DOCSLIB.ORG

Immunohistochemistry Stain Offerings

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

immunohistochemistry stain offerings TRUSTED PATHOLOGISTS. INVALUABLE ANSWERS.™ MARCHMAY 20172021 www.aruplab.com/ap-ihcaruplab.com/ap-ihc InformationInformation in this brochurein this brochure is current is current as of as May of March 2021. 2017. All content All content is subject is subject to tochange. change. Please contactPlease ARUPcontact ClientARUP Services Client Services at 800-522-2787 at (800) 522-2787 with any with questions any questions or concerns.or concerns. ARUP LABORATORIES As a nonprofit, academic institution of the University of Utah and its Department We believe in of Pathology, ARUP believes in collaborating, sharing and contributing to laboratory science in ways that benefit our clients and their patients. collaborating, Our test menu is one of the broadest in the industry, encompassing more sharing and than 3,000 tests, including highly specialized and esoteric assays. We offer comprehensive testing in the areas of genetics, molecular oncology, pediatrics, contributing pain management, and more. to laboratory ARUP’s clients include many of the nation’s university teaching hospitals and children’s hospitals, as well as multihospital groups, major commercial science in ways laboratories, and group purchasing organizations. We believe that healthcare should be delivered as close to the patient as possible, which is why we support that provide our clients’ efforts to be the principal healthcare provider in the communities they serve by offering highly complex assays and accompanying consultative support. the best value Offering analytics, consulting, and decision support services, ARUP provides for the patient. clients with the utilization management tools necessary to prosper in this time of value-based care. Our UM+ program helps clients control utilization, reduce costs, Together, and improve patient care. In addition, ARUP is a worldwide leader in innovative ARUP and laboratory research and development, led by the efforts of the ARUP Institute for Clinical and Experimental Pathology.® its clients will ARUP’s reputation for quality is supported by our ability to meet or exceed the improve patient requirements of multiple regulatory and accrediting agencies and organizations. ARUP participates in the CAP laboratory accreditation program and has CLIA care today and certification through the Centers of Medicare and Medicaid Services. In December 2016, ARUP earned accreditation to the ISO 15189:2012 standard under CAP. in the future. patients. answers. results.® A laboratory test is more than a number; it is a . person, an answer, a diagnosis.® IMMUNOHISTOCHEMISTRY STAIN OFFERINGS Immunohistochemistry is a valuable tool in morphologic diagnosis and is considered required testing for standard of care. ARUP Laboratories offers a wide range of immunohistochemical stains on paraffin sections from formalin-fixed tissue or cell blocks. In addition to routine antibodies used for diagnostic differentiation, ARUP offers a broad range of esoteric antibodies not usually available to the community pathologist. Currently, more than 175 antibodies are available, with new markers constantly being evaluated. ARUP’s antibody menu includes markers that help determine tumor-cell lineage, as well as prognostic and therapeutic markers. The ARUP Immunohistochemistry Laboratory is directed by board-certified pathologists who are also faculty members of the Department of Pathology at the University of Utah School of Medicine. ARUP’s pathologists are available for consultation and assistance with selecting the appropriate markers for analysis. Additional information about immunohistochemistry and ARUP’s antibody menu may be obtained by calling 800-522-2787 and asking for the Immunohistochemistry Laboratory or by visiting aruplab.com/ap-ihc. TECHNICAL PERSONNEL Medical Director: Rodney R. Miles, MD, PhD Operations Director: Amy Sandoval, MT(ASCP) Group Manager: Jeffery Hadley, MBA, CT(ASCP) Lab Supervisor: Matt Brooks, HT,(ASCP) SPECIMEN COLLECTION Methodology: Immunohistochemistry Performed: Monday–Friday Reported: 1–3 days SPECIMEN REQUIRED Collect: Tissue or cells Specimen Preparation • Formalin fix (10% neutral buffered formalin is preferred) and paraffin embed specimen (cells must be prepared into a cell block). • Protect paraffin block and/or slides from excessive heat. Transport tissue block or five unstained (3–5 micron thick sections), positively charged slides in a tissue transport kit (ARUP supply #47808). Kit is available online through eSupply using ARUP Connect™ or by contacting ARUP Client Services at 800-522-2787. • Two slides minimum are required; if sending precut slides, do not oven bake. Storage/Transport Temperature: Room temperature or refrigerated; ship in cooled container during summer months. Unacceptable