DOCSLIB.ORG

Abstracts from the 50Th European Society of Human Genetics Conference: Electronic Posters

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Abstracts from the 50Th European Society of Human Genetics Conference: Electronic Posters European Journal of Human Genetics (2019) 26:820–1023 https://doi.org/10.1038/s41431-018-0248-6 ABSTRACT Abstracts from the 50th European Society of Human Genetics Conference: Electronic Posters Copenhagen, Denmark, May 27–30, 2017 Published online: 1 October 2018 © European Society of Human Genetics 2018 The ESHG 2017 marks the 50th Anniversary of the first ESHG Conference which took place in Copenhagen in 1967. Additional information about the event may be found on the conference website: https://2017.eshg.org/ Sponsorship: Publication of this supplement is sponsored by the European Society of Human Genetics. All authors were asked to address any potential bias in their abstract and to declare any competing financial interests. These disclosures are listed at the end of each abstract. Contributions of up to EUR 10 000 (ten thousand euros, or equivalent value in kind) per year per company are considered "modest". Contributions above EUR 10 000 per year are considered "significant". 1234567890();,: 1234567890();,: E-P01 Reproductive Genetics/Prenatal and fetal echocardiography. The molecular karyotyping Genetics revealed a gain in 8p11.22-p23.1 region with a size of 27.2 Mb containing 122 OMIM gene and a loss in 8p23.1- E-P01.02 p23.3 region with a size of 6.8 Mb containing 15 OMIM Prenatal diagnosis in a case of 8p inverted gene. The findings were correlated with 8p inverted dupli- duplication deletion syndrome cation deletion syndrome. Conclusion: Our study empha- sizes the importance of using additional molecular O¨. Kırbıyık, K. M. Erdog˘an, O¨.O¨zer Kaya, B. O¨zyılmaz, cytogenetic methods in clinical follow-up of complex Y. B. Kutbay, T. R. O¨zdemir, A. Koc¸, M. Saka Gu¨venc¸ rearrangements in the prenatal cases. In unstable chromo- somal rearrangements, fetal USG scans are not sufficient to Training and Research Hospital Genetic Diognosis Center, detect fetal anomalies. However, molecular karyotyping is Izmir, Turkey gaining importance in order to evaluate unbalanced chro- mosomal anomalies, to predict fetal prognosis and to give Introduction: 8p inverted duplication deletion syndrome appropriate genetic counseling. is a rare chromosomal anomaly characterized by mild to severe intellectual deficit, severe developmental delay, Ö. Kırbıyık: None. K.M. Erdoğan: None. Ö. Özer hypotonia, agenesis of the corpus callosum and minor facial Kaya: None. B. Özyılmaz: None. Y.B. Kutbay: None. T. anomalies such as prominent forehead, temporal baldness, R. Özdemir: None. A. Koç: None. M. Saka Güvenç: anteverted nostrils and eversion of the lower lip. Materials None. and Method: A prenatal case was investigated due to high risk for Down syndrome in first trimester biochemichal E-P01.03 screening and advanced maternal age (36) by amniocentesis A Case of Fertile Man With Lack of AmelogeninY and fetal ultrasonography (USG). Results: Amniocentesis Locus was performed at 16th weeks of gestation. The result of the QF-PCR analysis for rapid aneuploidy screening was nor- M. N. Somuncu1, A. G. Zamani1, E. Goktas1,A.Acar2, mal, but add (8p) was determined by conventional kar- M. S. Yıldırım1 yotyping. The parental karyotypes had no chromosomal anomaly. In the subtelomeric FISH study of the fetal sam- 1Department of Medical Genetics, Meram Medical Faculty, ple, there was a subtelomeric deletion in the 8p region. Necmettin Erbakan University, KONYA, Turkey, KONYA, There was no fetal structural anomaly in level II fetal USG Turkey, 2Department of Gynecology, Meram Medical Abstracts from the 50th European Society of Human Genetics Conference:. 