Genome-Wide Investigation of Cellular Functions for Trna Nucleus

Home , Acetylglutamate kinase, ALG1, ALG6, ALG8, Allantoicase, Allantoinase

Genome-wide Investigation of Cellular Functions for tRNA Nucleus-

Cytoplasm Trafficking in the Yeast Saccharomyces cerevisiae

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Hui-Yi Chu

Graduate Program in Molecular, Cellular and Developmental Biology

The Ohio State University

2012

Dissertation Committee:

Anita K. Hopper, Advisor

Stephen Osmani

Kurt Fredrick

Jane Jackman

Hui-Yi Chu

2012

Abstract

In eukaryotic cells tRNAs are transcribed in the nucleus and exported to the cytoplasm for their essential role in protein synthesis. This export event was thought to be unidirectional. Surprisingly, several lines of evidence showed that mature cytoplasmic tRNAs shuttle between nucleus and cytoplasm and their distribution is nutrient-dependent.

This newly discovered tRNA retrograde process is conserved from yeast to vertebrates.

Although how exactly the tRNA nuclear-cytoplasmic trafficking is regulated is still under investigation, previous studies identified several transporters involved in tRNA subcellular dynamics. At least three members of the β-importin family function in tRNA nuclear-cytoplasmic intracellular movement: (1) Los1 functions in both the tRNA primary export and re-export processes; (2) Mtr10, directly or indirectly, is responsible for the constitutive retrograde import of cytoplasmic tRNA to the nucleus; (3) Msn5 functions solely in the re-export process. In this thesis I focus on the physiological role(s) of the tRNA nuclear retrograde pathway. One possibility is that nuclear accumulation of cytoplasmic tRNA serves to modulate translation of particular transcripts. To test this hypothesis, I compared expression profiles from non-translating mRNAs and polyribosome-bound translating mRNAs collected from msn5Δ and mtr10Δ mutants and wild-type cells, in fed or acute amino acid starvation conditions. Microarray data revealed that several amino acid biosynthetic pathways, including the sulfur assimilation, arginine ii

biosynthesis, and leucine biosynthesis pathways, are primary targets of the tRNA

trafficking processes. I confirmed the microarray data by both Northern and Western blot

analyses. Levels of all tested target proteins involved in such amino acid biogenesis pathways are down-regulated when the tRNA nuclear import or re-export is disrupted.

The steady state levels of target total RNAs are similar between wild-type cells and tRNA trafficking defective mutants. The data suggest that the reduction of target proteins most likely results from translation defects of the target mRNAs. This study provides information that tRNA nuclear-cytoplasmic dynamics is connected to amino acid biosynthesis via control at the level of translation.

iii

This thesis is dedicated to my family and the memory of my dear mother.

Acknowledgements

First and foremost I want to thank my advisor Anita K. Hopper, for her warm encouragement and advice. From her I have learned how to enjoy the research life and open my mind for every possibility. She is always patient, optimistic, and enthusiastic,

even during difficult moments. I appreciate all her supports and contributions of time,

ideas, and funding in my Ph.D pursuits. When I lose my confidence, she always believed me more than myself. I thank her wide knowledge and logical way of thinking, which made this thesis possible. I am grateful for the excellent role model which she provided as a woman scientist. It is my honor to be one of her students.

I am acknowledged my thesis committee, Professor Stephen Osmani, Professor

Kurt Fredrick, and Professor Jane Jackman, for their interests, professional comments, and personal encouragements. I am also grateful that my previous advisor in the

Nationwide Children Hospital, Dr. Akihira Otoshi, for his giving me the chance coming to the United States. I want to thank the director of MCDB graduate program, Professor

David Bisaro, for his understanding and decision of accepting me, which made me get the opportunity to join in this wonderful lab.

Being part of the Hopper lab would definitely become a beautiful memory in my life. It was my pleasure to work with such nice lab members. I thank our post-docs

Rebecca, for her good ideas and always willing to help us whenever we have questions, v

and Emily, for her nice communication skills. Thanks to Greetchen, Nripesh, Tsung-Po,

Hsiao-Yun (Ivy), Jingyan, and Marina. When I became too serious or too panic, they

provided laughs and supports. When I had successful experiments, they shared the joyful

moments.

My life in the OSU was fulfilling and the learning experience was most

comprehensive in my study journey. As a hearing impaired foreigner, I sincerely thank

Cindy Knecht and Andrea Crago from the disability service that was provided by the

OSU and the Professional Reporters, Inc. Their amazing real-time transcribing work truly helped me overcome the double barriers of disability and language. Thank to OSU provided such a friendly campus. I thank people in the department of Molecular Genetics, in particular Professor Jim Hopper, Professor Paul Herman, and their lab members.

In these years of joys and frustrations, thanks for all the supports my friends in

Columbus. Thanks to Rosa, Keith and their dog Bailey, for their generosity and warm supports. Thanks to I-Ju, Liang-Chun, and Yuh-Ying, for banding together over food and

life. I also thank Kuo-Fang and Shu-Hao, studying together with them was a different and

great experience. Also thanks to many old friends in Taiwan, they keep caring about me

no matter the distance.

Finally, and most importantly, thanks to my parents for their nurture and

education. Their unconditional love made me brave to face the challenges and was the

motivation of my pursuits. Thanks to my sister and brother, and their families, for their

understanding and supports. And last, but not least, to Yuan-Sheng, thank you for the

love and consistent being there for me.

Vita

March 1978 ...... Born−Taipei, Taiwan

2000...... B.S. Biology, National Taiwan Normal

University, Taiwan

2003...... M.S. Genetics, National Yang-Ming

University, Taiwan

2006 to present ...... Graduate Research Associate, Molecular,

Cellular, and Developmental Biology

Program, The Ohio State University

Publication

Lai, Y.-S., Murali, S., Ju, H. Y., Wu, M. F., Guo, I. C., Chen, S. C., Fang, K. and Chang, C. Y.

Two iridovirus-susceptible cell lines established for kidney and liver of grouper,

Epinephelus awoara, and partial characterization of grouper iridovirus. Journal of fish

disease 23, 379-338, 2000.

vii

Lai, Y.-S., Murali, S., Chiu, H. C., Ju, H. Y., Lin, Y. S., Chen, S. C., Guo, I. C., Fang, K. and

Chang, C. Y. Preparation of yellow grouper nervous necrosis virus in a new nodavirus-

susceptible cell lines from yellow grouper, Epinephelus awoara brain tissue. Journal of fish

disease 24,299-309, 2001.

Chu, H. Y. Phenotypic Analysis of the Aurora-A Transgenic Mice. Master Thesis. Institute of

Genetics, National Yang Ming University, July, 2003.

Chu, H. Y. and Otoshi, A. Cloning and functional analysis of hypothalamic homeobox gene

Bsx1a and its isoform, Bsx1b., Mol Cell Biol. 27(10), 3743-9, 2007.

Li, C.C., Chu, H.Y., Yang, C.W., Chou, C.K. and Tsai, T.F. Aurora-A overexpression in mouse

liver causes p53-dependent premitotic arrest during liver regeneration. Mol Cancer Res.

7(5), 678-88, 2009.

Chu, H. Y. and Hopper, A. K. Genome-wide investigation of the cellular functions for tRNA

nucleus-cytoplasm trafficking in S. cerevisiae. (in prep.)

Fields of Study

Major Field: Molecular, Cellular and Developmental Biology

viii

Table of Contents

Abstract ...... ii

Acknowledgements ...... v

Vita ...... vii

Fields of Study ...... viii

Table of Contents ...... ix

List of Tables ...... xiv

List of Figures ...... xvi

Chapter 1 Introduction...... 1

1.1 Nucleocytoplasmic transport ...... 1

1.2 tRNA biology in yeast ...... 5

1.2.1 The life of tRNA: biogenesis, maturation, and turnover ...... 5

1.2.2 tRNA subcellular dynamics ...... 10

1.3 Amino acid stress responses ...... 12

1.4 Microarray analysis ...... 14

1.4.1 Microarray general applications and advanced usage for translational

profiling ...... 14

1.4.2 Data analysis ...... 16

1.5 Aim of this study ...... 21 ix

Chapter 2 Materials and Methods...... 22

2.1 Yeast growth conditions and strain construction ...... 22

2.1.1 Media and growth conditions ...... 22

2.1.2 Yeast strain construction ...... 23

2.1.3 Growth assay ...... 25

2.2 Polysome profiles and RNA isolation ...... 25

2.2.1 Polysome profiles ...... 25

2.2.2 Quantification of polysome profiles ...... 27

2.2.3 RNA extraction ...... 28

2.3 Microarray data analysis ...... 28

2.3.1 Pre-processing of raw data ...... 29

2.3.2 Identification of significant differentially-expressed genes ...... 29

2.3.3 Hierarchical clustering of significantly changed target transcripts ...... 30

2.4 Northern blot analysis ...... 30

2.4.1 Preparation of DNA probes ...... 31

2.5 Western blot analysis ...... 31

2.5.1 Protein extraction ...... 31

2.5.2 Western blot and quantification ...... 32

2.6 Cis-regulatory element analyses of targets ...... 33

2.6.1 Codon bias and amino acid usage ...... 33

Chapter 3 Genome-wide investigations of cellular functions for tRNA nuclear- cytoplasmic trafficking in regulation of translation ...... 43

3.1 Introduction ...... 43

3.2 Results ...... 48

3.2.1 Polysome profiles analysis ...... 48

3.2.2 Microarray data pre-processing ...... 49

3.2.3 Identification of significant differentially-expressed genes (DEGs) ...... 57

3.2.4 Transcriptional control and RNA stability of target mRNAs are not

affected ...... 60

3.2.5 Verification of microarray data by western blot analyses ...... 61

3.2.6 tRNA subcellular trafficking affects translation regulation of amino acid

biosyntheses transcripts ...... 77

3.2.7 Cis-regulatory elements analysis of tRNA trafficking targets ...... 85

3.3 Discussion ...... 86

Chapter 4 Transcriptional analysis of mtr10Δ cells ...... 96

4.1 Introduction ...... 96

4.2 Results ...... 97

4.2.1 Microarray analysis of transcription profiles in msn5∆ cells ...... 98

4.2.2 Microarray analysis of transcription profiles in mtr10∆ cells ...... 98

4.2.3 Confirmations of selected target mRNA expressions by Northern blot

analysis ...... 104

4.2.4 Phenotypic analyses by growth assays ...... 105

4.3 Discussion ...... 112

Chapter 5 Summary and future directions ...... 115

APPENDIX A: Tested possibilities for mechanism of down-regulated translation of the

target mRNAs involved in the Met, Arg, and Leu biosynthetic pathways ...... 117

APPENDIX B: Transcripts with decreased translation activity index in fed mtr10Δ cells

...... 121

APPENDIX C: Transcripts with increased translation activity index in fed mtr10Δ cells

...... 129

APPENDIX D: Transcripts with changed translation activity index in mtr10Δ cells in

amino acid starvation condition ...... 136

APPENDIX E: Transcripts with decreased translation activity index in fed msn5Δ cells

...... 138

APPENDIX F: Summary tables of functional catalogue analysis for affected transcripts

in mtr10Δ cells in fed or amino acid starvation conditions...... 140

APPENDIX G: Down-regulated genes in mtr10Δ cells in fed condition ...... 145

APPENDIX H: Up-regulated genes in mtr10Δ cells in fed condition ...... 157

APPENDIX I: Down-regulated genes in mtr10Δ cells in amino acid starvation condition

...... 178

APPENDIX J: Up-regulated genes in mtr10Δ cells in amino acid starved condition ... 212

APPENDIX K: Summary tables of functional catalogue analysis for affected transcripts in msn5Δ cells in fed or amino acid starvation conditions ...... 251

APPENDIX L: Down-regulated genes in msn5Δ cells in fed condition...... 256

APPENDIX M: Up-regulated genes in msn5Δ cells in fed condition ...... 264

xii

APPENDIX N: Down-regulated genes in msn5Δ cells in amino acid starvation condition

...... 275

APPENDIX O: Up-regulated genes in msn5Δ cells in amino acid starvation condition290

APPENDIX P: R codes for microarray data analysis ...... 302

References ...... 326

xiii

List of Tables

Table 2. 1. Yeast strains used in this study ...... 34

Table 2. 2. Oligonucleotides used in this study ...... 38

Table 3. 1. Summary tables of numbers of differentially expressed genes in mtr10Δ or msn5Δ cells in fed or starved conditions...... 67

Table 4. 1. Numbers of significant differentially transcriptionally expressed genes from

total mRNA samples of msn5Δ or mtr10Δ cells in fed or amino acid starvation conditions...... 103

Table 4. 2. GO term enrichment analysis and FunCat analysis of genes with significant

changed in mtr10Δ cells in fed condition...... 107

Table 4. 3. GO term enrichment analysis and FunCat analysis of genes with significant

changed in mtr10Δ cells in acute amino acid starved condition...... 108

Table F. 1. FunCat analysis of down-regulated transcripts in mtr10Δ cells in fed condition...... 140

Table F. 2. FunCat analysis of up-regulated transcripts in mtr10Δ cells in fed condition.

...... 141 xiv

Table F. 3. FunCat analysis of down-regulated transcripts in mtr10Δ cells in amino acid starved condition...... 142

Table F. 4. FunCat analysis of up-regulated transcripts in mtr10Δ cells in amino acid

starved condition...... 143

Table K. 1. FunCat analysis of down-regulated transcripts in msn5Δ cells in fed condition...... 251

Table K. 2. Up-regulated transcripts in msn5Δ cells in fed condition...... 252

Table K. 3. FunCat analysis of down-regulated transcripts in msn5Δ cells in amino acid starvation condition...... 254

Table K. 4. FunCat analysis of up-regulated transcripts in msn5Δ cells in amino acid starvation condition...... 255

List of Figures

Figure 1. 1. Ran Cycle and Ran-dependent nuclear export and import...... 4

Figure 1. 2. Summary of tRNA processing pathways...... 8

Figure 1. 3. Probe and probesets...... 19

Figure 2. 1. Illustration of quantification method...... 27

Figure 3. 1. Current model of tRNA subcellular movement in yeast...... 46

Figure 3. 2. Flowchart of experimental designs...... 47

Figure 3. 3. Polysome profiles of wild-type, mtr10Δ, and msn5Δ cells collected from fed or 30-min amino acid starved conditions...... 51

Figure 3. 4. Polysome profiles of wild-type, los1Δ, and los1Δ msn5Δ cells collected from fed or 30-min amino acid starved condition...... 52

Figure 3. 5. Quantification of polysome profiles of tRNA trafficking mutants in fed (A-

C) or amino acid starved (D-F) conditions...... 54

Figure 3. 6. Summary of microarray experiments...... 55

Figure 3. 7. Global assessment of microarray raw data set from fractionated RNA

samples by using principle component analysis (PCA)...... 56

Figure 3. 8. Box plot of raw microarray data...... 64 xvi

Figure 3. 9. Box plot of RMA normalized microarray data...... 65

Figure 3. 10. Volcano plot showing differential expressed genes selected by P/NP index

compared from mtr10Δ to wild-type cells...... 66

Figure 3. 11. Heat map of hierarchical clustering results of gene expression profiles from translational DEGs in mtr10Δ cells versus wild-type cells in fed condition...... 68

Figure 3. 12. Heat map of hierarchical clustering results of translational DEGs from

msn5Δ cells compared to wild-type cells in fed condition...... 69

Figure 3. 13. Venn diagram of DEGs which were decreased in translation activity index

in both mtr10Δ and msn5Δ cells...... 70

Figure 3. 14. Amino acid biosynthesis pathways affected in tRNA trafficking mutants.

...... 72

Figure 3. 15. Expression profile of MET3 transcript among all microarray samples. .... 74

Figure 3. 16. Northern blot analysis of total RNA collected from wild-type and tRNA

trafficking mutants in fed condition...... 75

Figure 3. 17. Growth assay of tRNA trafficking mutants on SC, SC-arginine and SC-

methionine plates...... 76

Figure 3. 18. Growth assays of cells with Met22-3HA fusion protein...... 79

Figure 3. 19. Western blot analysis of endogenously 3HA- or GFP- tagged target

proteins...... 81

Figure 3. 20. Western blot analysis of protein levels in tRNA trafficking mutants

harboring recovery plasmids...... 82

xvii

Figure 3. 21. Immunoblot analyses of Met3-, Arg3-, and Leu4-3HA fusion proteins in

wild-type cells and dhh1Δ pat1Δ cells...... 83

Figure 3. 22. Heat map of hierarchical clustering of codon occurrence frequency for

DEGs with decreased translation activity index in mtr10Δ cells...... 84

Figure 4. 1. PCA analysis of transcription profiles of total mRNAs from wild-type,

msn5Δ, and mtr10Δ cells in fed or acute amino acid starvation condition...... 101

Figure 4. 2. Volcano plots showing differential expressed genes at transcriptional level in mtr10Δ cells versus wild-type cells...... 102

Figure 4. 3. Venn diagram of differentially expressed genes from mtr10Δ cells relative to wild-type cells in fed and amino acid starved conditions...... 109

Figure 4. 4. Northern blot analysis of total mRNAs collected from wild-type, mtr10Δ,

and msn5Δ cells grown in fed condition...... 110

Figure 4. 5. Growth assay to assess the function of Mtr10 in DNA damage response. 111

Figure A. 1. Growth assay of mutants defective in tRNA export and modifications.. . 118

Figure A. 2. Growth assay of mutants defective in tRNA import and modifications.. . 119

Figure A. 3. Western blot analysis of Arg3-3HA in tRNA modification mutants...... 120

xviii

CHAPTER 1

Introduction

Eukaryotic cells contain a variety of lipid bilayer membrane-surrounded organelles. One of these organelles, the nucleus, is the genetic information center that controls biological activities. An important issue in eukaryotic cell biology concerns the coordination of cellular process via spatial and temporal regulation. The nucleus communicates with the cytoplasm via nuclear pores through which macromolecules flow. DNA contains the genetic information which is transcribed into RNAs and translated into proteins. Transfer

RNA (tRNA) is one of three main forms of RNAs. tRNAs function by delivering amino acids to the protein synthesis machinery in the cytoplasm. Nuclear-cytoplasmic cross-talk involving tRNAs is of particular interest to our laboratory. To investigate such questions, we employ the powerful genetic tool, the budding yeast Saccharomyces cerevisiae, which has been broadly used for biological research, as our model system.

1.1 Nucleocytoplasmic transport

The traffic between nucleus and cytoplasm occurs through nuclear pores. Nuclear pores are composed of nuclear pore complexes (NPCs) which are organized into channel structures that cross the inner and outer nuclear membranes. NPCs allow diffusion of 1

small molecules (< 40 kDa). In contrast, macromolecules (large proteins or

ribonucleoproteins [RNPs]) contain specific sequences (nuclear export sequences, NES;

or nuclear localization sequences, NLS) that are recognized and actively translocated in

and out of the NPCs by transport receptors in an energy dependent manner (for review,

see Aitchison and Rout, 2012).

In the S. cerevisiae genome, there are 14 nuclear transport receptors that are

members of karyopherin β family (Stewart, 2003). According to the direction in which they move their cargos, the receptors are referred to as exportins (nucleus to cytoplasm) or importins (cytoplasm to nucleus). The process of nuclear transport is controlled by the small GTPase, Ran. There are two forms of Ran, the GTP-bound form, which is primarily located in the nucleus, or the GDP-bound form, which is primarily located in the cytoplasm (Kuersten et al., 2001). This asymmetric distribution results from the distinct subcellular localizations of the Ran cycle regulators, the cytoplasmic GTPase-activating protein (RanGAP, encoded by RNA1) and the nuclear guanine nucleotide exchange factor

(RanGEF, encoded by RCC1), which are responsible for the conversion of Ran-GTP and

Ran-GDP states (top panel of Figure 1. 1) (for reviews, see Nakielny and Dreyfuss, 1999;

Rodriguez et al., 2004). The exportin receptors bind Ran-GTP and the cargo in the nucleus, and the complex moves via the nuclear pore to the cytoplasm where the complex disassociates upon Ran-GTP hydrolysis to Ran-GDP by RanGAP (middle panel of Figure

1. 1). Ran-GDP returns to the nucleus by the aid of NTF2 (Ribbeck et al., 1998), and is converted to Ran-GTP form again by RanGEF. The importin receptors bind the cargo

(directly or adaptor-mediated) in the cytoplasm in a Ran-GTP independent manner. The

2 importin-cargo complex translocates to the nucleus where importin encounters Ran-GTP, and this leads to the release of cargo and importin returns to the cytoplasm for next cycle

(bottom panel of Figure 1. 1) (for review, see Chook and Süel, 2011).

As the molecular size of tRNA is ~25 kDa which is theoretically able to leave the nucleus by diffusion, its export requires the Ran pathway and the functions of karyopherin.

Figure 1. 1. Ran Cycle and Ran-dependent nuclear export and import.

1.2 tRNA biology in yeast

1.2.1 The life of tRNA: biogenesis, maturation, and turnover

tRNA biogenesis

tRNA is an essential adaptor molecule composed 73 to 93 nucleotides that fold into L-

shaped tertiary structures. tRNAs function to translate genetic information encoded in

mRNAs to proteins by delivering the appropriate amino acids during translation at the

ribosome. In yeast tRNA transcription occurs in the nucleolus, a sub-compartment in the nucleus (Thompson et al., 2003). tRNA genes (tDNAs) are transcribed by RNA polymerase III (Pol III), which recognizes the promoter sequences within tRNA genes

(Dieci et al., 2007). Transcriptional control of tRNAs is regulated by Pol III via the master regulator, Maf1 (for reviews, see Ciesla and Boguta, 2008; Willis and Moir, 2007).

tRNA processing

Since the initial tRNA transcripts contain extra nucleotides at 5’and 3’ ends and some of tRNA precursors have intervening sequences (IVS, or introns) between exons, the tRNA transcripts need to be processed to mature sized molecules. tRNAs are also highly modified in post-transcriptional steps. The processing events, including removal of

5’ and 3’ termini, CCA addition, and intron splicing, generally occur in a specific order.