Conditions • Specimens submitted with nonrepresentative tissue type. Depleted specimens. • Specimens fixed in any fixative other than 10% neutral buffered formalin. Stability (collection to initial testing) • Ambient: indefinite • Refrigerated: indefinite • Frozen: unacceptable Note: The following list is available for stain-and-return service only. Slides will be returned to the client pathologist for interpretation. If interpretation is needed, please order the appropriate consultation. Stand-alone stain and interpretations are not available unless otherwise indicated. aruplab.com/ap-ihc 1 QUICK REFERENCE FOR STAIN AND RETURN ONLY Breast/Endometrium/Ovary/ Hematopoietic Markers • TdT • Chromogranin A Testes Markers • ALK-1 • TIA-1 • NSE • Androgen receptor • BCL-2 Histiocytic Markers • Synaptophysin • Estrogen • BCL- 6 • CD1a Oncogene/Tumor Suppressor • Inhibin • Beta F1 • CD68 (KP1) Markers • NUT • BOB-1 • Lysozyme (muramidase) • p16 • PAX8 • CD1a • p53 • Progesterone • CD2 (AB75) Kidney Markers • HNF-1B Differentiation Markers • CD3 Pancreas Markers • Fumarate Hydratase • B72.3 (breast) • CD4 (1F6) • BCL-10 • Carbonic Anhydrase IX • DOG1 • CD5 • Chymotrypsin • Estrogen (breast, ovary, and • CD7 Liver Markers • Gastrin endometrium) • CD8 • Alpha-1-antitrypsin (a-1-AT) • HNF-1B • HSA (liver) • CD10 (calla) • Alpha fetoprotein (AFP) • Trypsin • CD14 • Arginase 1 • Inhibin Peripheral Neuroectodermal • CD15 (Leu M1) • Glypican 3 • Mammaglobin A Markers • NKX3.1 • CD19 • Glutamine Synthetase • CD99 (013) (Ewing sarcoma) • P40 • CD20 (L26, Leu16) • HNF-1B • P504S (prostate) • CD21 • HSA (liver) Pituitary Markers • CD23 • ACTH • P63 Melanocytic Markers • CD25 • Human growth hormone (HGH) • PAP (prostate) • HMB-45 • CD30 (Ki-1) • Luteinizing Hormone • PAX2 • Melan A (MART1) • CD31 • Prolactin • PAX8 • MITF • CD33 • PD-L1 • S-100 Prognostic Markers • PIN4 (prostate) • CD34 (QBEND10) • BAf47/Ini-1 • PSA (prostate) • CD35 Mesenchymal Markers • ERBB2 (HercepTest) • RCC • CD43 (L60, Leu 22) • Vimentin • CD45 (LCA) • HercepTest (Refer to ERBB2) • TFE3 Microbial Markers • CD52 (CAMPATH-1) • Ki-67 (MIB-1) • Helicobacter pylori Epithelial Markers • CD56 (NCAM) • Mismatch repair by IHC (HNPCC) • Toxoplasmosis • AE1/AE3 • CD61 (GPIIIa) (includes MLH1, MSH2, MSH6, • Ber-EP4 • CD68 (KP1) Mucinous Markers and PMS2)—not available as • Beta-catenin • CD71 • Muc-1 glycoprotein stain and return • Calretinin • CD79a • Muc-4 glycoprotein • p16 • CAM 5.2 LMW • CD117 (c-kit) Muscle Markers • p53 • CDX2 • CD123 • Caldesmon (h-CD) • WT-1 • CEA (monoclonal) • CD138 (plasma) • Desmin • CK 5/6 Thyroid/Parathyroid Markers • CD163 • Muscle specific actin (MSA) • CK 7 • Calcitonin • Cyclin D1 (SP4) • Myoglobin • CK 20 • Parathyroid hormone (PTH) • DBA.44 • Myosin • E-cadherin • Thyroglobulin • Factor XIIIa (factor XIII) • MYF-4 • EMA • TTF-1 • Glycophorin A • Smooth muscle actin (SMA) • ERA (MOC-31) • Granzyme B Vascular Markers • Keratin 903 (HMW) Nervous System Markers • IgG • C4d • P501S • ATRX • IgD • Calponin • PIN4 (prostate) • Beta Amyloid • IgG4 • CD31 • SOX-10 • CD56 (NCAM) • IRF4/MUM1 • CD34 (QBEND10) • GFAP • TTF-1 • Kappa • IDH1 • Collagen IV • WT-1 (N-terminus) • Ki-67 (MIB-1) • NeuN • D2-40 Germ-Cell Tumors/Placenta • Lambda • Neurofilament (68kD) • Glut-1 Markers • LEF1 • PHF-Tau • Human chorionic gonadotropin • Mast-cell tryptase Viral Markers • S-100 (hCG) • Myeloperoxidase (MPO) • Adenovirus • SOX-10 • Human placental lactogen (HPL) • Oct-2 • CM • aSynuclein • Placental alkaline phosphatase • PAX-5 • HHV8 • Ubiquitin (PLAP) • PD1 • HSV I/HSV II • Oct-3/4 • TCL1 Neuroendocrine Markers • SV40 (BK virus) • SALL4 • TCR DELTA • CD56 (NCAM) • Treponema pallidum 2 For the most up-to-date information on Immunohistochemistry Stain Offerings, please visit: THE FOLLOWING STAINS ARE AVAILABLE WITH INTERPRETATION stain test # description • The D5F3 monoclonal ALK antibody provides increased sensitivity, which can more accurately identify ALK-rearranged lung adenocarcinoma with high reproducibility, sensitivity, and specificity. ALK (D5F3) 2007324 • Facilitates the routine identification of ALK-rearranged lung adenocarcinomas in clinical practice and detects lung cancers that may be responsive to ALK inhibitors ALK (D5F3) with reflex to FISH 2011431 See ALK (D5F3). if equivocal or positive • Prognostic for breast cancer ER/PR panel 0049210 • Predictive for response of breast cancers and endometrial cancers to hormonal therapy • Differentiates endocervical from endometrial adenocarcinomas ERBB2 (HercepTest) 0049174 • Aids in identifying breast cancer patients eligible for Herceptin therapy ERBB2 (HercepTest) with reflex 0049178 See ERBB2. to FISH if 2+ HNPCC 0049302 See Mismatch repair (MSI). • Distinguishes primary from secondary
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Patterns of Green Fluorescent Protein Expression in Transgenic Plants

