DOCSLIB.ORG

Generate Metabolic Map Poster

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Generate Metabolic Map Poster Authors: Pallavi Subhraveti Ron Caspi Peter Midford Peter D Karp An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Ingrid Keseler Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_000023265Cyc: Acidimicrobium ferrooxidans DSM 10331 Cellular Overview Connections between pathways are omitted for legibility. Anamika Kothari Macromolecule Modification Fatty Acid and Amine and C1 Compound Lipid Degradation Degradation/ Polyamine Utilization and Utilization/ UDP-N-acetyl- undecaprenyl- sn-glycero-3- apo-[propionyl- a peptidoglycan L-alanyl-γ-D- Biosynthesis tRNA processing Assimilation β Assimilation - Other cob(II)yrinate a,c- Cofactor, Carrier, and Vitamin Biosynthesis oleate -oxidation α-D-glucosamine diphospho-N- 2-methylbutanoate phospho-N- CoA:carbon- 2-oxobutanoate pyruvate dimer (meso- glutamyl-L-lysyl- a protein cob(II)yrinate a,c-diamide flavin biosynthesis I (bacteria and plants) adenosylcobinamide-GDP mycothiol biosynthesis superpathway of thiamine diphosphate biosynthesis II benzimidazolyl adenosylcobamide Fatty Acid and Lipid Biosynthesis ATP roseoflavin biotin RS01180 biotin diamide biosynthesis I putrescine formate acrylonitrile acetylmuramoyl- (arachidonoyl) dioxide ligase diaminopimelate D-alanyl-D-alanine biosynthesis II (late salvage from cobinamide I biosynthesis from adenosylcobinamide-GDP a polycistronic biotin 5'-phosphate ATP-dependent (early cobalt insertion) biosynthesis I oxidation to CO degradation I γ containing) 2 oleate L-alanyl- -D- ethanolamine (ADP-forming)] Clp protease: cobalt incorporation) D-glucopyranose palmitate biosynthesis (type II fatty acid synthase) tRNA precursor acetate- acetolactate uroporphyrinogen-III GTP cob(II)inamide 6-phosphate cys benzimidazole fatty acid elongation -- saturated glutamyl-L-lysyl- penicillin- AFER_RS03920 long-chain-fatty- -CoA synthase + + uroporphyrinogen-III a [ThiS sulfur- arg formate acrylonitrile D-alanyl-D-alanine bifunctional clpX H RS01510 H uroporphyrinogen-III cob(I)yrinic acid inositol-3- UDP-N- ligase: acs glycerophosphodiester biotin/lipoate A/ penicillin- binding uroporphyrinogen-III carrier protein] nicotinate-nucleotide-- formate acid--CoA ligase: large subunit: riboflavin kinase/ C-methyltransferase: bifunctional a,c-diamide phosphate SufS family an acetoacetyl-[acp] acetylglucosamine- phosphodiesterase: B protein ligase: binding protein ATP-dependent C-methyltransferase: dimethylbenzimidazole an acetoacetyl-[acp] dehydrogenase AFER_RS07040 acetate-- AFER_RS08300 FAD synthetase: cobA 3,4-dihydroxy- adenosyltransferase: synthase: cysteine -N-acetylmuramyl- AFER_RS11220 AFER_RS05135 protein 2: mrdA Clp protease cobA a tRNA precursor a tRNA precursor with subunit alpha: fdhF [+ 2 isozymes] CoA ligase: acetolactate AFER_RS03295 precorrin-1 AFER_RS03715 desulfurase: phosphoribosyltransferase: 3-oxoacyl-[acyl- agmatine acrylamide (pentapeptide) 2: mrdA NAD(P) precorrin-1 2-butanone- AFER_RS00185 CO AFER_RS08505 glycerophosphoryl biotin/lipoate A/ proteolytic + + cobT with a 5' extension a 5' extension and 2 synthase: ilvN γ H H 4-phosphate cob(I)yrinic acid D-glyceraldehyde sufS carrier-protein] oleoyl-CoA pyrophosphoryl- diester B protein ligase: