The FAD Synthetase from the Human Pathogen Streptococcus Pneumoniae: a Bifunctional Enzyme Exhibiting Activity-Dependent Redox R
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Control Engineering Perspective on Genome-Scale Metabolic Modeling
Control Engineering Perspective on Genome-Scale Metabolic Modeling by Andrew Louis Damiani A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama December 12, 2015 Key words: Scheffersomyces stipitis, Flux Balance Analysis, Genome-scale metabolic models, System Identification Framework, Model Validation, Phenotype Phase Plane Analysis Copyright 2015 by Andrew Damiani Approved by Jin Wang, Chair, Associate Professor of Chemical Engineering Q. Peter He, Associate Professor of Chemical Engineering, Tuskegee University Thomas W. Jeffries, Professor of Bacteriology, Emeritus; University of Wisconsin-Madison Allan E. David, Assistant Professor of Chemical Engineering Yoon Y. Lee, Professor of Chemical Engineering Abstract Fossil fuels impart major problems on the global economy and have detrimental effects to the environment, which has caused a world-wide initiative of producing renewable fuels. Lignocellulosic bioethanol for renewable energy has recently gained attention, because it can overcome the limitations that first generation biofuels impose. Nonetheless, in order to have this process commercialized, the biological conversion of pentose sugars, mainly xylose, needs to be improved. Scheffersomyces stipitis has a physiology that makes it a valuable candidate for lignocellulosic bioethanol production, and lately has provided genes for designing recombinant Saccharomyces cerevisiae. In this study, a system biology approach was taken to understand the relationship of the genotype to phenotype, whereby genome-scale metabolic models (GSMMs) are used in conjunction with constraint-based modeling. The major restriction of GSMMs is having an accurate methodology for validation and evaluation. This is due to the size and complexity of the models. -
(12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Open Matthew R Moreau Ph.D. Dissertation Finalfinal.Pdf
The Pennsylvania State University The Graduate School Department of Veterinary and Biomedical Sciences Pathobiology Program PATHOGENOMICS AND SOURCE DYNAMICS OF SALMONELLA ENTERICA SEROVAR ENTERITIDIS A Dissertation in Pathobiology by Matthew Raymond Moreau 2015 Matthew R. Moreau Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2015 The Dissertation of Matthew R. Moreau was reviewed and approved* by the following: Subhashinie Kariyawasam Associate Professor, Veterinary and Biomedical Sciences Dissertation Adviser Co-Chair of Committee Bhushan M. Jayarao Professor, Veterinary and Biomedical Sciences Dissertation Adviser Co-Chair of Committee Mary J. Kennett Professor, Veterinary and Biomedical Sciences Vijay Kumar Assistant Professor, Department of Nutritional Sciences Anthony Schmitt Associate Professor, Veterinary and Biomedical Sciences Head of the Pathobiology Graduate Program *Signatures are on file in the Graduate School iii ABSTRACT Salmonella enterica serovar Enteritidis (SE) is one of the most frequent common causes of morbidity and mortality in humans due to consumption of contaminated eggs and egg products. The association between egg contamination and foodborne outbreaks of SE suggests egg derived SE might be more adept to cause human illness than SE from other sources. Therefore, there is a need to understand the molecular mechanisms underlying the ability of egg- derived SE to colonize the chicken intestinal and reproductive tracts and cause disease in the human host. To this end, the present study was carried out in three objectives. The first objective was to sequence two egg-derived SE isolates belonging to the PFGE type JEGX01.0004 to identify the genes that might be involved in SE colonization and/or pathogenesis. -
Letters to Nature