The leader sequence is cleaved from pre-tRNAs to generate a mature 5’ end by the ribonucleoprotein endonuclease (RNase P). RNase P is composed of a RNA molecule and protein subunits (for reviews, see Esakova and Krasilnikov, 2010; Walker and

Engelke, 2006). The 3’ end of pre-tRNA is processed by removal of the trailer sequence 5

and the subsequent addition of CCA nucleotides after the residue N73. The former

reaction is catalyzed by the yeast endoribonuclease tRNase Z (Trz1) and exonuclease

Rex1, which is balanced by the presence of Lhp1 (yeast La protein, which is a chaperon required for tRNA maturation) (for reviews, see Nakanishi and Nureki, 2005; Phizicky and Hopper, 2010). Addition of nucleotides C74, C75, and A76 is required for subsequent

amino acid attachment. This reaction is catalyzed by the enzyme tRNA

nucleotidyltransferase, encoded by CCA1 in yeast. CCA1 is an essential gene, but there is

a temperature-sensitive mutant of this gene, cca1-1. Cells with this mutation cca1-1 have

a phenotype that is associated with incompletely-processed tRNAs. Interestingly, yeast

Cca1 is an isozyme which has three ATGs. The multiple transcripts result in the

production of three proteins that are differentially distributed to nucleus, cytoplasm, and

mitochondria (Chen et al., 1992b; Wolfe et al., 1994).

Among the total of 286 nuclear tRNA genes in yeast, 59 encode introns. Introns

are located between the 3’ end of the anticodon after nucleotide 37 and the loop 1. Intron

lengths vary from 14 to 60 nucleotides. The intron-containing tRNAs belong to 10

different tRNA families (for reviews, see Hopper and Phizicky, 2003; Abelson et al.,

1998; Hani and Feldmann, 1998). tRNA intron removal is catalyzed by the

heterotetrameric splicing endonuclease complex (SEN). Although the SEN complex is

essential, a previous study demonstrated that the intron of one tRNA, tRNATrp(CCA), is

unnecessary in translation and cell growth (Mori et al., 2011). In yeast, the pre-tRNA

splicing reaction includes three steps. First, the intron-containing tRNAs are cleaved at

both ends of the intron by SEN. Second, the subsequently generated two halves are

6 ligated by tRNA ligase Trl1 and 2’-phosphate is formed at the splice junction. Removal of the 2’ phosphate at the splice junction is catalyzed by the 2’ phosphotransferase Tpt1

(for review, see Hopper and Phizicky, 2003). SEN is functionally conserved from yeast to vertebrates; however, its subcellular localization is not. The work from Yoshihisa showed that the yeast SEN is located at mitochondria surface (Yoshihisa et al., 2003), but vertebrate SEN is in the nucleus (Paushkin et al., 2004). A recent study reveals that SEN possesses a novel function unrelated to splicing that requires all four subunits to be located on the mitochondria (Dhungel and Hopper, 2012).

tRNA modification

To date, more than 100 post-transcriptional modified nucleotides have been described in tRNAs (Cantara et al., 2011). Although the biological function(s) of many tRNA modifications are not completely understood, some of them have been shown to play a role in stabilizing tRNA tertiary structure, facilitating tRNA folding, and preventing translation frameshift to increase the accuracy of protein synthesis (for review, see

Gustilo et al., 2008). tRNA modification enzymes locate at different subcellular compartments, including nucleolus, nucleoplasm, the inner nuclear membrane, the cytoplasm, and mitochondria (for review, see Hopper and Phizicky, 2003).

Figure 1. 2. Summary of tRNA processing pathways. tRNA modification pathways are not included.

tRNA aminoacylation

Before binding to ribosomes, tRNAs are aminoacylated, or charged, at their 3’ end of the

CCA sequence. Charging is catalyzed by aminoacyl tRNA synthetases (aaRS). There are

20 aaRSs, each corresponding to a single amino acid. Since there are multiple tRNAs for

given amino acids, one enzyme generally recognize more than one tRNA substrate.

Although the classical view was that tRNA aminoacylation solely occurs in the

cytoplasm, several aminoacyl tRNA synthetases are located in the nucleus in vertebrates

and yeast, and tRNA charging has been shown to occur in the nucleus (Lund and

Dahlberg, 1998; Sarkar and Hopper, 1998).

tRNA turnover/degradation

As tRNAs are long-lived relative to mRNAs and are recycled for multiple rounds of

tRNA charging, it is not surprising that there are at least two quality control pathways

that function in repairing or degrading damaged tRNAs (for reviews, see Hopper et al.,

2010; Phizicky and Hopper, 2010; Thompson and Parker, 2009). The yeast TRAMP complex, that includes Trf4/5, Air1/Air2, and Mtr4, was the first discovered mechanism to monitor the integrity of pre-tRNA during tRNA biogenesis (Kadaba et al., 2004;

Kadaba et al., 2006). This pathway recognizes hypomodified nuclear tRNAs, such as

Met 1 tRNAi at m A58, caused by mutation of Trm6. Substrates of the TRAMP pathway are

poly-adenylated and subjected to degradation from their 3’ end by the nuclear exosome.

Other studies demonstrated that additional tRNA substrates, for example, pre-tRNA

transcript (LaCava et al., 2005), tRNAAla with a structural defect (Vanacova et al., 2005),

U6 small nuclear RNA, or 3’ truncated 5S rRNA (Kadaba et al., 2006), are also checked

by this pathway.

In contrast to the TRAMP pathway which is restricted to the nucleus, the second

surveillance mechanism, the rapid tRNA decay (RTD) pathway, is located in both the

nucleus and the cytoplasm. The RTD pathway acts on mature tRNAs from the 5’ end (for

review, see Phizicky and Hopper, 2010). Cells with defective Trm8 and Trm4, which

7 5 normally modify tRNAs at m G46 and m C49, respectively, exhibit elevated temperature- sensitive growth, caused by the rapid degradation of hypomodified tRNAVal(AAC) by the

RTD pathway (Alexandrov et al., 2006). Furthermore, tRNA substrates with different modification defects are also RTD targets (Chernyakov et al., 2008). The same study reported a similar rate of tRNA substrate degradation after addition of transcription inhibitor thiolutin, showing that the degradation targets mature tRNAs, rather than pre- tRNAs (Chernyakov et al., 2008). Two 5’−3’ exonucleases were identified to function in the RTD pathway by suppressor analysis, Rat1, which locates in the nucleus, and Xrn1, which locates in the cytoplasm. Both of them require Met22 activity since a MET22-null mutant leads to accumulation of the substrate pAp that subsequently inhibits the activities of Xrn1 and Rat1 (Chernyakov et al., 2008; Dichtl et al., 1997).

1.2.2 tRNA subcellular dynamics

Transfer RNAs must exit the nucleus to the cytoplasm to function in protein synthesis;

therefore, it has been thought for a long time that tRNAs move one-way into the

cytoplasm. However, surprisingly, it was subsequently learned that cytoplasmic mature

10 tRNAs re-visit the nucleus, a process referred to as retrograde tRNA nuclear import

(Shaheen and Hopper, 2005; Takano et al., 2005). Imported cytoplasmic tRNAs return back to the cytoplasm via a process termed tRNA re-export (Shaheen and Hopper, 2005;

Takano et al., 2005; Whitney et al., 2007). This retrograde process is conserved from yeast to vertebrates (Barhoom et al., 2011; Shaheen et al., 2007; Zaitseva et al., 2006).

In vertebrate cells, tRNA nuclear export is mediated by Exportin-t (Exp-t), a member of the Ran-binding karyopherins (Arts et al., 1998a; Kutay et al., 1998). The orthologue of Exp-t in fungi, Xpo-t or Los1, is so far the only known tRNA exporter able to bind to end-processed intron-containing tRNAs in a Ran-GTP dependent manner. The crystal structure showed that Xpo-t from S. pombe binds tRNAs directly by contacting the acceptor arm, TψC and D loops (Cook et al., 2009). The data support the early observations that Exp-t prefers tRNAs with 5’ and 3’ matured ends but has no preference for intron-containing or intron-less tRNAs. (Arts et al., 1998b; Lipowsky et al., 1999;

Lund and Dahlberg, 1998).

In yeast, los1Δ cells are viable, suggesting that there are tRNA export pathway(s) in addition to Los1 (Hurt et al., 1987). Exp-5 (Msn5 in yeast) was identified as a tRNA exporter and functions in parallel with Los1. However, there must exist additional export pathway because los1Δ msn5Δ mutant is still viable (Takano et al., 2005).

Exportin-5 (Exp-5), or yeast orthologue Msn5, functions in exporting double strand miRNA in mammalian cells (Bohnsack et al., 2004; Gwizdek et al., 2003; Lund et al., 2004; Yi et al., 2003) and plants (Bollman et al., 2003). In yeast, Msn5 exports phosphorylated nuclear proteins to cytoplasm such as transcription factors Pho4 and Far1

(Blondel et al., 1999; Kaffman et al., 1998). The role of Msn5 in tRNA subcellular dynamics is solely in re-exporting back to the cytoplasm, as msn5Δ cells accumulate mature tRNAs but not precursor tRNAs in the nucleus (Murthi et al., 2010). Since it has been shown that the nuclear import process is constitutive, but tRNA nuclear accumulation is dependent on nutrient availability, it has been proposed that tRNA

nuclear-cytoplasmic trafficking is most likely regulated at the re-export process in response to nutrient availability (Murthi et al., 2010).

Spliced tRNAs are found to accumulate in the nucleus upon nutrient starvation

(Hurto et al., 2007; Shaheen and Hopper, 2005; Takano et al., 2005; Whitney et al., 2007).

One β-importin member, Mtr10 (vertebrate TRN-SR2), is responsible for tRNA nuclear accumulation upon nutrient deprivation and for the constitutive retrograde nuclear transport, directly or indirectly (Murthi et al., 2010). Relative to other members, there is limited understanding of the mechanism by which Mtr10 functions in tRNA nucleocytoplasmic dynamics. It is not known if Mtr10 binds tRNAs directly or adaptor mediated, and it is conceivable that Mtr10 functions in tethering tRNAs in the nucleus, therefore further studies on Mtr10 are necessary.

1.3 Amino acid stress responses

Yeast cells rapidly respond to changing environments by reprogramming gene expression.

Several studies have described the changes in global gene expression when the

availability of nutrient, such as amino acids, carbon source, or phosphate, are limited

(Castelli et al., 2011; Gasch et al., 2000; Kuhn et al., 2001; Natarajan et al., 2001; Ogawa

12 et al., 2000). Amino acid starvation is of particular interest in this work. It is known that amino acid deprivation results in global translation repression, which has been thought to inhibit general protein synthesis by which cells can save energy. Moreover, amino acid stress also causes induced translation of the central positive transcription regulator Gcn4.

Gcn4 is a transcription activator that stimulates the transcription of several amino acid biosynthesis pathways upon amino acid deprivation (for review, see Hinnebusch, 2005).

Signaling pathways involved in translation regulation for amino acid-starved cells are well-studied (for reviews, see Gasch and Werner-Washburne, 2002; Wilson and

Roach, 2002). Uncharged tRNAs increase when cells are deprived for amino acids which subsequently activates the protein kinase Gcn2. Gcn2 phosphorylates the translation initiation factor eIF2-α, which prevents the regulatory circuit of eIF2 and initiation complex formation. Phosphorylation of eIF2α subsequent leads to general translation inhibition. Interestingly, although the global translation is inhibited, starvation of amino acids, purine, or glucose, activates the translation of Gcn4 mRNA (for review, see

Hinnebusch, 2005). Gcn4 is regulated at multiple levels. There are four small uORFs in the upstream sequence of the Gcn4 transcript. They serve to negatively regulate translation of Gcn4. Under nutrient starvation, the ribosome bypasses the uORFs and thus derepresses the translation of Gcn4 in a Gcn2-dependent manner (Hinnebusch, 1997).

Moreover, there are also several reports demonstrating that the derepression of Gcn4 can also be regulated in a Gcn2-independent fashion (for review, see Hinnebusch, 2005).

Finally, Gcn4 can be regulated at the level of protein stability. The half-life of Gcn4 is 2 minutes when cells are grown in rich media, however, in cells deprived of amino acids

the half-life of Gcn4 increased to 10 minutes. Phosphorylation of Gcn4 by cyclin

dependent kinase Pho85 is required before it is degraded by Rad6 and Cdc34 (Kornitzer et al., 1994; Shemer et al., 2002).

1.4 Microarray analysis

1.4.1 Microarray general applications and advanced usage for

translational profiling

Microarray technology is a very powerful approach to examine gene expression levels on large or genome-wide scale. Arrays are created by thousands of probes robotically spotted and immobilized on microscope glass slides or silicon chips (Affymetrix). The probes can be DNA, cDNA, or oligonucleotides, and they are designed to hybridize to specific fluorophore-labeled targets in samples. Thus the abundance of targets can be detected and quantified based on fluorescence signal levels.

There are two basic types of arrays for expression analysis, dual channel (two- color) and single channel (one-color). Two-color microarray (also called cDNA or spotted array) was first developed by the Patrick Brown laboratory (Schena et al., 1995); these arrays are generated by spotting cDNA probes on to the solid supports. The experiment design typically compares two biological samples, for example, reference

(control) versus drug-treatment, and is thus measuring the relative abundance of targets between samples. The two samples are usually labeled with two different dyes, such as

Cy3 (green) and Cy5 (red), and then mixed and hybridized to one array. During image analysis, the ratio of the two dye intensities is calculated for each spot and thus represents 14

the relative amount of each target. The advantages of this technology are that the probes

can be customized for only a set of genes of interest (for example, immune-response

related genes, Kim et al., 2005) and the cost is relatively inexpensive.

Single-channel arrays, or high-density arrays, contain short-oligonucleotides (for

example, in Affymetrix GeneChip®, probes are 25 nucleotides in length), these are

designed to match part of each single dye-labeled target and thus are referred as

“probeset”. These oligonucleotides are produced directly on silicon chips by

photolithography technique (Fodor et al., 1991). A large number of different probesets

can be synthesized on a single chip, (for example, the Affymetrix Human Genome U133

Plus 2.0 Array is comprised of more than 54,000 probesets, http://www.affymetrix.com/) and thus it is also called high-density array. This array generally provides “absolute” intensity of each labeled target, so two chips are needed to compare the expression level of a gene from two biological conditions.

To date, many microarray experiments are utilized for various applications.

Different experimental designs provide different kinds of information. In the last few years, a growing number of studies combined technology of translation status and microarray analysis to analyze translation profiles in a genome-wide scale under many different conditions, such as environmental stress (Arava et al., 2003; Blais et al., 2004;

Kuhn et al., 2001; Shenton et al., 2006; Smirnova et al., 2005). The sucrose gradient sedimentation of mRNA is affected by its ribosome occupancy and that is an indicator of translational status as ribosome binding (initiation), moving along the coding region

(elongation), and falling off (termination). Thus, the distribution pattern of ribosome

becomes an important indicator for analyzing global translation profiles or translational status of genes of interest. Different organization of ribosome association on an mRNA can reflect its translation efficiency; for example, high occupancy on polysomes of a particular transcript usually correlates with high efficiency of translation and may

generate high levels of protein products (Tuller et al., 2007).

In this study, Affymetrix GeneChip arrays (Yeast Genome 2.0 arrays) are used,

so the experiment and data analysis are specific to these arrays. RNA was extracted from

the biological samples, converted to cDNA, and then labeled with Biotin. The labeled

cDNAs were hybridized to the surface of the arrays, followed by washing and processing.

The arrays were scanned by a laser to generate the digital image files and the raw

intensity data were obtained.

1.4.2 Data analysis

After scanning the hybridized array an image file is created (.dat). Software provided by

Affymetrix, GeneChip Operating System (GCOS), computes the signal intensity from

image file and subsequently creates .cel files. The files need further processing before

being subjected to statistic analysis and selection of differentially expressed genes.

Although commercial software from microarray companies is costly, there are other

open-source programs in various platforms that are freely available. These programs

include Significance Analysis of Microarrays (SAM, which can be executed in Excel,

Tusher et al., 2001), Bioconductor (Gentleman et al., 2004,

http://www.bioconductor.org/), and GenePattern (Reich et al., 2006,

http://www.broadinstitute.org/cancer/software/genepattern/). In this project all of the

microarray data analyses were executed by employing the Bioconductor in R

environment or the GenePattern web-interface platform. Bioconductor uses the R

statistical programming language and provides various packages not only for microarray

analysis, but also for sequence data and other high-throughput data assays (554 software

packages while writing the thesis). There are also several diagnostic plots that can be utilized to visualize the data set and to assess data quality for each step of data analysis.

For example, box plots and principle component analysis (PCA) can be applied as a general assessment of microarray data. Scatter plots and volcano plots provide comparison results of two samples. GenePattern is another useful platform for genomic analysis, which offers many tools to analyze large-scale data in web-based interface or

the user’s computer.

There is no standard procedure for analyzing microarray data. Therefore, each

step of analyzing decisions leads to non-identical results. Generally, the pipeline of

microarray data analysis includes pre-processing of raw data, identification of significant

differential genes, visualization, and interpretation. Each of the steps is briefly described below and the details are written with R language in Appendix P.

Pre-processing

On Affymetrix GeneChips, there are many probes (short oligonucleotides), referred as a

probeset, designed for targeting a single gene (Figure 1. 3). The .cel file contains signal

intensity data of each probe. Therefore, it is necessary to process the intensities of those

probesets into gene expression values for each target. This step is called normalization. In

addition, there are other factors that must be considered such as technical artifacts. Thus

the purpose of normalization is not only to process expression values, but also to remove

these artificial effects and to correct backgrounds among chips. In this procedure, the cdf

(chip description file) file, which is provided from Affymetrix, is required because it

offers the identity of the probe information. There are several methods to perform

normalization. One of them, Robust Multiarray Average (RMA), available in a package

called “affy” from Bioconductor, is currently most commonly used for microarray

normalization (Bolstad et al., 2003; Irizarry et al., 2003). RMA is an algorithm and the

assumption of RMA is that usually only a small percentage of genes are altered in

different conditions. Thus RMA uses quantile normalization and median polish (an

alternative way to get median value) to calculate the expression values by using all

probesets (the log2-converted perfect-match intensities) across all chips. In this way it

provides sensitive detection of differential expressed genes with statistical tests.

Identification of differential expressed genes

The main purpose of microarray analysis is to identify the genes which are differentially expressed in different conditions or treatments. Numerous statistical strategies are designed and developed for selecting those expression-changed genes; most of them use variants of t-test to take sample size and variations into account. Since the traditional multiple tests is not appropriate for the genome-wide scale data, several alternative

methods for permutation of p-value are developed for more accurate selection of genes of

interest, for example, the Bonferroni correction or false discovery rate (FDR). In this

project, the package of “Linear Models for Microarray data analysis” (limma) in

Bioconductor was used to select significant differentially expressed genes (DEGs).

Employing limma analysis, DEGs can be ranked by both fold-change and Bonferroni-

adjusted p-value (Smyth, 2004). Once the list of significant differentially expressed genes

is created, the data can be used for a variety of following analyses, such as hierarchical

clustering and pattern recognition.

Figure 1. 3. Probe and probesets.

Hierarchical clustering

When significant differentially expressed genes are selected, the next challenge is how to focus on real genes of interest. One approach is clustering, which is widely used in microarray analysis. Based on various algorithms, the produced clusters can have 19

differences in properties. For example, hierarchical, k-means, and self-organizing map

(SOM), etc., are common methods for analyzing microarray data (Sherlock, 2000). The

hierarchical clustering model is generated based on distance connectivity. Briefly, the

algorithm calculates the distance of each gene expression value and returns groups of

genes or samples with similar expression profiles. Additionally, there are various ways to

measure distances and to cluster groups. Moreover, the input files can be normalized expression values from genome-wide array without statistical analysis or only the

expression profiles from differential expression genes. Therefore, each choice in

measurement and in clustering would give different results. In this project, the

hierarchical analysis and the visualization of the results were generated from GenePattern.

GO term enrichment analysis and FunCat

Other approaches to focus on genes of interest are by employing the Gene Ontology (GO) enrichment analysis (http://amigo.geneontology.org/cgi-

bin/amigo/term_enrichment?session_id=) or MIPS FunCat analysis (Functional

Catalogue, http://mips.helmholtz-muenchen.de/proj/funcatDB/search_main_frame.html)

(Ruepp et al., 2004). GO is a biological database that provides information of gene

products within defined categories (for review, see Rhee et al., 2008). FunCat provides

such information in a different way. Using similar concepts like clustering, GO term

enrichment analysis and FunCat group genes associated with similar phenotypes and

compare the occurrence frequency with genome frequency by statistical analysis. In this

work both tools are performed to gain more insight of the gene list.

1.5 Aim of this study

The major goal of this study is to investigate the potential role(s) of tRNA nuclear-

cytoplasmic trafficking in translation regulation, globally and specifically, by analyzing

the polysome profiles and by employing microarrays of mRNAs that are or are not

associated with polysomes. I compared the translation profiles by microarray analysis of

mRNAs isolated from wild-type cells to mRNAs isolated from cells defective in tRNA

nuclear import (mtr10Δ) or re-export (msn5Δ) grown in fed condition or acutely starved by removal of all amino acids (Chapter 3). In addition, since little is known about the importer Mtr10, a minor aim of this work was to analyze transcriptional profiles of mtr10Δ cells, which could provide insights into its cellular function(s) (Chapter 4).

CHAPTER 2

Materials and Methods

2.1 Yeast growth conditions and strain construction

Most Saccharomyces cerevisiae strains employed in this study were derived from haploid

BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0, from Open Biosystems (Winzeler et al.,

1999) or are otherwise indicated. All of the strains are listed in Table 2. 1.

2.1.1 Media and growth conditions

Yeast cells were grown in either YEPD (yeast extract/peptone medium with 2 %

glucose/dextrose) or SC medium (Synthetic Complete defined medium; Difco yeast

nitrogen base without amino acids, supplemented with amino acids, adenine [0.04 g/L],

uracil [0.04 g/L], and 2 % glucose as carbon source) at 23°C or 30°C in an air shaker

with speed of 220 rpm. Amino acids in SC medium included L-arginine (0.02 g/L), L-

aspartic acid (0.1 g/L), L-glutamic acid (0.1 g/L), L-histidine (0.02 g/L), L-isoleucine

(0.06 g/L), L-leucine (0.06 g/L), L-lysine (0.03 g/L), L-methionine (0.02 g/L), L-

phenylalanine (0.05 g/L), L-serine (0.375 g/L), L-threonine (0.2 g/L), L-tryptophan (0.02

22 g/L), L-tyrosine (0.05 g/L), L-valine (0.15 g/L). For amino acid starvation experiments, pre-warmed SC medium without addition of amino acids was used.

2.1.2 Yeast strain construction

Oligonucleotides

DNA oligonucleotides were synthesized by SIGMA-ALDRICH. The sequences of all employed oligonucleotides are in Table 2. 2.

