Calbindin-D28k and Its Role in Apoptosis: Inhibition of Caspase-3 Activity and Interaction with Pro-Caspase-3 Investigated by In-Situ FRET Microscopy

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Dissertation Aus dem Physiologischen Institut Lehrstuhl: Physiologie – Zelluläre Physiologie (Biomedizinisches Zentrum München) der Ludwig-Maximilians-Universität München Vorstand: Prof. Dr. Claudia Veigel Calbindin-D28k and its role in apoptosis: Inhibition of Caspase-3 activity and interaction with Pro-Caspase-3 investigated by in-situ FRET microscopy. Dissertation zum Erwerb des Doktorgrades der Medizin an der Medizinischen Fakultät der Ludwig-Maximilians-Universität zu München vorgelegt von Johannes Lohmeier aus Bong Town, Liberia 2018 Mit Genehmigung der Medizinischen Fakultät der Universität München Berichterstatter: Prof. Dr. Michael Meyer Prof. Dr. Alexander Faussner Mitberichterstatter: Prof. Dr. Nikolaus Plesnila Prof. Dr. Dr. Bernd Sutor Dekan: Prof. Dr. med. dent. Reinhard Hickel Tag der mündlichen Prüfung: 14.06.2018 Eidesstattliche Versicherung Lohmeier, Johannes Name, Vorname Ich erkläre hiermit an Eides statt, dass ich die vorliegende Dissertation mit dem Thema Calbindin-D28k and its role in apoptosis: Inhibition of Caspase-3 activity and interaction with Pro-Caspase-3 investigated by in-situ FRET microscopy. selbständig verfasst, mich außer der angegebenen keiner weiteren Hilfsmittel bedient und alle Erkenntnisse, die aus dem Schrifttum ganz oder annähernd übernommen sind, als solche kenntlich gemacht und nach ihrer Herkunft unter Bezeichnung der Fundstelle einzeln nachgewiesen habe. Ich erkläre des Weiteren, dass die hier vorgelegte Dissertation nicht in gleicher oder in ähnlicher Form bei einer anderen Stelle zur Erlangung eines akademischen Grades eingereicht wurde. München, den 23.12.2016 Table of contents 1. Introduction ....................................................................................................................... 1 1.1. Calbindin-D28k (CBD28k) .....................................................................................................1 1.1.1. EF-hand motif ................................................................................................................. 3 1.1.2. Cytoprotection ................................................................................................................ 3 1.1.3. Intermolecular interaction ............................................................................................ 4 1.2. Apoptosis ................................................................................................................................ 7 1.3. Förster resonance energy transfer (FRET) .................................................................... 10 1.3.1. Theoretical background of FRET ............................................................................... 10 1.3.2. FRET microscopy .......................................................................................................... 13 1.3.2.1. Acceptor-Photobleaching (PB) .......................................................................... 14 1.3.2.2. Sensitized Emission (SE) ..................................................................................... 15 1.3.3. Fluorescent proteins (FPs) ......................................................................................... 17 1.3.4. FRET Caspase-3 biosensor ........................................................................................ 19 1.4. Research objectives ........................................................................................................... 20 1.4.1. Pilot experiment: In-situ assay of Caspase-3 activity upon expression of Calbindin-D28k ....................................................................................................................... 20 1.4.2. Investigation of intermolecular interaction between Calbindin-D28k and Pro- Caspase-3 by Acceptor-Photobleaching and Sensitized Emission ............................. 21 2. Materials and methods ............................................................................................... 22 2.1. Molecular biology ............................................................................................................... 26 2.1.1. pCMV5 vector plasmid ................................................................................................ 26 2.1.2. Primer design and Polymerase Chain Reaction (PCR) ........................................ 27 2.1.2.1. mAmetrine primers .............................................................................................. 27 2.1.2.2. Calbindin-D28k primers ...................................................................................... 28 2.1.2.3. tdTomato primers ................................................................................................ 