L-alanyl- -D- subunit: transhydrogenase uroporphyrinogen-III an [L-cysteine a carboxy- benzimidazole agmatinase: and a long 3' trailer a short 3' extension amidase: AFER_RS08020 roseoflavin uroporphyrinogen-III synthase/GTP a,c-diamide Ins(3)P UDP-N-acetyl- 3-phosphate reductase: fabG undecaprenol N- phosphodiesterase: AFER_RS05380 a peptidoglycan glutamyl-L- D-ala AFER_RS09035 C-methyltransferase: α desulfurase]-S- adenylated-[ThiS adenosylcobinamide- ribotide speB ribonuclease D: ribonuclease acyl-CoA/acyl-ACP AFER_RS01195 (2S)-2- adenine C-methyltransferase: cyclohydrolase II: adenosyltransferase: -D-glucosamine 1-deoxy-D- gly a (3R)-3- acetylglucosamine AFER_RS08065 with D,D cross- D-ala lysyl-D-alanine cobA sulfanyl-L-cysteine sulfur-carrier protein] GDP phosphate AFER_RS08370ribonuclease P protein [+ 2 isozymes] methylbutanoyl- diphosphate a peptide cobA a 3-oxoacyl-[acp] dehydrogenase: transferase: AMP (S)-2-aceto-2- dinucleotide H + RS09415 H + AFER_RS08720 [corrinoid cobO xylulose-5- hydroxybutanoyl-[acp] ribonuclease D: PH: rph component: CoA [propionyl- links (meso- 2,5-diamino-6- D-inositol-3-phosphate putrescine AFER_RS09140 AFER_RS11060 hydroxybutanoate precorrin-2 adenosyltranferase]- phosphate glycine 5-methylbenzimidazolyl adenosylcobamide AFER_RS08370 AFER_RS10560 acrylate ditrans,octacis- UDP CoA:carbon- diaminopimelate precorrin-2 (5-phospho-D- glycosyltransferase: adenosylcobinamide- 3-hydroxyacyl- sn-glycerol cob(II)inamide synthase: oxidase biosynthesis from adenosylcobinamide-GDP (2E,9Z)- undecaprenyldiphospho- anandamide dioxide ligase containing) AFER_RS01840 GDP ACP dehydratase a tRNA precursor with 3-phosphate precorrin-2 C(20)- ribosylamino) AFER_RS02455 ThiO: thiO 3-oxoacyl- octadecenoyl-CoA N-acetyl-(N-acetyl-β-D- (ADP-forming)] a thiocarboxylated- ribazoletransferase: FabZ: fabZ a short 3' extension F0F1 ATP pyrimidin- H + H + methyltransferase: 1-O-(2-acetamido- AIR 1-deoxy-D-xylulose [ThiS sulfur- AFER_RS02740 5-methylbenzimidazole [acyl-carrier- a tRNA precursor glucosaminyl)muramoyl- synthase 4(3H)-one 2-iminoacetate γ cobI [corrinoid 2-deoxy-α-D- 5-phosphate carrier protein] a (2E)-but-2-enoyl-[acp] protein] with a 5' extension L-alanyl- -D-glutamyl-L- sirohydrochlorin bifunctional α α nicotinate-nucleotide-- ribonuclease ribonuclease D: adenosyltranferase]- glucopyranosyl)-1D-myo phosphomethylpyrimidine Co -[ - reductase: (S)-3-hydroxy-(9Z) lysyl-D-alanyl-D-alanine precorrin-3A diaminohydroxyphosphoribosylaminopyrimidine dimethylbenzimidazole beta-ketoacyl- PH: rph AFER_RS08370 synthase ThiC: thiC thiazole synthase: (benzimidazolyl)]-Co enoyl-ACP fabG + + deaminase/5-amino-6-(5-phosphoribosylamino) cob(I)inamide -inositol 3-phosphate phosphoribosyltransferase: ACP synthase II: -octadecenoyl-CoA H RS00750 H AFER_RS05910 β-adenosylcobamide reductase uracil reductase RibD: ribD cob(I)yrinic acid cobT AFER_RS05585 a (3R)-3- quinoxaline-2- a peptidoglycan a uridine 38- an [amino-group HMP-P 5'-phosphate FabI: fabI a 2,3,4-saturated adenosylcobinamide a purine H O carbamoyl a uracil in DNA 5-amino-6-(5- a,c-diamide hydroxyacyl-[acyl- aryl-carrier protein diphosphate 2 asp dimer (E. faeciums) carrier protein]- cobalt- 2-[(2R,5Z)-2-carboxy- thiamine diphosphate salvage II adenosylcobinamide- 5-methylbenzimidazole dipyrromethane