High efficiency yeast transformation

Double deletion and genomic C-terminal 3HA- or GFP-tag strains were generated by introducing PCR fragments with selection marker using a Lithium acetate (LiOAc) transformation method (Chen et al., 1992a; Longtine et al., 1998). Yeast cells were grown overnight in 50 ml of rich YEPD media until OD600 reached 1-3. Cells were harvested, washed twice with 1X TE/LiOAc solution (1M LiOAc and TE buffer containing 10 mM

Tris-HCl, pH7.4, and 1mM of EDTA, pH8.0, served as 10X stocks), and then resuspended in 0.7-1 ml of 1X TE/LiOAc solution. For each reaction, 100 µl of yeast competent cells were then mixed with 10 µl of PCR products of replacement cassettes after ethanol-precipitated or column-purified, and 10 µl of denatured salmon-sperm DNA, followed with addition of 650 µl transformation solution (ratio of 60% PEG: LiOAc: TE:

H2O as 7:1:1:1). The mixtures were incubated at 23°C or 30°C in an air shaker for 1 hr, followed by heat-shock in a 42°C water bath for 15 min. Cells were then collected by centrifugation for 10 seconds and then plated onto selective solid media and incubated for

2 or more days. Colonies were then picked and grown on new selective solid media for a

second round of selection. For drug-selective media, such as Hygromycin B, cells were

grown in YEPD media for 6 hr or overnight prior to plating.

Strain construction

To select deletion strains, yeast cells were mixed with an appropriate DNA replacement

cassette, natMX4, hphMX4 (Goldstein and McCusker, 1999), or Kleuyveromyces lactis

LEU2 (Gueldener et al., 2002), followed by high efficiency transformation, and grown on

solid media containing the appropriate drugs: YEPD + clonNAT (100 mg/L; Werner

BioAgents, Jena, Germany), YEPD + hygromycin B (300 mg/L, Calbiochem, La Jolla,

CA), or SC-Leu, respectively. For construction of genomic C-terminal 3HA- or GFP-tag

strains, yeast cells were incubated with knock-in cassette (pFA6a-3HA-His3 or pFA6a-

GFP-His3) and were grown and selected on the SC-his solid media.

Preparation of yeast genomic DNA

For deletion strains, yeast cells were confirmed by PCR analysis of genomic DNA with

primers complementary with an upstream region of the target gene and with selection

marker. To confirm C-terminal tagging, primers complementary with middle of the

particular coding region and with epitope were used. To extract genomic DNA, one

colony (or more than one) with size of approximately 1 mm was picked from plates,

transferred into a microfuge tube containing 100 µl of zymolyase digestion solution, and

incubated at 37°C for 30 min. 1/10 volume of 10% SDS and 2 volumes of

phenol/chloroform were added followed by vigorously shaking. After centrifugation,

supernatants were transferred and the nucleic acids were precipitated with 2 volumes of

ethanol and 1/10 volume of 3M sodium acetate in -80°C. DNA pellets were then

collected, washed by 70 % ethanol, and dissolved in 20 µl of sterile H2O.

2.1.3 Growth assay

Yeast cells were cultured overnight in YEPD medium prior to the growth assay. Cells

were adjusted to same starting OD600 and then 10-fold serial dilutions in sterile H2O were prepared. 5 µl aliquots of each dilution was spotted on the indicated solid media, such as

SC, SC-met, or SC-arg, followed by incubated at indicated temperatures for 2 or more days and then photographed.

2.2 Polysome profiles and RNA isolation

For microarray analysis, wild-type (BY4742), msn5Δ, and mtr10Δ cells were used; for polysome profile analysis, additional tRNA retrograde mutants, los1Δ and los1Δ msn5Δ,

were used.

2.2.1 Polysome profiles

One liter of cell culture was grown in synthetic complete media at 30°C in an air shaker

to early logarithmic phase (A600 around 0.35). The culture was divided into two bottles;

after centrifuging (~ 2,700 g, room temperature, 5 min) the cultures were resuspended

with 500 ml of 30°C pre-warmed SC and SC-aa (SC medium lacks all amino acids) 25

medium, respectively, and the two cultures were returned to the shaker for 30 min.

Cycloheximide was added to each culture to final concentration 100 µg/ml for two

minutes before cultures were harvested. Cultures were cooled on ice less than 5 min, and

cells were harvested and washed with 20 ml of cold freshly-prepared lysis buffer (20 mM

Tris-HCl with pH 8.0, 140 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 100 µg/ml

cycloheximide, 1 mg/ml heparin). After the culture was washed, the cells were

transferred to 15 ml conical tubes and then resuspended in 750 µl of lysis buffer. ~350 µl

of cold acid-washed glass beads (0.4-0.6 mm diameter, Thomas Scientific) were added

and then cells were disrupted by vortexing in cold room with 10 cycles of 30 seconds burst and 30 seconds ice. The clear crude lysate was obtained after centrifugation at ~

12,600 g for 5 min at 4°C. 5 µl of lysate was transferred into 995 µl of water for A260 measurement to estimate the RNA concentration.

Twenty A260 units of cell extract with the addition of Triton X-100 to final

concentration 1 % were loaded onto an 11ml gradient (Polyallomer tube, Beckman

Coulter) composed with five layers of 10%, 20%, 30%, 40%, and 50% sucrose (w/v) in

gradient buffer (20 mM Tris-HCl with pH 8.0, 140 mM KCl, 5 mM MgCl2, 0.5 mM dithiothreitol, 100 µg/ml cycloheximide, 0.5 mg/ml heparin). Gradients were centrifuged in SW41 Ti rotor (Beckman Coulter) at 39,000 rpm for 2.5 hr in 4°C. Gradient was fractionated into 14 tubes (~0.9 ml) using ISCO UA-6 collection system (Brandel,

Gaithersburg, MD) with UV254 recorder. During the process of fractionation polysome

profiles were monitored and traced continuously.

2.2.2 Quantification of polysome profiles

The scanned polysome profiles were analyzed using an area measurement tool in Adobe

Acrobat 8 Professional version. Statistical significant analyses were conducted in

Microsoft Excel with two tail t test. Figure 2. 1 shows how each peak was selected in the

polysome profiles in fed or starved conditions. In fed condition, the areas of 40S and 80S

peaks are measured separately. This sum of 40S and 80S area represented non-translating

pool. In amino acid starved cells, there was a large increase in the non-translating region

and usually above the range of UV254 detector. Therefore, the area of 40S + 80S was

estimated by projecting (the shading region of right panel in Figure 2. 1). Profiles shown

in Figure 2. 1 are representatives from more than three repeated experiments.

Fed Starved

Figure 2. 1. Illustration of quantification method.

2.2.3 RNA extraction

For microarray experiments, polysomal RNA isolation procedures were similar as

previously described (Arava et al., 2003; Coller and Parker, 2005). Briefly, fractions 5 to

8 (non-polysomal RNA samples) and 10 to 14 (polysomal RNA samples) were pooled

together in 30 ml glass tubes. Fractions were then mixed with 2-fold volumes (2V) of 8M

Guanidine-HCl; the RNAs were then precipitated in 100% ethanol. The nucleic acid

pellets were obtained by centrifugation using JA-17 rotor (~13,800 g, for 20 min at

4°C). The pellets were washed once with 85% ethanol, dissolved in 400 µl of TE buffer, and then transferred into 2 ml microfuge tube following by phenol/chloroform extraction.

After centrifugation (~ 12,600 g for 10 min at 4°C), the supernatant was transferred to a new 1.5 ml microfuge tube and 200 µl of 7.5 M LiCl (to final concentration 2.5M) was added to precipitate the RNAs after stored at -20°C overnight. RNA samples were collected at ~ 12,600 g for 20 min at 4°C and they were washed with 85% ethanol followed with dissolving in sterile H2O. To remove LiCl, RNA samples were precipitated

again by ethanol/NaOAc and resuspended in 7 to 15 µl of nuclease-free water.

Unfractionated RNA samples were directly extracted from the lysates for “total RNA”.

Concentrations of RNA samples were measured by A260.

2.3 Microarray data analysis

The quality of total, polysomal, or non-polysomal RNAs from BY4742, msn5Δ, and

mtr10Δ cells grown in fed or amino acid starvation conditions were estimated using an

Agilent Bioanalyzer. Microarray experiments were then performed using Affymetrix 28

GeneChip Yeast Genome 2.0 arrays according to manufacturer’s instructions by the OSU

microarray shared resource (http://www.osuccc.osu.edu/microarray/). Data pre-

processing and further statistical analysis were conducted using the free open-source

software R (version 2.7.2 or later, R development Core Team, 2011) (http://www.r-

project.org) and Bioconductor suite (Gentleman et al., 2004) supplemented with packages

of Affy (Irizarry et al., 2003), Limma (linear models for microarray data) (Smyth, 2004),

and others, as described in the programming codes in Appendix P. Microarray raw and

normalized data set will be deposited in the GEO database.

2.3.1 Pre-processing of raw data

In this project, the procedures of pre-processing included raw intensity data (.cel files) imported into R, removal of S. pombe probes, Robust Multiarray Average (RMA) normalization, and filtering outliers. After RMA normalization, expression intensities of each target were simultaneously transformed to a single log2 value, which was then

utilized for calculation of the translational activity index (P/NP) using the equation log2 P

– log2 NP. Distinct processed dataset from each mutant under fed or starvation were then

generated (mtr10Δ versus wild-type in fed or in starvation conditions; msn5Δ versus

wild-type in fed or in starvation conditions). Codes are in Appendix P.

2.3.2 Identification of significant differentially-expressed genes

Each dataset was subjected to fit the linear model using the limma program according to

instructions. Significant differentially expressed genes were selected by setting cutoff 29

conditions, such as log2 (fold-change) and adjusted p-value, and were highlighted in

volcano plots. Codes are in Appendix P. These selected genes were then annotated and

exported for further applications. In this study, hierarchical clustering, gene ontology

enrichment analysis, functional categories were used.

2.3.3 Hierarchical clustering of significantly changed target transcripts

When differentially-expressed targets were selected, their expression profiles from P, NP,

and T, were extracted for heatmap creation. Hierarchical clustering analysis and

generation of heatmaps were conducted using web-based tool in the GenePattern

platform (by using the modules of HierarchicalClustering and

HierarchicalClusteringViewer) (Reich et al., 2006) with the parameters of pearson-

correlation in row distance, no column clustering, and pair-wise complete linkage.

(http://www.broadinstitute.org/cancer/software/genepattern/).

2.4 Northern blot analysis

Total RNA (12 µg in 6 µl) samples were denatured (for each sample, denaturing buffer contained 3 µl of 10X MOPS buffer, 5.3 µl of 37 % formaldehyde, 15 µl of de-ionized formamide, 1 µl of 1mg/ml ethidium bromide) at 65°C for 15 min, following by chilling on ice and addition of loading dye (75 % glycerol and 0.2 % bromophenol blue in RNA denature buffer). Denatured RNA samples were separated by 1.2 % agarose formaldehyde gels in 1X MOPS buffer subjected to electrophoresis at 50-80 V for

approximately 5-6 hr. RNAs were then capillary transferred to Hybond N membrane (GE

Healthcare) using 20X SSC, following by UV cross-linking to the membranes. The blot was hybridized at 42°C with purified radiolabeled DNA probes. Blots were washed with

wash buffer (2X SSC, 0.05 % SDS). The blots were then analyzed using Typhoon Trio

variable Mode Imager (GE Healthcare) and ImageQuant 5.0 (Molecular Dynamics).

2.4.1 Preparation of DNA probes

DNA probes (length between 300 to 800 base pair) used for Northern blots were generated by PCR with genomic DNA from wild-type cells or with plasmids from the

yeast genomic tiling collection (Jones et al., 2008, OpenBiosystems). DNA probes were randomly radiolabeled with random primers (Invitrogen), α–32P-dCTP (PerkinElmer,

Massachusetts, USA), dATP, dTTP, and dGTP, by DNA polymerase Klenow (Fermentas,

Maryland, USA). Labeled probes were purified by eluting from G-50 column (GE

Healthcare). The purified probes were then denatured in boiled water for 5 min and added

into hybridization buffer. All of the oligonucleotides used in this study are listed in

Table 2. 2.

2.5 Western blot analysis

2.5.1 Protein extraction

Whole cell protein extracts were prepared from 15 ml cell cultures grown at 30°C to a

density of 0.35-0.45 OD600. Cells were washed once with cold water and disrupted in 100

µl lysis buffer (50 mM Tris-HCl with pH7.4, 150 mM NaCl, 25 mM EDTA, 1 % Triton

X-100, 0.5 % SDS, 10 mM PMSF, 1X protease inhibitor [Calbiochem, cocktail set IV]) 31

with approximately 50-70 µl of acid-washed glass beads. Cleared cell extracts were obtained after centrifugation at ~ 12,600 g for 5 min at 4°C. Protein concentrations were determined from 1 µl of extracts using the Bradford method (Bio-Rad). Protein extracts were then denatured in 4X SDS sample loading buffer (0.2 M Tris-HCl with pH6.8, 8 % SDS, 0.4 % BPB, 40 % Glycerol, 57.2 mM 2-ME) in boiling water for 5 minutes.

2.5.2 Western blot and quantification

Depending on the individual endogenous target protein intracellular levels, total amounts

of 5 to 20 µg of protein extracts from each strain were resolved on 10% SDS-PAGE with running buffer (0.025 M Tris, 0.192 M glycine, 0.1 % SDS). Immunoblotting was employed using a semi-dry transfer apparatus (BioRad Trans-Blot) at 15 V for 1 hr in transfer buffer (30 mM glycine, 0.037 % SDS, 20 % methanol, 48 mM Tris-HCl, pH 8.0).

The blots were probed with primary antibodies in 5 % non-fat milk in 1X TBST buffer

(20 mM Tris-HCl, pH 7.4, 120 mM NaCl, 0.1 % Tween-20). 3HA or GFP fusion proteins,

Pgk1, or Kar2, were detected using horseradish peroxidase (HRP)-conjugated

electrochemiluminescence (ECL) technology (Pierce, Rockford, IL, USA) using primary

antibodies: anti-HA, (Roche, Rat monoclone, 3F10, 1:1,500), anti-GFP (Roche, mouse

polyclone, 1:1,500), anti-Pgk1 (a kind gift from Paul Herman lab; rabbit polyclone, 1:

15,000), anti-Kar2 (Santa Cruz Biotechnology, rabbit polyclone, y-115, sc-33630, 1:

5,000). Quantification of protein signals were performed by ImageJ open source software

(http://rsbweb.nih.gov/ij/).

2.6 Cis-regulatory element analyses of targets

Sequences of upstream and downstream of target genes were retrieved from web-based

resource (Regulatory Sequence Analysis Tools, RSAT, http://rsat.ulb.ac.be/rsat/)

(Thomas-Chollier et al., 2011; Thomas-Chollier et al., 2008; van Helden, 2003). The output text file was later utilized for further analyses of codon bias usage and amino acid usage.

2.6.1 Codon bias and amino acid usage

For investigating the codon bias and amino acid usage, the open reading frame sequences

of translational differentially expressed genes (DEGs) in fed mtr10Δ cells were extracted

from the table supplemented with the frequencies of each codon in each gene by the

generous help of Dr. Thomas Begley (State University of New York in Albany) to

compile the algorithm. Z score for each transcript, calculated as described previously

(Begley et al., 2007). The data were imported into GenePattern for generation of

hierarchical heat map.

Table 2. 1. Yeast strains used in this study

Strain Genotype Source BY4742 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0, wild-type Winzeler et al., 1999

los1Δ MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 los1::kanMX4 Winzeler et al., 1999

msn5Δ MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 msn5::kanMX4 Winzeler et al., 1999 los1Δmsn5Δ MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 los1::kanMX4 msn5::hphMX4 This study mtr10Δ MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mtr10::natMX4 This study

BY4741 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0, wild-type Winzeler et al., 1999

dhh1ko1 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 dhh1::hphMX4 Hurto and Hopper, 2011

pat1ko8 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 pat1::natMX4 Hurto and Hopper, 2011

pat1dhh1-11 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 pat1::natMX4 dhh1::hphMX4 Hurto and Hopper, 2011 34

mtr10Δ MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 mtr10::natMX4 Murthi et al., 2010 HYC163 MATα BY4742 MET22-3HA::His3MX6 This study HYC171 MATα los1Δ MET22-3HA::His3MX6 This study HYC179 MATα msn5Δ MET22-3HA::His3MX6 This study HYC186 MATα los1Δ msn5Δ MET22-3HA::His3MX6 This study HYC192 MATα mtr10Δ MET22-3HA::His3MX6 This study HYC261 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 MET22::natMX4 This study HYC296 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 trm8::Kl.leu2 trm4::natMX4 This study HYC348 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 trm8::Kl.leu2 trm4::kanMX4 met22:natMX4 This study HYC337 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 msn5::kanMX4 trm8::Kl.leu2 trm4::natMX4 This study HYC335 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 los1::kanMX4 trm8::Kl.leu2 trm4::natMX4 This study HYC341 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 los1::kanMX4 msn5::hphMX4 trm8::Kl.leu2 This study trm4::natMX4 (continued.) 34

Table 2. 1. (continued.) Strain Genotype Source HYC375 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mtr10:: natMX4 trm8::Kl.leu2 This study trm4::kanMX4 HYC354 MATα BY4742 MET2-3HA::His3MX6 This study HYC364 MATα los1Δ MET2-3HA::His3MX6 This study HYC359 MATα msn5Δ MET2-3HA::His3MX6 This study HYC367 MATα los1Δ msn5Δ MET2-3HA::His3MX6 This study HYC370 MATα mtr10Δ MET2-3HA::His3MX6 This study HYC479 MATα BY4742 MET3-3HA::His3MX6 This study HYC483 MATα los1Δ MET3-3HA::His3MX6 This study HYC486 MATα msn5Δ MET3-3HA::His3MX6 This study HYC489 MATα los1Δ msn5Δ MET3-3HA::His3MX6 This study HYC492 MATα mtr10Δ MET3-3HA::His3MX6 This study

35 HYC495 MATα BY4742 MET14-3HA::His3MX6 This study HYC500 MATα los1Δ MET14-3HA::His3MX6 This study HYC504 MATα msn5Δ MET14-3HA::His3MX6 This study HYC508 MATα los1Δ msn5Δ MET14-3HA::His3MX6 This study HYC514 MATα mtr10Δ MET14-3HA::His3MX6 This study HYC560 MATα BY4742 CYS4-3HA::His3MX6 This study HYC565 MATα los1Δ CYS4-3HA::His3MX6 This study HYC570 MATα msn5Δ CYS4-3HA::His3MX6 This study HYC574 MATα los1Δ msn5Δ CYS4-3HA::His3MX6 This study HYC578 MATα mtr10Δ CYS4-3HA::His3MX6 This study HYC1162 MATα BY4742 ARG3-3HA::His3MX6 This study (continued.) 35

Table 2. 1. (continued.) Strain Genotype Source HYC619 MATα los1ΔARG3-3HA::His3MX6 This study HYC1165 MATα msn5Δ ARG3-3HA::His3MX6 This study HYC630 MATα los1Δ msn5Δ ARG3-3HA::His3MX6 This study HYC1167 MATα mtr10Δ ARG3-3HA::His3MX6 This study HYC1171 MATα BY4742 ARG5,6-GFP(S65T)::His3MX6 This study HYC636 MATα los1Δ ARG5,6-GFP(S65T)::His3MX6 This study HYC1174 MATα msn5Δ ARG5,6-GFP(S65T)::His3MX6 This study HYC638 MATα los1Δ msn5Δ ARG5,6-GFP(S65T)::His3MX6 This study HYC1175 MATα mtr10Δ ARG5,6-GFP(S65T)::His3MX6 This study HYC1012 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 pat1ko8 ARG3-3HA::His3MX6 This study

36 HYC1017 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 pat1ko8 MET3-3HA::His3MX6 This study HYC1041 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 mtr10::natMX4 MET3-3HA::His3MX6 This study HYC1057 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 mtr10::natMX4 ARG3-3HA::His3MX6 This study HYC1078, BY4741 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 ARG3-3HA::His3MX6 This study HYC1082, BY4741 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 MET3-3HA::His3MX6 This study HYC1086, dhh1 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 ARG3-3HA::His3MX6 This study HYC1090, dhh1 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 MET3-3HA::His3MX6 This study HYC1094, dhh1pat1 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 ARG3-3HA::His3MX6 This study HYC1098, dhh1pat1 MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 MET3-3HA::His3MX6 This study HYC1185, BY4742 (HYC1171 derivative) ARG5,6-GFP(S65T)::His3MX6 [pRS426 URA3] This study HYC1186, BY4742 (HYC1171 derivative) ARG5,6-GFP(S65T)::His3MX6 [Trz1-MORF URA3] This study HYC1195, tyw1 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 tyw1::kanMX4 ARG3-3HA::His3MX6 This study HYC1201, BY4742 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 ARG3-3HA::His3MX TRM5-GFP::kanMX4 This study

36 (continued.)

