DOCSLIB.ORG

This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Al Ahdal, Hadil Title: Investigating the role of miR-21 in adult neurogenesis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. Investigating the role of miR-21 in adult neurogenesis Hadil Mohammad Al Ahdal Faculty of Health Sciences Bristol Medical School A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School 64,598 words Abstract MicroRNAs (miRNAs) are a class of small non-coding RNAs that act as post- transcriptional regulators and play important roles in neurodegenerative diseases and brain disorders (Nelson et al. 2008). MiR-21, a miRNA that is dysregulated in cancers including glioblastomas, targets cellular processes including cell proliferation and apoptosis (Krichevsky & Gabriely 2009). MiR-21 has been shown to be upregulated following traumatic brain injury and spinal cord injury; this upregulation has been postulated to reduce lesion size, enhance cell survival and confer better neurological outcome (Ge et al. 2014; Hu et al. 2013). Due to its effects on cell proliferation and survival, miR-21 was speculated to play a role in adult neurogenesis in the mammalian brain. The effect of altering miR-21 levels on the cell fate of newborn neurons in the adult hippocampus was investigated using transgenic mice that globally either overexpress miR-21 (miR-21 OE) or lack miR-21 (miR-21 KO). First, increased neurogenesis in the dentate gyrus (DG) of miR-21 OE mice was detected, while miR-21 KO mice showed reduced neurogenesis in the same area. Transgenic mice lacking miR-21 (miR-21 KO) demonstrated impairment in learning and memory in the Morris water maze task. Mir-21 KO mice also showed reduced neurogenesis in the subventricular zone. To further understand the pathways that are involved in miR-21 regulation in the adult brain, miR-21 targets were investigated experimentally and using bioinformatics prediction tools. These results suggest that miR-21 plays an important role in regulating adult neurogenesis and learning behaviour. Overall, this is the first study to investigate miR-21 altered expression role in the adult normal brain. Linking i miR-21 role in this study to increased miR-21 levels in the brain and spinal cord after injury, will help to identify possible therapeutic strategies for treating traumatic injuries and neurodegenerative diseases. ii Acknowledgements I would like to express my sincerest gratitude to my supervisor Dr Liang-Fong Wong for her encouragement, time and support throughout my PhD studies. I wish to thank her mostly for her continues mentorship and patience. I am very grateful to Prof James Uney my second supervisor, for giving me the opportunity to be part of his team. I would like to thank my progress reviewers; Dr Fiona Holmes and Prof. David Murphy for their guidance, valuable comments and advice. I am deeply grateful to Dr Oscar Cordero-Llana for his motivations and help even when things were not good. I would also to thank Prof Clea Warburton for using her water maze tools and Dr Maeve Caldwell for her help in the animal work and tissue culture techniques. I want to acknowledge Dr Ali Bienemann and Dr Keven Kemp for their help in imaging processing. A big thank to Dr Sian Baker, Nickola Buckner and Jessica McMaster for proofreading my drafts and providing a valuable feedback. A special thank goes to of all colleagues and friends in the School of Biomedical Studies and the family of the Regenerative Medicine Laboratory for both their scientific help, friendship and all the happy moments. I owe my deepest gratitude to my husband Abdullah and my lovely children Jana, Hana and Ghazi for supporting me over the PhD good and tough times, I couldn’t do it without you. I would like to thank all my friends in Bristol and my brothers and family in Saudi Arabia, you helped to bring the balance into my life. My Parents this thesis is dedicated to you. I would like to acknowledge my sponsor Princess Norah University for funding my project. iii Author’s Declaration I declare that the