    Patterns of Green Fluorescent Protein Expression in Transgenic Plants

    Color profile: Generic CMYK printer profile Composite Default screen Plant Molecular Biology Reporter 18: 141a–141i, 2000 © 2000 International Society for Plant Molecular Biology. Printed in Canada. Publish by Abstract Patterns of Green Fluorescent Protein Expression in Transgenic Plants BRIAN K. HARPER1 and C. NEAL STEWART JR.2,* 1Novartis Agricultural Biotechnology Research, Inc., 3054 Cornwallis Rd., Research Triangle Park, NC 27709; 2Dept of Biology, University of North Carolina, Greensboro, NC 27402-6174 Abstract. Modified forms of genes encoding green fluorescent protein (GFP) can be mac- roscopically detected when expressed in whole plants. This technology has opened up new uses for GFP such as monitoring transgene presence and expression in the environment once it is linked or fused to a gene of interest. When whole-plant or whole-organ GFP vi- sualization is required, GFP should be predictably expressed and reliably fluorescent. In this study the whole plant expression and fluorescence patterns of a mGFP5er gene driven by the cauliflower mosaic virus 35S promoter was studied in intact GFP-expressing trans- genic tobacco (Nicotiana tabacum cv. Xanthi). It was shown that GFP synthesis levels in single plant organs were similar to GUS activity levels from published data when driven by the same promoter. Under the control of the 35S promoter, high expression of GFP can be used to visualize stems, young leaves, flowers, and organs where the 35S promoter is most active. Modified forms of GFP could replace GUS as the visual marker gene of choice. Key words: expression patterns, green fluorescent protein, marker genes Patterns of IntroductionGFP expression Harper and Stewart Since the discovery of green fluorescent protein (GFP) from the jellyfish Aequorea victoria it has become a frequently used tool in biology.
  • Supplementary Materials and Method Immunostaining and Western Blot