28 2.1.2.4. Caspase-3 primers ............................................................................................... 29 2.1.2.5. Partial IMPase primers ........................................................................................ 29 2.1.3. Restriction enzyme (RE) digestion .......................................................................... 30 2.1.4. Gel electrophoresis (GE) ............................................................................................ 30 2.1.5. Ligation of DNA ............................................................................................................ 31 2.1.6. Purification of DNA ..................................................................................................... 31 2.1.7. DNA sequencing .......................................................................................................... 31 2.1.8. SDS-Page and Western Blot ..................................................................................... 31 2.2. Cellular biology .................................................................................................................... 34 2.2.1. Transformation ............................................................................................................. 34 2.2.2. Isolation and expansion of clones ........................................................................... 34 2.2.3. Plasmid preparation .................................................................................................... 34 2.2.4. Preparation of eukaryotic cell lines ........................................................................ 35 2.2.5. Transient transfection ................................................................................................ 36 2.2.6. Application of cytotoxic agents ............................................................................... 37 2.2.7. Preparation of slides for confocal microscopy ..................................................... 38 2.3. Confocal-Imaging................................................................................................................ 39 2.3.1. Imaging-Configuration ............................................................................................... 40 2.3.2. Data acquisition and analysis ................................................................................... 41 2.4. Miscellaneous ..................................................................................................................... 42 3. Results ............................................................................................................................ 43 3.1. Fusion proteins .................................................................................................................... 43 3.1.1. FRET donor: mAmetrine-CBD28k ............................................................................. 43 3.1.2. FRET acceptor: tdTomato-CASP3 ............................................................................ 44 3.1.3. FRET acceptor: tdTomato-pIMPase ......................................................................... 45 3.2. Pilot experiments ............................................................................................................... 46 3.2.1. Signal increase upon photobleaching ................................................................ 46 3.2.2. mTurquoise2 spectral bleed-through (SBT) ..................................................... 48 3.2.3. In-situ assay of Caspase-3 activity upon expression of Calbindin-D28k .. 49 3.3. Investigation of intermolecular interaction between Calbindin-D28k and Pro- Caspase-3 by Acceptor-Photobleaching and Sensitized Emission ................................. 54 4. Discussion ...................................................................................................................... 59 5. Summary ........................................................................................................................ 70 References .......................................................................................................................... 71 Appendix ............................................................................................................................ 79 Suppl.: pCMV5 plasmid Suppl.: mAmetrine forward and reverse primer Suppl.: CBD28k forward and reverse primer Suppl.: tdTomato forward and reverse primer Suppl.: CASP3 forward and reverse primer Suppl.: IMPase secondary structure Suppl.: pIMPase design and construction Suppl.: mAmetrine (w/ linker and w/o TAA stop codon) + EcoR1 + CBD28k (w/ stop codon) inserted in pCMV5 MCS Suppl.: TdTomato (w/o TAA stop codon) + Kpn1 + GTT-Linker + CASP3 (w/ stop codon) inserted in pCMV5 MCS Suppl.: tdTomato (w/o TAA stop codon) +
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Altered Calcium Handling in Cerebellar Purkinje Neurons with the Malignant Hyperthermia Mutation, Ryr1-Y522S/+

