affymetrix GeneChip WT Terminal Labeling Kit (Affymetrix, Santa Clara, USA) according to manufacturer`s recommendations. Following fragmentation and end-labelling, 2.07 μg of cDNAs were hybridized for 16 hours at 45oC on GeneChip Human Gene 1.0 ST arrays (Affymetrix) interrogating 28.869 genes represented by approximately 27 probes spread across the full length of the gene. The chips were washed and stained in the GeneChip® Fluidics Station 450 (Affymetrix) and scanned with the GeneChip Scanner 3000 7G (Affymetrix) at a resolution of 0,7 µm. Raw data (.CEL Intensity files) were extracted from the scanned images using the Affymetrix GeneChip Command Console (AGCC) version 3.1. CEL files were further processed with Affymetrix Expression Console software version 1. 1 to calculate probe set signal intensities using Robust Multi-array Average (RMA) algorithms with default settings. Three separate hybridizations were performed with independent samples from control or HT29LMα1 cells. Raw data can be found using the GEO accession number GSE83747. Changes in gene expression in dependence of LMα1 are shown as Log2 fold-change (Fc) values. We chose a cutoff with a p-value <0.01, a Log2 difference of +/-1 for genes of cancer cells. Gene list analysis was done by using the gene ontology online Amigo tool (http://amigo.geneontology.org/amigo) and the Panther tool (http://pantherdb.org/webservices/go/overrep.jsp) with default parameters. For qRT-PCR, RNA was treated with DNase I and reverse transcribed using the High Capacity cDNA RT Kit.