    Supplementary Materials and Method Immunostaining and Western Blot

    Supplementary Materials and Method Immunostaining and Western Blot Analysis For immunofluorescence staining, mouse and human cells were fixed with 4% paraformaldehyde- PBS for 15 min. Following Triton-X100 permeabilization and blocking, cells were incubated with primary antibodies overnight at 4°C following with Alexa 594-conjugated secondary antibodies at 4°C for 1 hour (Thermo Fisher Scientific, 1:1000). Samples were mounted using VECTASHIELD Antifade Mounting Medium with DAPI (Vector Laboratories) and immunofluorescence was detected using Olympus confocal microscopy. For western blot analysis, cells were lysed on ice using RIPA buffer supplemented with protease and phosphatase inhibitors (Sigma). Primary Antibodies for Immunostaining and Western Blot Analysis: Yap (14074, Cell Signaling), pYAP (4911, Cell Signaling), Lats1 (3477, Cell Signaling), pLats1( 8654, Cell Signaling), Wnt5a (2530, Cell Signaling), cleaved Caspase-3 (9661, Cell Signaling), Ki-67 (VP-K451, Vector Laboratories), Cyr61 (sc-13100, Santa Cruz Biotechnology), CTGF (sc-14939, Santa Cruz Biotechnology), AXL (8661, Cell Signaling), pErk (4376, Cell Signaling), pMEK (4376, Cell Signaling), Ck-19 (16858-1-AP, Proteintech), Actin (A2228, Sigma Aldrich), Vinculin (V4139, Sigma Aldrich), Kras (sc-30, Santa Cruz Biotechnology). Ectopic expression of YAP1 and WNT5A in mouse and human cells To generate YAP1S127A-expressing stable Pa04C cells, Pa04C cells were transfected with a linearized pcDNA3.1 plasmid with or without YAP1 cDNA containing S127A substitution. Two days post-transfection using Lipofectamine1000, cultures were selected in G418 (Sigma) and single clones were picked and expanded for further analysis. Overexpression of YAPS127A or WNT5A in human or mouse cells other than Pa04C were acheieved with lentivral infection. Briefly, lentivirus infection was performed by transfecting 293T cells with either GFP control, YAP1S127A, or WNT5A cloned in pHAGE lentivirus vector {EF1α promoter-GW-IRES-eGFP (GW: Gateway modified)}.
  • Detection of Interacting Transcription Factors in Human Tissues Using