letters to nature Received 7 July; accepted 21 September 1998. 26. Tronrud, D. E. Conjugate-direction minimization: an improved method for the re®nement of macromolecules. Acta Crystallogr. A 48, 912±916 (1992). 1. Dalbey, R. E., Lively, M. O., Bron, S. & van Dijl, J. M. The chemistry and enzymology of the type 1 27. Wolfe, P. B., Wickner, W. & Goodman, J. M. Sequence of the leader peptidase gene of Escherichia coli signal peptidases. Protein Sci. 6, 1129±1138 (1997). and the orientation of leader peptidase in the bacterial envelope. J. Biol. Chem. 258, 12073±12080 2. Kuo, D. W. et al. Escherichia coli leader peptidase: production of an active form lacking a requirement (1983). for detergent and development of peptide substrates. Arch. Biochem. Biophys. 303, 274±280 (1993). 28. Kraulis, P.G. Molscript: a program to produce both detailed and schematic plots of protein structures. 3. Tschantz, W. R. et al. Characterization of a soluble, catalytically active form of Escherichia coli leader J. Appl. Crystallogr. 24, 946±950 (1991). peptidase: requirement of detergent or phospholipid for optimal activity. Biochemistry 34, 3935±3941 29. Nicholls, A., Sharp, K. A. & Honig, B. Protein folding and association: insights from the interfacial and (1995). the thermodynamic properties of hydrocarbons. Proteins Struct. Funct. Genet. 11, 281±296 (1991). 4. Allsop, A. E. et al.inAnti-Infectives, Recent Advances in Chemistry and Structure-Activity Relationships 30. Meritt, E. A. & Bacon, D. J. Raster3D: photorealistic molecular graphics. Methods Enzymol. 277, 505± (eds Bently, P. H. & O'Hanlon, P. J.) 61±72 (R. Soc. Chem., Cambridge, 1997). -
The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota. -
Product Sheet Info
Master Clone List for NR-19279 ® Vibrio cholerae Gateway Clone Set, Recombinant in Escherichia coli, Plates 1-46 Catalog No. NR-19279 Table 1: Vibrio cholerae Gateway® Clones, Plate 1 (NR-19679) Clone ID Well ORF Locus ID Symbol Product Accession Position Length Number 174071 A02 367 VC2271 ribD riboflavin-specific deaminase NP_231902.1 174346 A03 336 VC1877 lpxK tetraacyldisaccharide 4`-kinase NP_231511.1 174354 A04 342 VC0953 holA DNA polymerase III, delta subunit NP_230600.1 174115 A05 388 VC2085 sucC succinyl-CoA synthase, beta subunit NP_231717.1 174310 A06 506 VC2400 murC UDP-N-acetylmuramate--alanine ligase NP_232030.1 174523 A07 132 VC0644 rbfA ribosome-binding factor A NP_230293.2 174632 A08 322 VC0681 ribF riboflavin kinase-FMN adenylyltransferase NP_230330.1 174930 A09 433 VC0720 phoR histidine protein kinase PhoR NP_230369.1 174953 A10 206 VC1178 conserved hypothetical protein NP_230823.1 174976 A11 213 VC2358 hypothetical protein NP_231988.1 174898 A12 369 VC0154 trmA tRNA (uracil-5-)-methyltransferase NP_229811.1 174059 B01 73 VC2098 hypothetical protein NP_231730.1 174075 B02 82 VC0561 rpsP ribosomal protein S16 NP_230212.1 174087 B03 378 VC1843 cydB-1 cytochrome d ubiquinol oxidase, subunit II NP_231477.1 174099 B04 383 VC1798 eha eha protein NP_231433.1 174294 B05 494 VC0763 GTP-binding protein NP_230412.1 174311 B06 314 VC2183 prsA ribose-phosphate pyrophosphokinase NP_231814.1 174603 B07 108 VC0675 thyA thymidylate synthase NP_230324.1 174474 B08 466 VC1297 asnS asparaginyl-tRNA synthetase NP_230942.2 174933 B09 198 -
Supplementary Material Computational Prediction of SARS
Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE. -
The Metabolic Building Blocks of a Minimal Cell Supplementary