    Altered Calcium Handling in Cerebellar Purkinje Neurons with the Malignant Hyperthermia Mutation, Ryr1-Y522S/+

    University of Denver Digital Commons @ DU Electronic Theses and Dissertations Graduate Studies 1-1-2011 Altered Calcium Handling in Cerebellar Purkinje Neurons with the Malignant Hyperthermia Mutation, RyR1-Y522S/+ George C. Talbott University of Denver Follow this and additional works at: https://digitalcommons.du.edu/etd Part of the Biochemistry, Biophysics, and Structural Biology Commons, and the Biology Commons Recommended Citation Talbott, George C., "Altered Calcium Handling in Cerebellar Purkinje Neurons with the Malignant Hyperthermia Mutation, RyR1-Y522S/+" (2011). Electronic Theses and Dissertations. 638. https://digitalcommons.du.edu/etd/638 This Thesis is brought to you for free and open access by the Graduate Studies at Digital Commons @ DU. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ DU. For more information, please contact [email protected],[email protected]. ALTERED CALCIUM HANDLING IN CEREBELLAR PURKINJE NEURONS WITH THE MALIGNANT HYPERTHERMIA MUTATION, RYR1 Y522S/+ __________ A Thesis Presented to The Faculty of Natural Sciences and Mathematics University of Denver __________ In Partial Fulfillment of the Requirements for the Degree Master of Science __________ by George C. Talbott June 2011 Advisor: Nancy M. Lorenzon, PhD ©Copyright by George C. Talbott 2011 All Rights Reserved Author: George C. Talbott Title: ALTERED CALCIUM HANDLING IN CEREBELLAR PURKINJE NEURONS WITH THE MALIGNANT HYPERTHERMIA MUTATION, RYR1 Y522S/+ Advisor: Nancy M. Lorenzon, PhD Degree Date: June 2011 Abstract To investigate the etiology of malignant hyperthermia and central core disease, mouse models have recently been generated and characterized (Chelu et al., 2006). These RyR Y522S/+ knock-in mutant mice provide an excellent tool to investigate calcium dysregulation, its pathological consequences, and potential therapeutic approaches.
  • 32-4621: Recombinant Rat Calbindin-1 Description Product

    32-4621: Recombinant Rat Calbindin-1 Description Product

    ABGENEX Pvt. Ltd., E-5, Infocity, KIIT Post Office, Tel : +91-674-2720712, +91-9437550560 Email : [email protected] Bhubaneswar, Odisha - 751024, INDIA 32-4621: Recombinant Rat Calbindin-1 Alternative Name : Calbindin,Vitamin D-dependent calcium-binding protein,avian-type,Calbindin D28,D-28K,Spot 35 protein,Calb1,CaBP28K,MGC93326. Description Source : Escherichia Coli. Recombinant Rat Calbindin-1 produced in E.Coli.The Rat CALB1 is purified by proprietary chromatographic techniques. Calbindins are Ca-binding proteins belonging to the troponin C superfamily. CALB28K/Calbindin1/CALB1 (D28K/Spot35 protein or cholecalcin, rat 261 aa; mouse 261 aa; human 261-aa, chromosome 8q21.3-q22.1) was originally described as 27-kDA induced by vitamin D in the duodenum of chicken. In mammals, it is expressed in the kidney, pancreatic islets, and brain. In brain, its synthesis is independent of vitamin D. CABP28K contains 4 active and 2 inactive EF-hand Ca-binding domains. The gene for CABP28K is clustered in the same region as carbonic anhydrase. The neurons in the brains of patients with Huntington disease are CAB28K depleted. There are two types of CaBPs: the 'trigger'- and the 'buffer'-CaBPs. The conformation of 'trigger' type CaBPs changes upon Ca2+ binding and exposes regions on protein that interact with target molecules, thus altering their activity. The buffer-type CABP are thought to control the intracellular calcium concentration. Calbindin D-28K is found predominantly in subpopulations of central and peripheral nervous system neurons, and in certain epithelial cells involved in Ca2+ transport such as distal tubular cells and cortical collecting tubules of the kidney, and in enteric neuroendocrine cells.
  • Myoplasmic Resting Ca2+ Regulation by Ryanodine Receptors Is