    Detection of Interacting Transcription Factors in Human Tissues Using

    Myšičková and Vingron BMC Genomics 2012, 13(Suppl 1):S2 http://www.biomedcentral.com/1471-2164/13/S1/S2 PROCEEDINGS Open Access Detection of interacting transcription factors in human tissues using predicted DNA binding affinity Alena Myšičková*, Martin Vingron From The Tenth Asia Pacific Bioinformatics Conference (APBC 2012) Melbourne, Australia. 17-19 January 2012 Abstract Background: Tissue-specific gene expression is generally regulated by combinatorial interactions among transcription factors (TFs) which bind to the DNA. Despite this known fact, previous discoveries of the mechanism that controls gene expression usually consider only a single TF. Results: We provide a prediction of interacting TFs in 22 human tissues based on their DNA-binding affinity in promoter regions. We analyze all possible pairs of 130 vertebrate TFs from the JASPAR database. First, all human promoter regions are scanned for single TF-DNA binding affinities with TRAP and for each TF a ranked list of all promoters ordered by the binding affinity is created. We then study the similarity of the ranked lists and detect candidates for TF-TF interaction by applying a partial independence test for multiway contingency tables. Our candidates are validated by both known protein-protein interactions (PPIs) and known gene regulation mechanisms in the selected tissue. We find that the known PPIs are significantly enriched in the groups of our predicted TF-TF interactions (2 and 7 times more common than expected by chance). In addition, the predicted interacting TFs for studied tissues (liver, muscle, hematopoietic stem cell) are supported in literature to be active regulators or to be expressed in the corresponding tissue.
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
  • EP3 Prostate Adenocarcinoma Metastasis to the Bilateral Ureters

    EP3 Prostate Adenocarcinoma Metastasis to the Bilateral Ureters

    Autopsy, Forensic, Grossing 004 Id: EP3 Prostate Adenocarcinoma Metastasis to the Bilateral Ureters: An Unusual Pattern Suvra Roy, MD, L. Maximilian Buja, MD, University of Texas Health Science Center at Houston We report an autopsy of a patient with prostate cancer who had hydronephrosis and sepsis due to obstruction from Downloaded from https://academic.oup.com/ajcp/article/144/suppl_2/A004/1772163 by guest on 23 September 2021 bilateral ureteral metastasis of prostate adenocarcinoma. He was an 82-year-old man who presented to the emergency department with weakness and shortness of breath. Fifteen years earlier, he had been diagnosed with prostate cancer , underwent chemotherapy, and was in remission for 10 years. Eighteen months ago, he developed a recurrence and began chemotherapy again but, because of his worsening renal condition, stopped the chemotherapy about 4 months ago. On admission, he was found to have chronic kidney disease, stage 5, and sepsis. Abdominal CT was negative for genitourinary mass. His condition deteriorated rapidly and he developed bradycardia and then pulseless electrical activity (PEA). He went into cardiac arrest for 30 minutes without return of pulse and remained in PEA. His poor prognosis was explained to his family and, per the family’s wishes, resuscitation was stopped, and the patient died. Autopsy revealed bilateral dilated renal pelvis, trabeculated urinary bladder and enlarged prostate. No gross evidence of metastasis was identified in lymph nodes or bone. However, the openings of the ureters revealed papillary masses involving the distal ureters bilaterally, but not involving the bladder. Microscopic examination of the masses revealed atypical tumor cells with highly pleomorphic features.
  • Characterization of FLT3-Itdmut Acute Myeloid Leukemia

