DOCSLIB.ORG

Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen, DRB1-15 beta chain OS=Homo sapiens GN=HLA-DRB1 PE=1 SV=2 - [2B1F_HUMAN] 92,48 11 2 19 79 266 29,94700135 7,737792969 12 P37802 Transgelin-2 OS=Homo sapiens GN=TAGLN2 PE=1 SV=3 - [TAGL2_HUMAN] 92,46 1 9 20 234 199 22,37717408 8,250488281 13 Q9UNM6 26S proteasome non-ATPase regulatory subunit 13 OS=Homo sapiens GN=PSMD13 PE=1 SV=2 - [PSD13_HUMAN] 92,29 2 6 25 61 376 42,91814899 5,808105469 14 P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] 91,45 2 1 16 122 152 17,13767207 6,188964844 15 P28062 Proteasome subunit beta type-8 OS=Homo sapiens GN=PSMB8 PE=1 SV=3 - [PSB8_HUMAN] 91,3 2 1 18 82 276 30,3345719 7,430175781 16 Q9BV86-2 Isoform 2 of N-terminal Xaa-Pro-Lys N-methyltransferase 1 OS=Homo sapiens GN=NTMT1 - [NTM1A_HUMAN] 91,03 2 1 12 27 145 15,8860594 9,129394531 17 P09936 Ubiquitin carboxyl-terminal hydrolase isozyme L1 OS=Homo sapiens GN=UCHL1 PE=1 SV=2 - [UCHL1_HUMAN] 91,03 1 9 20 145 223 24,80845905 5,478027344 18 P84085 ADP-ribosylation factor 5 OS=Homo sapiens GN=ARF5 PE=1 SV=2 - [ARF5_HUMAN] 90,56 2 3 16 155 180 20,5165808 6,785644531 19 P63220 40S ribosomal protein S21 OS=Homo sapiens GN=RPS21 PE=1 SV=1 - [RS21_HUMAN] 90,36 1 1 6 21 83 9,105568955 8,499511719 20 P18085 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3 - [ARF4_HUMAN] 90 1 3 16 189 180 20,49769405 7,137207031 21 P80723 Brain acid soluble protein 1 OS=Homo sapiens GN=BASP1 PE=1 SV=2 - [BASP1_HUMAN] 89,87 2 18 18 521 227 22,68001306 4,627441406 22 A6NHG4 D-dopachrome decarboxylase-like protein OS=Homo sapiens GN=DDTL PE=2 SV=1 - [DDTL_HUMAN] 89,55 2 1 8 21 134 14,18626797 6,290527344 23 P26447 Protein S100-A4 OS=Homo sapiens GN=S100A4 PE=1 SV=1 - [S10A4_HUMAN] 89,11 1 1 10 24 101 11,72073264 6,112792969 24 P62937 Peptidyl-prolyl cis-trans isomerase A OS=Homo sapiens GN=PPIA PE=1 SV=2 - [PPIA_HUMAN] 89,09 4 5 16 240 165 18,00088618 7,811035156 25 P49773 Histidine triad nucleotide-binding protein 1 OS=Homo sapiens GN=HINT1 PE=1 SV=2 - [HINT1_HUMAN] 88,89 1 4 10 35 126 13,79309454 6,946777344 26 P62328 Thymosin beta-4 OS=Homo sapiens GN=TMSB4X PE=1 SV=2 - [TYB4_HUMAN] 88,64 2 3 6 62 44 5,049516495 5,059082031 27 P07954 Fumarate hydratase, mitochondrial OS=Homo sapiens GN=FH PE=1 SV=3 - [FUMH_HUMAN] 88,63 2 1 30 60 510 54,60217128 8,763183594 28 P31949 Protein S100-A11 OS=Homo sapiens GN=S100A11 PE=1 SV=2 - [S10AB_HUMAN] 88,57 1 4 8 116 105 11,73282564 7,122558594 29 Q6UXS9 Inactive caspase-12 OS=Homo sapiens GN=CASP12 PE=2 SV=2 - [CASPC_HUMAN] 88,56 2 1 20 93 341 38,84028053 6,023925781 30 Q15286 Ras-related protein Rab-35 OS=Homo sapiens GN=RAB35 PE=1 SV=1 - [RAB35_HUMAN] 88,56 20 7 19 201 201 23,01076773 8,294433594 31 Q6EEV6 Small ubiquitin-related modifier 4 OS=Homo sapiens GN=SUMO4 PE=1 SV=2 - [SUMO4_HUMAN] 88,42 4 1 7 19 95 10,67836131 7,181152344 32 Q9H0U4 Ras-related protein Rab-1B OS=Homo sapiens GN=RAB1B PE=1 SV=1 - [RAB1B_HUMAN] 