821 Faculty,Necmettin Erbakan University, KONYA, Turkey, invasive diagnosis. Chromosome analysis and QFPCR was KONYA, Turkey performed for all patients. Normal results were reported in 2711 cases by fetal karyotyping and in 2706 cases by Introduction: Amelogenin gene is responsable for QFPCR. Anomaly detection rates were similar for two amelogenesis and the development of enamel of tooth. The methods (5,09% for karyotyping and 4,02% for QFPCR). gene is located each of the sex chromosomes. AmelX is QFPCR as a fast and reliable prenatal diagnosis method in present on the Xp22.1-p22.3 and AmelY is present on the all indication groups and may be preferred as the sole Yp11.2, differ by a 6 bp deletion in the third intron of prenatal investigation in patients without fetal ultrasono- AmelX is not in AmelY. It is lead to be useful for gender graphic findings. identification detecting of amelogenin homologus. It’s fact O. Ozer kaya: None. A. Koc: None. T. Ozdemir: that Y chromosome abnormalities are primarily considired None. O. Kirbiyik: None. B. Ozyilmaz: None. M. Oze- for male infertility or subfertility. Meterials and Methods: ren: None. D. Can Oztekin: None. C.E. Taner: None. Y. Quantitative fluorescent polymerase chain reaction (qf pcr) B. Kutbay: None. K.M. Erdogan: None. M. Saka combination with conventional cytogenetic analysis has Guvenc: None. been used routinely in prenatal diagnosis. The technique, is based on the length variotions of short tandem repeat (str) in E-P01.05 chromosomes. Also, AmelX and AmelY sequences are Cell-free fetal DNA in amniotic fluid supernatant for these markers. In the case, fourteen weeks choryonic villus prenatal diagnosis samples (cvs) with indications of omphalocele and ana- ncefalia were refered to our clinic for prenatal diagnosis. m. soltani1, E. Sakhinia2 When detecting the lock of AmelY locus in cvs we analyzed the parents immediately for amel fragments. Results: 1Department of Genetics, Ahar Branch, Islamic Azad Uni- AmelX of the mother was normal level whether fetüs and versity, Ahar, Iran, Tabriz, Iran, Islamic Republic of, father have not any size of AmelY loci but had SRY sex- 2Division of Medical Genetics, Faculty of Medicine, Tabriz determining region Y marker. Conclusion: A few cases University of Medical Sciences, Tabriz, Iran, Tabriz, Iran, have been reported interstitial deletion of AmelY loci have Islamic Republic of oligozoospemic clinique associated with male infertility but we had described lack of AmelY locus both fetus and the Amniotic fluid is widely utilized for prenatal diagnosis. father. Interesting feature of the case that father had not Amniotic fluid supernatant however, is usually discarded dysmorphic features also is a fertile man. Genetic coun- and not deemed good source of fetal DNA.The aim of this seling was given to the family. study was to assess cell-free fetal DNA extracted from amniotic fluid supernatant for application in prenatal diag- M.N. Somuncu: None. A.G. Zamani: None. E. Gok- nosis such as gender determination and early diagnosis of β- tas: None. A. Acar: None. M.S. Yıldırım: None. thalassemia. Samples of amniotic fluid from 70 pregnant women were collected and put through routine tests along E-P01.04 with tests for cell-free fetal DNA from the amniotic fluid QFPCR in Invasive Prenatal Diagnosis: Single Center supernatant.The DNA in the amniotic fluid supernatant was Experience in Turkey extracted and analyzed for gender determination by PCR and Real-time PCR.ARMS-PCR was applied to test for the O. Ozer kaya, A. Koc, T. Ozdemir, O. Kirbiyik, B. early diagnosis of IVS II-I mutation (common β-thalassemia Ozyilmaz, M. Ozeren, D. Can Oztekin, C. E. Taner, Y. B. mutation) and E7V mutation for sickle cell anemia using Kutbay, K. M. Erdogan, M. Saka Guvenc DNA extracted from the amniotic fluid supernatant. Using the cell-free fetal DNA extracted from the amniotic fluid Tepecik Training and Research Hospital, Izmir, Turkey supernatant, the sensitivity of PCR and Real-time PCR for gender detection was compared with the routine cytogenetic QFPCR is being used for more than 20 years. It is based method.The fetus tested for sickle cell anemia and β-tha- on the investigation of polymorphic short tandem repeats lassemia was observed to be healthy but heterozygous for (STRs) and is preferred widely for prenatal rapid aneu- IVS II-I mutation. The findings indicated that cell-free fetal ploidy detection. In this study, we reported retrospectively DNA from amniotic fluid supernatant can be a good source our prenatal diagnosis results between January 