work in this dissertation was carried out in accordance with the requirements of the University's Regulations and Code of Practice for Research Degree Programmes and that it has not been submitted for any other academic award. Except where indicated by specific reference in the text, the work is the candidate's own work. Work done in collaboration with, or with the assistance of, others, is indicated as such. Any views expressed in the dissertation are those of the author. Signed: ……………………………………………. Date: ……………… iv v Table of contents Chapter 1 Introduction 1 1.1 Background 2 1.1.1 Historical background 3 1.2 Neurogenic niches in the adult brain 4 1.2.1 Neurogenesis in the adult SVZ 7 1.2.2 Adult neurogenesis in the adult hippocampus 11 1.3 Adult neurogenesis and aging 14 1.3.1 Adult neurogenesis and neurodegenerative diseases 14 1.4 Functional significance of adult neurogenesis 17 1.5 Adult neurogenesis in human 20 1.6 Regulation of adult neurogenesis 21 1.6.1 Regulation by intrinsic factors 23 1.6.2 Extrinsic factors 28 1.7 The use of mice as an animal model to investigate neurogenesis 31 1.7.1 Detection methods for mouse adult neurogenesis 32 1.7.2 Markers for adult NPCs and neurogenesis 33 1.8 MicroRNA 35 1.8.1 Biogenesis of miRNAs 37 1.9 Role of miRNAs in neurogenesis 40 1.9.1 MiRNA-21 44 1.9.2 MiR-21 expression in the brain 46 1.9.3 MiR-21 in cancer 47 1.9.4 MiR-21 in traumatic brain injury 48 1.10 Hypothesis and aims of the study 50 Chapter 2 Methods 52 vi 2.1 Animals 53 2.2 Bromodeoxyuridine injection and detection 53 2.3 Histological Processing 54 2.4 Immunohistochemistry 55 2.4.1 Immunocytochemistry 55 2.4.2 Immunohistochemistry using DAB reagent 55 2.4.3 Fluorescence staining 56 2.4.4 Nissl Staining 58 2.5 Microscopy 58 2.6 Quantification of cultured cells and sections 59 2.7 SDS-PAGE and Western Blotting 60 2.7.1 Protein extraction 60 2.7.2 Western blot solutions 62 2.8 RNA extraction from hippocampal tissue 64 2.9 Analysis of miRNA expression 64 2.10 Production of cDNA for gene expression 66 2.11 q-PCR 66 2.12 Fluorescent in Situ Hybridization (FISH) for microRNA and immunofluorescent staining 67 2.13 Culture of neural stem cells from the subventricular zone (SVZ) 69 2.14 Behavioural Experiments 70 2.14.1 Water maze 70 2.15 Bioinformatics analysis 72 2.16 Statistical analysis 72 Chapter 3 Role of miR-21 in neurogenesis within the adult dentate gyrus 74 3.1 Introduction 75 3.1.1 Hippocampal anatomy and connectivity 76 vii 3.1.2 Identification and Quantification of Neurogenesis 78 3.1.3 Altering neurogenesis impacts on learning and memory 80 3.1.4 miRNA in neurogenesis 82 3.1.5 Aims 83 3.2 Results 85 3.2.1 miR-21 is expressed in the normal adult brain. 85 3.2.2 miR-21 is localized with some of the GFAP+ cells in the hippocampus 88 3.2.3 Altered miR-21 levels did not affect proliferation or astrogenesis in the hippocampus 90 3.2.4 Loss of miR-21 reduces neurogenesis in the adult hippocampus 92 3.2.5 miR-21 KO mice have impaired performance in Morris water maze task 96 3.2.6 MiR-21 knockdown increases the expression of the apoptotic marker Cleaved Caspase-3 101 3.2.7 Neurogenesis in P30 miR-21 KO animals is not impaired 103 3.2.8 Improved adult neurogenesis in aged OE mice 105 3.3 Discussion 107 Chapter 4 miR-21 target prediction and validation 118 4.1 Introduction 119 4.1.1 Principles of miRNA target prediction 122 4.1.2 miRNA target prediction tools 126 4.1.3 Experimental validation of predicted targets 130 4.1.4 Known and validated targets of miR-21 131 4.1.5 Aims 133 4.2 Results 135 4.2.1 Altered expression of miR-21 does not affect expression of other brain- enriched miRNAs 135 4.2.2 Screening of miR-21 targets using computational tools 146 viii 4.2.3 Bioinformatics analysis 150 4.2.4 Experimentally validated targets 153 4.3 Discussion 160 Chapter 5 The role of miR-21 in adult subventricular zone neurogenesis 168 5.1 Introduction 169 5.1.1 The role of miRNAs in adult SVZ neurogenesis 170 5.1.2 The structure and cellular circuit in the OB 171 5.1.3 Functional significance of adult SVZ neurogenesis 172 5.1.4 Aims 173 5.2 Results 176 5.2.1 Assessing in vitro neural differentiation of neural precursors derived from miR-21 KO and miR-21 OE mice 176 5.2.2 Reduced neurogenesis in the OB of miR-21 KO mice 183 5.2.3 Neurogenesis in the SVZ is not impaired at postnatal day 30 197 5.2.4 miR-21 loss does not influence neurogenesis in the SVZ of mice aged 12 months 199 5.3 Discussion 201 Chapter 6 General Discussion 210 REFERENCES 221 Appendix 289 ix List of Figures Figure 1-1: Neurogenesis niches in the adult mouse brain.