88,06 20 1 17 234 201 22,15722983 5,731933594 33 P54709 Sodium/potassium-transporting ATPase subunit beta-3 OS=Homo sapiens GN=ATP1B3 PE=1 SV=1 - [AT1B3_HUMAN] 87,81 1 7 20 198 279 31,49209563 8,353027344 34 P31939 Bifunctional purine biosynthesis protein PURH OS=Homo sapiens GN=ATIC PE=1 SV=3 - [PUR9_HUMAN] 87,5 1 13 48 190 592 64,57534505 6,712402344 35 O75083 WD repeat-containing protein 1 OS=Homo sapiens GN=WDR1 PE=1 SV=4 - [WDR1_HUMAN] 87,46 2 15 43 236 606 66,15187224 6,653808594 36 P07355-2 Isoform 2 of Annexin A2 OS=Homo sapiens GN=ANXA2 - [ANXA2_HUMAN] 87,39 3 25 37 1006 357 40,38571944 8,367675781 37 Q9HCJ6 Synaptic vesicle membrane protein VAT-1 homolog-like OS=Homo sapiens GN=VAT1L PE=1 SV=2 - [VAT1L_HUMAN] 87,35 1 2 30 87 419 45,87014303 5,059082031 38 P63027 Vesicle-associated membrane protein 2 OS=Homo sapiens GN=VAMP2 PE=1 SV=3 - [VAMP2_HUMAN] 87,07 2 2 7 50 116 12,65468926 8,133300781 39 P22392-2 Isoform 3 of Nucleoside diphosphate kinase B OS=Homo sapiens GN=NME2 - [NDKB_HUMAN] 86,89 3 4 21 196 267 30,11763447 8,924316406 40 Q9H3Z4 DnaJ homolog subfamily C member 5 OS=Homo sapiens GN=DNAJC5 PE=1 SV=1 - [DNJC5_HUMAN] 86,87 2 2 8 38 198 22,134332 5,071777344 41 P12814-4 Isoform 4 of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 - [ACTN1_HUMAN] 86,77 6 13 77 477 930 107,0737084 5,579589844 42 P62258 14-3-3 protein epsilon OS=Homo sapiens GN=YWHAE PE=1 SV=1 - [1433E_HUMAN] 86,67 2 9 26 341 255 29,15541736 4,741699219 43 P52434 DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Homo sapiens GN=POLR2H PE=1 SV=4 - [RPAB3_HUMAN] 86,67 1 1 11 19 150 17,13244875 4,678222656 44 P06733 Alpha-enolase OS=Homo sapiens GN=ENO1 PE=1 SV=2 - [ENOA_HUMAN] 86,41 2 20 42 740 434 47,13932161 7,386230469 45 Q8N6I4-3 Isoform 3 of Transmembrane protein 251 OS=Homo sapiens GN=TMEM251 - [TM251_HUMAN] 86,39 3 1 7 34 169 19,41290035 7,840332031 46 P00441 Superoxide dismutase [Cu-Zn] OS=Homo sapiens GN=SOD1 PE=1 SV=2 - [SODC_HUMAN] 86,36 1 3 11 39 154 15,92590463 6,125488281 47 P50990 T-complex protein 1 subunit theta OS=Homo sapiens GN=CCT8 PE=1 SV=4 - [TCPQ_HUMAN] 86,31 1 15 45 276 548 59,58250903 5,604980469 48 Q99983 Osteomodulin OS=Homo sapiens GN=OMD PE=1 SV=1 - [OMD_HUMAN] 86,22 1 1 23 55 421 49,46022472 5,592285156 49 Q580R0 Uncharacterized protein C2orf27 OS=Homo sapiens GN=C2orf27A PE=2 SV=1 - [CB027_HUMAN] 86,21 2 1 8 25 203 21,50356241 5,160644531 50 P50395 Rab GDP dissociation inhibitor beta OS=Homo sapiens GN=GDI2 PE=1 SV=2 - [GDIB_HUMAN] 86,07 2 11 35 284 445 50,6308798 6,468261719 51 P04899 Guanine nucleotide-binding protein G(i) subunit alpha-2 OS=Homo sapiens GN=GNAI2 PE=1 SV=3 - [GNAI2_HUMAN] 85,92 7 11 27 618 355 40,42505614 5,541503906 52 P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] 85,91 1 4 10 168 149 16,8268352 4,221191406 53 P00558 Phosphoglycerate kinase 1 OS=Homo sapiens GN=PGK1 PE=1 SV=3 - [PGK1_HUMAN] 85,85 2 16 36 396 417 44,58612916 8,104003906 