    Myoplasmic Resting Ca2+ Regulation by Ryanodine Receptors Is

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Georgia State University Georgia State University ScholarWorks @ Georgia State University Chemistry Faculty Publications Department of Chemistry 2014 Myoplasmic resting Ca2+ regulation by ryanodine receptors is under the control of a novel Ca2+- binding region of the receptor Yanyi Chen Georgia State University, [email protected] Shenghui Xue Georgia State University, [email protected] Juan Zou Georgia State University, [email protected] Jose Lopez University of California, Davis Jenny J. Yang Georgia State University, [email protected] See next page for additional authors Follow this and additional works at: http://scholarworks.gsu.edu/chemistry_facpub Part of the Chemistry Commons Recommended Citation Chen, Yanyi; Xue, Shenghui; Zou, Juan; Lopez, Jose; Yang, Jenny J.; and Perez, Claudio, "Myoplasmic resting Ca2+ regulation by ryanodine receptors is under the control of a novel Ca2+-binding region of the receptor" (2014). Chemistry Faculty Publications. Paper 10. http://scholarworks.gsu.edu/chemistry_facpub/10 This Article is brought to you for free and open access by the Department of Chemistry at ScholarWorks @ Georgia State University. It has been accepted for inclusion in Chemistry Faculty Publications by an authorized administrator of ScholarWorks @ Georgia State University. For more information, please contact [email protected]. Authors Yanyi Chen, Shenghui Xue, Juan Zou, Jose Lopez, Jenny J. Yang, and Claudio Perez This article is available at ScholarWorks @ Georgia State University: http://scholarworks.gsu.edu/chemistry_facpub/10 Biochem. J. (2014) 460, 261–271 (Printed in Great Britain) doi:10.1042/BJ20131553 261 Myoplasmic resting Ca2 + regulation by ryanodine receptors is under the control of a novel Ca2 + -binding region of the receptor Yanyi CHEN*1, Shenghui XUE*1, Juan ZOU*, Jose R.
  • IHC Test Menu

    IHC Test Menu

    Immunohistochemistry Test Menu A Alpha fetoprotein [I AFP] CD99 Ewings sarcoma PNET [I CD99] Anaplastic lymphoma kinase -1 [I ALK] CD103 Integrin alpha E [I CD103] Androgen receptor [I ANDRO]* CD117 C-Kit, myeloid, mast cells, GIST [I CD117] Annexin A1, hairy cell, B cell lymphoma [I ANXA1] CD138 plasma cells, subset epithelial cells [I CD138] Anti-Arginase-1 [I ARGINASE] CD163 histiocytes [I CD163] CDK4 cyclin-depdendent kinase-4, clone DCS-31 [I CDK4] B CDX2 colorectal carcinoma [I CDX2] BCL2 follicular lymphoma, apoptosis inhibiting protein [I BCL2] Chromogranin A [I CHROGRAN] BCL6 follicle center B-cell [I BCL6] CMYC C-MYC oncoprotein [I CMYC] BER EP4 Epithelial antigen [I BER EP4] Collagen IV, basement membrane protein [I CLLGIV] BRAF [I V600E] Cyclin D1/PRAD1 mantle cell lymphoma [I CYCLIN] Cytokeratin 5/6, squamous, mesothelial [I CK5/6] C Cytokeratin 7, 54kD [I CK7] CA 19-9 pancreas, liver, ovary, lung tumors [I CA19 9] Cytokeratin 7/8 CAM5.2 [I CAM 5.2] CA 125 epitheliod malignancies ovary, breast [I CA125] Cytokeratin 8, 35BH11 [I CK8] Calcitonin [I CALCT] Cytokeratin 8/18, adenocarcinoma [I CK8/18] Caldesmon, smooth muscle [I CALDSM] Cytokeratin 19 [I CK19] Calretinin; Calcium binding protein [I CALRT] Cytokeratin 20 [I CK20] CAM 5.2 Cytokeratin 7/Cytokeratin 8 [I CAM 5.2] Cytokeratin cocktail, PAN (AE1/AE3) [I AE1/AE3] Carcinoembryonic antigen (CEA) [I CEA] Cytokeratin high molecular weight; 34BE12 [I CK HMW] Cathepsin D, breast carcinoma [I CATHD] Cytomegalovirus [I CMV] CD1a cortical thymocyctes, Langerhans cells [I CD1a]
  • Changes in Transcript and Protein Levels of Calbindin D28k, Calretinin