The metabolic building blocks of a minimal cell Mariana Reyes-Prieto, Rosario Gil, Mercè Llabrés, Pere Palmer and Andrés Moya Supplementary material. Table S1. List of enzymes and reactions modified from Gabaldon et. al. (2007). n.i.: non identified. E.C. Name Reaction Gil et. al. 2004 Glass et. al. 2006 number 2.7.1.69 phosphotransferase system glc + pep → g6p + pyr PTS MG041, 069, 429 5.3.1.9 glucose-6-phosphate isomerase g6p ↔ f6p PGI MG111 2.7.1.11 6-phosphofructokinase f6p + atp → fbp + adp PFK MG215 4.1.2.13 fructose-1,6-bisphosphate aldolase fbp ↔ gdp + dhp FBA MG023 5.3.1.1 triose-phosphate isomerase gdp ↔ dhp TPI MG431 glyceraldehyde-3-phosphate gdp + nad + p ↔ bpg + 1.2.1.12 GAP MG301 dehydrogenase nadh 2.7.2.3 phosphoglycerate kinase bpg + adp ↔ 3pg + atp PGK MG300 5.4.2.1 phosphoglycerate mutase 3pg ↔ 2pg GPM MG430 4.2.1.11 enolase 2pg ↔ pep ENO MG407 2.7.1.40 pyruvate kinase pep + adp → pyr + atp PYK MG216 1.1.1.27 lactate dehydrogenase pyr + nadh ↔ lac + nad LDH MG460 1.1.1.94 sn-glycerol-3-phosphate dehydrogenase dhp + nadh → g3p + nad GPS n.i. 2.3.1.15 sn-glycerol-3-phosphate acyltransferase g3p + pal → mag PLSb n.i. 2.3.1.51 1-acyl-sn-glycerol-3-phosphate mag + pal → dag PLSc MG212 acyltransferase 2.7.7.41 phosphatidate cytidyltransferase dag + ctp → cdp-dag + pp CDS MG437 cdp-dag + ser → pser + 2.7.8.8 phosphatidylserine synthase PSS n.i. cmp 4.1.1.65 phosphatidylserine decarboxylase pser → peta PSD n.i. -
Q 297 Suppl USE
The following supplement accompanies the article Atlantic salmon raised with diets low in long-chain polyunsaturated n-3 fatty acids in freshwater have a Mycoplasma dominated gut microbiota at sea Yang Jin, Inga Leena Angell, Simen Rød Sandve, Lars Gustav Snipen, Yngvar Olsen, Knut Rudi* *Corresponding author: [email protected] Aquaculture Environment Interactions 11: 31–39 (2019) Table S1. Composition of high- and low LC-PUFA diets. Stage Fresh water Sea water Feed type High LC-PUFA Low LC-PUFA Fish oil Initial fish weight (g) 0.2 0.4 1 5 15 30 50 0.2 0.4 1 5 15 30 50 80 200 Feed size (mm) 0.6 0.9 1.3 1.7 2.2 2.8 3.5 0.6 0.9 1.3 1.7 2.2 2.8 3.5 3.5 4.9 North Atlantic fishmeal (%) 41 40 40 40 40 30 30 41 40 40 40 40 30 30 35 25 Plant meals (%) 46 45 45 42 40 49 48 46 45 45 42 40 49 48 39 46 Additives (%) 3.3 3.2 3.2 3.5 3.3 3.4 3.9 3.3 3.2 3.2 3.5 3.3 3.4 3.9 2.6 3.3 North Atlantic fish oil (%) 9.9 12 12 15 16 17 18 0 0 0 0 0 1.2 1.2 23 26 Linseed oil (%) 0 0 0 0 0 0 0 6.8 8.1 8.1 9.7 11 10 11 0 0 Palm oil (%) 0 0 0 0 0 0 0 3.2 3.8 3.8 5.4 5.9 5.8 5.9 0 0 Protein (%) 56 55 55 51 49 47 47 56 55 55 51 49 47 47 44 41 Fat (%) 16 18 18 21 22 22 22 16 18 18 21 22 22 22 28 31 EPA+DHA (% diet) 2.2 2.4 2.4 2.9 3.1 3.1 3.1 0.7 0.7 0.7 0.7 0.7 0.7 0.7 4 4.2 Table S2. -
Structure and Mechanism of a Eukaryotic Fmn Adenylyltransferase
STRUCTURE AND MECHANISM OF A EUKARYOTIC FMN ADENYLYLTRANSFERASE Approved by supervisory committee ____________________________________ Hong Zhang, Ph.D. (Mentor) ____________________________________ Diana Tomchick, Ph.D. (Committee Chair) ____________________________________ Kevin Gardner, Ph.D. ____________________________________ Betsy Goldsmith, Ph.D. This thesis is dedicated to my family. STRUCTURE AND MECHANISM OF A EUKARYOTIC FMN ADENYLYLTRANSFERASE by CARLOS HUERTA JR. DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2009 Copyright by CARLOS HUERTA JR., 2009 All Rights Reserved ACKNOWLEDGEMENTS There are many individuals that contributed to my graduate education and I would like to thank a few of them. First, I would like to honor my mentor, Dr. Hong Zhang. Dr. Zhang’s support and encouragement was essential to the completion of my graduate education. Dr. Zhang’s compassion to X-ray crystallography and biological science was fundamental in transforming me into a structural biologist. I would also like to thank all past and current members of the Zhang laboratory. In particular, I would like to thank Dr. Nian Huang and Dr. Darek Martynowski for discussions in structure refinement and modeling, and Marcelo Raines for teaching me protein purification and crystallization. A special acknowledgement goes to Dr. Dominika Borek for teaching me how to solve my first protein structure and her support through-out my graduate education. My graduate thesis would not be possible without the guidance and understanding of my dissertation committee members Dr.