Table 2. 1. (continued) Strain Genotype Source HYC1210, BY4742 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 ARG3-3HA::His3MX TRM5-NES- This study GFP::kanMX4 HYC1231, mtr10 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mtr10::natMX4 ARG3-3HA::His3MX This study TRM5-GFP::kanMX4 HYC1232, mtr10 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mtr10::natMX4 ARG3-3HA::His3MX This study TRM5-NES-GFP::kanMX4 HYC1360, BY4742 MATα BY4742 LEU4-3HA::His3MX6 This study HYC1360, los1msn5 MATα los1Δ msn5Δ LEU4-3HA::His3MX6 This study HYC1374, mtr10 MATα mtr10Δ LEU4-3HA::His3MX6 This study HYC1381, BY4741 MATa BY4741 LEU4-3HA::His3MX6 This study HYC1378, dhh1pat1 MATa dhh1Δ pat1Δ LEU4-3HA::His3MX6 This study HYC1380, dhh1 MATa dhh1Δ LEU4-3HA::His3MX6 This study HYC1383, mtr10 MATa mtr10Δ LEU4-3HA::His3MX6 This study 37

Table 2. 2. Oligonucleotides used in this study

Name Purpose Sequence (5’→3’) Source mtr10 deletion F TGAGGATATACTAAGGATTAACTTGCGTTATGGACAACTTACAG Shaheen and Hopper, WHIT37

(::nat or ::hph) GTATCTGCAGGTCGACGGATCCCCGG 2005 mtr10 deletion R CCATCCAACAAACGCCCTAATCCTTCCTTCCCTCACCTTTCTGTA Shaheen and WHIT38

(nat or hph) ATCCCTTGAGTGGATCTGATATCGA Hopper, 2005 Shaheen and WHIT47 mtr10 upstream CATCGGCACTATTCACAGGAA

Hopper, 2005 Shaheen and WHIT48 mtr10 downstream GGCATATCCTGATGTACTCAG

Hopper, 2005 msn5 deletion F CGTTGATTGGAAGAAAAGTAATGGATTCCACAGGCGCTTCTCAG WHIT59 Michael Whitney (::nat or ::hph) ATTGTTACAGCTGAAGCTTCGTACGC msn5 deletion R CAGACCCACATTAAAACGCTTGATTATATGCATATTTACCGGCT WHIT60 Michael Whitney (::nat or ::hph) GCCGACTGTGGATCTGATATCATCGA

38 HY01 F msn5 upstream CCATTGAACAGAGGTGCTGGAG This study HY02 R msn5 downstream GGTGTATGCACGTACCTCTTAC This study HY06 F mtr10 Midstream TTGGTAGATATACCGAATGGACAG This study HY07 R mtr10 Midstream ACTCAATATCAATCGAACTCTGCAC This study HY25 F met22 DNA probe generation TCCTATTGACGGAACCAAGG This study HY26 R met22 DNA probe generation CCTCCAGCTTCATGGACAAT This study HY33 F met3 DNA probe generation TAGAGCCCACAGGGAGTTGACTG This study HY34 R met3 DNA probe generation GGTCTTGGTGGGTTGGATTCTC This study HY37 F met2 DNA probe generation CTAGTGCTTGAGTCTGGCGTGGT This study HY38 R met2 DNA probe generation GACATACGTGCAGCCGATAGTCC This study HY43 F met14 DNA probe generation CGCAAGGCATTGAGAAAACAGG This study HY45 F Met28 DNA probe generation CATTGCTGCTGGTTAGCAGTGG This study (continued.) 38

Table 2. 2. continued. Name Purpose Sequence (5’→3’) Source HY46 R Met28 DNA probe generation CTACCTGCCCATGTTCCGTCTCT This study GTTATAGCGTCAAGTGGCCCACGCGAGTTACATGACTTGGTGGT HY73 F Met22 C-term tag GTCTACATCATGCGATGTCATTCAGTCAAGAAACGCCcggatccccgg This study gttaattaa CACATACACACATATATATATGTACTCATATATTTATGTCTATCA HY74 R Met22 C-term tag This study ATAAAGTAAAATATATGTTATgaattcgagctcgtttaaac HY75 R confirm 3HA tag GCGCCTCAGCACTGAGCAGCG This study TPL010 R confirm GFP tagg TTGTGACCATTAACATCACCATCT Tsung-Po Lai HY83 F Trm8 upstream GCTAAGTGGGTTGGGTTTGGTTCGTACG This study HY84 R Trm8 downstream CGGAAGAGCTTGCGGCTCAAATAACCTGG This study HY85 F Trm4 deletion (::natMX4 or CACTTCCTTTTATCTACACTGTAATCCGAAGAATACACTATAAG 39 This study ::kanMX4) GCTGGCTAGAAGccaggtcgacggatccccgg GCCTTTTAATAATATACATTTACTTTACAGTGGAGGGGATAAGA Trm4 deletion (::natMX4 or HY86 R AACATGATAACTATCAATTAGCAGCGCcgtggatctgatatcatcgatgaattcga This study ::kanMX4) gc HY87 F Trm4 upstream GCGGTGCTGAAGTAACGAAACCGCGCGC This study HY88 R Trm4 downstream CCGCAGGTCTTTCGCAATTTATACCTTGGGTC This study HY89 F Trm8 midstream GGCTGTGGATTCGGTGGGTTGATGATAG This study HY90 F Trm4 midstream GTCGAAGATAGCACTGAGGCGGC This study CAGCAGTTCCCATAGGATAAAATTTTCAAGCGTTTATTGTTAAG HY91 F Trm8 deletion (::Kl.leu2) This study CTGAAAGCCAAGCCcgccagctgaagcttcgtac GTATATGTGGTAAATTGTTCTAGTTATACATCTATGTTACAATAT HY92 R Trm8 deletion (::Kl.leu2) This study GGCTGGCGccttcacttgcatctatccgttc GTTAGTAAGTAAGAAGTTTAAAGACAACTCAGAAGACATCAGC Met22 deletion (::natMX4 or HY93 F ACTTTACTCTGGCATTGGAAAGAGAATTATTGGccaggtcgacggatccc This study ::hphMX4) cgg HY94 R Met22 deletion (::natMX4 or GTACTCATATATTTATGTCTATCAATAAAGTAAAATATATGTTAT This study 39 (continued.)

Name Purpose Sequence (5’→3’) Source ::hphMX4) TTAGGCGTTTCTTGACTGAATGACATCGCcgtggatctgatatcatcgatgaatt cgagc HY95 F Met22 upstream CAAGAGGCTCCTTGAGGGCATTCAAG This study HY96 R Met22 downstream CGGTCAGAATCCTGCTGTATTTTCTTGTCTCAC This study HY97 F Met22 midstream CCCTTGGTTCCGTCAATAGGATCCAAACACC This study GGTAACGATGAAACGAAGACGTCTGTCTTTGGTGAGGCCGAAG HY106 F Met2 C-term tagging This study AAGTTACCAACTGGcggatccccgggttaattaa GCTGTTTGTCTATATATAAATATAGATATAGATATACATGTACTG HY107 R Met2 C-term tagging This study GTTTATCTATGTTATGCCgaattcgagctcgtttaaac HY110 F Met2 upstream CCGCTTCGTTGTACAACCTACCTG This study HY111 F Arg3 DNA probe generation GGTGCCCAACCGATGTTTTTAGG This study HY112 R Arg3 DNA probe generation CGCACCGTTTCTCTCAGCAAC This study 40 CCTATTTCACATATTGTACAAAAAGTTGTCCTATTCTTGGAAGAC HY117 F Met3 C-term tagging This study AATGGCTTTTTTGTATTTcggatccccgggttaattaa GCAAATCTATTTATTTTGCGCGGTCGATCATGAATTTTGCCCTAC HY118 R Met3 C-term tagging This study TTTTGAGATGGGgaattcgagctcgtttaaac CGGTTGAAGAATGTGCTACCATTATTTATGAGTACTTAATCAGT HY119 F Met14 C-term tagging This study GAAAAAATCATCCGTAAGCATTTGcggatccccgggttaattaa CCTCGAATAAATATGTTCTATATTATATATATACATCTTTTATAT HY120 R Met14 C-term tagging This study ATCATTAAATGTACAGgaattcgagctcgtttaaac GCAGCTATGTCTGCCATTGATATCTTTGTTAATAATAAAGGTAAT HY133 F Arg3 C-term tagging This study TTCAAGGACTTGAAAcggatccccgggttaattaa GCAAAATAATCAATGTATATCATTATTCATGCATCTATATCTGTA HY134 R Arg3 C-term tagging This study TTTATATATTAGTTATTAAGgaattcgagctcgtttaaac HY135 F Arg5,6 DNA probe generation CGCGCTTATTGGTGCTAGAGGT This study HY136 R Arg5,6 DNA probe generation CCTTGAAACCACTGCCCAACAT This study HY137 F Arg5,6 C-term tagging GCAAAATATTAATCTTGCTATGGGTTATGGAGAGTATGCTGGTA This study 40 (continued.)

Table 2. 2. (continued.) Name Purpose Sequence (5’→3’) Source TCCCTGAAAATAAAATTATTGGTGTCcggatccccgggttaattaa CGTTATTTAATGGATATATATATATTATATATTTATATACGTTAA HY138 R Arg5,6 C-term tagging This study TGTCTCATGTGACTGAGCTGCAGgaattcgagctcgtttaaac GCCGTTATCACTGATGGCTTGAAACCAATCCATATCGTTACTAA HY144 F Cys4 C-term KI This study GATGGATTTACTGAGCTACTTAGCAcggatccccgggttaattaa GAGAACGGTGCAATTGAATAGGAAAGGAATGACGGATTTTGCT HY145 R Cys4 C-term KI This study TCTATGTTTGCTTTTATTTGAAGCgaattcgagctcgtttaaac HY146 F Cys4 midstream conf. GACTCTTCAAAGCTGGAGGCTTCGACG This study CWC15_DNA probe CAGACCACAGTTAGAAGCAAGAAGCGG HY203 F This study generation CWC15_DNA probe HY204 R GTCATATCGTTAATGTATCCGGACGCTG This study generation HY205 F LCD1_DNA probe generation CAGATCTGAAATCCTTGATAAGCGGTAGTTGGTGG This study 41 HY206 R LCD1_DNA probe generation CCAAGTTCGGGGAGTCTTGTCCCACGTACC This study HY207 F RAD9_DNA probe generation GGGGATGCTGTTACCTTTGATGGAAATGAGTACG This study HY208 R RAD9_DNA probe generation CCAGTGTAGTGTAGGCCACCCCAACGCC This study GTO3_DNA probe HY213 F CTCCTGTGGCTAACATACCCAATAACGCGC This study generation GTO3_DNA probe HY214 R GACCCGTGGCTGCGAGCGAGTATATCCGAG This study generation HY219 F ACT1 DNA probe generation CCGGTGATGGTGTTACTCACGTCGTTCC This study HY220 F ACT1 DNA probe generation GACCTTCATGGAAGATGGAGCCAAAGCGGTG This study HY252 F MTH1 DNA probe generation CCCCCTCTACTGTGCACACGCAACTAAC This study HY253 R MTH1 DNA probe generation GGTATTATGCTTGGTGGGGGCATGTCCGGTC This study HY267 F Trm5 midstream GGCGCCACTGATACCATCCAAATGCCATGGGTGC This study HY275 R Trm5 C-term KI CATCTCGTTTCTTTTTCTAATGGTCGCCTTTTTGCCTTTTTCCTCC Ohira and Suzuki, 41 (continued.)

Table 2. 2. continued. Name Purpose Sequence (5’→3’) Source

CACGGCgaattcgagctcgtttaaacTTTTCGACACTGGATGGCGGCGTT 2011 AGTA gcacccaccaaaccgatgtattgcgcgagtttccaacttccagctaacgtactaccaccgcttgagag Ohira and Suzuki, HY276 F Trm5 C-term KI (NES-GFP)

acttactcttgatggtcgacggatccccggg 2011 Ohira and Suzuki, HY277 F Trm5 C-term KI (GFP) ccgatgtattgcgcgagtttccaacttccagctaacgtaggtcgacggatccccggg

2011 HY308 F Sps2 DNA probe generation CTGATACTGCATTAACCTCCATCG This study HY309 R Sps2 DNA probe generation CGCCTCTTATGATCGAACGACCGG This study CTGGTGATGTGTCCATTCCATCTTTGGCCGAGGTCGAAGGTAAG HY312 F LEU4 C-term KI This study AATGCTGCGGCATCTGGCTCTGCAcggatccccgggttaattaa CCGTGCTTCTAGTAATTATATGGTTAAAAAAAAAGGAAAGGAA HY313 R LEU4 C-term KI GTAAATAAATAAGTATAGAAATAAATAGAAGCGgaattcgagctcgtttaa This study ac HY314 F LEU4 midstream GCGTGCTCAAGGTGAAACTCAATGGAGAATCCC This study 42 HY325 R LEU4 DNA probe generation TCGGAGACACCTACACCCCATTTGTAGGCC This study

CHAPTER 3

Genome-wide investigations of cellular functions for tRNA nuclear-cytoplasmic trafficking in regulation of translation

3.1 Introduction

In eukaryotic cells, tRNAs are transcribed in the nucleus but function in protein synthesis in the cytoplasm. For decades, tRNAs were thought to travel only unidirectionally, nucleus to cytoplasm. However, it is now known that tRNAs actively shuttle between the nucleus and the cytoplasm (Shaheen and Hopper, 2005; Takano et al., 2005; Whitney et al., 2007), and this bi-directional movement is conserved in vertebrate cells (Barhoom et al., 2011; Shaheen et al., 2007; Zaitseva et al., 2006). Cytoplasmic mature tRNAs rapidly accumulate in the nucleus when cells are nutrient-deprived as observed by fluorescence in situ hybridization. Upon re-feeding, the nuclear previously-cytoplasmic tRNAs return to the cytoplasm to participate in translation (Hurto et al., 2007; Shaheen and Hopper,

2005; Whitney et al., 2007).

In the current working model, at least three nuclear transporters (all belong to β-

importin family) function in tRNA nucleus-cytoplasm subcellular dynamics: Los1, Mtr10,

and Msn5 (Figure 3. 1). Los1 functions in the initial export of intron-containing and

intron-less tRNAs, and also in the re-export of previously cytoplasmic mature tRNAs

back to the cytoplasm. Mtr10, directly or indirectly, is responsible for the retrograde

movement of cytoplasmic tRNAs to the nucleus. Little is known about the biological

roles of Mtr10 and one goal of this study is also to investigate the transcriptional

expression profiles of mtr10Δ cells, which will be addressed in Chapter 4. Msn5 can

export intron-less tRNAs and appears to function solely in tRNA re-export (Hopper et al.,

2010; Murthi et al., 2010).

There are still many questions regarding the tRNA trafficking process. For

example, not all the exporters/importers have been identified (for reviews, see Hopper,

2006; Hopper et al., 2010; Hopper and Shaheen, 2008). Although it appears that tRNA re-export is regulated by nutrient status of the cell and the regulation is coordinated with

P-body formation (Hurto and Hopper, 2011), none of the details of the molecular regulation have been uncovered. Whitney et al. demonstrated that the PKA pathway is required for the tRNA nuclear accumulation and this is independent of Gcn2 (Whitney et al., 2007). Perhaps the most important question “Why does cytoplasmic tRNA travel back to the nucleus” remains completely unresolved. Previous studies showed that tRNA accumulate in the nucleus when cells are nutrient stressed or when tRNA is damaged, implicating the potential roles of tRNA retrograde pathway in response to stress or in tRNA quality control (Feng and Hopper, 2002; Sarkar et al., 1999).

Based on the essential role that tRNAs serve as adaptors to deliver amino acids for polypeptides synthesis during translation in the cytoplasm, in this chapter we focus on the impacts of tRNA nuclear-cytoplasmic dynamics on translation regulation in the yeast,

Saccharomyces cerevisiae. In this work, we demonstrate that tRNA nuclear-cytoplasmic movement plays a role in regulating translation of mRNAs encoding proteins involved in several amino acid biosynthetic pathways, including sulfur assimilation (methionine), arginine, and leucine. Thus, tRNA nuclear-cytoplasm trafficking is involved in cellular metabolism/physiology.

Figure 3. 1. Current model of tRNA subcellular movement in yeast. The proposed model of tRNA nuclear-cytoplasmic trafficking includes three steps. 1. Primary export. The primary tRNA transcripts are end-processed and exported to the cytoplasm by the tRNA exportin Los1. 2. Constitutive retrograde import. After maturation processes (including intron-splicing on the mitochondria, base modifications, and aminoacylation), Mtr10 is responsible for the import of the cytoplasmic mature tRNAs to the nucleus. 3. Re-export. The previously-cytoplasmic tRNAs are re-exported from the nucleus to the cytoplasm by the functions of Los1 and Msn5.

Figure 3. 2. Flowchart of experimental designs. For polysome profiles, more than three repeats were performed. For microarray samples, two biological repeats were performed and RNAs were extracted from indicated pools and hybridized to two Affymetrix chips.

3.2 Results

This section includes results of polysome profiles analyses, microarray data of

translational activity, followed by verification and sequence analyses. Figure 3. 2 illustrates the steps of experiments for polysome profile analysis and microarray sample collection.

3.2.1 Polysome profiles analysis

Previous studies showed that tRNAs accumulate in the nucleus when cells are nutrient

starved (Hurto et al., 2007; Shaheen and Hopper, 2005; Whitney et al., 2007). Amino

acid or glucose deprivation also causes translation inhibition (Ashe et al., 2000; Holmes et al., 2004). Therefore, we proposed that cells regulate the translation machinery by

controlling tRNA availability via its subcellular distribution. If it is true, we expected that

the global translation should be inhibited in cells with defects in tRNA export pathways,

such as in msn5Δ, los1Δ, and los1Δ msn5Δ mutants in which tRNAs constitutively

accumulated in the nucleus. Furthermore, in cells which fail to accumulate tRNAs in the

nucleus the global translation in nutrient starvation, such as mtr10Δ cells, translation

should not be inhibited. To test the hypothesis, we analyzed the polysome profiles of wild

type, mtr10Δ, msn5Δ, los1Δ, and los1Δ msn5Δ cells grown in fed or acute amino acid

deprivation conditions (Figure 3. 3 and Figure 3. 4).

As anticipated, in wild-type cells there was a major shift from polysomes to the

non-translating region when cells were nutrient deprived (Figure 3. 3). Surprisingly, in

general, the polysome profiles from cells with defects in the tRNA trafficking pathways 48

were similar in fed or amino acid starvation condition, but three differences were

demonstrated. First, quantifications of polysome profiles from fed msn5Δ and los1Δ msn5Δ cells revealed that there were statistically significant increases in the ratio of P/NP relative to that in wild-type cells (NP, non-polysomal region, represented the region of

40S+80S, Figure 3. 5). Since the polysome region did not exhibit large changes, the decreases of NP region accounted for the increases in P/NP ratio. Second, the polysome region of fed mtr10Δ cells was smaller, suggesting a translation defect. Third, in starved mtr10Δ cells the NP region was smaller and polysomal region was larger, suggesting the rate of ribosome runoff in mtr10Δ cells is slower. This suggested that mtr10Δ cells were defective in repressing translation when responding to nutrient deprivation (Figure 3. 5).

Possible explanations are addressed in the Discussion section. In summary, the similar polysome profiles of tRNA export mutants suggested that the global translation is not affected when tRNAs are accumulated in the nucleus, and this led us to employ microarray experiments to identify the specific targets.

3.2.2 Microarray data pre-processing

To investigate whether the tRNA trafficking process regulates translation of particular

mRNAs, we performed microarray analysis on the distribution of polysome-bound (P,

translating) and non-polysome bound (NP, not-translating) mRNAs from wild-type,

msn5Δ, and mtr10Δ cells grown in fed or acute amino acid starvation conditions

(summary of the microarray experiments is cartooned in Figure 3. 6). After microarray

experiments, all of the raw intensity data files (*.cel files) from fractioned (P or NP) and

unfractionated (total, T) RNA samples were generated. These files were imported together into the platform R with Bioconductor (Gentleman et al., 2004; R development

Core Team, 2011). A diagnostic plot, principle component analysis (PCA) plot was

utilized to roughly assess the similarity of microarray data. Figure 3. 7 exhibited that

expression profiles of msn5Δ cells are similar to those from wild-type cells whereas

mtr10Δ profiles displayed larger differences. Prior to the normalization, an optional

procedure of masking S. pombe probes was performed because Affymetrix Yeast 2.0

GeneChips, contain two yeast species genomes, S. cerevisiae and S. pombe. In addition,

this step can decrease background noise.

As mentioned in Introduction, it is required to process the intensity data from

probesets into gene expression values by normalization. We used the function of Robust

Multiarray Average (RMA) (Irizarry et al., 2003) in the affy package. It is an algorithm that has been commonly used for microarray normalization (Ashe et al., 2000; Shenton et al., 2006; Smirnova et al., 2005; Vyas et al., 2009). Box plots of microarray data before and after RMA normalization were shown in Figure 3. 8 and Figure 3. 9. After a step of filtering low signals, a log2-value matrix with 36 columns (RNA samples) and 5684 rows

(genes) was used for calculation of P/NP ratio and subsequently subject to statistical

analysis to select differential expressed genes.

Figure 3. 3. Polysome profiles of wild-type, mtr10Δ, and msn5Δ cells collected from fed or 30-min amino acid starved conditions. Twenty A260 units of cell lysate were loaded

and separated on 10% to 50% sucrose gradient. Polysome traces were recorded by UV254 detector during fractionation and are shown as representatives from more than five experiments. Cartoons represent the phenotypes of tRNA distribution.

Figure 3. 4. Polysome profiles of wild-type, los1Δ, and los1Δ msn5Δ cells collected from fed or 30-min amino acid starved condition. Twenty A260 units of cell lysate were loaded and separated on 10% to 50% sucrose gradient. Polysome traces were recorded by

UV254 detector during fractionation and are shown as representatives from more than five experiments. Cartoons represent the phenotypes of tRNA distribution.

A. Fed D. Starved 1.2 1.4 1 * * * 1.2

P/T 1 0.8 P/T 0.8 0.6 0.6 0.4 0.4 0.2 0.2 n=8 n=8 n=11 n=5 n=11 n=5 n=8 n=8 0 n=17 0 n=18 WT mtr10∆ msn5∆ los1∆ los1∆ WT mtr10∆ msn5∆ los1∆ los1∆ msn5∆ msn5∆

B. Fed E. Starved 1.2 1.4 1 * * 1.2 1 0.8 * NP/T 0.8 0.6 NP/T 0.6 0.4 0.4 0.2 0.2 0 0 WT mtr10∆ msn5∆ los1∆ los1∆ WT mtr10∆ msn5∆ los1∆ los1∆ msn5∆ msn5∆

C. Fed F. Starved

2 2.5

* * 2 * 1.5 1.5 1 P/NP

P/NP 1 0.5 0.5

0 0 WT mtr10∆ msn5∆ los1∆ los1∆ WT mtr10∆ msn5∆ los1∆ los1∆ msn5∆ msn5∆

Figure 3. 5. Quantification of polysome profiles of tRNA trafficking mutants in fed (A- C) or amino acid starved (D-F) conditions. NP represents the region of 40S and 80S in the polysome profile; P represents the region of disome and polysome in the profile; T represents the area of whole profile. *: p-value 0.01

Figure 3. 6. Summary of microarray experiments. One RNA sample was hybridized to one Affymetrix yeast 2.0 GeneChip.

Figure 3. 7. Three dimensional view of result from principle component analysis (PCA). Global assessment of microarray raw data set from fractionated RNA samples was evaluated by using principle component analysis (Courtesy of microarray center of OSU). WT_fed_mono represents the samples that were collected from non-polysomal bound fractions of wild-type cells grown in fed condition. One block represents one microarray experiment. Same color represents biological repeats of same condition.