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • S100 Calcium-Binding Protein S100 Proteins
    S S100 Calcium-Binding Protein experiments showed the S100 protein fraction consti- tuted two different dimeric species comprised of two ▶ S100 Proteins b protomers (S100B) or an a, b heterodimer (Isobe et al. 1977). Early members of the S100 protein family were frequently given suffixes based on their localiza- tion or molecular size and included S100P (placental), S100 Proteins S100C (cardiac or calgizzarin), p11 (11 kDa), and MRP8/MRP14 (myeloid regulatory proteins, 8 and Brian R. Dempsey, Anne C. Rintala-Dempsey and 14 kDa). In 1993, initial genetic studies showed that Gary S. Shaw six of the S100 genes were clustered on chromosome Department of Biochemistry, The University of 1q21 (Engelkamp et al. 1993), a number that has Western Ontario, London, ON, Canada expanded since. Based on this observation most of the proteins were renamed according to the physical order they occupy on the chromosome. These include Synonyms S100A1 (formerly S100a), S100A2 (formerly S100L), S100A10 (p11), S100A8/S100A14 (MRP8/MRP14). S100 calcium-binding protein A few S100 proteins are found on other chromosomes including S100B (21q21). Currently there are 27 known S100 family members: S100A1-A18, S100B, S100 Protein Family Members S100G, S100P, S100Z, trichohylin, filaggrin, filaggrin- 2, cornulin, and repetin (Table 1). S100A1, S100A2, S100A3, S100A4, S100A5, S100A6, S100A7, S100A8, S100A9, S100A10, S100A11, S100A12, S100A13, S100A14, S100A15, S100A16, Role of S100 Proteins in Calcium Signaling S100B, S100P, S100G, S100Z, trichohylin, filaggrin, filaggrin-2,
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Inactive X Chromosome Is Epigenetically Unstable and Transcriptionally Labile in Breast Cancer
    Supplemental Information The inactive X chromosome is epigenetically unstable and transcriptionally labile in breast cancer Ronan Chaligné1,2,3,8, Tatiana Popova1,4, Marco-Antonio Mendoza-Parra5, Mohamed-Ashick M. Saleem5 , David Gentien1,6, Kristen Ban1,2,3,8, Tristan Piolot1,7, Olivier Leroy1,7, Odette Mariani6, Hinrich Gronemeyer*5, Anne Vincent-Salomon*1,4,6,8, Marc-Henri Stern*1,4,6 and Edith Heard*1,2,3,8 Extended Experimental Procedures Cell Culture Human Mammary Epithelial Cells (HMEC, Invitrogen) were grown in serum-free medium (HuMEC, Invitrogen). WI- 38, ZR-75-1, SK-BR-3 and MDA-MB-436 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) containing 10% fetal bovine serum (FBS). DNA Methylation analysis. We bisulfite-treated 2 µg of genomic DNA using Epitect bisulfite kit (Qiagen). Bisulfite converted DNA was amplified with bisulfite primers listed in Table S3. All primers incorporated a T7 promoter tag, and PCR conditions are available upon request. We analyzed PCR products by MALDI-TOF mass spectrometry after in vitro transcription and specific cleavage (EpiTYPER by Sequenom®). For each amplicon, we analyzed two independent DNA samples and several CG sites in the CpG Island. Design of primers and selection of best promoter region to assess (approx. 500 bp) were done by a combination of UCSC Genome Browser (http://genome.ucsc.edu) and MethPrimer (http://www.urogene.org). All the primers used are listed (Table S3). NB: MAGEC2 CpG analysis have been done with a combination of two CpG island identified in the gene core. Analysis of RNA allelic expression profiles (based on Human SNP Array 6.0) DNA and RNA hybridizations were normalized by Genotyping console.