carboxyl adenylate 40 in tRNA ATP phospho-D- adenosyltransferase: fatty acyl-[acp] ribonucleoside phosphate tRNA γ sirohydrochlorin 1-(2-acetamido- bifunctional 4-methylthiazol-5(2H)- ribotide phosphate a butanoyl-[acp] 3-hydroxyacyl-carrier protein] biotin C-terminal- - sulfite RS08665 sulfite ribosylamino)uracil GDP cofactor biosynthesis 3-oxo-(9Z)- 5'-triphosphate precorrin-3B D-ribulose AFER_RS03715 2-deoxy-α-D- hydroxymethylpyrimidine ylidene]ethyl phosphate ACP penicillin- pseudouridine (L-glutamate 5- bifunctional 4-amino-2-methyl-5- Coα-[α- an apo-[hydroxymethylbilane an uncharged tRNA octadecenoyl-CoA uracil-DNA N-acetyl- 5-phosphate cob(I)yrinic acid glucopyranosyl)- kinase/ beta-ketoacyl- dehydratase acyl carrier inorganic aspartate/ornithine binding synthase: semialdehyde-2- precorrin-3B C(17)- diaminohydroxyphosphoribosylaminopyrimidine pyrimidinemethanol (benzimidazolyl)]-Co adenosylcobinamide- synthase]-L-cysteine acetyl-CoA C- bifunctional glycosylase: gamma- bifunctional a,c-diamide 1D-myo-inositol phosphomethylpyrimidine ACP synthase II: FabZ: fabZ protein: acpP diphosphatase: carbamoyltransferase: protein AFER_RS10750 biotin--[acetyl- yl)-L-glutamate methyltransferase: deaminase/5-amino-6-(5-phosphoribosylamino) bifunctional β-adenosylcobamide GDP acyltransferase: adenosylcobinamide AFER_RS02255 glutamyl- sulfite RS05780 sulfite 3,4-dihydroxy- adenosyltransferase: N-acetyl-1-D-myo kinase: thiD AFER_RS05585 acyl carrier AFER_RS07715 AFER_RS08605 2: mrdA RluA family CoA-carboxylase] cobalt-factor III cobJ uracil reductase RibD: ribD 2-(2-carboxy-4- hydroxymethylpyrimidine ribazoletransferase: AFER_RS07055 kinase/ uracil-DNA phosphate 2-butanone- cobO -inositol-2-amino- a [hydroxymethylbilane protein: RdgB/HAM1 family pseudouridine ligase: 5-amino-6-(5- HMP-PP methylthiazol-5- kinase/ AFER_RS02740 adenosylcobinamide- aspartate glycosylase: an [amino-groupreductase: precorrin-4 4-phosphate 2-deoxy-α-D- adenosylcobalamin synthase] ES intermediate a 3-oxohexanoyl-[acp] acetyl-CoA C- non-canonical synthase: AFER_RS10855 phospho-D- yl)ethyl phosphate 2 lipoprotein posttranslational AFER_RS07810 carbamoyltransferase a peptidoglycan adenosylcobinamide salvage from cobalamin phosphomethylpyrimidine enoyl-ACP acyltransferase: phosphate AFER_RS04220 carrier protein]-argC serine serine synthase/GTP glucopyranoside Coα-[α-(5- modification Pentose Phosphate Pathways purine NTP AFER_RS06220 γ RS05440 cobalt-precorrin-4/ ribitylamino)uracil kinase: thiD hydroxymethylbilane reductase guanylyltransferase: catalytic subunit: tetramer with a D-ala 38- C-terminal- - cyclohydrolase II: deacetylase: 3-oxotehexanoyl- a trans-2- AFER_RS01350 pyrophosphatase: a pseudouridine thr thr bifunctional cob(I)alamin
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Ribonucleotides Incorporated by the Yeast Mitochondrial DNA Polymerase Are Not Repaired