3.2.3 Identification of significant differentially-expressed genes (DEGs)

In order to understand the impact on translational status of specific mRNAs when cells are defective in tRNA nuclear import or re-export pathway, we analyzed the translation activity index of each mRNA, which was obtained from the ratio of P/NP (Smirnova et al., 2005; Vyas et al., 2009). There are several indexes which have served as indicators of translation status. Generally, higher translational index correlates with higher protein level (Greenbaum et al., 2002; Tuller et al., 2007). The tRNA retrograde process was proposed to function in regulation of translation of a subset of transcripts (Shaheen and

Hopper, 2005; Whitney et al., 2007); therefore, we expected that aberrant tRNA nuclear- cytoplasmic traffic could result in a re-distribution between P- and NP- bound population for such target mRNAs. Moreover, considering that Msn5 and Mtr10 also transport other protein cargos, we proposed that the transcripts that are affected commonly in mtr10Δ cells and msn5Δ cells are more likely the primary targets of tRNA trafficking. Thus, we paid more attention on the transcripts with changes in translational activity index affected in both msn5Δ and mtr10Δ cells.

To identify such tRNA trafficking targets, a three-step approach was executed.

First, the ratio of P/NP of each mRNA from the pre-processed matrix was calculated.

Second, the translationally differentially expressed genes (DEGs) were selected separately from mtr10Δ cells or from msn5Δ cells versus wild-type cells in fed or starved condition by using the statistic method of linear model for microarray data (Limma)

(Smyth, 2004). In this work, translationally DEGs were selected when adjusted p-values were smaller than 0.05 and 1.5 fold change (log2 FC = 0.6) from each mutant relative

to wild-type under each condition. The numbers of statistically DEGs are summarized in

Table 3. 1. Detail lists are in Appendix B to Appendix E. Expression profiles from these

genes were selected and imported to GenePattern website for generation of hierarchical

heat map (Figure 3. 11 from fed mtr10Δ and Figure 3. 12 from fed msn5Δ). We also performed the same statistical analyses of “total” RNA samples; with this information we can check transcriptional effects by selecting potential targets with changes in P/NP ratio and no or little changes in their “total” expression levels. For details of transcriptional

analyses, see Chapter 4.

The translation profiling is unchanged in msn5-depleted cells under fed or amino

acid starvation condition

Because in msn5Δ cells tRNAs constitutively accumulate in the nucleus, we expected a

large change in its translation profile. However, the numbers of translationally

differentially expressed genes in msn5Δ cells were few or none in fed or starved

condition (see summary table of number of translationally differentially expressed genes

in Table 3. 1). This result was consistent with the data from polysome profiles (Figure 3.

5), which showed that there was no large difference between msn5Δ and wild-type cells.

The unchanged translational profiles of msn5Δ cells in fed or starved condition might be due to two, or more, possibilities. First, tRNA nuclear accumulation is uncoupled with translation. Second and more likely, the Los1 and unknown tRNA re-export pathways are sufficient to compensate or maintain translation. Further interpretations are in the

Discussion.

Normal responses to amino acid deprivation at translation level in tRNA import

mutant

Considering that in mtr10-null cells tRNAs fail to accumulate in the nucleus upon

nutrient stress (Hurto et al., 2007; Shaheen and Hopper, 2005) and that a defect of

translation repression was demonstrated (Figure 3. 3), we anticipated a subset of

transcripts were translationally changed in starved mtr10Δ cells. However, very few

transcripts that were translationally changed in starved mtr10Δ cells (Table 3. 1), which

suggested that tRNA nuclear retrograde transport process is not regulating translation in response to nutrient availability. Furthermore, this correlates to the observation that tRNA nuclear import is a constitutive process (Murthi et al., 2010).

A group of transcripts is translationally down-regulated in both mtr10Δ cells and msn5Δ cells

On the basis of the opposite phenotypes in tRNA subcellular distribution between msn5Δ

and mtr10Δ cells, we attempted to identify transcripts which display opposite translation

expression patterns (i.e., up-regulated in mtr10Δ cells and down-regulated in msn5Δ cells, or vise versa, when compared to wild-type cells); however, such transcripts were not identified. More surprisingly, we identified a group of transcripts that was down- regulated in translation (with decreased P/NP ratio) in both msn5Δ and mtr10Δ cells

under fed condition. Furthermore, by employing the web-based tool which provides a

survey of the functional distribution of genes of interests, MIPS functional catalogue

(Ruepp et al., 2004), we found that the group of the affected transcripts was functionally

overrepresented in methionine/sulfur and arginine amino acid biosynthesis (Figure 3. 13).

In addition, the translational indexes of transcripts encoding other amino acid

biosynthesis pathways, such as LEU4, SER33, and LYS5, were also decreased in mtr10Δ

cells (Figure 3. 11). Our data indicated that tRNA subcellular dynamics has a unique role

in regulating translation of a subset of mRNAs encoding enzymes involved in several amino acid biogenesis pathways, including methionine, arginine, leucine, serine, and lysine (methionine, arginine, and leucine biosynthetic pathways are shown in Figure 3.

14).

3.2.4 Transcriptional control and RNA stability of target mRNAs are

not affected

According to the microarray expression profiles, mRNAs encoding proteins in the

methionine and arginine biosynthetic pathways were translationally down-regulated in fed msn5Δ and mtr10Δ cells. The total expression levels of these targets in tRNA trafficking mutants were similar to that in wild-type cells from microarray data (for example, MET3 in (Figure 3. 15). To confirm the microarray results, we employed

Northern blot analysis. The total RNAs were extracted from wild-type and tRNA trafficking mutant cells (msn5Δ, mtr10Δ, los1Δ, los1Δ msn5Δ) grown in SC media (fed condition). Since Los1 functions in tRNA primary export and re-export pathways, we anticipated that blocking nuclear export pathways by deleting both Los1 and Msn5 would further enhance the phenotypes of the potential targets, which would be shown in the next section. The Northern blots were hybridized to the DNA probes for target mRNAs, such

as ARG5,6, MET3, and LEU4 (Figure 3. 16). The result showed that the steady state

levels of target mRNAs were not largely changed in all tested strains. In addition, another line of evidence supported that the transcriptional control of these target transcripts were not affected. When cells were amino acid deprived, translation of the master regulator

Gcn4 is induced and it subsequently activates the transcription of amino acid biogenesis- related genes. If the transcriptional control is defective, cells cannot grow in amino acid deprived conditions. Given this consideration, we performed a growth assay of tRNA nuclear-cytoplasmic shuttling mutants on SC solid media without methionine or arginine.

Interestingly, those mutants were able to grow on SC-methionine or SC-arginine plates

(Figure 3. 17), suggesting that the general amino acid transcriptional control is not affected.

3.2.5 Verification of microarray data by western blot analyses

The Northern blot analysis and growth assays indicated that the steady state levels of

mRNAs and transcriptional control are not affected in the mutants that are defective in

tRNA subcellular trafficking. To confirm the results of the microarray analysis which

indicated that these transcripts are changed at the translation level, we employed western

analysis to determine the endogenous levels of protein targets. We introduced the 3HA or

GFP epitope tags at the C-terminal of the endogenous locus to generate in-frame fusion

of the Met, Arg, or Leu protein targets in wild-type cells and each tRNA trafficking

mutant cells, including mtr10Δ, msn5Δ, los1Δ, and los1Δ msn5Δ. All of the fusion proteins were full length and functional by assessing cell growth on methionine (a

representative result is shown in Figure 3. 18) or arginine (not shown) depletion plates.

We then examined the steady state levels of endogenous protein targets by immunoblots

of whole-cell extracts obtained from normal SC media cultures.

Correlated to their decreased translation activity indexes from microarray data,

the expression levels of all tested proteins (Met2-3HA, Met3-3HA, Met14-3HA, Met22-

3HA, Arg3-3HA, Arg5,6-GFP, and Leu4-3HA) were remarkably reduced or even not

apparent in mtr10Δ cells (Figure 3. 19) while these target proteins had basal level

expression in wild-type cells. In msn5Δ or los1Δ cells these protein levels were not

largely changed. As mentioned earlier, it has been shown that Los1 and Msn5 function in

parallel in the tRNA nuclear re-export process. Blocking tRNA re-export pathway only

by deleting Msn5 would not be sufficient to cause significant result; this led to the prediction that further blocking tRNA re-export by deleting both Los1 and Msn5 would

lead to significant decrease in target protein levels. In agreement with this expectation,

the levels of Met, Arg, and Leu biosynthetic pathway proteins in los1Δ msn5Δ cells were

synergistically decreased when compared to that in single deletion strains (Figure 3. 19).

Importantly, this result also demonstrated that the growth defect of mtr10Δ cells was not

accounted by the reduced level of target proteins because los1Δ msn5Δ cells grow as well

as wild-type cells. Furthermore, most of tested proteins exhibited higher levels in los1Δ

cells (Figure 3. 19). We reasoned that it was likely caused by up-regulated translation of

Gcn4 mRNA, because it has been shown that translation of Gcn4 is up-regulated when

unspliced tRNA accumulates in the nucleus in los1Δ cells (Qiu et al., 2000).

To further validate microarray data, Cys4-3HA fusion proteins were also tested as unchanged candidate in all tested cells (Figure 3. 19). Moreover, when we introduced the functional Los1, Msn5, or Mtr10 proteins back into individual mutants, the levels of

Met3-3HA protein expression in tRNA trafficking mutants were mostly or partially recovered to basal level as in wild-type cells (Figure 3. 20).

Collectively, the results from western blot analysis confirmed the microarray data that target mRNAs with lower translation activity indexed were poorly-translated.

Raw data log2 intensity log2 6 8 10 12 14 X26_Wt.fed.total.CEL X01_WT.fed.poly.CEL X02_WT.fed.poly.CEL X03_WT.fed.mono.CEL X04_WT.fed.mono.CEL X29_msn5.fed.total.CEL X30_msn5.fed.total.CEL X09_msn5.fed.poly.CEL X10_msn5.fed.poly.CEL X33_mtr10.fed.total.CEL X34_mtr10.fed.total.CEL X17_mtr10.fed.poly.CEL X18_mtr10.fed.poly.CEL X25_Wt.fed_total_c.CEL X11_msn5.fed.mono.CEL X12_msn5.fed.mono.CEL X28_Wt.starved.total.CEL X19_mtr10.fed.mono.CEL X20_mtr10.fed.mono.CEL X05_WT.starved.poly.CEL X06_WT.starved.poly.CEL X07_WT.starved.mono.CEL X08_WT.starved.mono.CEL X31_msn5.starved.total.CEL X32_msn5.starved.total.CEL X13_msn5.starved.poly.CEL X14_msn5.starved.poly.CEL X35_mtr10.starved.total.CEL X36_mtr10.starved.total.CEL X21_mtr10.starved.poly.CEL X22_mtr10.starved.poly.CEL X27_Wt.Starved_total_c.CEL X15_msn5.starved.mono.CEL X16_msn5.starved.mono.CEL X23_mtr10.starved.mono.CEL X24_mtr10.starved.mono.CEL

Figure 3. 8. Box plot of raw microarray data.

After Remove probes and RMA normalized

8 log2 intensity log2

4 X26_Wt.fed.total.CEL X01_WT.fed.poly.CEL X02_WT.fed.poly.CEL X03_WT.fed.mono.CEL X04_WT.fed.mono.CEL X29_msn5.fed.total.CEL X30_msn5.fed.total.CEL X09_msn5.fed.poly.CEL X10_msn5.fed.poly.CEL X33_mtr10.fed.total.CEL X34_mtr10.fed.total.CEL X17_mtr10.fed.poly.CEL X18_mtr10.fed.poly.CEL X25_Wt.fed_total_c.CEL X11_msn5.fed.mono.CEL X12_msn5.fed.mono.CEL X28_Wt.starved.total.CEL X19_mtr10.fed.mono.CEL X20_mtr10.fed.mono.CEL X05_WT.starved.poly.CEL X06_WT.starved.poly.CEL X07_WT.starved.mono.CEL X08_WT.starved.mono.CEL X31_msn5.starved.total.CEL X32_msn5.starved.total.CEL X13_msn5.starved.poly.CEL X14_msn5.starved.poly.CEL X35_mtr10.starved.total.CEL X36_mtr10.starved.total.CEL X21_mtr10.starved.poly.CEL X22_mtr10.starved.poly.CEL X27_Wt.Starved_total_c.CEL X15_msn5.starved.mono.CEL X16_msn5.starved.mono.CEL X23_mtr10.starved.mono.CEL X24_mtr10.starved.mono.CEL

Figure 3. 9. Box plot of RMA normalized microarray data.

Volcano plot of limma -- P/NP_fed_mtr10 vs wt -log10 p value p -log10 0123456

-3 -2 -1 0 1 2 3 4

diff(logFC)

Volcano plot of limma -- P/NP_starved_mtr10 vs wt -log10 p -log10 value 012345

-2-101234

diff(logFC)

Figure 3. 10. Volcano plot showing differential expressed genes selected by P/NP index compared from mtr10Δ to wild-type cells. Upper, fed condition; bottom, starved condition.

mtr10∆ vs. wild-type P/NP T P/T

Fed a Starved a Fed b Starved b Fed c Starved c Up 93 2 335 605 0 102 Down 131 5 198 560 1 143

msn5∆ vs. wild-type P/NP T P/T

Fed d Starved d Fed e Starved e Fed f Starved f Up 0 0 177 193 0 0 Down 12 0 119 258 0 0

Table 3. 1. Summary tables of numbers of differentially expressed genes in mtr10Δ or msn5Δ cells in fed or starved conditions. top, mtr10Δ cells vs. wild-type cells; bottom, msn5Δ cells vs. wild-type cells. P/NP, translation activity index, obtained from log2 P- log2 NP. T, total RNA, obtained from unfrationated RNA sample. P/T, index for analysis of ribosome occupancy, obtained from log2 P- log2 T. a: cutoff condition: adjusted p-

value < 0.05 with log2 FC 0.6 (Up-regulated) or − 0.6 (Down-regulated); b: cutoff condition: adjusted p-value < 0.001 with log2 FC 0.6 or − 0.6; c: adjusted p-value <

0.01 with log2 FC 0.6 or < − 0.6; d: adjusted p-value < 0.05 with log2 FC 0.6 or −

0.6; e: adjusted p-value < 0.05 with log2 FC 0.6 or − 0.6; f: adjusted p-value < 0.05 with log2 FC 0.6 or − 0.6.

Figure 3. 11. Heat map of hierarchical clustering results of gene expression profiles from translational DEGs in mtr10Δ cells versus wild-type cells in fed condition.

Figure 3. 12. Heat map of hierarchical clustering results of translational DEGs from msn5Δ cells compared to wild-type cells in fed condition.

Figure 3. 13. Venn diagram of DEGs which were decreased in translation activity index in both mtr10Δ and msn5Δ cells.

Figure 3. 14. Amino acid biosynthesis pathways affected in tRNA trafficking mutants. A. Sulfur assimilation pathway. B. Arginine 72 biosynthesis pathway. C. Leucine biosynthesis pathway. Transcripts with decreased translation activity index were marked with green shadow. Targets confirmed by Western blot analyses are indicated with orange box.

Figure 3. 15. Expression profile of MET3 transcript among all microarray samples. The expression values were log2 and centered to the median of all values from all samples. WT_fed_poly represents RNA sample was collected from polysome-bound pool from wild-type cells in fed condition. WT_fed_mono represents RNA samples was collected from non-polysome bound pool 74 from wild-type cells in fed condition. WT_starved_poly represents RNA sample was collected from polysome-bound pool from wild-type cells in amino acid starvation condition.

Figure 3. 16. Northern blot analysis of total RNA collected from wild-type and tRNA trafficking mutants in fed condition. The blot was hybridized to α-32P-dCTP-labeled ARG5,6, MET3, or LEU4 DNA probes. ACT1 served as an internal loading control. 25S and 18S rRNAs were indicated in the bottom ethidium bromide-staining formaldehyde agarose gel. Each ratio was normalized to the expression values of ACT1 and compared to WT.

Figure 3. 17. Growth assay of tRNA trafficking mutants on SC, SC-arginine and SC- methionine plates. All tested cells were grown in rich liquid media overnight and adjusted to similar density before spotted on indicated solid plates and incubated at 30°C for two days. arg3Δ and met22Δ cells served as controls for SC-arginine and SC-methionine, respectively.

3.2.6 tRNA subcellular trafficking affects translation regulation of

amino acid biosyntheses transcripts

We attempted to study the roles of Mtr10 and Msn5, by analyzing transcripts

translationally affected by both of Mtr10 and Msn5. However, it still could be argued that

the reduced levels of proteins involved in the Met, Arg, and Leu biosynthetic pathways

resulted from defects in protein transport, rather than tRNA subcellular dynamics. We

sought to alter tRNA nuclear/cytoplasmic dynamics in an independent way. Dhh1 and

Pat1 are not β-importin members and it has been shown that in dhh1Δ pat1Δ cells

translation is repressed (Coller and Parker, 2005) and tRNAs fail to accumulate in the

nucleus upon amino acid starvation (Hurto and Hopper, 2011). Both of these phenotypes

exist for mtr10Δ cells and thus the tRNA subcellular trafficking is also aberrant in dhh1Δ

pat1Δ cells. Therefore, we disrupted tRNA nuclear-cytoplasmic trafficking and assessed the levels of target proteins in dhh1Δ pat1Δ cells.

As predicted, the levels of endogenous fusion proteins in Met, Arg, and Leu biosynthetic pathways were largely decreased in dhh1Δ pat1Δ cells (Figure 3. 21).

Moreover, it appeared that Dhh1 played a more important role in regulating translation of the Met, Arg, and Leu biosynthetic pathway transcripts because the reduction was also observed in dhh1Δ cells, but not in pat1Δ cells. It is also worthy to notice that BY4741 and its isogenic mtr10Δ cells were utilized as isogenic controls for dhh1Δ pat1Δ cells, and their protein expression patterns were similar as which shown in BY4742 derivative strains. This result further provides the evidence that the reduced levels of enzymes in

Met, Arg, and Leu biosynthetic pathways can be reproduced in different mating type/background.

Figure 3. 18. Growth assays of cells with Met22-3HA fusion protein. WT, wild-type cells, as the parent strain for Met22-3HA knock-in, #6 and #12 represent candidate numbers. All of the parental strains and their derivatives were grown in liquid YEPD media overnight at 30°C. Cells were adjusted to similar density and followed by 10X serial dilution before spotting on the indicated solid media and incubated at 30°C or 37°C for two days.

Figure 3. 19. Western blot analysis of endogenously 3HA- or GFP- tagged target proteins. A. targets with decreased translation 81 activity index were poorly-translated in tRNA trafficking mutants. B. target with no change in translation index was also not changed in protein expression. Pgk1 and Nsp1 served as internal loading controls. Each ratio was obtained from normalizing to internal control and then comparing to WT.

Figure 3. 20. Western blot analysis of protein levels in tRNA trafficking mutants harboring recovery plasmids. Cells with Met3-3HA fusion proteins were transformed with pRS416 vector or MORF plasmids containing individual functional karyopherin and its promoter (courtesy from Ivy Huang). Cells harboring plasmids were then cultured in SC-uracil liquid media to early log phase. Met3-3HA proteins were determined by immunoblotting with α-HA antibody. Pgk1 served as internal loading control.

Figure 3. 21. Immunoblot analyses of Met3-, Arg3-, and Leu4-3HA fusion proteins in wild-type cells and dhh1Δ pat1Δ cells. Pgk1 and Kar2 served as internal loading controls. Each ratio was obtained from normalizing to internal control and then comparing to WT.

Figure 3. 22. Heat map of hierarchical clustering of codon occurrence frequency for DEGs with decreased translation activity index in mtr10Δ cells. 84

Taken together, our investigation of translational expression profiles by

microarray analysis of the tRNA subcellular trafficking mutants showed that the translation of proteins responsible for methionine, arginine, and leucine biosynthesis

pathways were defective, suggesting that tRNA trafficking process plays a role in

regulating cell metabolism by influencing the translation of a subset of mRNAs. This is

the first and novel connection between tRNA subcellular dynamics and cell physiological

process.

3.2.7 Cis-regulatory elements analysis of tRNA trafficking targets

Protein translation is generally regulated at the steps of translation initiation or the rate of

elongation (Day and Tuite, 1998; McCarthy, 1998). Translation initiation is the rate-

limiting step and can be regulated by the 5’ sequences or length of upstream region of the

ORF, or by the secondary structure of the 5’ leader (Hinnebusch, 2005; Lawless et al.,

2009; Tuller et al., 2009). We were unable to identify a common cis-acting motif from upstream and downstream sequences, except for Gcn4-responsive, methionine-, arginine- response elements, among these primary target genes (data not shown, for reviews see

Hinnebusch, 1988; Thomas and Surdin-Kerjan, 1997).

Translation elongation can be affected by the number of rare codons (Letzring et al., 2010). We proposed that the target transcripts (mRNAs encode enzymes in Met, Arg, and Leu biosynthetic pathways) might have rarely used codons or amino acids, which can lead to inefficient translation and cause the reduced level of protein products. We analyzed the codon usage as well as amino acid usage for each target by comparing the

appearance frequencies of each codon or amino acid in targets open reading frames

versus genome average occurrence. However, we were unable to document rare codon

bias (Figure 3. 22) or particular amino acid usage patterns (not shown). The possible

mechanisms for translation regulation will be further described in Discussion.

3.3 Discussion

In this work we demonstrate that constitutive tRNA nuclear accumulation in cells with

defective tRNA re-export (los1Δ, msn5Δ, and los1Δ msn5Δ) does not cause large global

translation repression. There are several possible explanations. First, it is possible that the

remaining cytoplasmic pool of tRNAs is sufficient to maintain the translation machinery.

Second, and a non-exclusive, possibility is that the additional tRNA export pathway(s) is

sufficient to transport tRNAs back to the cytoplasm, and that these pathways contribute to

the generally normal translation. Finally, although we cannot rule out the impacts from

additional tRNA export pathway, perhaps global translation is not coupled with tRNA

subcellular distribution and, if this is the case, the mechanisms of translation inhibition

and tRNA nuclear accumulation upon nutrient stress must be distinct. Thus, the

translation repression upon nutrient stress is likely not resulted from nuclear

accumulation of tRNA. Although there is no dramatic change, we still found a significant

reduction in non-polysome region in the polysome profiles from msn5Δ and los1Δ msn5Δ

cells. This result might be attributed to the combination of small translation defects of affected mRNAs (e. g. 10 % decrease of each mRNA), which are not selected in the microarray data analysis.

In contrast, polysomal region is decreased in mtr10Δ cells which are defective in tRNA nuclear import, suggesting a translation defect. This observation might be contributed from several factors. The mtr10Δ strain exhibits growth defect and this is likely due to impaired import of the essential mRNA export factor, Npl3, to the nucleus

(Pemberton et al., 1997; Senger et al., 1998). Furthermore, Npl3 has been shown to associate with polysomes and act as a negative translation regulator, and Mtr10 is involved in the disassociation of Npl3 from polysome-bound mRNAs (Windgassen et al.,

2004). Therefore, the translation defect might result from the cytoplasmic pool of Npl3 that are associated with polysomes. Taken together, the translation defect in mtr10Δ strain could be an ultimate outcome of several factors: growth defect, impaired nuclear import of Npl3, impaired tRNA nuclear import, and also likely the aberrant transport of unidentified cargos.