    [Show full text]
  • Anti-ARMCX1 Monoclonal Antibody, Clone FQS23965 (DCABH-6907) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-ARMCX1 monoclonal antibody, clone FQS23965 (DCABH-6907) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Rabbit monoclonal to ARMCX1 - N-terminal Antigen Description This gene encodes a member of the ALEX family of proteins and may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and two Armadillo (arm) repeats. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members, including ALEX2 and ALEX3, on the X chromosome. Immunogen Synthetic peptide (the amino acid sequence is considered to be commercially sensitive) within Human ARMCX1 aa 1-150 (N terminal). The exact sequence is proprietary.Database link: Q9P291 Isotype IgG Source/Host Rabbit Species Reactivity Human Clone FQS23965 Purity Tissue culture supernatant Conjugate Unconjugated Applications WB, ICC/IF Positive Control Human fetal heart or fetal brain lysate, HeLa cells. Format Liquid Size 100 μl Buffer pH: 7.2; Preservative: 0.01% Sodium azide; Constituents: 50% Glycerol, 0.05% BSA, PBS Preservative 0.01% Sodium Azide Storage Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C long term. Avoid freeze / thaw cycle. Ship Shipped at 4°C. 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved GENE INFORMATION
    [Show full text]
  • Rage (Receptor for Advanced Glycation End Products) in Melanoma
    RAGE (RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS) IN MELANOMA PROGRESSION A Dissertation Submitted to the Graduate Faculty of the North Dakota State University of Agriculture and Applied Science By Varsha Meghnani In Partial Fulfillment for the Degree of DOCTOR OF PHILOSOPHY Major Department: Pharmaceutical Sciences May 2014 Fargo, North Dakota North Dakota State University Graduate School Title RAGE (RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS) IN MELANOMA PROGRESSION By VARSHA MEGHNANI The Supervisory Committee certifies that this disquisition complies with North Dakota State University’s regulations and meets the accepted standards for the degree of DOCTOR OF PHILOSOPHY SUPERVISORY COMMITTEE: ESTELLE LECLERC Chair BIN GUO STEPHEN O’ROURKE JANE SCHUH Approved: 5/22/2014 JAGDISH SINGH Date Department Chair ABSTRACT The Receptor for Advanced Glycation End Products (RAGE) and its ligands are expressed in multiple cancer types and are implicated in cancer progression. Our lab has previously reported higher transcript levels of RAGE and S100B in advanced staged melanoma patients. The contribution of RAGE in the pathophysiology of melanoma has not been well studied. Based on previous reports, we hypothesized that RAGE, when over-expressed in melanoma cells, promotes melanoma progression. To study the pathogenic role of RAGE in melanoma, a primary melanoma cell line, WM115, was selected and stably transfected with full length RAGE (FL_RAGE) to generate a model cell line over-expressing RAGE (WM115_RAGE). WM266, a sister cell line of WM115, originated from a metastatic tumor of the same patient was used as a metastatic control cell line in the study. After assessing the expression levels of RAGE in the transfected cells, the influence of RAGE on their cellular properties was examined.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • FAM210A Is a Novel Determinant of Bone and Muscle Structure And