    Ribonucleotides incorporated by the yeast mitochondrial DNA polymerase are not repaired Paulina H. Wanrooija,1, Martin K. M. Engqvistb,c,2, Josefin M. E. Forslunda,2, Clara Navarreteb, Anna Karin Nilssona, Juhan Sedmand, Sjoerd Wanrooija, Anders R. Clausenb, and Andrei Chabesa,e,1 aDepartment of Medical Biochemistry and Biophysics, Umeå University, SE-901 87 Umeå, Sweden; bInstitute of Biomedicine, University of Gothenburg, SE-405 30 Gothenburg, Sweden; cDepartment of Biology and Biological Engineering, Chalmers University of Technology, SE-412 96 Gothenburg, Sweden; dDepartment of Biochemistry, Institute of Molecular and Cell Biology, University of Tartu, Tartu 51010, Estonia; and eLaboratory for Molecular Infection Medicine Sweden, Umeå University, SE-901 87 Umeå, Sweden Edited by Philip C. Hanawalt, Stanford University, Stanford, CA, and approved October 17, 2017 (received for review July 25, 2017) Incorporation of ribonucleotides into DNA during genome replica- Mec1/Rad53 genome integrity checkpoint regulates yeast RNR tion is a significant source of genomic instability. The frequency activity through several different mechanisms (14). of ribonucleotides in DNA is determined by deoxyribonucleoside The incorporation of ribonucleotides (rNMPs) into the genome triphosphate/ribonucleoside triphosphate (dNTP/rNTP) ratios, by the during DNA replication has become recognized as a significant ability of DNA polymerases to discriminate against ribonucleotides, source of genomic instability. Given that the physiological con- and by the capacity of repair mechanisms to remove incorporated centrations of ribonucleoside triphosphates (rNTPs), the building ribonucleotides. To simultaneously compare how the nuclear and blocks of RNA, are one to two orders-of-magnitude higher than mitochondrial genomes incorporate and remove ribonucleotides, those of dNTPs, rNMPs are frequently incorporated into DNA we challenged these processes by changing the balance of cellular during replication (15, 16).
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Letters to Nature
    letters to nature Received 7 July; accepted 21 September 1998. 26. Tronrud, D. E. Conjugate-direction minimization: an improved method for the re®nement of macromolecules. Acta Crystallogr. A 48, 912±916 (1992). 1. Dalbey, R. E., Lively, M. O., Bron, S. & van Dijl, J. M. The chemistry and enzymology of the type 1 27. Wolfe, P. B., Wickner, W. & Goodman, J. M. Sequence of the leader peptidase gene of Escherichia coli signal peptidases. Protein Sci. 6, 1129±1138 (1997). and the orientation of leader peptidase in the bacterial envelope. J. Biol. Chem. 258, 12073±12080 2. Kuo, D. W. et al. Escherichia coli leader peptidase: production of an active form lacking a requirement (1983). for detergent and development of peptide substrates. Arch. Biochem. Biophys. 303, 274±280 (1993). 28. Kraulis, P.G. Molscript: a program to produce both detailed and schematic plots of protein structures. 3. Tschantz, W. R. et al. Characterization of a soluble, catalytically active form of Escherichia coli leader J. Appl. Crystallogr. 24, 946±950 (1991). peptidase: requirement of detergent or phospholipid for optimal activity. Biochemistry 34, 3935±3941 29. Nicholls, A., Sharp, K. A. & Honig, B. Protein folding and association: insights from the interfacial and (1995). the thermodynamic properties of hydrocarbons. Proteins Struct. Funct. Genet. 11, 281±296 (1991). 4. Allsop, A. E. et al.inAnti-Infectives, Recent Advances in Chemistry and Structure-Activity Relationships 30. Meritt, E. A. & Bacon, D. J. Raster3D: photorealistic molecular graphics. Methods Enzymol. 277, 505± (eds Bently, P. H. & O'Hanlon, P. J.) 61±72 (R. Soc. Chem., Cambridge, 1997).