Upon amino acid deprivation, mtr10Δ cells, which fail to accumulate tRNAs in the nucleus upon nutrient stress, are also defective in translation repression. This result is consistent with the model proposed previously (Hurto and Hopper, 2011). In this model, tRNA nuclear accumulation is a downstream event of the global translation repression in response to nutrient stress. If this is the case, the mutant with failure to repress translation upon nutrient stress should also not able to accumulate tRNA in the nucleus. In agreement with this prediction, in dhh1Δ pat1Δ cells, mutations which have been shown to block general translation repression in amino acid or glucose withdrawal condition

(Coller and Parker, 2005; Holmes et al., 2004), tRNAs also fail to accumulate in the nucleus in amino acid or glucose starvation condition (Hurto and Hopper, 2011).

A defect of translation repression in response to amino acid starvation is observed in mtr10Δ cells, but microarray analysis of translational profiles from starved mtr10Δ cells does not correlate such change. We reason that the changes in translation of affected mRNAs are slight, so they are not selected by the cutoff conditions with large fold- change while compared to wild-type cells in the microarray analysis, but each slight change can be additive and ultimately affects the polysome profile.

Surprisingly, we discover that the basal level of translation of a group of target mRNAs is reduced in cells defective in tRNA trafficking by mutations in tRNA retrograde import or re-export or independently by deleting Dhh1 and Pat1 proteins. The affected mRNAs encode enzymes involved in amino acid biosynthesis pathways, including sulfur assimilation (methionine), arginine, and leucine. In addition, Ser33 and

Lys5 are also potential targets; however, the endogenous abundance of Ser33 and Lys5 proteins are too low to be assessed by western blot. According to previous results with reduced levels of enzymes in Met, Arg, and Leu biosynthetic pathways, we anticipate the protein levels of Ser33 and Lys5 should also decrease in tRNA trafficking mutants. If so, there are five amino acid biosynthesis pathways affected. Taken together, these results support that tRNA subcellular dynamics serves as a novel mechanism to regulate the translation of mRNAs involved in amino acid biosynthesis pathways. And this role also further correlates with the constitutive tRNA import process (Murthi et al., 2010).

The mechanism(s) for how the affected enzymes are reduced is not clear. It appears that the reduction of these proteins is defective at translation regulation of the target mRNAs based on three observations from this work. First, the transcriptional

control and the steady state levels of the mRNAs involved in are generally not changed.

Second, the levels of Met, Arg, and Leu biosynthetic enzymes are also decreased in

dhh1Δ pat1Δ cells, in which cells mRNAs are stabilized. Third, the expression profiles of

most target mRNAs showed that their decreased translation activity indexes (P/NP) are

due to increasing in the NP values, suggesting a translation initiation defect of such

mRNAs (Figure 3. 15). Although we do not exclude the possibility for enhanced protein

turnover, it would be important to investigate whether and how the translation of the

target mRNAs is affected.

There is still much to learn about how signaling pathway(s) regulate tRNA

nuclear-cytoplasmic dynamics, which may also provide a possible mechanism for

regulating translation of target mRNAs. So far no evidence indicates that Dhh1 and Pat1

are tRNA transporters, and it was proposed that both Dhh1 and Pat1 are involved in a

signal transduction pathway for tRNA subcellular trafficking (Hurto and Hopper, 2011).

Considering the tRNA import process is constitutive and its impairment causes decreased

basal levels of translation of mRNAs that encode Met, Arg, and Leu biosynthetic

pathways, the signaling pathway must be active in normal condition. Moreover, given the

nuclear accumulation of tRNAs in nutrient starvation stress, the signaling pathway must

be responsive to nutrient availability and transmit the signal through Dhh1, Pat1, and

Mtr10 into the nucleus. In agreement with this hypothesis, the amino acid responsive

Gcn2-dependent signaling pathway is not involved in the tRNA subcellular movement because Gcn2-depleted cells do not prevent the nuclear accumulation of tRNAs (Whitney

et al., 2007). The PKA pathway has been shown to be involved in the tRNA trafficking

(Whitney et al., 2007), but given the complexity of this pathway, as well as TOR and glucose derepression pathways, how exactly the signaling pathway(s) plays a role in tRNA nuclear-cytoplasmic trafficking needs further investigation (Whitney et al., 2007).

It is unknown what the consequence(s) of reduced enzyme levels in the Met, Arg, and Leu biogenesis pathways is. One possibility is that reduction of such enzymes leads to decrease amino acid products. However, it is less likely according to several lines of evidence. First, no tRNA charging defects are observed in tRNA trafficking mutants

(Whitney et al., 2007, and personal communication with Dr. Rebecca Hurto), suggesting that aminoacylation status of bulk tRNAs must be not affected in tRNA trafficking mutants. Second, uncharged tRNAs can activate the kinase Gcn2 and subsequently enhance translation of GCN4, the general regulator of amino acid biosynthesis, which activates the transcription of Gcn4-responsive genes. Evidence from transcription expression profiles of fed mtr10Δ and msn5Δ cells showed that Gcn4-responsive genes are not induced (data not shown). This result correlates to previous observation that aminoacylation status of tRNAs are not affected when tRNA nuclear-cytoplasmic trafficking is defective (Whitney et al., 2007). We still cannot completely rule out this possibility that the productions of amino acids, including Met, Arg, Leu, or more, production are reduced in the tRNA trafficking mutants and this reduction is complemented by amino acids from media.

It is also likely that tRNA nuclear-cytoplasmic trafficking functions in maintaining the basal levels of these target enzymes to regulate intermediates of the Met,

Arg, and Leu biosynthetic pathways, not to regulate the amino acid production per se. If

90 it is true, we can predict the intracellular levels of specific substrates of these target enzymes may be accumulated and/or enzyme products decreased in the Met, Arg, and

Leu biosynthetic pathways in tRNA trafficking mutants.

Since several amino acid biogenesis-related enzymes can be feedback regulated by their products (Cherest et al., 1973, for reviews, see Hinnebusch, 1988; Thomas and

Surdin-Kerjan, 1997), it seems also possible that tRNA trafficking defects lead to changes in metabolic flux and that subsequently causes accumulation of amino acids. The excess amino acid products further inhibit the rate-limiting enzyme activities without affecting aminoacylation levels of tRNAs. If it is true, it will also be interesting to learn why sulfur assimilation and arginine biosynthesis pathways are repressed by regulating multiple proteins of the pathways, whereas the affected Leu, Ser, and Lys biosynthetic pathway proteins function at first step of each pathway (leucine biosynthesis pathway see

Figure 3. 14, serine and lysine pathways are not shown). Therefore, extensive analysis of amino acid intermediates and metabolome in tRNA trafficking mutants may shed light on understanding the physiological functions of tRNA subcellular dynamics.

How these specific mRNA targets are commonly regulated at translation level by tRNA nuclear-cytoplasmic trafficking? It is not clear. We are unable to identify common cis-regulatory elements among the ORFs within these down-regulated translating mRNAs by analyzing codon bias or amino acid usage bias. Moreover, other than Gcn4- responsive elements, methionine-responsive element, and arginine-responsive element, we are not able to find other common regulatory motifs among the 5’ UTR and 3’ UTR regions from all of the target mRNAs. These results led us to propose that perhaps these

targets are regulated by secondary structure close to AUG or by uORF, which serves as

negative translation regulator. Importantly, a previous study characterizing MET2

transcript provides a hint in which MET2 is implicated to be regulated at post-

transcriptional level and there are two possible stem-loop-stem structures from upstream

region to open reading frame (-9 to +61 and -80 to -44, Baroni et al., 1986; Forlani et al.,

1991). Whether and how MET2 transcript is regulated via the secondary structure is still unknown. A recent publication has been shown that proteins synthesis can be initiated by non-canonical uORF in mammalian cells (Starck et al., 2012). Thus, investigation of secondary structure near start codon as well as identification of possible uORF (canonical and non-canonical) among the upstream sequences of these targets might provide possible regulatory mechanisms.

Although we discovered a novel function for tRNA subcellular trafficking in cellular metabolism, its other potential functions are not excluded. For example, tRNA nuclear retrograde import might function in transporting damaged or hypomodified tRNAs back to the nucleus for quality control/proofreading. It has been shown that two tRNA surveillance systems exist in yeast cells, the TRAMP pathway, which locates in the nucleus, and the RTD pathway, which locates in the nucleus and the cytoplasm.

(Alexandrov et al., 2006; Chernyakov et al., 2008; Kadaba et al., 2006). Since tRNA nuclear import is constitutive, transporting damaged cytoplasmic tRNAs for repair or turnover further supports this observation. Moreover, in trm8Δ trm4Δ cells tRNAVal(AAC) is hypomodified and degraded by the RTD pathway, which was proposed to cause the

temperature sensitive growth at 37°C (Chernyakov et al., 2008). When we introduced

92 los1Δ into trm8Δ trm4Δ cells, we found this triple mutant is even more sensitive when grown at 30°C (Appendix A, Figure A. 1). We reason that it is likely because tRNA substrates are retained in the nucleus in cells lacking Los1, and this subsequently leads to increasing tRNA substrates degraded by endonucleases.

A recent study showed that the tRNA nuclear-cytoplasmic trafficking is required for wybutosine (yW) base modification of tRNAPhe at position 37 (Ohira and Suzuki,

Phe 2011). G37 of tRNA must be imported to the nucleus and modified by nuclear Trm5,

1 Phe and the product m G37 of tRNA needs to return cytoplasm for next modification to form yW. The yW formation is catalyzed by the four cytoplasmic enzymes, Tyw1-4, and is important to prevent translation frameshift (Kalhor et al., 2005; Noma et al., 2006).

Therefore, interrupting tRNA nuclear import or re-export would generate the hypomodified tRNAPhe , which subsequently increase translation frameshift, and that might be the reason for reduced levels of proteins involved in Met, Arg, and Leu biosynthetic pathways in cells defective in tRNA nuclear import or export. And if this is the case, mislocation of the nuclear Trm5 to the cytoplasm may prevent the reduction.

Furthermore, in tyw1Δ cells the levels of proteins responsible for Met, Arg, and Leu biosynthetic pathways should also decrease. However, our result revealed that mislocation of the nuclear Trm5 to the cytoplasm in mtr10Δ cells does not rescue the reduced protein levels (Appendix A, Figure A. 3). Also, Arg3-3HA (Appendix A, Figure

A. 3) or Met3-3HA (data not shown) protein levels are unchanged in tyw1Δ cells.

Therefore, hypomodified tRNAPhe is not the reason for down-regulation of translating amino acid biosynthetic mRNAs. However, there are other modifications whose

pathways are not yet discovered. This might also follow the tRNA nuclear-cytoplasmic

trafficking and contribute to the regulation on the translation of the target mRNAs.

It is also possible that the tRNA nuclear import functions for nuclear translation.

Whether nuclear translation does occur in the eukaryotic cells has been argued for a long time. Recently it has been reported that nuclear translation occurs in the mammalian cells

(David et al., 2012; Reid and Nicchitta, 2012). Others argued that their data do not support the nuclear translation (Dahlberg and Lund, 2012). Even if nuclear translation occurs in the mammalian cells, it may or may not occur in yeast. Thus, tRNA import may still leave a novel function in the nucleus.

We seek to provide addition information about the cellular function of tRNA nucleocytoplasmic trafficking. For example, we would like to extend the analysis of cis- regulatory elements by identifying possible uORFs or secondary structures in the upstream region of target mRNAs. Moreover, the mRNAs encode Met, Arg, and Leu biosynthetic pathways should be associated with the non-polysomal region in the

Northern blot analysis of samples collected from tRNA trafficking mutants. Furthermore, since there is no large change in microarray analysis of msn5Δ cells and Los1 also functions in tRNA re-export, therefore, we expect a larger change in los1Δ msn5Δ cells by microarray analysis.

There are more questions remaining unanswered. How do cells sense tRNA intracellular distribution? Are nuclear accumulated tRNAs functional? If so, what is the physiological role(s) of previously-cytoplasmic nuclear tRNA during nutrient starvation?

The roles of tRNA nuclear-cytoplasmic trafficking in quality control and the newly

94 discovered regulation/maintenance of amino acid biosynthesis are still not able to explain why and how tRNAs are retained in the nucleus upon nutrient stress? More studies on how exporters are regulated during nutrient stress and which signaling pathway(s) is involved will be important to answer these questions.

CHAPTER 4

Transcriptional analysis of mtr10Δ cells

4.1 Introduction

Mtr10 was first discovered in a genome-wide screen for polyadenylated mRNAs accumulation in the nucleus at 37°C. Thus, Mtr10 was suggested to function in mRNA nuclear export (Kadowaki et al., 1994). Later, it was reported to be a member of the karyopherin family that functions in nuclear import of an essential mRNA binding protein, Npl3. Npl3 functions in nuclear export of mRNAs and large ribosomal subunits

(Hackmann et al., 2011; Lee et al., 1996; Stage-Zimmermann et al., 2000; Windgassen et al., 2004). Npl3 immunoprecipitates with Mtr10 and the complex only disassociates in the presence of Ran-GTP. Npl3 shuttles between the nucleus and the cytoplasm, and thus in the absence of Mtr10 as expected for a β-importin, Npl3 mislocalizes to the cytoplasm

(Pemberton et al., 1997; Senger et al., 1998).

Mtr10 is also required for the nuclear import of the RNA component of the yeast telomerase, TLC1 (Ferrezuelo et al., 2002; Gallardo et al., 2008). The nucleo-cytoplasmic trafficking of TLC1 RNA is required for telomerase biogenesis (Gallardo et al., 2008;

Teixeira et al., 2002). In wild-type cells TLC1 RNA is predominantly in the nucleus and

it is mislocalized to the entire cell in mtr10Δ cells (Ferrezuelo et al., 2002).

To date, the understanding of the physiological roles of Mtr10 is limited. It was

proposed that there must be more unexplored cargos which depend on Mtr10 (Senger et

al., 1998). In this study, we employed a genome-wide approach to determine the direct and indirect targets of Mtr10 by comparing the gene expression level of each transcript in mtr10Δ to wild-type cells in fed or amino acid starvation condition. We demonstrated that

in addition to its previously known role to import Npl3, Mtr10 also likely functions in

sporulation, DNA damage response, glutathione homeostasis, metal ion homeostasis, and

lipid metabolism, directly or indirectly.

4.2 Results

This section includes data analysis of transcription profiles from total mRNAs of msn5Δ

(section 4.2.1) and mtr10Δ (section 4.2.2 and thereafter) cells compared to wild-type cells

in fed or amino acid starvation conditions. Because the transcription profiles of msn5Δ

cells were as expected from the large numbers of studies of this karyopherin (Bakhrat et

al., 2008; Blondel et al., 1999; Bollman et al., 2003; DeVit and Johnston, 1999; Kaffman

et al., 1998; Shimada et al., 2000; Willis and Moir, 2007), the results described in this

section predominately focus on the transcriptional analyses of mtr10Δ cells. The data

include the microarray analyses of the transcriptional profiles, the validations of selected

transcripts, and functional analyses.

4.2.1 Microarray analysis of transcription profiles in msn5∆ cells

Since Msn5 is known to export several nuclear phosphorylated transcription factors, such

as Far1 and Pho4, to the cytoplasm in fed conditions (Blondel et al., 1999; Kaffman et al.,

1998), we expected that msn5Δ cells would accumulate these cargos in the nucleus and

therefore their target genes would have induced transcription. After employing statistical

analysis of the transcription profiles from msn5Δ cells to the profiles from wild-type cells,

we used the cutoff conditions with adjusted p-value 0.05 and log2 FC 0.6 or −0.6 to select differentially expressed genes. In msn5Δ cells, 177 genes were up-regulated and

119 genes were down-regulated in the fed condition; and 193 genes were up-regulated and 258 genes were down-regulated in acute amino acid starved condition (see

Table 4. 1). All of the genes with statistically significant changes in expression are listed in Appendix L to Appendix O (msn5Δ vs. wild-type in fed or amino acid starved conditions). Most of the affected mRNAs are consistent with previous studies (Blondel et al., 1999; Springer et al., 2003). For example, the transcription of several Pho4- responsive genes, such as PHO84, PHO89, PHO11, and PHO5, were activated in msn5Δ

cells (Appendix M). Hence, in the following sections we focus on the transcriptional

profiles from mtr10Δ cells.

4.2.2 Microarray analysis of transcription profiles in mtr10∆ cells

Current understanding of the cellular roles of the importin Mtr10 is largely unclear. Since the results from analysis of the transcriptional profiles of msn5Δ cells confirmed its known roles, we proposed that analysis of transcriptional profiles of mtr10Δ cells could 98

provide further insights into the cellular functions of Mtr10. In general, the transcription

profiles from mtr10Δ cells exhibited a relatively larger change as roughly assessed by

PCA analysis (Figure 4. 1). We next performed statistical analysis of the microarray

transcriptional profiles from total RNA samples of mtr10Δ cells compared to total RNA samples isolated from wild-type cells that were propagated in fed or acute amino acid starvation condition. Because ~10% of genome was affected in mtr10Δ cells (~900 genes affected in fed and ~1400 genes affected in starved condition) when using adjusted p-

value 0.05, we used a more stringent condition to select significant differentially expressed genes to narrow down the range of genes of interests (Table 4. 1). Total numbers of 533 genes from fed mtr10Δ cells and 1165 genes from starved mtr10Δ cells were selected using the cutoff condition as adjusted p-value 0.001 and log2 FC 0.6 or

−0.6 (Figure 4. 2 and Table 4. 1). More details are described below. All of the genes with

statistically significant changed in expression are listed in Appendix G to Appendix J

(mtr10Δ vs. wild-type).

Genes with expression changed in mtr10Δ cells under fed condition

There are 335 genes that were up-regulated and 198 genes that were down-regulated in

cells lacking Mtr10 (Table 4. 1). To understand the functions of the differential expressed

genes, we employed GO term-enrichment analysis and FunCat analysis (complete result

of FunCat analysis is in Appendix F). Among the 335 up-regulated genes, the top one

over-represented function of each analysis was sexual reproduction (from GO term

enrichment analysis, n=28) and zygospore development (from FunCat, n=21),

99 respectively (Table 4. 2). The results suggested that Mtr10, directly or indirectly, is involved in the regulation of zygote or spore formation. Among 198 down-regulated genes, 11 encoded proteins that function in metal ion homeostasis (top one from GO term enrichment analysis) and 22 encoded proteins that function in lipid metabolism (top one from FunCat analysis) (Table 4. 2). Taken together, the transcriptional profiling of fed mtr10Δ cells revealed several potential functions of Mtr10.

100

Figure 4. 1. PCA analysis of transcription profiles of total mRNAs from wild-type, msn5Δ, and mtr10Δ cells in fed or acute amino acid starvation condition. PCA analysis provided a general view of microarray data before statistical analysis. One ball represents one microarray experiment.

101

Volcano plot of limma -- Tf_mtr10 vs wt -log10 p value -log10 02468

-6 -4 -2 0 2 4 Diff (logFC)

Volcano plot of limma -- Ts_mtr10 vs wt -log10 p -log10 value 02468

-6 -4 -2 0 2 Diff (logFC)

Figure 4. 2. Volcano plots showing differential expressed genes at transcriptional level in mtr10Δ cells versus wild-type cells. Upper, in fed condition; bottom, in acute amino acid starved condition. Red dots represent up-regulated genes; blue dots represent down-

regulated genes. Cutoff values of adjusted p-value < 0.001 with log2 FC 0.6 or − 0.6 are shown in dashed lines in the plots. Y axis represents log10 of original p-value.

102

msn5Δ vs. WT mtr10Δ vs. WT

Total.Fed a Total.Starved a Total.Fed b Total.Starved b Up 177 193 335 605 Down 119 258 198 560

Table 4. 1. Numbers of significant differentially transcriptionally expressed genes from total mRNA samples of msn5Δ or mtr10Δ cells in fed or amino acid starvation conditions. a: adjusted p-value < 0.05 with log2 FC 0.6 or − 0.6; b: adjusted p-value < 0.001

with log2 FC 0.6 or − 0.6.

Genes changed in mtr10-deletion cells under starved condition

By identifying genes with expression changes in amino acid starved mtr10Δ cells

compared to amino acid starved wild-type cells, we may be able to discover “Mtr10-

dependent amino acid-deprived responsive” genes. If so, the data could provide

information about the possible role of Mtr10 in response to environmental stress. In the

transcriptional profiles from starved mtr10Δ cells, there were 605 genes that were up-

regulated and 560 genes that were down-regulated (Table 4. 1). Some of the affected

genes were attributed to loss of Mtr10 per se, and thus appeared in both profiles from fed

and starved conditions (the common affected genes in fed and starved conditions in

Figure 4. 3). We identified numerous genes with affected expression only in starved condition. The functions of up-regulated genes included cell cycle, DNA repair, nuclear mRNA splicing, and protein folding (Table 4. 3). Interestingly, among starvation-only

103

down-regulated genes via identified a large numbers of genes encoded transporters. This

result suggested that Mtr10 is likely involved in regulation of transporters in response to

amino acid starvation.

4.2.3 Confirmations of selected target mRNA expressions by Northern

blot analysis

Genome-wide studies usually provide valuable information, but often produce errors or

false-positive results. Hence, it is necessary to validate every gene of interest selected

from microarray expression profiles by different methods, such as Northern blot analysis

or real-time RT-PCR. To confirm the microarray data analysis of the transcriptional

profile from mtr10Δ cells grown in fed condition, I performed the Northern analyses. The

total mRNAs were collected from wild-type, mtr10Δ, and msn5Δ cells grown in SC media. In this experiment, msn5Δ cells served as an internal negative control. At least one target gene from each functional category was chose to be validated.

Most of the targets from up-regulated expression profiles in mtr10Δ cells were confirmed: MTH1 (encodes a protein involved in negative regulator of glucose signaling transduction pathway), CWC15 (encodes a protein involved in mRNA splicing), RAD9

(encodes DNA-damage checkpoint protein), and LCD1 (encodes a protein essential in

DNA integrity pathway) (Figure 4. 4) were all up-regulated. The expression profiles of

SNF3 (encodes membrane glucose sensor) and DAL80 (encodes negative regulator of nitrogen degradation pathway) were tested but no signals were detected, likely due to their low expressions (data not shown). SPS2, SPR3, and SPR28, encode proteins

104

expressed during sporulation, were also tested. The expression level of SPS2 gene was

not significantly increased in mtr10Δ cells (Figure 4. 4). In addition, the signals of SPR3

and SPR28 were too low to be detected by Northern analysis (data not shown).