    FAM210A is a novel determinant of bone and muscle PNAS PLUS structure and strength Ken-ichiro Tanakaa, Yingben Xuea, Loan Nguyen-Yamamotoa, John A. Morrisb,c,d, Ippei Kanazawae, Toshitsugu Sugimotoe, Simon S. Winga,f, J. Brent Richardsb,c,d, and David Goltzmana,f,1 aCalcium Research Laboratory, Metabolic Disorders and Complications Program, Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; bDepartment of Medicine, McGill University, Montreal, QC, Canada H3T 1E2; cDepartment of Human Genetics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; dDepartment of Epidemiology and Biostatistics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; eInternal Medicine 1, Faculty of Medicine, Shimane University, 693-8501 Shimane, Japan; and fDivision of Endocrinology, Department of Medicine, McGill University, Montreal, QC, Canada H4A 3J1 Edited by John T. Potts, Massachusetts General Hospital, Charlestown, MA, and approved March 14, 2018 (received for review November 1, 2017) Osteoporosis and sarcopenia are common comorbid diseases, yet TOM1L2/SREBF1 locus were found to exert opposing effects on their shared mechanisms are largely unknown. We found that total body lean mass and total body less head BMD (13). SREBP- genetic variation near FAM210A was associated, through large 1, and the product of the SREBF1 gene, is known to exert op- genome-wide association studies, with fracture, bone mineral posing effects on osteoblast and myoblast differentiation (14, 15). density (BMD), and appendicular and whole body lean mass, in However, more commonly, bone loss coincides with a decrease in humans. In mice, Fam210a was expressed in muscle mitochondria muscle mass and function, suggesting that there are shared bio- and cytoplasm, as well as in heart and brain, but not in bone.
    [Show full text]
  • Getic Pathways Critical Issues in Contractile fibres [132]
    Journal of Neuromuscular Diseases 1 (2014) 15–40 15 DOI 10.3233/JND-140011 IOS Press Review Mass Spectrometry-Based Identification of Muscle-Associated and Muscle-Derived Proteomic Biomarkers of Dystrophinopathies Paul Dowling, Ashling Holland and Kay Ohlendieck∗ Department of Biology, National University of Ireland, Maynooth, Ireland Abstract. The optimization of large-scale screening procedures of pathological specimens by genomic, proteomic and metabolic methods has drastically increased the bioanalytical capability for swiftly identifying novel biomarkers of inherited disorders, such as neuromuscular diseases. X-linked muscular dystrophy represents the most frequently inherited muscle disease and is characterized by primary abnormalities in the membrane cytoskeletal protein dystrophin. Mass spectrometry-based proteomics has been widely employed for the systematic analysis of dystrophin-deficient muscle tissues, using patient samples and animal models of dystrophinopathy. Both, gel-based methods and label-free mass spectrometric techniques have been applied in compar- ative analyses and established a large number of altered proteins that are associated with muscle contraction, energy metabolism, ion homeostasis, cellular signaling, the cytoskeleton, the extracellular matrix and the cellular stress response. Although these new indicators of muscular dystrophy have increased our general understanding of the molecular pathogenesis of dystrophinopathy, their application as new diagnostic or prognostic biomarkers would require the undesirable usage of invasive methodology. Hence, to reduce the need for diagnostic muscle biopsy procedures, more recent efforts have focused on the proteomic screening of suitable body fluids, such as plasma, serum or urine, for the identification of changed concentration levels of muscle-derived peptides, protein fragments or intact proteins. The occurrence of muscular dystrophy-related protein species in biofluids will be extremely helpful for the future development of cost-effective and non-invasive diagnostic procedures.