    Characterization of FLT3-Itdmut Acute Myeloid Leukemia

    Travaglini et al. Blood Cancer Journal (2020) 10:85 https://doi.org/10.1038/s41408-020-00352-9 Blood Cancer Journal ARTICLE Open Access Characterization of FLT3-ITDmut acute myeloid leukemia: molecular profiling of leukemic precursor cells Serena Travaglini1, Daniela Francesca Angelini 2, Valentina Alfonso1, Gisella Guerrera2,SerenaLavorgna1, Mariadomenica Divona1, Anna Maria Nardozza1, Maria Irno Consalvo1, Emiliano Fabiani1,MarcoDeBardi 2, Benedetta Neri3,FabioForghieri4, Francesco Marchesi5, Giovangiacinto Paterno1, Raffaella Cerretti1, Eva Barragan 6, Valentina Fiori7,SabrinaDominici7, Maria Ilaria Del Principe1, Adriano Venditti 1, Luca Battistini2, William Arcese1, Francesco Lo-Coco1, Maria Teresa Voso 1,2 and Tiziana Ottone1,2 Abstract Acute myeloid leukemia (AML) with FLT3-ITD mutations (FLT3-ITDmut) remains a therapeutic challenge, with a still high relapse rate, despite targeted treatment with tyrosine kinase inhibitors. In this disease, the CD34/CD123/CD25/CD99+ leukemic precursor cells (LPCs) phenotype predicts for FLT3-ITD-positivity. The aim of this study was to characterize the distribution of FLT3-ITD mutation in different progenitor cell subsets to shed light on the subclonal architecture of FLT3-ITDmut AML. Using high-speed cell sorting, we sequentially purified LPCs and CD34+ progenitors in samples from patients with FLT3-ITDmut AML (n = 12). A higher FLT3-ITDmut load was observed within CD34/CD123/CD25/CD99+ LPCs, as compared to CD34+ progenitors (CD123+/−,CD25−,CD99low/−)(p = 0.0005) and mononuclear cells (MNCs) (p < 0.0001). This was associated with significantly increased CD99 mean fluorescence intensity in LPCs. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Significantly higher FLT3-ITDmut burden was also observed in LPCs of AML patients with a small FLT3-ITDmut clones at diagnosis.
  • Germ Cell Origin of Testicular Carcinoid Tumors Phillip H

    Germ Cell Origin of Testicular Carcinoid Tumors Phillip H

    Imaging, Diagnosis, Prognosis Germ Cell Origin of Testicular Carcinoid Tumors Phillip H. Abbosh,1Shaobo Zhang,1Gregory T.MacLennan,3 Rodolfo Montironi,4 Antonio Lopez-Beltran,5 Joseph P. Rank,6 LeeAnn Baldridge,1and Liang Cheng1, 2 Abstract Purpose: Carcinoids are neuroendocrine tumors and most frequently occur within tissues derived from the embryonic gut.These tumors can occur in any organ site but are rare in the testis. The cell type giving rise to testicular carcinoid is unknown.We hypothesized that testicular carci- noid may have a germ cell origin. Experimental Design: We describe our analysis of protein and genetic markers of germ cell neoplasia, using immunohistochemistry and fluorescence in situ hybridization, in four testicular carcinoid tumors. Results: All four cases of testicular carcinoid tumor arose in a background of mature teratoma. Isochromosome 12p was identified in carcinoid tumor cells in all four samples. 12p overrepresen- tation was also observed in three cases. Isochromosome 12p and 12p overrepresentation were present in cells of coexisting mature teratoma in three cases. Carcinoid tumors showed strong immunoreactivity for synaptophysin and chromogranin, but no immunoreactivity for OCT4, CD30, c-kit,TTF-1, and CDX2. Membranous and cytoplasmic staining for h-catenin was detected in three cases. Conclusion: Our findings suggest that testicular carcinoid represents a phenotypic expression of testicular teratoma and is of germ cell origin. Testicular carcinoid tumor is rare. It was originally reported in Materials and Methods 1954 by Simon (1) who described it as part of a cystic teratoma, and additional cases have been subsequently reported. All Patients. We analyzed four cases of testicular carcinoid tumor.
  • Corneal Endotheliitis with Cytomegalovirus Infection of Persisted