We also examined the expression levels of two candidate genes, GTO3 and TPO4,

which were down-regulated by microarray analyses. GTO3 encodes a glutathione

transferase and TPO4 encodes a polyamine transporter. The results of Northern analysis showed that the expression level of GTO3 was dramatically reduced in mtr10Δ cells

relative to wild-type or msn5Δ cells and thus confirmed the microarray data (Figure 4. 4).

In contrast, the expression level of TPO4 was unchanged in mtr10Δ cells when compared

to wild-type cells (data not shown).

In conclusion, by employing Northern blot analysis, the expression profiles of

most tested targets from microarray analyses in fed mtr10Δ cells were confirmed. Mtr10

not only imports Npl3 but also is possibly involved in regulation of glucose signaling

pathway, DNA damage checkpoint pathways, and glutathione homeostasis. Although

further investigations are required, the microarray analysis of transcription profiles from mtr10Δ cells provides valuable information and hints of the physiological roles of Mtr10.

4.2.4 Phenotypic analyses by growth assays

Since it appeared that the DNA damage-related genes were up-regulated in mtr10Δ cells

(Figure 4. 4), we proposed that the DNA damage pathway was activated in mtr10Δ cells.

If so, mtr10Δ cells might be more resistant to DNA damage than wild-type cells. To test

this hypothesis, we performed growth assay of wild-type, mtr10Δ, msn5Δ, los1Δ, and

105

los1Δ msn5Δ cells, on solid media containing the mutagen 5-fluorouracil (5-FU) which

induces DNA base excision repair pathway (Seiple et al., 2006), or methyl

methanesulfonate (MMS) which causes DNA double strand breaks (Lundin et al., 2005)

(Figure 4. 5). Since it was previously shown that los1Δ cells are sensitive to 5-FU

(Gustavsson and Ronne, 2008), we utilized los1Δ strain as a positive control. We also

examined other tRNA nucleocytoplasmic trafficking mutants, such as msn5Δ and los1Δ

msn5Δ, to test their growth in the presence of these mutagens.

Contrary to the expectation, the mtr10Δ strain was not resistant to either DNA

damage agent. Conversely, the mtr10Δ cells were more sensitive (Figure 4. 5). These results indicated that both DNA repair pathways were defective in the absence of Mtr10

even through RAD9 and LCD1 mRNA levels were induced (Figure 4. 4). As expected, los1Δ cells were not viable in the presence of 5-FU, msn5Δ cells grew similarly as wild- type cells. These results suggest that Los1 and Msn5 do not function in parallel in response to DNA damage. Since 5-FU activates DNA base-excision pathway (Seiple et al., 2006) and los1Δ cells are sensitive to 5-FU (Gustavsson and Ronne, 2008), we hypothesized that Los1 functions in the DNA damage response. If this is the case, los1Δ cells would be also sensitive when DNA damage response alternatively induced by MMS.

However, wild-type, msn5Δ, los1Δ, and los1Δ msn5Δ strains had similar growth on the

MMS-containing solid media. The data suggest that these tRNA exportin pathways function independently for the DNA double-strand damage response.

106

107

Table 4. 2. GO term enrichment analysis and FunCat analysis of genes with significant changed in mtr10Δ cells in fed condition. Significant up-regulated or down-regulated expressed genes were analyzed and grouped with their GO terms or functional categories by using web-interface tools in GO or FunCat, respectively. Bold words represent the over-represented GO term or functional categories. Numbers of genes in each term or category are noted in parentheses. The p-value was obtained by comparing the occurrence frequency to background frequency.

107

108

Table 4. 3. GO term enrichment analysis and FunCat analysis of genes with significant changed in mtr10Δ cells in acute amino acid starved condition. Significant up-regulated or down-regulated expressed genes were analyzed and grouped with their GO terms or functional categories by using web-interface tools in GO or FunCat, respectively. Bold words represent the over- represented GO term or functional categories. Numbers of genes in each term or category are noted in parentheses. The p-value was obtained by comparing the occurrence frequency to background frequency.

108

Figure 4. 3. Venn diagram of differentially expressed genes from mtr10Δ cells relative to wild-type cells in fed and amino acid starved conditions.

109

110

Figure 4. 4. Northern blot analysis of total mRNAs collected from wild-type, mtr10Δ, and msn5Δ cells grown in fed condition. ACT1 served as internal loading control. 25S and 18S rRNAs were also serving as internal loading controls, the bottom pictures were ethidium bromide-stained agarose gels. Each ratio was obtained from normalizing to ACT1 expression value and then compared to WT.

110

Figure 4. 5. Growth assay to assess the function of Mtr10 in DNA damage response. All of the strains were grown in liquid YEPD media overnight at 30°C and were adjusted to similar density followed with 10X serial dilution before spotting on the indicated solid media. 5-FU, 5-fluorouracil, a pyrimidine analog. MMS, an agent causes DNA double strand breaks. The concentrations of 5-FU and MMS were 15 µg/ml and 0.02 %, respectively, in SC media. The cells were incubated at indicated temperatures for 2 days.

111

4.3 Discussion

Here we report that in mtr10Δ cells a large number of genes (about ~10% of the genome

when we used the stringent conditions with adjusted p-value < 0.001 and log2 FC 0.6 or − 0.6) have affected expression from microarray analysis. Among the up-regulated genes, those encoding zygote development and sporulation are over-represented. In

Northern analysis the expression level of one of these genes, SPS2, is not significantly increased. It is likely because its expression is too low to be detected. Therefore, the potential function of Mtr10, and/or its unknown cargo(s), in the regulation of sporulation may not be exclusive.

Other than sporulation-related genes, we also confirmed the enhanced expression of DNA damage check point-related genes, RAD9 and LCD1, in fed mtr10Δ cells.

However, the results of growth assay indicated that the mtr10Δ cells are highly sensitive to 5-FU and MMS and do not grow in the presence of these agents. It is unknown whether up-regulated expression of RAD9 and LCD1 are direct or indirect due to loss of

Mtr10, but this misregulation may contribute to the defect of DNA damage response in mtr10Δ cells. Since the studies about Rad9 and Lcd1 mainly focus on the regulation of their phosphorylation states during DNA damage signaling pathway (Andrew, 1998;

Rouse and Jackson, 2000), our findings provide a potentially different level of regulation.

More interestingly, previous work showed that intron-containing tRNAs are retained in the nucleus after UV-induced DNA damage due to the translocation of Los1 from the nucleus to cytoplasm (Ghavidel et al., 2007). Although the regulation of this translocation and its biological significance are unclear, this observation leads to the idea that Mtr10 112

might play a role in the DNA damage signaling transduction pathway. If so, it might be directly regulated by the translocation of Mtr10 upon DNA damage (like Los1) or

through Mtr10’s function in shuttling the unknown cargo(s) that function in the DNA

damage signaling pathways.

Northern analysis also confirmed that induction of expression levels of MTH1,

which encodes a negative regulator in the glucose signaling pathway (for review, see

Santangelo, 2006). When cells are grown in glucose-containing media, MTH1 expression

is repressed by the Snf1-Mig1 glucose repression pathway (Kim et al., 2006). Strikingly,

MTH1 not only de-represses in mtr10Δ cells but also in msn5Δ cells. This observation

indicates that the Snf1-Mig1 glucose repression pathway is not fully functional in cells

with defective in tRNA nuclear-cytoplasmic traffic. It is unknown whether the

accumulating MTH1 transcripts leads to increased Mth1 protein and more phosphorylated

Mth1. Because it has been shown that the regulation of tRNA subcellular distribution is

glucose-dependent/specific (Whitney et al., 2007), our data provides supporting evidence

that there might be a connection between the regulation of glucose signaling transduction

pathway and tRNA subcellular movement.

For down-regulated genes, we confirmed GTO3 reduced transcript levels. GTO3

encodes a glutathione transferase. This result provides another potential function for

Mtr10 in glutathione homeostasis. In addition, Mtr10 may participate in two other

cellular processes: metal ion homeostasis and lipid metabolism, according to the

microarray analysis. It is particularly interesting to examine the expression levels of

genes related to the lipid metabolism in mtr10Δ cells, because lipid homeostasis is

113

important for maintaining cell membrane and cell shape, and previous observations shows that mtr10Δ cells have abnormal long and shield-like shape (Murthi et al., 2010;

Whitney et al., 2007). Therefore, although further investigations are needed, the transcriptional profiles provide explanations for the abnormal shape of mtr10Δ mutant cells.

114

CHAPTER 5

Summary and future directions

In this study the data provide no evidence for the possibility that tRNA nuclear retrograde process functions as a stress signal upon nutrient deprivation from the results of polysome profiles and microarray data of starved tRNA trafficking mutants. But we discovered a novel connection between tRNA nuclear-cytoplasmic trafficking and translation of the Met, Arg, and Leu amino acid biosynthetic mRNAs. In cells with defects of tRNA trafficking, several enzymes involved in the Met, Arg, and Leu amino acid biosynthesis pathways are poorly produced, suggesting a role of tRNA nuclear- cytoplasmic trafficking in maintaining the basal levels of translation of mRNAs encoding

Met, Arg, and Leu biosynthetic pathways.

Future direction

It is unknown what are the consequence(s) caused by the reduced levels of the

Met, Arg, and Leu biosynthetic enzymes. A high-throughput analysis of amino acid intermediates in Met, Arg, and Leu biosynthesis pathways by LC/MS might provide more insights in the ultimate outcomes in amino acid metabolism when tRNA nuclear- cytoplasmic traffic is defective. Additionally, it is also interesting to study by which 115 mechanism that tRNA trafficking specifically regulates the translations of mRNAs involved in Met, Arg, and Leu biosynthetic pathways.

On the other hand, more work is required to confirm the microarray data for the mtr10Δ mutant. In addition, further investigations on the consequences of the affected genes will contribute a greater understanding of the biological functions of Mtr10. In particular, what is the role of Mtr10 in DNA damage response pathways? Whether or not the glucose signaling pathways are misregulated in the mutants with defects of tRNA nuclear-cytoplasmic trafficking? If so, how these two pathways are coupled?

116

APPENDIX A: Tested possibilities for mechanism of down-regulated translation of the target mRNAs involved in the Met, Arg, and Leu biosynthetic pathways

This section includes two results. First, in Figure A. 1 and Figure A. 2, I employed the growth assay to determine the temperature sensitive growth of tRNA modification mutants and its derivative strain with tRNA trafficking mutants. Second, we tested the hypothesis that mislocate the nuclear Trm5 to the cytoplasm might rescue the reduced levels of Arg3-3HA in cells with defective of tRNA import process (mtr10Δ) (Figure A.

3). In addition, we assessed Arg3-3HA protein levels in tRNA yW modification mutant

(tyw1Δ) (Figure A. 3). The result showed that Arg3-3HA protein level was not rescued when mislocating Trm5 into the cytoplasm in mtr10Δ cells and Arg3-3HA protein was unchanged in tyw1Δ cells. Moreover, nuclear retention tRNAs by overexpressing Trz1-

MORF does not lead to reduced levels of Arg5,6-GFP. All together, several lines of evidence indicated that the reduced levels of target amino acid biosynthesis pathways do not result from tRNAPhe modification defect.

117

118

Figure A. 1. Growth assay of mutants defective in tRNA export and modifications. trm8Δ trm4Δ mutants combined with defective tRNA export processes (los1Δ, msn5Δ, los1Δ msn5Δ). trm8Δ trm4Δ-derived defective tRNA export mutants. All mutants were grown in liquid media overnight and density-adjusted cells were serial-diluted on SC solid media and incubated two or more days at indicated temperature. #1, #2, and #3 represented three different candidates.

118

119

Figure A. 2. Growth assay of mutants defective in tRNA import and modifications. All mutants were grown in liquid media overnight and density-adjusted cells were serial-diluted on SC solid media and incubated two or more days at indicated temperature. #1, #2, and #3 represented three different candidates. A. trm8Δ trm4Δ mutants combined with defective tRNA export processes (los1Δ, msn5Δ, los1Δ msn5Δ). B. trm8Δ trm4Δ mutants combined with defective of tRNA import process mtr10Δ.

119

Figure A. 3. Western blot analysis of Arg3-3HA in tRNA modification mutants. A. Endogenously GFP or NES-GFP tagged Trm5 was created in Wild-type or mtr10Δ cells that harboring Arg3-3HA fusion protein. The whole cell extracts were collected from early log phase of cell culture in SC media. Kar2 is internal loading control. B. Assessment of Arg3-3HA protein levels in tyw1Δ cells. Wild-type or mtr10Δ cells served as positive and negative controls. C. Assessment of Arg5,6-GFP in cells expressing vector or Trz1-MORF plasmid before and after galactose 3-hr induction.

120

APPENDIX B: Transcripts with decreased translation activity index in fed mtr10Δ cells

The transcripts with decreased P/NP ratio (cutoff condition: log2 FC 0.6 and adjusted p-value 0.05) in mtr10Δ cells while compared to wild-type cells in fed condition are listed below and ordered according to log2 (fold-change).

Transcripts with decreased P/NP ratio in fed mtr10Δ cells.

log2 (mtr10[P Symbols ORF Description f/NP.f]/ adj.p.val WT[Pf/N P.f]) SUL1 YBR294W High affinity sulfate permease; sulfate uptake is mediated by specific ‐2.8202 0.0026 sulfate transporters Sul1p and Sul2p, which control the concentration of endogenous activated sulfate intermediates STR3 YGL184C Peroxisomal cystathionine beta‐lyase, converts cystathionine into ‐2.4652 0.0024 homocysteine; may be redox regulated by Gto1p BDH2 YAL061W Putative medium‐chain alcohol dehydrogenase with similarity to ‐2.2714 0.0037 BDH1; transcription induced by constitutively active PDR1 and PDR3 PHM6 YDR281C Protein of unknown function, expression is regulated by phosphate ‐2.0514 0.0171 levels MET2 YNL277W L‐homoserine‐O‐acetyltransferase, catalyzes the conversion of ‐1.8123 0.0041 homoserine to O‐acetyl homoserine which is the first step of the methionine biosynthetic pathway MET28 YIR017C Basic leucine zipper (bZIP) transcriptional activator in the Cbf1p‐ ‐1.7081 0.0050 Met4p‐Met28p complex, participates in the regulation of sulfur metabolism NA YGR226C Dubious open reading frame, unlikely to encode a protein; not ‐1.6090 0.0408 conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W AAD14 YNL331C Putative aryl‐alcohol dehydrogenase with similarity to P. ‐1.5827 0.0127 chrysosporium aryl‐alcohol dehydrogenase; mutational analysis has not yet revealed a physiological role TPK1 YJL164C cAMP‐dependent protein kinase catalytic subunit; promotes ‐1.5650 0.0060 vegetative growth in response to nutrients via the Ras‐cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p MET3 YJR010W ATP sulfurylase, catalyzes the primary step of intracellular sulfate ‐1.4839 0.0060 activation, essential for assimilatory reduction of sulfate to sulfide, involved in methionine metabolism 121

log2 (mtr10[P Symbols ORF Description f/NP.f]/ adj.p.val WT[Pf/N P.f]) MMP1 YLL061W High‐affinity S‐methylmethionine permease, required for utilization ‐1.4724 0.0050 of S‐methylmethionine as a sulfur source; has similarity to S‐ adenosylmethionine permease Sam3p NA YHR140W Putative integral membrane protein of unknown function ‐1.4717 0.0288 FRE5 YOR384W Putative ferric reductase with similarity to Fre2p; expression ‐1.4654 0.0205 induced by low iron levels; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies NA YBR184W Putative protein of unknown function; YBR184W is not an essential ‐1.4519 0.0060 gene MET32 YDR253C Zinc‐finger DNA‐binding protein, involved in transcriptional ‐1.4489 0.0096 regulation of the methionine biosynthetic genes, similar to Met31p NA YFR032C‐B Putative protein of unknown function; identified by gene‐trapping, ‐1.4458 0.0171 microarray‐based expression analysis, and genome‐wide homology searching QDR2 YIL121W Multidrug transporter of the major facilitator superfamily, required ‐1.4424 0.0301 for resistance to quinidine, barban, cisplatin, and bleomycin; may have a role in potassium uptake COX17 YLL009C Copper metallochaperone that transfers copper to Sco1p and ‐1.3702 0.0459 Cox11p for eventual delivery to cytochrome c oxidase; contains twin cysteine‐x9‐cysteine motifs MET14 YKL001C Adenylylsulfate kinase, required for sulfate assimilation and involved ‐1.3027 0.0171 in methionine metabolism ARG3 YJL088W Ornithine carbamoyltransferase (carbamoylphosphate:L‐ornithine ‐1.2977 0.0060 carbamoyltransferase), catalyzes the sixth step in the biosynthesis of the arginine precursor ornithine SAP4 YGL229C Protein required for function of the Sit4p protein phosphatase, ‐1.2958 0.0216 member of a family of similar proteins that form complexes with Sit4p, including Sap155p, Sap185p, and Sap190p MHT1 YLL062C S‐methylmethionine‐homocysteine methyltransferase, functions ‐1.2937 0.0108 along with Sam4p in the conversion of S‐adenosylmethionine (AdoMet) to methionine to control the methionine/AdoMet ratio MET16 YPR167C 3'‐phosphoadenylsulfate reductase, reduces 3'‐phosphoadenylyl ‐1.2880 0.0112 sulfate to adenosine‐3',5'‐bisphosphate and free sulfite using reduced thioredoxin as cosubstrate, involved in sulfate assimilation and methionine metabolism NA YDR366C Putative protein of unknown function ‐1.2866 0.0204 AMS1 YGL156W Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) ‐1.2697 0.0112 degradation; delivered to the vacuole in a novel pathway separate from the secretory pathway NA YKL069W Methionine‐R‐sulfoxide reductase, reduces the R enantiomer of free ‐1.2514 0.0366 Met‐SO, in contrast to Ycl033Cp which reduces Met‐R‐SO in a peptide linkage; has a role in protection against oxidative stress SEO1 YAL067C Putative permease, member of the allantoate transporter subfamily ‐1.2394 0.0293 of the major facilitator superfamily; mutation confers resistance to ethionine sulfoxide EMI2 YDR516C Non‐essential protein of unknown function required for ‐1.2189 0.0416 transcriptional induction of the early meiotic‐specific transcription factor IME1; required for sporulation; expression is regulated by glucose‐repression transcription factors Mig1/2p NA YBL008W‐A Putative protein of unknown function; identified by fungal homology ‐1.2071 0.0459 and RT‐PCR NA YLR361C‐A Putative protein of unknown function ‐1.1860 0.0429 SUL2 YLR092W High affinity sulfate permease; sulfate uptake is mediated by specific ‐1.1638 0.0252 sulfate transporters Sul1p and Sul2p, which control the concentration of endogenous activated sulfate intermediates 122

log2 (mtr10[P Symbols ORF Description f/NP.f]/ adj.p.val WT[Pf/N P.f]) SPC3 YLR066W Subunit of signal peptidase complex (Spc1p, Spc2p, Spc3p, Sec11p), ‐1.1282 0.0431 which catalyzes cleavage of N‐terminal signal sequences of proteins targeted to the secretory pathway; homologous to mammalian SPC22/23 MET1 YKR069W S‐adenosyl‐L‐methionine uroporphyrinogen III transmethylase, ‐1.1043 0.0205 involved in the biosynthesis of siroheme, a prosthetic group used by sulfite reductase; required for sulfate assimilation and methionine biosynthesis ARG7 YMR062C Mitochondrial ornithine acetyltransferase, catalyzes the fifth step in ‐1.1018 0.0205 arginine biosynthesis; also possesses acetylglutamate synthase activity, regenerates acetylglutamate while forming ornithine HXT9 YJL219W Putative hexose transporter that is nearly identical to Hxt11p, has ‐1.0957 0.0454 similarity to major facilitator superfamily (MFS) transporters, expression of HXT9 is regulated by transcription factors Pdr1p and Pdr3p RGI1 YER067W Protein of unknown function involved in energy metabolism under ‐1.0825 0.0308 respiratory conditions; protein abundance is increased upon intracellular iron depletion PAU17 YLL025W Protein of unknown function, member of the seripauperin ‐1.0771 0.0171 multigene family encoded mainly in subtelomeric regions; YLL025W is not an essential gene NAT5 YOR253W Subunit of the N‐terminal acetyltransferase NatA (Nat1p, Ard1p, ‐1.0728 0.0454 Nat5p); N‐terminally acetylates many proteins, which influences multiple processes such as the cell cycle, heat‐shock resistance, mating, sporulation, and telomeric silencing NA YDL114W Putative protein of unknown function with similarity to acyl‐carrier‐ ‐1.0609 0.0108 protein reductases; YDL114W is not an essential gene SET4 YJL105W Protein of unknown function, contains a SET domain ‐1.0592 0.0330 NA YJL218W Putative protein of unknown function, similar to bacterial ‐1.0499 0.0108 galactoside O‐acetyltransferases; induced by oleate in an OAF1/PIP2‐dependent manner; promoter contains an oleate response element consensus sequence; non‐essential gene NA YOR387C Putative protein of unknown function; regulated by the metal‐ ‐1.0169 0.0293 responsive Aft1p transcription factor; highly inducible in zinc‐ depleted conditions; localizes to the soluble fraction NA YIL046W‐A Putative protein of unknown function; identified by expression ‐1.0125 0.0293 profiling and mass spectrometry BNA4 YBL098W Kynurenine 3‐mono oxygenase, required for the de novo ‐1.0108 0.0498 biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p; putative therapeutic target for Huntington disease RTT102 YGR275W Component of both the SWI/SNF and RSC chromatin remodeling ‐1.0074 0.0171 complexes, suggested role in chromosome maintenance; possible weak regulator of Ty1 transposition IRC15 YPL017C Microtubule associated protein; regulates microtubule dynamics; ‐0.9902 0.0301 required for accurate meiotic chromosome segregation; null mutant displays large budded cells due to delayed mitotic progression, increased levels of spontaneous Rad52 foci NA YJL163C Putative protein of unknown function ‐0.9795 0.0330 GID7 YCL039W Protein of unknown function, involved in proteasome‐dependent ‐0.9741 0.0424 catabolite inactivation of fructose‐1,6‐bisphosphatase; contains six WD40 repeats; computational analysis suggests that Gid7p and Moh1p have similar functions PAU5 YFL020C Member of the seripauperin multigene family encoded mainly in ‐0.9672 0.0301 subtelomeric regions; induced during alcoholic fermentation; 123