54 Q8NC24 RELT-like protein 2 OS=Homo sapiens GN=RELL2 PE=1 SV=1 - [RELL2_HUMAN] 85,81 1 1 13 65 303 32,38496752 6,902832031 55 O00442 RNA 3'-terminal phosphate cyclase OS=Homo sapiens GN=RTCA PE=1 SV=1 - [RTCA_HUMAN] 85,79 2 1 25 117 366 39,311406 7,854980469 56 P54920 Alpha-soluble NSF attachment protein OS=Homo sapiens GN=NAPA PE=1 SV=3 - [SNAA_HUMAN] 85,76 2 7 26 133 295 33,21128096 5,363769531 57 P04080 Cystatin-B OS=Homo sapiens GN=CSTB PE=1 SV=2 - [CYTB_HUMAN] 85,71 1 3 7 62 98 11,13259138 7,562011719 58 P07737 Profilin-1 OS=Homo sapiens GN=PFN1 PE=1 SV=2 - [PROF1_HUMAN] 85,71 1 6 12 147 140 15,04455675 8,265136719 59 P14678-2 Isoform SM-B of Small nuclear ribonucleoprotein-associated proteins B and B' OS=Homo sapiens GN=SNRPB - [RSMB_HUMAN] 85,71 4 1 21 96 231 23,64022285 10,90185547 60 Q71UM5 40S ribosomal protein S27-like OS=Homo sapiens GN=RPS27L PE=1 SV=3 - [RS27L_HUMAN] 85,71 2 1 5 6 84 9,470867485 9,451660156 61 Q96FQ6 Protein S100-A16 OS=Homo sapiens GN=S100A16 PE=1 SV=1 - [S10AG_HUMAN] 85,44 1 3 10 74 103 11,79396933 6,785644531 62 P07237 Protein disulfide-isomerase OS=Homo sapiens GN=P4HB PE=1 SV=3 - [PDIA1_HUMAN] 85,43 1 20 45 344 508 57,08067601 4,868652344 63 Q00610-2 Isoform 2 of Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC - [CLH1_HUMAN] 85,42 4 52 116 928 1639 187,770795 5,693847656 64 P08670 Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 - [VIME_HUMAN] 85,41 27 28 48 790 466 53,61908105 5,122558594 65 P61224 Ras-related protein Rap-1b OS=Homo sapiens GN=RAP1B PE=1 SV=1 - [RAP1B_HUMAN] 85,33 5 1 17 313 184 20,8115937 5,782714844 66 Q9NXU5 ADP-ribosylation factor-like protein 15 OS=Homo sapiens GN=ARL15 PE=1 SV=1 - [ARL15_HUMAN] 85,29 1 1 11 15 204 22,86150952 5,630371094 67 P01111 GTPase NRas OS=Homo sapiens GN=NRAS PE=1 SV=1 - [RASN_HUMAN] 85,19 1 2 16 123 189 21,21551551 5,173339844 68 Q9XRX5-2 Isoform 2 of HERV-H LTR-associating protein 3 OS=Homo sapiens GN=HHLA3 - [HHLA3_HUMAN] 85,12 1 1 9 47 121 13,50188164 9,378417969 69 P28838 Cytosol aminopeptidase OS=Homo sapiens GN=LAP3 PE=1 SV=3 - [AMPL_HUMAN] 84,97 2 2 41 103 519 56,13081415 7,928222656 70 P31942 Heterogeneous nuclear ribonucleoprotein H3 OS=Homo sapiens GN=HNRNPH3
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Iron Depletion Reduces Abce1 Transcripts While Inducing The
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 22 October 2019 doi:10.20944/preprints201910.0252.v1 1 Research Article 2 Iron depletion Reduces Abce1 Transcripts While 3 Inducing the Mitophagy Factors Pink1 and Parkin 4 Jana Key 1,2, Nesli Ece Sen 1, Aleksandar Arsovic 1, Stella Krämer 1, Robert Hülse 1, Suzana 5 Gispert-Sanchez 1 and Georg Auburger 1,* 6 1 Experimental Neurology, Goethe University Medical School, 60590 Frankfurt am Main; 7 2 Faculty of Biosciences, Goethe-University Frankfurt am Main, Germany 8 * Correspondence: [email protected] 9 10 Abstract: Lifespan extension was recently achieved in