2012 and of fetal DNA and be used in early prenatal diagnosis due to May 2014 in Tepecik Training and Research Hospital its fast and accurate application.Therefore, it would be Genetic Diagnostic Center. Prenatal diagnosis was offered suggested that the supernatant from the amniotic fluids’ to 6800 high risk pregnancies and 2883 cases accepted disposal is prevented because if the tests needs to be 822 repeated, cell-free fetal DNA extracted from the amniotic prophylactic gonadectomy, psychological support and fluid supernatant can be used as an alternative source for genetic counselling. prenatal diagnosis. Conclusions: DSD are rare however extremely sig- nificant conditions that may interfere with life quality, so all M. soltani: None. E. Sakhinia: None. efforts should be made in order to get the precise diagnosis as well as the best care possible. E-P01.06 A multidisciplinary approach in a two generation A.R. Soares: None. T. Borges: None. E. Fernandes: family presenting with a 46,XY disorder of sex None. N.O. Teles: None. A. Gonçalves: None. M.E. Oli- development veira: None. R. Santos: None. A.M. Fortuna: None. A. R. Soares1, T. Borges2, E. Fernandes3, N. O. Teles4,5, E-P01.07 A. Gonc¸alves6,5, M. E. Oliveira6,5, R. Santos6,5,A.M. A Novel Mutation Of Androgen Receptor Gene In A Fortuna1,5 Primary Amenorrhoea Patient 1Medical Genetics Department, Centro Genética Médica Dr. A. G. Zamanı1, M. N. Somuncu1, E. Goktas1,K. Jacinto Magalhães - CHPorto, Porto, Portugal, 2Paediatric Gezginc¸2, M. S. Yıldırım1 Endocrinology Unit, Centro Materno-Infantil do Norte - CHPorto, Porto, Portugal, 3Gynaecology Department, 1Department of Medical Genetics, Meram Medical Faculty, Centro Materno-Infantil do Norte - CHPorto, Porto, Portu- Necmettin Erbakan University, KONYA, Turkey, KONYA, gal, 4Cytogenetics Unit, Centro Genética Médica Dr.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • University of California, San Diego
    UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs of this journey. iv EPIGRAPH It is foolish to tear one's hair in grief, as though sorrow would be made less by baldness. ~Cicero v TABLE OF CONTENTS Signature Page .............................................................................................................. iii Dedication ....................................................................................................................
    [Show full text]
  • Oral Health in Prevalent Types of Ehlers–Danlos Syndromes
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Ghent University Academic Bibliography J Oral Pathol Med (2005) 34: 298–307 ª Blackwell Munksgaard 2005 Æ All rights reserved www.blackwellmunksgaard.com/jopm Oral health in prevalent types of Ehlers–Danlos syndromes Peter J. De Coster1, Luc C. Martens1, Anne De Paepe2 1Department of Paediatric Dentistry, Centre for Special Care, Paecamed Research, Ghent University, Ghent; 2Centre for Medical Genetics, Ghent University Hospital, Ghent, Belgium BACKGROUND: The Ehlers–Danlos syndromes (EDS) Introduction comprise a heterogenous group of heritable disorders of connective tissue, characterized by joint hypermobility, The Ehlers–Danlos syndromes (EDS) comprise a het- skin hyperextensibility and tissue fragility. Most EDS erogenous group of heritable disorders of connective types are caused by mutations in genes encoding different tissue, largely characterized by joint hypermobility, skin types of collagen or enzymes, essential for normal pro- hyperextensibility and tissue fragility (1) (Fig. 1). The cessing of collagen. clinical features, modes of inheritance and molecular METHODS: Oral health was assessed in 31 subjects with bases differ according to the type. EDS are caused by a EDS (16 with hypermobility EDS, nine with classical EDS genetic defect causing an error in the synthesis or and six with vascular EDS), including signs and symptoms processing of collagen types I, III or V. The distribution of temporomandibular disorders (TMD), alterations of and function of these collagen types are displayed in dental hard tissues, oral mucosa and periodontium, and Table 1. At present, two classifications of EDS are was compared with matched controls.