    Changes in Transcript and Protein Levels of Calbindin D28k, Calretinin

    Original Article doi: 10.5115/acb.2010.43.3.218 pISSN 2093-3665 eISSN 2093-3673 Changes in transcript and protein levels of calbindin D28k, calretinin and parvalbumin, and numbers of neuronal populations expressing these proteins in an ischemia model of rat retina Shin Ae Kim, Ji Hyun Jeon, Min Jeong Son, Jiook Cha, Myung-Hoon Chun, In-Beom Kim Department of Anatomy, College of Medicine, The Catholic University of Korea, Seoul, Korea Abstract: Excessive calcium is thought to be a critical step in various neurodegenerative processes including ischemia. Calbindin D28k (CB), calretinin (CR), and parvalbumin (PV), members of the EF-hand calcium-binding protein family, are thought to play a neuroprotective role in various pathologic conditions by serving as a buffer against excessive calcium. The expression of CB, PV and CR in the ischemic rat retina induced by increasing intraocular pressure was investigated at the transcript and protein levels, by means of the quantitative real-time reverse transcription-polymerase chain reaction, western blot and immunohistochemistry. The transcript and protein levels of CB, which is strongly expressed in the horizontal cells in both normal and affected retinas, were not changed significantly and the number of CB-expressing horizontal cells remained unchanged throughout the experimental period 8 weeks after ischemia/reperfusion injury. At both the transcript and protein levels, however, CR, which is strongly expressed in several types of amacrine, ganglion, and displaced amacrine cells in both normal and affected retinas, was decreased. CR-expressing ganglion cell number was particularly decreased in ischemic retinas. Similar to the CR, PV transcript and protein levels, and PV-expressing AII amacrine cell number were decreased.
  • This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research

    This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research

    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Al Ahdal, Hadil Title: Investigating the role of miR-21 in adult neurogenesis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. Investigating the role of miR-21 in adult neurogenesis Hadil Mohammad Al Ahdal Faculty of Health Sciences Bristol Medical School A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School 64,598 words Abstract MicroRNAs (miRNAs) are a class of small non-coding RNAs that act as post- transcriptional regulators and play important roles in neurodegenerative diseases and brain disorders (Nelson et al.
  • Immunohistochemistry Stain Offerings

    Immunohistochemistry Stain Offerings

    immunohistochemistry stain offerings TRUSTED PATHOLOGISTS. INVALUABLE ANSWERS.™ MARCHMAY 20172021 www.aruplab.com/ap-ihcaruplab.com/ap-ihc InformationInformation in this brochurein this brochure is current is current as of as May of March 2021. 2017. All content All content is subject is subject to tochange. change. Please contactPlease ARUPcontact ClientARUP Services Client Services at 800-522-2787 at (800) 522-2787 with any with questions any questions or concerns.or concerns. ARUP LABORATORIES As a nonprofit, academic institution of the University of Utah and its Department We believe in of Pathology, ARUP believes in collaborating, sharing and contributing to laboratory science in ways that benefit our clients and their patients. collaborating, Our test menu is one of the broadest in the industry, encompassing more sharing and than 3,000 tests, including highly specialized and esoteric assays. We offer comprehensive testing in the areas of genetics, molecular oncology, pediatrics, contributing pain management, and more. to laboratory ARUP’s clients include many of the nation’s university teaching hospitals and children’s hospitals, as well as multihospital groups, major commercial science in ways laboratories, and group purchasing organizations. We believe that healthcare should be delivered as close to the patient as possible, which is why we support that provide our clients’ efforts to be the principal healthcare provider in the communities they serve by offering highly complex assays and accompanying consultative support. the best value Offering analytics, consulting, and decision support services, ARUP provides for the patient. clients with the utilization management tools necessary to prosper in this time of value-based care.
  • Chemical Agent and Antibodies B-Raf Inhibitor RAF265