    Corneal Endotheliitis with Cytomegalovirus Infection of Persisted

    Correspondence 1105 Sir, resulted in gradual decreases of KPs, but graft oedema Corneal endotheliitis with cytomegalovirus infection of persisted. Vision decreased to 20/2000. corneal stroma The patient underwent a second keratoplasty combined with cataract surgery in August 2007. Although involvement of cytomegalovirus (CMV) in The aqueous humour was tested for polymerase corneal endotheliitis was recently reported, the chain reaction to detect HSV, VZV, or CMV; a positive pathogenesis of this disease remains uncertain.1–8 Here, result being obtained only for CMV-DNA. Pathological we report a case of corneal endotheliitis with CMV examination demonstrated granular deposits in the infection in the corneal stroma. deep stroma, which was positive for CMV by immunohistochemistry (Figures 2a and b). The cells showed a typical ‘owl’s eye’ morphology (Figure 2c). Case We commenced systemic gancyclovir at 10 mg per day A 44-year-old man was referred for a gradual decrease in for 7 days, followed by topical 0.5% gancyclovir eye vision with a history of recurrent iritis with unknown drops six times a day. With the postoperative follow-up aetiology. The corrected visual acuity in his right eye was period of 20 months, the graft remained clear without 20/200. Slit lamp biomicroscopy revealed diffuse corneal KPs (Figure 1d). The patient has been treated with oedema with pigmented keratic precipitates (KPs) gancyclovir eye drops t.i.d. to date. His visual acuity without anterior chamber cellular reaction (Figure 1a). improved to 20/20, and endothelial density was The patient had undergone penetrating keratoplasty in 2300/mm2. Repeated PCR in aqueous humour for August 2006, and pathological examination showed non- CMV yielded a negative result in the 10th week.
  • Single-Cell RNA Sequencing Demonstrates the Molecular and Cellular Reprogramming of Metastatic Lung Adenocarcinoma

    Single-Cell RNA Sequencing Demonstrates the Molecular and Cellular Reprogramming of Metastatic Lung Adenocarcinoma

    ARTICLE https://doi.org/10.1038/s41467-020-16164-1 OPEN Single-cell RNA sequencing demonstrates the molecular and cellular reprogramming of metastatic lung adenocarcinoma Nayoung Kim 1,2,3,13, Hong Kwan Kim4,13, Kyungjong Lee 5,13, Yourae Hong 1,6, Jong Ho Cho4, Jung Won Choi7, Jung-Il Lee7, Yeon-Lim Suh8,BoMiKu9, Hye Hyeon Eum 1,2,3, Soyean Choi 1, Yoon-La Choi6,10,11, Je-Gun Joung1, Woong-Yang Park 1,2,6, Hyun Ae Jung12, Jong-Mu Sun12, Se-Hoon Lee12, ✉ ✉ Jin Seok Ahn12, Keunchil Park12, Myung-Ju Ahn 12 & Hae-Ock Lee 1,2,3,6 1234567890():,; Advanced metastatic cancer poses utmost clinical challenges and may present molecular and cellular features distinct from an early-stage cancer. Herein, we present single-cell tran- scriptome profiling of metastatic lung adenocarcinoma, the most prevalent histological lung cancer type diagnosed at stage IV in over 40% of all cases. From 208,506 cells populating the normal tissues or early to metastatic stage cancer in 44 patients, we identify a cancer cell subtype deviating from the normal differentiation trajectory and dominating the metastatic stage. In all stages, the stromal and immune cell dynamics reveal ontological and functional changes that create a pro-tumoral and immunosuppressive microenvironment. Normal resident myeloid cell populations are gradually replaced with monocyte-derived macrophages and dendritic cells, along with T-cell exhaustion. This extensive single-cell analysis enhances our understanding of molecular and cellular dynamics in metastatic lung cancer and reveals potential diagnostic and therapeutic targets in cancer-microenvironment interactions. 1 Samsung Genome Institute, Samsung Medical Center, Seoul 06351, Korea.
  • IHC) Outreach Services