    [Show full text]
  • Product Sheet Info
    Master Clone List for NR-19279 ® Vibrio cholerae Gateway Clone Set, Recombinant in Escherichia coli, Plates 1-46 Catalog No. NR-19279 Table 1: Vibrio cholerae Gateway® Clones, Plate 1 (NR-19679) Clone ID Well ORF Locus ID Symbol Product Accession Position Length Number 174071 A02 367 VC2271 ribD riboflavin-specific deaminase NP_231902.1 174346 A03 336 VC1877 lpxK tetraacyldisaccharide 4`-kinase NP_231511.1 174354 A04 342 VC0953 holA DNA polymerase III, delta subunit NP_230600.1 174115 A05 388 VC2085 sucC succinyl-CoA synthase, beta subunit NP_231717.1 174310 A06 506 VC2400 murC UDP-N-acetylmuramate--alanine ligase NP_232030.1 174523 A07 132 VC0644 rbfA ribosome-binding factor A NP_230293.2 174632 A08 322 VC0681 ribF riboflavin kinase-FMN adenylyltransferase NP_230330.1 174930 A09 433 VC0720 phoR histidine protein kinase PhoR NP_230369.1 174953 A10 206 VC1178 conserved hypothetical protein NP_230823.1 174976 A11 213 VC2358 hypothetical protein NP_231988.1 174898 A12 369 VC0154 trmA tRNA (uracil-5-)-methyltransferase NP_229811.1 174059 B01 73 VC2098 hypothetical protein NP_231730.1 174075 B02 82 VC0561 rpsP ribosomal protein S16 NP_230212.1 174087 B03 378 VC1843 cydB-1 cytochrome d ubiquinol oxidase, subunit II NP_231477.1 174099 B04 383 VC1798 eha eha protein NP_231433.1 174294 B05 494 VC0763 GTP-binding protein NP_230412.1 174311 B06 314 VC2183 prsA ribose-phosphate pyrophosphokinase NP_231814.1 174603 B07 108 VC0675 thyA thymidylate synthase NP_230324.1 174474 B08 466 VC1297 asnS asparaginyl-tRNA synthetase NP_230942.2 174933 B09 198
    [Show full text]
  • Supplementary Material Computational Prediction of SARS
    Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE.
    [Show full text]
  • The Metabolic Building Blocks of a Minimal Cell Supplementary
    The metabolic building blocks of a minimal cell Mariana Reyes-Prieto, Rosario Gil, Mercè Llabrés, Pere Palmer and Andrés Moya Supplementary material. Table S1. List of enzymes and reactions modified from Gabaldon et. al. (2007). n.i.: non identified. E.C. Name Reaction Gil et. al. 2004 Glass et. al. 2006 number 2.7.1.69 phosphotransferase system glc + pep → g6p + pyr PTS MG041, 069, 429 5.3.1.9 glucose-6-phosphate isomerase g6p ↔ f6p PGI MG111 2.7.1.11 6-phosphofructokinase f6p + atp → fbp + adp PFK MG215 4.1.2.13 fructose-1,6-bisphosphate aldolase fbp ↔ gdp + dhp FBA MG023 5.3.1.1 triose-phosphate isomerase gdp ↔ dhp TPI MG431 glyceraldehyde-3-phosphate gdp + nad + p ↔ bpg + 1.2.1.12 GAP MG301 dehydrogenase nadh 2.7.2.3 phosphoglycerate kinase bpg + adp ↔ 3pg + atp PGK MG300 5.4.2.1 phosphoglycerate mutase 3pg ↔ 2pg GPM MG430 4.2.1.11 enolase 2pg ↔ pep ENO MG407 2.7.1.40 pyruvate kinase pep + adp → pyr + atp PYK MG216 1.1.1.27 lactate dehydrogenase pyr + nadh ↔ lac + nad LDH MG460 1.1.1.94 sn-glycerol-3-phosphate dehydrogenase dhp + nadh → g3p + nad GPS n.i. 2.3.1.15 sn-glycerol-3-phosphate acyltransferase g3p + pal → mag PLSb n.i. 2.3.1.51 1-acyl-sn-glycerol-3-phosphate mag + pal → dag PLSc MG212 acyltransferase 2.7.7.41 phosphatidate cytidyltransferase dag + ctp → cdp-dag + pp CDS MG437 cdp-dag + ser → pser + 2.7.8.8 phosphatidylserine synthase PSS n.i. cmp 4.1.1.65 phosphatidylserine decarboxylase pser → peta PSD n.i.