    Chemical Agent and Antibodies B-Raf Inhibitor RAF265

    Supplemental Materials and Methods: Chemical agent and antibodies B-Raf inhibitor RAF265 [5-(2-(5-(trifluromethyl)-1H-imidazol-2-yl)pyridin-4-yloxy)-N-(4-trifluoromethyl)phenyl-1-methyl-1H-benzp{D, }imidazol-2- amine] was kindly provided by Novartis Pharma AG and dissolved in solvent ethanol:propylene glycol:2.5% tween-80 (percentage 6:23:71) for oral delivery to mice by gavage. Antibodies to phospho-ERK1/2 Thr202/Tyr204(4370), phosphoMEK1/2(2338 and 9121)), phospho-cyclin D1(3300), cyclin D1 (2978), PLK1 (4513) BIM (2933), BAX (2772), BCL2 (2876) were from Cell Signaling Technology. Additional antibodies for phospho-ERK1,2 detection for western blot were from Promega (V803A), and Santa Cruz (E-Y, SC7383). Total ERK antibody for western blot analysis was K-23 from Santa Cruz (SC-94). Ki67 antibody (ab833) was from ABCAM, Mcl1 antibody (559027) was from BD Biosciences, Factor VIII antibody was from Dako (A082), CD31 antibody was from Dianova, (DIA310), and Cot antibody was from Santa Cruz Biotechnology (sc-373677). For the cyclin D1 second antibody staining was with an Alexa Fluor 568 donkey anti-rabbit IgG (Invitrogen, A10042) (1:200 dilution). The pMEK1 fluorescence was developed using the Alexa Fluor 488 chicken anti-rabbit IgG second antibody (1:200 dilution).TUNEL staining kits were from Promega (G2350). Mouse Implant Studies: Biopsy tissues were delivered to research laboratory in ice-cold Dulbecco's Modified Eagle Medium (DMEM) buffer solution. As the tissue mass available from each biopsy was limited, we first passaged the biopsy tissue in Balb/c nu/Foxn1 athymic nude mice (6-8 weeks of age and weighing 22-25g, purchased from Harlan Sprague Dawley, USA) to increase the volume of tumor for further implantation.
  • Miz1 Is Required to Maintain Autophagic Flux

    Miz1 Is Required to Maintain Autophagic Flux

    ARTICLE Received 3 Apr 2013 | Accepted 3 Sep 2013 | Published 3 Oct 2013 DOI: 10.1038/ncomms3535 Miz1 is required to maintain autophagic flux Elmar Wolf1,*, Anneli Gebhardt1,*, Daisuke Kawauchi2, Susanne Walz1, Bjo¨rn von Eyss1, Nicole Wagner3, Christoph Renninger3, Georg Krohne1, Esther Asan3, Martine F. Roussel2 & Martin Eilers1,4 Miz1 is a zinc finger protein that regulates the expression of cell cycle inhibitors as part of a complex with Myc. Cell cycle-independent functions of Miz1 are poorly understood. Here we use a Nestin-Cre transgene to delete an essential domain of Miz1 in the central nervous system (Miz1DPOZNes). Miz1DPOZNes mice display cerebellar neurodegeneration characterized by the progressive loss of Purkinje cells. Chromatin immunoprecipitation sequencing and biochemical analyses show that Miz1 activates transcription upon binding to a non-palin- dromic sequence present in core promoters. Target genes of Miz1 encode regulators of autophagy and proteins involved in vesicular transport that are required for autophagy. Miz1DPOZ neuronal progenitors and fibroblasts show reduced autophagic flux. Consistently, polyubiquitinated proteins and p62/Sqtm1 accumulate in the cerebella of Miz1DPOZNes mice, characteristic features of defective autophagy. Our data suggest that Miz1 may link cell growth and ribosome biogenesis to the transcriptional regulation of vesicular transport and autophagy. 1 Theodor Boveri Institute, Biocenter, University of Wu¨rzburg, Am Hubland, 97074 Wu¨rzburg, Germany. 2 Department of Tumor Cell Biology, MS#350, Danny Thomas Research Center, 5006C, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, USA. 3 Institute for Anatomy and Cell Biology, University of Wu¨rzburg, Koellikerstrasse 6, 97070 Wu¨rzburg, Germany. 4 Comprehensive Cancer Center Mainfranken, Josef-Schneider-Strasse 6, 97080 Wu¨rzburg, Germany.
  • CPCA-Calb Chicken Polyclonal Antibody