    IHC) Outreach Services

    Immunohistochemistry (IHC) Outreach Services Note t ype of fixative used if not neutral buffered f ormalin. Note t ype of tissue/specim en Unless specified otherwise, positive and negative controls react satisfactoril y. Antibody Classif ications: – IVD (In Vitro Diagnosis) – No disclaimer required. – ASR (Anal yte Specific Reagent) – m ust use a disclaimer on the report (See Belo w) ASR required disclaimer T his test was developed a nd its perform ance characteristics determ ined b y Marshf ield Labs. It has not been cleared or approved b y th e U.S. Food and Drug Adm inistration. T he FDA has determ ined that such clearance or approval is not necessar y. T his test is used f or clinical purposes. It should not be regarded as investigational or f or research. T his laborator y is certif ied under the Clinical Laborator y Im provem ent Am endm ents (CLIA) as qualified to perf orm high-complexity testing. Available Chrom ogen – All m ark ers have been validated with 3,3’-Diam inobenzidine T etrah ydrochloride (DAB) which results in a bro wn/black precipitate. DAB is the routine chrom ogen. In addition, som e m ark ers have also been validated using the Fast Red (RED), which results in a re d precipitate. If available wit h both chrom ogens and one is not selected, the def ault will be t he DAB chrom ogen. Antibod y Common Applications Staining Characteristics/Cla ssification If Other Than IVD Actin (muscle specific) Smooth, skeletal & cardiac muscle Cytoplasmic Actin (smooth muscle) Smooth muscle and myoepithelial cells Cytoplasmic and membrane Adrenocorticotropin (ACTH) Pituitary neoplasms Cytoplasmic Alpha-1-Fetoprotein (AFP) Hepatoma, germ cell tumors Cytoplasmic ALK Protein ALK1 positive lymphomas Cytoplasmic and/or nuclear Alpha-1-Antitrypsin Demonstrates A-1-AT in liver Cytoplasmic (A-1-AT) Bcl-2 Oncoprotein Follicular lymphoma and soft tissue Cytoplasmic tumors Bcl-6 Follicular lymphoma Nuclear Ber-EP4, Epithelial Antigen Adenocarcinoma vs.
  • Immunohistochemistry Immunohistochemistry

    Immunohistochemistry Immunohistochemistry

    !"#$%&'"()(*+$(,$-#)&.(-&/$ 0--1.("23'(4"#-23'5+$$ 65.&17$7#$)&$8(14"&57295#$:;<$=";$ >+(.<$85&.4#$ Immunohistochemistry Immunohistochemistry It’s all about chosing the adapted anbody(ies) Immunohistochemistry It’s all about chosing the adapted anbody(ies) for the selected task(s) AnAbodies • « Melanocyc » anbodies – S100 – MelanA – HMB45 – PNL2 – MiTF Specificity vs Sensivity – SOX10 – … • « Anomaly-specific » anbodies – BRAF V600E – NRAS Q61R – ALK – ROS1 – NTRK1 – MET – P16 – BAP1 – PDL1 – … • Other anbodies – D2-40 – CD68 HMB45 – … AnAbodies • « Melanocyc » anbodies – S100 – MelanA – HMB45 – PNL2 – MiTF – SOX10 – … • « Anomaly-specific » anbodies – BRAF V600E – NRAS Q61R – ALK – ROS1 – NTRK1 – MET – P16 – BAP1 – PDL1 – … • Other anbodies – D2-40 – CD68 NTRK1 – … AnAbodies • « Melanocyc » anbodies – S100 – MelanA – HMB45 – PNL2 – MiTF – SOX10 – … • « Anomaly-specific » anbodies – BRAF V600E – NRAS Q61R – ALK – ROS1 – NTRK1 – MET – P16 – BAP1 – PDL1 – … • Other anbodies (DD mainly) – D2-40 – CD68 – … Why perform IHC? • Confirm melanocyc lineage • Visualize the melanocytes • Benign vs Malignant • Molecular characterizaon A. Confirm melanocyc lineage • Unpigmented dermal or ulcerated tumor (No recognizable junconal melanocytes) • Unpigmented metastases • Desmoplasc melanoma A1. Confirm melanocyc lineage Unpigmented dermal or ulcerated tumor M, 65 Back 6Ha$[(.T5-$-#)&.(4+A4$)2.#&*#$ b.%2*-#.'#7$7#5-&)$(5$1)4#5&'#7$'1-(5$$ b.%2*-#.'#7$.#3'$(,$#%2'"#)2(27$4#))3$ A1. Confirm melanocyc lineage Unpigmented dermal or ulcerated tumor S100 Protein 6Ha$[(.T5-$-#)&.(4+A4$)2.#&*#$