    [Show full text]
  • Q 297 Suppl USE
    The following supplement accompanies the article Atlantic salmon raised with diets low in long-chain polyunsaturated n-3 fatty acids in freshwater have a Mycoplasma dominated gut microbiota at sea Yang Jin, Inga Leena Angell, Simen Rød Sandve, Lars Gustav Snipen, Yngvar Olsen, Knut Rudi* *Corresponding author: knut.rudi@nmbu.no Aquaculture Environment Interactions 11: 31–39 (2019) Table S1. Composition of high- and low LC-PUFA diets. Stage Fresh water Sea water Feed type High LC-PUFA Low LC-PUFA Fish oil Initial fish weight (g) 0.2 0.4 1 5 15 30 50 0.2 0.4 1 5 15 30 50 80 200 Feed size (mm) 0.6 0.9 1.3 1.7 2.2 2.8 3.5 0.6 0.9 1.3 1.7 2.2 2.8 3.5 3.5 4.9 North Atlantic fishmeal (%) 41 40 40 40 40 30 30 41 40 40 40 40 30 30 35 25 Plant meals (%) 46 45 45 42 40 49 48 46 45 45 42 40 49 48 39 46 Additives (%) 3.3 3.2 3.2 3.5 3.3 3.4 3.9 3.3 3.2 3.2 3.5 3.3 3.4 3.9 2.6 3.3 North Atlantic fish oil (%) 9.9 12 12 15 16 17 18 0 0 0 0 0 1.2 1.2 23 26 Linseed oil (%) 0 0 0 0 0 0 0 6.8 8.1 8.1 9.7 11 10 11 0 0 Palm oil (%) 0 0 0 0 0 0 0 3.2 3.8 3.8 5.4 5.9 5.8 5.9 0 0 Protein (%) 56 55 55 51 49 47 47 56 55 55 51 49 47 47 44 41 Fat (%) 16 18 18 21 22 22 22 16 18 18 21 22 22 22 28 31 EPA+DHA (% diet) 2.2 2.4 2.4 2.9 3.1 3.1 3.1 0.7 0.7 0.7 0.7 0.7 0.7 0.7 4 4.2 Table S2.