Caenorhabditis elegans nematodes by 11 mitochondrial stress and mitophagy, triggered via iron depletion. Conversely in man, deficient 12 mitophagy due to Pink1/Parkin mutations triggers iron accumulation in patient brain and limits 13 survival. We now aimed to identify murine fibroblast factors, which adapt their mRNA expression 14 to acute iron manipulation, relate to mitochondrial dysfunction and may influence survival. After 15 iron depletion, expression of the plasma membrane receptor Tfrc with its activator Ireb2, the 16 mitochondrial membrane transporter Abcb10, the heme-release factor Pgrmc1, the heme- 17 degradation enzyme Hmox1, the heme-binding cholesterol metabolizer Cyp46a1, as well as the 18 mitophagy regulators Pink1 and Parkin showed a negative correlation to iron levels. After iron 19 overload, these factors did not change expression. Conversely, a positive correlation of mRNA levels 20 with both conditions of iron availability was observed for the endosomal factors Slc11a2 and Steap2, 21 as well as for the iron-sulfur-cluster (ISC)-containing factors Ppat, Bdh2 and Nthl1.
    [Show full text]
  • The Regulation of Carbamoyl Phosphate Synthetase-Aspartate Transcarbamoylase-Dihydroorotase (Cad) by Phosphorylation and Protein-Protein Interactions
    THE REGULATION OF CARBAMOYL PHOSPHATE SYNTHETASE-ASPARTATE TRANSCARBAMOYLASE-DIHYDROOROTASE (CAD) BY PHOSPHORYLATION AND PROTEIN-PROTEIN INTERACTIONS Eric M. Wauson A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Pharmacology. Chapel Hill 2007 Approved by: Lee M. Graves, Ph.D. T. Kendall Harden, Ph.D. Gary L. Johnson, Ph.D. Aziz Sancar M.D., Ph.D. Beverly S. Mitchell, M.D. 2007 Eric M. Wauson ALL RIGHTS RESERVED ii ABSTRACT Eric M. Wauson: The Regulation of Carbamoyl Phosphate Synthetase-Aspartate Transcarbamoylase-Dihydroorotase (CAD) by Phosphorylation and Protein-Protein Interactions (Under the direction of Lee M. Graves, Ph.D.) Pyrimidines have many important roles in cellular physiology, as they are used in the formation of DNA, RNA, phospholipids, and pyrimidine sugars. The first rate- limiting step in the de novo pyrimidine synthesis pathway is catalyzed by the carbamoyl phosphate synthetase II (CPSase II) part of the multienzymatic complex Carbamoyl phosphate synthetase, Aspartate transcarbamoylase, Dihydroorotase (CAD). CAD gene induction is highly correlated to cell proliferation. Additionally, CAD is allosterically inhibited or activated by uridine triphosphate (UTP) or phosphoribosyl pyrophosphate (PRPP), respectively. The phosphorylation of CAD by PKA and ERK has been reported to modulate the response of CAD to allosteric modulators. While there has been much speculation on the identity of CAD phosphorylation sites, no definitive identification of in vivo CAD phosphorylation sites has been performed. Therefore, we sought to determine the specific CAD residues phosphorylated by ERK and PKA in intact cells.