    CPCA-Calb Chicken Polyclonal Antibody

    Calbindin CPCA-Calb Chicken Polyclonal Antibody Ordering Information Applications Host Isotype Molecular Wt. Species Cross-Reactivity Web www.encorbio.com Email [email protected] WB, IF/ICC, IHC Chicken IgY 28kDa Human, cow, rat, mouse Phone 352-372-7022 Fax 352-372-7066 HGNC Name: CALB1 UniProt: P05937 RRID: AB_2572237 Immunogen: Full-length recombinant human protein expressed in and purified from E. coli. Format: Supplied as an aliquot of IgY preparation plus 5mM NaN3 Storage: Stable at 4°C for 1 year. Recommended dilutions: WB: 1:5,000. IF/ICC or IHC: 1:1,000-1:5,000. References: 1. Kretsinger RH, Nockolds CE. Carp Muscle Calcium-binding Protein: II. Structure determination and general description. J. Biol. Chem. 248:3313-26 (1973). 2. Andressen C, Bliimcke I, Celio MR. Calcium- binding proteins: selective markers of nerve cells. Cell Tissue Res. 271:181-208 (1993). 3. Schwaller B, Meyer M, Schiffmann S. ‘New’ functions for ‘old’ proteins: The role of the calcium binding proteins calbindin D-28k, calretinin and parvalbumin, in cerebellar physiology. Studies with knockout mice. The Cerebellum 1:241–58 (2002). 4. Celio MR. Calbindin D-28k and parvalbumin in the rat nervous system. Neurosci. 35:375-475 Western blot analysis of different tissue lysates and recombinant Immunofluorescent analysis of rat cerebellum section stained with (1990). protein solutions using chicken pAb to calbindin, CPCA-Calb, dilution chicken pAb to calbindin, CPCA-Calb, dilution 1:2,000, in green, and 5. Condé F, et al. Local circuit neurons 1:5,000 in green: [1] protein standard (red), [2] rat cerebellum, [3] costained with rabbit pAb to MeCP2, RPCA-MeCP2, dilution 1:5,000, immunoreactive for calretinin, calbindin D‐28k pig hippocampus, [4] cow cerebellum, [5] protein standard (red).
  • Supplementary Material Contents

    Supplementary Material Contents

    Supplementary Material Contents Immune modulating proteins identified from exosomal samples.....................................................................2 Figure S1: Overlap between exosomal and soluble proteomes.................................................................................... 4 Bacterial strains:..............................................................................................................................................4 Figure S2: Variability between subjects of effects of exosomes on BL21-lux growth.................................................... 5 Figure S3: Early effects of exosomes on growth of BL21 E. coli .................................................................................... 5 Figure S4: Exosomal Lysis............................................................................................................................................ 6 Figure S5: Effect of pH on exosomal action.................................................................................................................. 7 Figure S6: Effect of exosomes on growth of UPEC (pH = 6.5) suspended in exosome-depleted urine supernatant ....... 8 Effective exosomal concentration....................................................................................................................8 Figure S7: Sample constitution for luminometry experiments..................................................................................... 8 Figure S8: Determining effective concentration .........................................................................................................