    [Show full text]
  • RARE CHROMOSOME DISORDERS the Term, ‘Rare Chromosome Disorders’, Refers to Conditions Which
    INFORMATION SHEET Page 1 COMPLEX LEARNING DIFFICULTIES AND DISABILITIES RESEARCH PROJECT (CLDD) RARE CHROMOSOME DISORDERS The term, ‘rare chromosome disorders’, refers to conditions which: 1. occur due to missing, duplicated or re-arranged chromosome material 2. have a low prevalence rate (thus not including chromosomal disorders such as Down syndrome). Chromosomes are structures found in the nuclei of cells in human bodies. Each chromosome contains thousands of genes which determine how we grow and develop. A typically developing person will have 23 pairs of chromosomes with one member of each pair being inherited from each parent, giving a total of 46 individual chromosomes. Two of these are the sex chromosomes which determine whether we are female (XX) or male (XY). The remaining 44 chromosomes are grouped in 22 pairs, numbered 1 to 22. The arms of a chromosome are called ‘p’ (shorter arm) and ‘q’ (long arm) (see Figure 1); these arms are separated into numerical regions, which in turn are divided into bands and sub-bands. p q Figure 1. Diagram of a chromosome Individually, rare chromosome disorders are extremely uncommon, with some being actually unique; however, collectively rare chromosome disorders make up at least one in every 200 live births, with babies either having symptoms from birth or early childhood, or being carriers of a chromosomal abnormality and experiencing the effects when they try to reproduce in later life (Searle and Hultén, 2009). Recent advances in technology and medical expertise has meant that chromosomes can be viewed at ever increasing magnifications, which is resulting in the detection of more complex defects.
    [Show full text]
  • Spectrum of PEX1 and PEX6 Variants in Heimler Syndrome
    European Journal of Human Genetics (2016) 24, 1565–1571 Official Journal of The European Society of Human Genetics www.nature.com/ejhg ARTICLE Spectrum of PEX1 and PEX6 variants in Heimler syndrome Claire EL Smith1, James A Poulter1, Alex V Levin2,3,4, Jenina E Capasso4, Susan Price5, Tamar Ben-Yosef6, Reuven Sharony7, William G Newman8,9, Roger C Shore10, Steven J Brookes10, Alan J Mighell1,11,12 and Chris F Inglehearn*,1,12 Heimler syndrome (HS) consists of recessively inherited sensorineural hearing loss, amelogenesis imperfecta (AI) and nail abnormalities, with or without visual defects. Recently HS was shown to result from hypomorphic mutations in PEX1 or PEX6,both previously implicated in Zellweger Syndrome Spectrum Disorders (ZSSD). ZSSD are a group of conditions consisting of craniofacial and neurological abnormalities, sensory defects and multi-organ dysfunction. The finding of HS-causing mutations in PEX1 and PEX6 shows that HS represents the mild end of the ZSSD spectrum, though these conditions were previously thought to be distinct nosological entities. Here, we present six further HS families, five with PEX6 variants and one with PEX1 variants, and show the patterns of Pex1, Pex14 and Pex6 immunoreactivity in the mouse retina. While Ratbi et al. found more HS-causing mutations in PEX1 than in PEX6, as is the case for ZSSD, in this cohort PEX6 variants predominate, suggesting both genes play a significant role in HS. The PEX6 variant c.1802G4A, p.(R601Q), reported previously in compound heterozygous state in one HS and three ZSSD cases, was found in compound heterozygous state in three HS families.
    [Show full text]
  • Lab 17. Chromosomes and Karyotypes: How Do Two Physically Healthy Parents Produce a Child with Down Syndrome and a Second Child
    Lab 17. Chromosomes and Karyotypes: How Do Two Physically Healthy Parents Produce a Child With Down Syndrome and a Second Child With Cri Du Chat Syndrome? Introduction Mendel’s model of inheritance is the basis for modern genetics. This important model can be broken down into four main ideas. First, and foremost, the fundamental unit of inheritance is the gene and alternative versions of a gene (alleles) account for the variation in inheritable characters. Second, an organism inherits two alleles for each character, one from each parent. Third, if the two alleles differ, then one is fully expressed and determines the nature of the specific trait (this version of the gene is called the dominant allele) while the other one has no noticeable effect (this version of the gene is called the recessive allele). Fourth, the two alleles for each character segregate (or separate) during gamete production. Therefore, an egg or a sperm cell only gets one of the two alleles that are present in the somatic cells of the organism. This idea is known as the law of segregation. It was brilliant (or lucky) that Mendel chose plant traits that turned out to have a relatively simple genetic basis. Each trait that he studied is determined by only one gene, and each of these genes only consists of two alleles. These conditions, however, are not met by all inheritable traits. The relationship between traits and genes is not always a simple one. In this investigation, you will use what you know about the relationship between traits and genes to explain how two children from the same family inherited two different genetic disorders.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Rank Contestant Country P Su T B M St Score Medal Abs. Rel. 1 William
    International Olympiad in Informatics – Statistics Olympiads Countries Tasks Hall of Fame Search Add Login ← IOI 2020 Main Results Delegations Contestants Tasks Administration Score ▼ Rank Contestant Country P Su T B M St Medal Abs. Rel. 1 William Lin United States of America 100 100 100 100 100.00 100.00 600.00 100.00% Gold 2 Eun Soo Choe Republic of Korea 100 100 100 100 93.00 100.00 593.00 98.83% Gold 3 Harris Leung Hong Kong 100 100 100 100 92.62 100.00 592.62 98.77% Gold 3 Yuxiang Luo China 100 100 100 100 92.62 100.00 592.62 98.77% Gold 3 Yuyang Zhou China 100 100 100 100 92.62 100.00 592.62 98.77% Gold 3 Zhanpeng Wang China 100 100 100 100 92.62 100.00 592.62 98.77% Gold 7 Mingrun Jiang China 100 100 100 100 92.24 100.00 592.24 98.71% Gold 8 Ildar Gainullin Russia 75 100 100 100 92.62 100.00 567.62 94.60% Gold 8 Tadija Šebez Serbia 75 100 100 100 92.62 100.00 567.62 94.60% Gold 10 Shayan Pardis Iran 44 100 100 100 92.62 100.00 536.62 89.44% Gold 11 Duc Bui Hong Vietnam 60 100 100 77 96.58 100.00 533.58 88.93% Gold 12 Junhyuk Song Republic of Korea 75 100 100 100 92.62 65.32 532.94 88.82% Gold 13 Pikatan Arya Bramajati Indonesia 49 100 100 100 80.43 100.00 529.43 88.24% Gold 14 Patrick Pavić Croatia 100 100 41 100 80.43 100.00 521.43 86.91% Gold 15 Nikoloz Birkadze Georgia 75 100 100 100 80.43 65.32 520.75 86.79% Gold 16 Teimurazi Toloraia Georgia 60 100 100 77 80.43 100.00 517.43 86.24% Gold 17 Alexandru Luchianov Romania 75 100 41 100 92.62 100.00 508.62 84.77% Gold 18 Thomas Guo Canada 49 100 100 100 92.62 65.32 506.94 84.49%
    [Show full text]
  • International Journal of Dentistry and Oral Health Volume 4 Issue 10, September 2018
    International Journal of Dentistry and Oral Health Volume 4 Issue 10, September 2018 International Journal of Dentistry and Oral Health Case Report ISSN 2471-657X Amelogenesis Imperfecta in Primary Dentition-A Case of Full Mouth Rehabilitation Revathy Viswanathan1, Janak Harish Kumar*2, Suganthi3 1Department of Pedodontics, Tamilnadu Government Dental College and Hospital, Chennai, Tamilnadu, India 2Intern, Department of Pedodontics, Tamilnadu Government Dental College and Hospital, Chennai, Tamilnadu, India 3Department of Pedodontics, Tamilnadu Government Dental College and Hospital, Chennai, Tamilnadu, India Abstract The most common anomalies of dental hard tissues include hereditary defects of enamel. Amelogenesis imperfecta (AI) has been described as a complex group of hereditary conditions that disturbs the developing enamel and exists independent of any related systemic disorder. This clinical case report describes the diagnosis and management of hypoplastic amelogenesis imperfecta in a 5-year-old child. The treatment objectives were to improve aesthetics, improve periodontal health, prevent further loss of tooth structure, and improve the child’s confidence. The treatment plan was to restore the affected teeth with full coverage restorations. Treatment involved placement of composite strip crowns on maxillary anterior teeth and stainless steel crowns on the posterior teeth followed by fluoride varnish application in the upper and lower arches. A 6-month follow-up showed great aesthetic and psychological improvements in the patient. Keywords: Amelogenesis imperfecta, Deciduous dentition, Composite strip crowns, Stainless steel crowns Corresponding author: Janak Harish Kumar teeth and can occur in both primary and permanent dentition which Intern, Department of Pedodontics and Preventive dentistry, results in the teeth being small, pitted, grooved and fragile with Tamilnadu Government Dental College and Hospital, Chennai, India.