    [Show full text]
  • Prognostic Values of S100 Family Members in Ovarian Cancer Patients Yang Bai1,2,3†, Liang-Dong Li4,5†, Jun Li1,2,3 and Xin Lu1,2,3,6*
    Bai et al. BMC Cancer (2018) 18:1256 https://doi.org/10.1186/s12885-018-5170-3 RESEARCH ARTICLE Open Access Prognostic values of S100 family members in ovarian cancer patients Yang Bai1,2,3†, Liang-Dong Li4,5†, Jun Li1,2,3 and Xin Lu1,2,3,6* Abstract Objective: Exhibiting high consistence in sequence and structure, S100 family members are interchangeable in function and they show a wide spectrum of biological processes, including proliferation, apoptosis, migration, inflammation and differentiation and the like. While the prognostic value of each individual S100 in ovarian cancer is still elusive. In current study, we investigated the prognostic value of S100 family members in the ovarian cancer. Methods: We used the Kaplan Meier plotter (KM plotter) database, in which updated gene expression data and survival information are from 1657 ovarian cancer patients, to assess the relevance of individual S100 family mRNA expression to overall survival in various ovarian cancer subtypes and different clinicopathological features. Results: It was found that high expression of S100A2 (HR = 1.18, 95%CI: 1.04–1.34, P = 0.012), S100A7A (HR = 1.3, 95%CI: 1. 04–1.63, P = 0.02),S100A10 (HR = 1.2, 95%CI: 1.05–1.38, P = 0.0087),and S100A16 (HR = 1.23, 95%CI: 1–1.51, P = 0.052) were significantly correlated with worse OS in all ovarian cancer patients, while the expression of S100A1 (HR = 0.87, 95%CI: 0. 77–0.99, P = 0.039), S100A3 (HR = 0.83, 95%CI: 0.71–0.96, P = 0.0011), S100A5 (HR = 0.84, 95%CI: 0.73–0.97, P = 0.017), S100A6 (HR = 0.84, 95%CI: 0.72–0.98, P = 0.024), S100A13 (HR = 0.85, 95%CI:0.75–0.97, P = 0.014) and S100G (HR = 0.86, 95%CI: 0.74–0.99, P = 0.041) were associated with better prognosis.
    [Show full text]
  • IHC Test Menu
    Immunohistochemistry Test Menu A Alpha fetoprotein [I AFP] CD99 Ewings sarcoma PNET [I CD99] Anaplastic lymphoma kinase -1 [I ALK] CD103 Integrin alpha E [I CD103] Androgen receptor [I ANDRO]* CD117 C-Kit, myeloid, mast cells, GIST [I CD117] Annexin A1, hairy cell, B cell lymphoma [I ANXA1] CD138 plasma cells, subset epithelial cells [I CD138] Anti-Arginase-1 [I ARGINASE] CD163 histiocytes [I CD163] CDK4 cyclin-depdendent kinase-4, clone DCS-31 [I CDK4] B CDX2 colorectal carcinoma [I CDX2] BCL2 follicular lymphoma, apoptosis inhibiting protein [I BCL2] Chromogranin A [I CHROGRAN] BCL6 follicle center B-cell [I BCL6] CMYC C-MYC oncoprotein [I CMYC] BER EP4 Epithelial antigen [I BER EP4] Collagen IV, basement membrane protein [I CLLGIV] BRAF [I V600E] Cyclin D1/PRAD1 mantle cell lymphoma [I CYCLIN] Cytokeratin 5/6, squamous, mesothelial [I CK5/6] C Cytokeratin 7, 54kD [I CK7] CA 19-9 pancreas, liver, ovary, lung tumors [I CA19 9] Cytokeratin 7/8 CAM5.2 [I CAM 5.2] CA 125 epitheliod malignancies ovary, breast [I CA125] Cytokeratin 8, 35BH11 [I CK8] Calcitonin [I CALCT] Cytokeratin 8/18, adenocarcinoma [I CK8/18] Caldesmon, smooth muscle [I CALDSM] Cytokeratin 19 [I CK19] Calretinin; Calcium binding protein [I CALRT] Cytokeratin 20 [I CK20] CAM 5.2 Cytokeratin 7/Cytokeratin 8 [I CAM 5.2] Cytokeratin cocktail, PAN (AE1/AE3) [I AE1/AE3] Carcinoembryonic antigen (CEA) [I CEA] Cytokeratin high molecular weight; 34BE12 [I CK HMW] Cathepsin D, breast carcinoma [I CATHD] Cytomegalovirus [I CMV] CD1a cortical thymocyctes, Langerhans cells [I CD1a]
    [Show full text]