    [Show full text]
  • Proteomic Analysis of the Rad18 Interaction Network in DT40 – a Chicken B Cell Line
    Proteomic analysis of the Rad18 interaction network in DT40 – a chicken B cell line Thesis submitted for the degree of Doctor of Natural Sciences at the Faculty of Biology, Ludwig-Maximilians-University Munich 15th January, 2009 Submitted by Sushmita Gowri Sreekumar Chennai, India Completed at the Helmholtz Zentrum München German Research Center for Environmental Health Institute of Clinical Molecular Biology and Tumor Genetics, Munich Examiners: PD Dr. Berit Jungnickel Prof. Heinrich Leonhardt Prof. Friederike Eckardt-Schupp Prof. Harry MacWilliams Date of Examination: 16th June 2009 To my Parents, Sister, Brother & Rajesh Table of Contents 1. SUMMARY ........................................................................................................................ 1 2. INTRODUCTION ............................................................................................................. 2 2.1. MECHANISMS OF DNA REPAIR ......................................................................................... 3 2.2. ADAPTIVE GENETIC ALTERATIONS – AN ADVANTAGE ....................................................... 5 2.3. THE PRIMARY IG DIVERSIFICATION DURING EARLY B CELL DEVELOPMENT ...................... 6 2.4. THE SECONDARY IG DIVERSIFICATION PROCESSES IN THE GERMINAL CENTER .................. 7 2.4.1. Processing of AID induced DNA lesions during adaptive immunity .................. 9 2.5. TARGETING OF SOMATIC HYPERMUTATION TO THE IG LOCI ............................................ 10 2.6. ROLE OF THE RAD6 PATHWAY IN IG DIVERSIFICATION
    [Show full text]
  • Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid
    The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d.
    [Show full text]
  • 1 Silencing Branched-Chain Ketoacid Dehydrogenase Or
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Silencing branched-chain ketoacid dehydrogenase or treatment with branched-chain ketoacids ex vivo inhibits muscle insulin signaling Running title: BCKAs impair insulin signaling Dipsikha Biswas1, PhD, Khoi T. Dao1, BSc, Angella Mercer1, BSc, Andrew Cowie1 , BSc, Luke Duffley1, BSc, Yassine El Hiani2, PhD, Petra C. Kienesberger1, PhD, Thomas Pulinilkunnil1†, PhD 1Department of Biochemistry and Molecular Biology, Dalhousie Medicine New Brunswick, Saint John, New Brunswick, Canada, 2Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada. †Correspondence to Thomas Pulinilkunnil, PhD Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dalhousie University Dalhousie Medicine New Brunswick, 100 Tucker Park Road, Saint John E2L4L5, New Brunswick, Canada. Telephone: (506) 636-6973; Fax: (506) 636-6001; email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International
    [Show full text]
  • Structures and Functions of Mitochondrial ABC Transporters
    ATP-binding cassette transporters: from mechanism to organism 943 Structures and functions of mitochondrial ABC transporters Theresia A. Schaedler*, Belinda Faust†, Chitra A. Shintre†, Elisabeth P. Carpenter†, Vasundara Srinivasan‡, Hendrik W. van Veen§ and Janneke Balk1 *Department of Biological Chemistry and Crop Protection, Rothamsted Research, West Common, Harpenden, AL5 2JQ, U.K. †Structural Genomics Consortium, Nuffield Department of Clinical Medicine, University of Oxford, Oxford, OX3 7DQ, U.K. ‡LOEWE center for synthetic microbiology (SYNMIKRO) and Philipps University, D-35043 Marburg, Germany §Department of Pharmacology, University of Cambridge, Tennis Court Road, Cambridge, CB2 1PD, U.K. John Innes Centre and University of East Anglia, Colney Lane, Norwich, NR4 7UH, U.K. Abstract A small number of physiologically important ATP-binding cassette (ABC) transporters are found in mitochondria. Most are half transporters of the B group forming homodimers and their topology suggests they function as exporters. The results of mutant studies point towards involvement in iron cofactor biosynthesis. In particular, ABC subfamily B member 7 (ABCB7) and its homologues in yeast and plants are required for iron-sulfur (Fe-S) cluster biosynthesis outside of the mitochondria, whereas ABCB10 is involved in haem biosynthesis. They also play a role in preventing oxidative stress. Mutations in ABCB6 and ABCB7 have been linked to human disease. Recent crystal structures of yeast Atm1 and human ABCB10 have been key to identifying substrate-binding sites and transport mechanisms. Combined with in vitro and in vivo studies, progress is being made to find the physiological substrates of the different mitochondrial ABC transporters. Sequence analysis of mitochondrial ABC The ABCB7 group, which includes the ABC transporters transporters of the mitochondria Atm1 in yeast and ATM3 in Arabidopsis, Mitochondria of most eukaryote species harbour 2–4 can be found in virtually all eukaryotic species.
    [Show full text]