    [Show full text]
  • Involvements of Hyperhomocysteinemia in Neurological Disorders
    H OH metabolites OH Review Involvements of Hyperhomocysteinemia in Neurological Disorders Marika Cordaro 1,† , Rosalba Siracusa 2,† , Roberta Fusco 2 , Salvatore Cuzzocrea 2,3,* , Rosanna Di Paola 2,* and Daniela Impellizzeri 2 1 Department of Biomedical, Dental and Morphological and Functional Imaging, University of Messina, Via Consolare Valeria, 98125 Messina, Italy; [email protected] 2 Department of Chemical, Biological, Pharmaceutical and Environmental Sciences, University of Messina, 98166 Messina, Italy; [email protected] (R.S.); [email protected] (R.F.); [email protected] (D.I.) 3 Department of Pharmacological and Physiological Science, Saint Louis University School of Medicine, Saint Louis, MO 63104, USA * Correspondence: [email protected] (S.C.); [email protected] (R.D.P.); Tel.: +39-090-6765208 (S.C. & R.D.P.) † The authors equally contributed to the review. Abstract: Homocysteine (HCY), a physiological amino acid formed when proteins break down, leads to a pathological condition called hyperhomocysteinemia (HHCY), when it is over a definite limit. It is well known that an increase in HCY levels in blood, can contribute to arterial damage and several cardiovascular disease, but the knowledge about the relationship between HCY and brain disorders is very poor. Recent studies demonstrated that an alteration in HCY metabolism or a deficiency in folate or vitamin B12 can cause altered methylation and/or redox potentials, that leads to a modification on calcium influx in cells, or into an accumulation in amyloid and/or tau protein involving a cascade of events that culminate in apoptosis, and, in the worst conditions, neuronal death. The present review will thus summarize how much is known about the possible role of HHCY in neurodegenerative disease.
    [Show full text]
  • Relics of the Bulgarian National Epic
    PAISStt OF HILENDAR: FOUNDER OF THE NATIONAL IDEOLOGY In modern historiography the first centuries of the of the respectful image of Mediaeval Bulgaria. In Sremski Ottoman rule of Bulgarian lands are determined as Late Karlovci, one of the most active literary centres of the Middle Ages. The time from the beginning of the 18th time, Paissi read the book of Dubrovnik Abbot Mavro century to the 1877-1878 Russo-Turkish War is called Orbini "The Realm of the Slavs" in which he discovered Bulgarian National Revival. If the National Revival period considerable evidence about the Bulgarians' past. for Northern Bulgaria and the Sofia Region continued by In 1762 he completed "Slav-Bulgarian History, about 1878, for Eastern Rumelia it was by 1885 and for the People and the Kings, the Bulgarian Saints and All Macedonia and Adrianople Thrace by 1912-1913. Bulgarian Activities and Events". In 83 hand-written The National Revival in the Bulgarian lands witnessed pages the inspired Hilendar Monk interpreted using considerable economic progress. The Bulgarian were romantic and heightened tone the grandour of increasingly getting rid of their mediaeval restricted out- Mediaeval Bulgaria, the victory of the Bulgarian army look and helplessness and were gradually getting aware over Byzantium, the impressive bravery and manliness of as people, aspiring towards economic and cultural the Bulgarians, the historic mission of the Cyril and progress. Hilendar monk Paissii became a mouthpiece of Methodius brothers and other eloquent facts, worthy to these changes in the national self-awareness. He was be remembers and respected by the successors. Already the first to perceive the beginning of the new time and in the forward this noted Bulgarian appealed with gen- the need of formulating verbally the maturing historical uine sincerity towards his compatriots to love and keep prospects and tasks before the Bulgarian people.
    [Show full text]
  • 1 Silencing Branched-Chain Ketoacid Dehydrogenase Or
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Silencing branched-chain ketoacid dehydrogenase or treatment with branched-chain ketoacids ex vivo inhibits muscle insulin signaling Running title: BCKAs impair insulin signaling Dipsikha Biswas1, PhD, Khoi T. Dao1, BSc, Angella Mercer1, BSc, Andrew Cowie1 , BSc, Luke Duffley1, BSc, Yassine El Hiani2, PhD, Petra C. Kienesberger1, PhD, Thomas Pulinilkunnil1†, PhD 1Department of Biochemistry and Molecular Biology, Dalhousie Medicine New Brunswick, Saint John, New Brunswick, Canada, 2Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada. †Correspondence to Thomas Pulinilkunnil, PhD Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dalhousie University Dalhousie Medicine New Brunswick, 100 Tucker Park Road, Saint John E2L4L5, New Brunswick, Canada. Telephone: (506) 636-6973; Fax: (506) 636-6001; email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International
    [Show full text]