    [Show full text]
  • Supplementary Informations SI2. Supplementary Table 1
    Supplementary Informations SI2. Supplementary Table 1. M9, soil, and rhizosphere media composition. LB in Compound Name Exchange Reaction LB in soil LBin M9 rhizosphere H2O EX_cpd00001_e0 -15 -15 -10 O2 EX_cpd00007_e0 -15 -15 -10 Phosphate EX_cpd00009_e0 -15 -15 -10 CO2 EX_cpd00011_e0 -15 -15 0 Ammonia EX_cpd00013_e0 -7.5 -7.5 -10 L-glutamate EX_cpd00023_e0 0 -0.0283302 0 D-glucose EX_cpd00027_e0 -0.61972444 -0.04098397 0 Mn2 EX_cpd00030_e0 -15 -15 -10 Glycine EX_cpd00033_e0 -0.0068175 -0.00693094 0 Zn2 EX_cpd00034_e0 -15 -15 -10 L-alanine EX_cpd00035_e0 -0.02780553 -0.00823049 0 Succinate EX_cpd00036_e0 -0.0056245 -0.12240603 0 L-lysine EX_cpd00039_e0 0 -10 0 L-aspartate EX_cpd00041_e0 0 -0.03205557 0 Sulfate EX_cpd00048_e0 -15 -15 -10 L-arginine EX_cpd00051_e0 -0.0068175 -0.00948672 0 L-serine EX_cpd00054_e0 0 -0.01004986 0 Cu2+ EX_cpd00058_e0 -15 -15 -10 Ca2+ EX_cpd00063_e0 -15 -100 -10 L-ornithine EX_cpd00064_e0 -0.0068175 -0.00831712 0 H+ EX_cpd00067_e0 -15 -15 -10 L-tyrosine EX_cpd00069_e0 -0.0068175 -0.00233919 0 Sucrose EX_cpd00076_e0 0 -0.02049199 0 L-cysteine EX_cpd00084_e0 -0.0068175 0 0 Cl- EX_cpd00099_e0 -15 -15 -10 Glycerol EX_cpd00100_e0 0 0 -10 Biotin EX_cpd00104_e0 -15 -15 0 D-ribose EX_cpd00105_e0 -0.01862144 0 0 L-leucine EX_cpd00107_e0 -0.03596182 -0.00303228 0 D-galactose EX_cpd00108_e0 -0.25290619 -0.18317325 0 L-histidine EX_cpd00119_e0 -0.0068175 -0.00506825 0 L-proline EX_cpd00129_e0 -0.01102953 0 0 L-malate EX_cpd00130_e0 -0.03649016 -0.79413596 0 D-mannose EX_cpd00138_e0 -0.2540567 -0.05436649 0 Co2 EX_cpd00149_e0
    [Show full text]
  • Mitochondrial Uncoupling and the Reprograming of Intermediary Metabolism in Leukemia Cells
    REVIEW ARTICLE published: 02 April 2013 doi: 10.3389/fonc.2013.00067 Mitochondrial uncoupling and the reprograming of intermediary metabolism in leukemia cells Juliana Vélez 1, Numsen Hail Jr.2,3, Marina Konopleva2,3, Zhihong Zeng 2,3, Kensuke Kojima2,3, Ismael Samudio1* and Michael Andreeff 2,3* 1 Grupo de Terapia Celular y Molecular Laboratorio de Bioquimica, Pontificia Universidad Javeriana, Bogotá, Colombia 2 Section of Molecular Hematology and Therapy, The University of Texas MD Anderson Cancer Center, Houston, TX, USA 3 Department of Leukemia, The University of Texas MD Anderson Cancer Center, Houston, TX, USA Edited by: Nearly 60 years ago Otto Warburg proposed, in a seminal publication, that an irreparable Jozsef Dudas, Medical University defect in the oxidative capacity of normal cells supported the switch to glycolysis for energy Innsbru, Austria generation and the appearance of the malignant phenotype (Warburg, 1956). Curiously, Reviewed by: Daniel Christian Hoessli, International this phenotype was also observed by Warburg in embryonic tissues, and recent research Center for Chemical and Biological demonstrated that normal stem cells may indeed rely on aerobic glycolysis – fermenting Sciences, Switzerland pyruvate to lactate in the presence of ample oxygen – rather than on the complete oxidation Jozsef Dudas, Medical University of pyruvate in the Krebs cycle – to generate cellular energy (Folmes et al., 2012). However, Innsbruck, Austria it remains to be determined whether this phenotype is causative for neoplastic develop- *Correspondence: Ismael Samudio, Laboratorio de ment, or rather the result of malignant transformation. In addition, in light of mounting Bioquimica #301, Edificio Jesús evidence demonstrating that cancer cells can carry out electron transport and oxidative Emilio Ramírez, Pontificia Universidad phosphorylation, although in some cases predominantly using electrons from non-glucose Javeriana, Cra 7 No.
    [Show full text]