log2 (mtr10[P Symbols ORF Description f/NP.f]/ adj.p.val WT[Pf/N P.f]) induced by low temperature and also by anaerobic conditions; negatively regulated by oxygen and repressed by heme NA YMR105W‐ Putative protein of unknown function ‐0.9640 0.0207 A AIM19 YIL087C Putative protein of unknown function; the authentic, non‐tagged ‐0.9508 0.0365 protein is detected in purified mitochondria in high‐throughput studies; null mutant displays reduced respiratory growth MER1 YNL210W Protein with RNA‐binding motifs required for meiosis‐specific mRNA ‐0.9436 0.0301 splicing; required for chromosome pairing and meiotic recombination MRPL49 YJL096W Mitochondrial ribosomal protein of the large subunit ‐0.9428 0.0288 AVT6 YER119C Vacuolar aspartate and glutamate exporter; member of a family of ‐0.9385 0.0408 seven genes (AVT1‐7) related to vesicular GABA‐glycine transporters; involved in compartmentalizing acidic amino acids in response to nitrogen starvation DOG2 YHR043C 2‐deoxyglucose‐6‐phosphate phosphatase, member of a family of ‐0.9243 0.0205 low molecular weight phosphatases, similar to Dog1p, induced by oxidative and osmotic stress, confers 2‐deoxyglucose resistance when overexpressed AGE2 YIL044C ADP‐ribosylation factor (ARF) GTPase activating protein (GAP) ‐0.9228 0.0366 effector, involved in Trans‐Golgi‐Network (TGN) transport; contains C2C2H2 cysteine/histidine motif YHC3 YJL059W Vacuolar membrane protein involved in the ATP‐dependent ‐0.8925 0.0293 transport of arginine into the vacuole and possibly in balancing ion homeostasis; homolog of human CLN3 involved in Batten disease (juvenile onset neuronal ceroid lipofuscinosis) NA YOL162W Putative protein of unknown function; member of the Dal5p ‐0.8915 0.0205 subfamily of the major facilitator family MET10 YFR030W Subunit alpha of assimilatory sulfite reductase, which converts ‐0.8869 0.0301 sulfite into sulfide MET22 YOL064C Bisphosphate‐3'‐nucleotidase, involved in salt tolerance and ‐0.8845 0.0215 methionine biogenesis; dephosphorylates 3'‐phosphoadenosine‐5'‐ phosphate and 3'‐phosphoadenosine‐5'‐phosphosulfate, intermediates of the sulfate assimilation pathway NSE4 YDL105W Nuclear protein that plays a role in the function of the Smc5p‐ ‐0.8792 0.0205 Rhc18p complex HUL4 YJR036C Protein with similarity to hect domain E3 ubiquitin‐protein ligases, ‐0.8737 0.0293 not essential for viability IRC24 YIR036C Putative benzil reductase;(GFP)‐fusion protein localizes to the ‐0.8731 0.0301 cytoplasm and is induced by the DNA‐damaging agent MMS; sequence similarity with short‐chain dehydrogenase/reductases; null mutant has increased spontaneous Rad52p foci NA YGR204C‐A Putative protein of unknown function; identified by gene‐trapping, ‐0.8700 0.0288 microarray‐based expression analysis, and genome‐wide homology searching GSY1 YFR015C Glycogen synthase with similarity to Gsy2p, the more highly ‐0.8694 0.0252 expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary phase MSW1 YDR268W Mitochondrial tryptophanyl‐tRNA synthetase ‐0.8661 0.0288 BUR6 YER159C Subunit of a heterodimeric NC2 transcription regulator complex ‐0.8641 0.0207 with Ncb2p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2alpha NA YOR238W Putative protein of unknown function; green fluorescent protein ‐0.8601 0.0171 124

log2 (mtr10[P Symbols ORF Description f/NP.f]/ adj.p.val WT[Pf/N P.f]) (GFP)‐fusion protein localizes to the cytoplasm MET17 YLR303W Methionine and cysteine synthase (O‐acetyl homoserine‐O‐acetyl ‐0.8522 0.0205 serine sulfhydrylase), required for sulfur amino acid synthesis ECM11 YDR446W Non‐essential protein apparently involved in meiosis, GFP fusion ‐0.8511 0.0293 protein is present in discrete clusters in the nucleus throughout mitosis; may be involved in maintaining chromatin structure PHO80 YOL001W Cyclin, interacts with cyclin‐dependent kinase Pho85p; regulates the ‐0.8458 0.0439 response to nutrient levels and environmental conditions, including the response to phosphate limitation and stress‐dependent calcium signaling FMN1 YDR236C Riboflavin kinase, phosphorylates riboflavin to form riboflavin ‐0.8445 0.0281 monophosphate (FMN), which is a necessary cofactor for many enzymes; localizes to microsomes and to the mitochondrial inner membrane CIR2 YOR356W Putative ortholog of human electron transfer flavoprotein ‐0.8429 0.0216 dehydrogenase (ETF‐dH); found in a large supramolecular complex with other mitochondrial dehydrogenases; may have a role in oxidative stress response HOR2 YER062C One of two redundant DL‐glycerol‐3‐phosphatases (RHR2/GPP1 ‐0.8370 0.0248 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition MET5 YJR137C Sulfite reductase beta subunit, involved in amino acid biosynthesis, ‐0.8342 0.0295 transcription repressed by methionine PIG1 YLR273C Putative targeting subunit for the type‐1 protein phosphatase Glc7p ‐0.8249 0.0248 that tethers it to the Gsy2p glycogen synthase NA YFR017C Putative protein of unknown function; green fluorescent protein ‐0.8211 0.0416 (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS; YFR017C is not an essential gene RRF1 YHR038W Mitochondrial ribosome recycling factor, essential for mitochondrial ‐0.8157 0.0366 protein synthesis and for the maintenance of the respiratory function of mitochondria RDL2 YOR286W Protein with rhodanese activity; contains a rhodanese‐like domain ‐0.8092 0.0354 similar to Rdl1p, Uba4p, Tum1p, and Ych1p; overexpression causes a cell cycle delay; null mutant displays elevated frequency of mitochondrial genome loss BNA3 YJL060W Kynurenine aminotransferase, catalyzes formation of kynurenic acid ‐0.8022 0.0301 from kynurenine; potential Cdc28p substrate XYL2 YLR070C Xylitol dehydrogenase, converts xylitol to D‐xylulose; expression ‐0.7997 0.0437 induced by xylose, even though this pentose sugar is not well utilized by S. cerevisiae; null mutant has cell wall defect NA YDL218W Putative protein of unknown function; YDL218W transcription is ‐0.7966 0.0366 regulated by Azf1p and induced by starvation and aerobic conditions; expression also induced in cells treated with the mycotoxin patulin CWC15 YDR163W Non‐essential protein involved in pre‐mRNA splicing, component of ‐0.7961 0.0301 a complex containing Cef1p; has similarity to S. pombe Cwf15p PAU18 YLL064C Protein of unknown function, member of the seripauperin ‐0.7936 0.0408 multigene family encoded mainly in subtelomeric regions; identical to Pau6p LYS5 YGL154C Phosphopantetheinyl transferase involved in lysine biosynthesis; ‐0.7917 0.0293 converts inactive apo‐form of Lys2p (alpha‐aminoadipate reductase) into catalytically active holo‐form by posttranslational addition of phosphopantetheine

125

log2 (mtr10[P Symbols ORF Description f/NP.f]/ adj.p.val WT[Pf/N P.f]) HBN1 YCL026C‐B Putative protein of unknown function; similar to bacterial ‐0.7903 0.0454 nitroreductases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; protein becomes insoluble upon intracellular iron depletion APQ12 YIL040W Protein required for nuclear envelope morphology, nuclear pore ‐0.7753 0.0293 complex localization, mRNA export from the nucleus; exhibits synthetic lethal genetic interactions with genes involved in lipid metabolism OSH6 YKR003W Member of an oxysterol‐binding protein family with overlapping, ‐0.7748 0.0301 redundant functions in sterol metabolism and which collectively perform a function essential for viability; GFP‐fusion protein localizes to the cell periphery NA YGL117W Putative protein of unknown function ‐0.7739 0.0256 MSK1 YNL073W Mitochondrial lysine‐tRNA synthetase, required for import of both ‐0.7704 0.0301 aminoacylated and deacylated forms of tRNA(Lys) into mitochondria and for aminoacylation of mitochondrially encoded tRNA(Lys) YSW1 YBR148W Protein required for normal prospore membrane formation; ‐0.7665 0.0301 interacts with Gip1p, which is the meiosis‐specific regulatory subunit of the Glc7p protein phosphatase; expressed specifically in spores and localizes to the prospore membrane RSM18 YER050C Mitochondrial ribosomal protein of the small subunit, has similarity ‐0.7607 0.0478 to E. coli S18 ribosomal protein ODC2 YOR222W Mitochondrial inner membrane transporter, exports 2‐oxoadipate ‐0.7406 0.0293 and 2‐oxoglutarate from the mitochondrial matrix to the cytosol for use in lysine and glutamate biosynthesis and in lysine catabolism PYK2 YOR347C Pyruvate kinase that appears to be modulated by phosphorylation; ‐0.7392 0.0408 PYK2 transcription is repressed by glucose, and Pyk2p may be active under low glycolytic flux MGT1 YDL200C DNA repair methyltransferase (6‐O‐methylguanine‐DNA methylase) ‐0.7329 0.0301 involved in protection against DNA alkylation damage NA YGL185C Putative protein with sequence similarity to hydroxyacid ‐0.7248 0.0400 dehydrogenases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm SHC1 YER096W Sporulation‐specific activator of Chs3p (chitin synthase III), required ‐0.7160 0.0365 for the synthesis of the chitosan layer of ascospores; has similarity to Skt5p, which activates Chs3p during vegetative growth; transcriptionally induced at alkaline pH MAM33 YIL070C Acidic protein of the mitochondrial matrix involved in oxidative ‐0.7148 0.0301 phosphorylation; related to the human complement receptor gC1q‐ R RTR2 YDR066C Protein of unknown function with high similarity to Rtr1p; exhibits ‐0.6954 0.0437 genetic interactions with Rtr1p; green fluorescent protein (GFP)‐ fusion protein localizes to the cytoplasm; YDR066C is not an essential gene AIM45 YPR004C Putative ortholog of mammalian electron transfer flavoprotein ‐0.6932 0.0293 complex subunit ETF‐alpha; interacts with frataxin, Yfh1p; null mutant displays elevated frequency of mitochondrial genome loss; may have a role in oxidative stress response SAM37 YMR060C Component of the Sorting and Assembly Machinery (SAM or TOB ‐0.6908 0.0478 complex) of the mitochondrial outer membrane, which binds precursors of beta‐barrel proteins and facilitates their outer membrane insertion; contributes to SAM complex stability VPS30 YPL120W Subunit of phosphatidylinositol (PtdIns) 3‐kinase complexes I and II; ‐0.6876 0.0293 Complex I is essential in autophagy and Complex II is required for vacuolar protein sorting; ortholog of the higher eukaryotic gene Beclin 1 126

log2 (mtr10[P Symbols ORF Description f/NP.f]/ adj.p.val WT[Pf/N P.f]) NA YLR031W Putative protein of unknown function ‐0.6863 0.0326 YSC84 YHR016C Actin‐binding protein involved in bundling of actin filaments and ‐0.6811 0.0324 endocytosis of actin cortical patches; activity stimulated by Las17p; contains SH3 domain similar to Rvs167p BDH1 YAL060W NAD‐dependent (R,R)‐butanediol dehydrogenase, catalyzes ‐0.6753 0.0431 oxidation of (R,R)‐2,3‐butanediol to (3R)‐acetoin, oxidation of meso‐ butanediol to (3S)‐acetoin, and reduction of acetoin; enhances use of 2,3‐butanediol as an aerobic carbon source IME1 YJR094C Master regulator of meiosis that is active only during meiotic events, ‐0.6740 0.0431 activates transcription of early meiotic genes through interaction with Ume6p, degraded by the 26S proteasome following phosphorylation by Ime2p JEN1 YKL217W Lactate transporter, required for uptake of lactate and pyruvate; ‐0.6735 0.0449 phosphorylated; expression is derepressed by transcriptional activator Cat8p during respiratory growth, and repressed in the presence of glucose, fructose, and mannose NA YDR248C Putative protein of unknown function; sequence similarity to ‐0.6716 0.0416 bacterial and human gluconokinase; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; upregulated by deletion of the RNAP‐II associated factor, PAF1 LEU4 YNL104C Alpha‐isopropylmalate synthase (2‐isopropylmalate synthase); the ‐0.6661 0.0330 main isozyme responsible for the first step in the leucine biosynthesis pathway CLD1 YGR110W Mitochondrial cardiolipin‐specific phospholipase; functions ‐0.6656 0.0482 upstream of Taz1p to generate monolyso‐cardiolipin; transcription increases upon genotoxic stress; involved in restricting Ty1 transposition; has homology to mammalian CGI‐58 RSB1 YOR049C Suppressor of sphingoid long chain base (LCB) sensitivity of an LCB‐ ‐0.6587 0.0454 lyase mutation; putative integral membrane transporter or flippase that may transport LCBs from the cytoplasmic side toward the extracytoplasmic side of the membrane TMT1 YER175C Trans‐aconitate methyltransferase, cytosolic enzyme that catalyzes ‐0.6578 0.0358 the methyl esterification of 3‐isopropylmalate, an intermediate of the leucine biosynthetic pathway, and trans‐aconitate, which inhibits the citric acid cycle COQ4 YDR204W Protein with a role in ubiquinone (Coenzyme Q) biosynthesis, ‐0.6484 0.0416 possibly functioning in stabilization of Coq7p; located on the matrix face of the mitochondrial inner membrane; component of a mitochondrial ubiquinone‐synthesizing complex SPS19 YNL202W Peroxisomal 2,4‐dienoyl‐CoA reductase, auxiliary enzyme of fatty ‐0.6481 0.0425 acid beta‐oxidation; homodimeric enzyme required for growth and sporulation on petroselineate medium; expression induced during late sporulation and in the presence of oleate NA YDR336W Putative protein of unknown function; sumoylated under stress ‐0.6439 0.0301 conditions in a genome wide study; YDR336W is not an essential gene TUM1 YOR251C Rhodanese domain sulfur transferase, accepts persulfite from Nfs1p ‐0.6330 0.0366 and transfers it to Uba4p in the pathway for 2‐thiolation of the wobble uridine base of tRNAs; also stimulates sulfur transfer by Nfs1p; may be mitochondrially localized NA YHR112C Putative protein of unknown function; green fluorescent protein ‐0.6309 0.0416 (GFP)‐fusion protein localizes to the cytoplasm AIM20 YIL158W Putative protein of unknown function; overexpression causes a cell ‐0.6267 0.0408 cycle delay or arrest; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole; null mutant displays elevated frequency of mitochondrial genome loss 127

log2 (mtr10[P Symbols ORF Description f/NP.f]/ adj.p.val WT[Pf/N P.f]) SWD3 YBR175W Essential subunit of the COMPASS (Set1C) complex, which ‐0.6238 0.0366 methylates histone H3 on lysine 4 and is required in transcriptional silencing near telomeres; WD40 beta propeller superfamily member and ortholog of mammalian WDR5 SNX41 YDR425W Sorting nexin, involved in the retrieval of late‐Golgi SNAREs from the ‐0.6154 0.0393 post‐Golgi endosome to the trans‐Golgi network; interacts with Snx4p STB2 YMR053C Protein that interacts with Sin3p in a two‐hybrid assay and is part of ‐0.6085 0.0419 a large protein complex with Sin3p and Stb1p NA YMR315W Protein with NADP(H) oxidoreductase activity; transcription is ‐0.6063 0.0424 regulated by Stb5p in response to NADPH depletion induced by diamide; promoter contains a putative Stb5p binding site DCG1 YIR030C Protein of unknown function, expression is sensitive to nitrogen ‐0.6057 0.0449 catabolite repression and regulated by Dal80p; contains transmembrane domain ARG5,6 YER069W Protein that is processed in the mitochondrion to yield ‐0.5991 0.0424 acetylglutamate kinase and N‐acetyl‐gamma‐glutamyl‐phosphate reductase, which catalyze the 2nd and 3rd steps in arginine biosynthesis; enzymes form a complex with Arg2p HAP3 YBL021C Subunit of the heme‐activated, glucose‐repressed Hap2p/3p/4p/5p ‐0.5909 0.0459 CCAAT‐binding complex, a transcriptional activator and global regulator of respiratory gene expression; contains sequences contributing to both complex assembly and DNA binding YCT1 YLL055W High‐affinity cysteine‐specific transporter with similarity to the ‐0.5853 0.0400 Dal5p family of transporters; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YCT1 is not an essential gene NA YLR352W Putative protein of unknown function with similarity to F‐box ‐0.5850 0.0493 proteins; interacts with Skp1p and Cdc53p; YLR352W is not an essential gene NA YNL193W Putative protein of unknown function; exhibits a two‐hybrid ‐0.5735 0.0493 interaction with Yhr151cp in a large‐scale analysis MET13 YGL125W Major isozyme of methylenetetrahydrofolate reductase, catalyzes ‐0.5689 0.0459 the reduction of 5,10‐methylenetetrahydrofolate to 5‐ methyltetrahydrofolate in the methionine biosynthesis pathway ARG1 YOL058W Arginosuccinate synthetase, catalyzes the formation of L‐ ‐0.5550 0.0493 argininosuccinate from citrulline and L‐aspartate in the arginine biosynthesis pathway; potential Cdc28p substrate TNA1 YGR260W High affinity nicotinic acid plasma membrane permease, responsible ‐0.5346 0.0460 for uptake of low levels of nicotinic acid; expression of the gene increases in the absence of extracellular nicotinic acid or para‐ aminobenzoate (PABA)

128

APPENDIX C: Transcripts with increased translation activity index in fed mtr10Δ cells

Transcripts with increased P/NP ratio in fed mtr10Δ cells.

log2 (mtr10[Pf/N adj.p.v Symbols ORF Description P.f]/WT[Pf/ al NP.f]) AFFX‐ NA NA 2.9412 0.0267 18srRnac_a t AFFX‐r2‐Sc‐ NA NA 2.9310 0.0454 18SrRNA‐ 3_at NA YHL012W Putative protein of unknown function, has some homology to 1.6485 0.0171 Ugp1p, which encodes UDP‐glucose pyrophosphorylase NA YBR238C Mitochondrial membrane protein with similarity to Rmd9p; not 1.3591 0.0403 required for respiratory growth but causes a synthetic respiratory defect in combination with rmd9 mutations; transcriptionally up‐ regulated by TOR; deletion increases life span YAP7 YOL028C Putative basic leucine zipper (bZIP) transcription factor 1.2656 0.0276 KAP123 YER110C Karyopherin beta, mediates nuclear import of ribosomal proteins 1.2417 0.0293 prior to assembly into ribosomes and import of histones H3 and H4; localizes to the nuclear pore, nucleus, and cytoplasm; exhibits genetic interactions with RAI1 KAP95 YLR347C Karyopherin beta, forms a complex with Srp1p/Kap60p; interacts 1.2363 0.0346 with nucleoporins to mediate nuclear import of NLS‐containing cargo proteins via the nuclear pore complex; regulates PC biosynthesis; GDP‐to‐GTP exchange factor for Gsp1p ACC1 YNR016C Acetyl‐CoA carboxylase, biotin containing enzyme that catalyzes 1.2323 0.0171 the carboxylation of acetyl‐CoA to form malonyl‐CoA; required for de novo biosynthesis of long‐chain fatty acids

129

log2 (mtr10[Pf/N adj.p.v Symbols ORF Description P.f]/WT[Pf/ al NP.f]) SSA3 YBL075C ATPase involved in protein folding and the response to stress; plays 1.1830 0.0431 a role in SRP‐dependent cotranslational protein‐membrane targeting and translocation; member of the heat shock protein 70 (HSP70) family; localized to the cytoplasm CDC34 YDR054C Ubiquitin‐conjugating enzyme (E2) and catalytic subunit of SCF 1.1211 0.0293 ubiquitin‐protein ligase complex (together with Skp1p, Rbx1p, Cdc53p, and an F‐box protein) that regulates cell cycle progression by targeting key substrates for degradation RNR1 YER070W Major isoform of the large subunit of ribonucleotide‐diphosphate 1.1207 0.0205 reductase; the RNR complex catalyzes rate‐limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits AFFX‐r2‐Sc‐ NA NA 1.1078 0.0302 SRB4‐5_at NA YMR230W‐ Putative protein of unknown function 1.0989 0.0171 A NUP192 YJL039C Essential structural subunit of the nuclear pore complex (NPC), 1.0915 0.0319 localizes to the nuclear periphery of nuclear pores, homologous to human p205 DRS2 YAL026C Aminophospholipid translocase (flippase) that maintains 1.0772 0.0416 membrane lipid asymmetry in post‐Golgi secretory vesicles; contributes to clathrin‐coated vesicle formation and endocytosis; mutations in human homolog ATP8B1 result in liver disease TIF4632 YGL049C Translation initiation factor eIF4G, subunit of the mRNA cap‐ 1.0711 0.0293 binding protein complex (eIF4F) that also contains eIF4E (Cdc33p); associates with the poly(A)‐binding protein Pab1p, also interacts with eIF4A (Tif1p); homologous to Tif4631p GSC2 YGR032W Catalytic subunit of 1,3‐beta‐glucan synthase, involved in 1.0557 0.0496 formation of the inner layer of the spore wall; activity positively regulated by Rho1p and negatively by Smk1p; has similarity to an alternate catalytic subunit, Fks1p (Gsc1p) MPT5 YGL178W Member of the Puf family of RNA‐binding proteins; binds to mRNAs 1.0514 0.0301 encoding chromatin modifiers and spindle pole body components; involved in longevity, maintenance of cell wall integrity, and sensitivity to and recovery from pheromone arrest NA YNL247W Cysteinyl‐tRNA synthetase; may interact with ribosomes, based on 1.0468 0.0293 co‐purification experiments SRP40 YKR092C Nucleolar, serine‐rich protein with a role in preribosome assembly 1.0348 0.0288 or transport; may function as a chaperone of small nucleolar ribonucleoprotein particles (snoRNPs); immunologically and structurally to rat Nopp140 CDC60 YPL160W Cytosolic leucyl tRNA synthetase, ligates leucine to the appropriate 1.0205 0.0301 tRNA CHC1 YGL206C Clathrin heavy chain, subunit of the major coat protein involved in 1.0150 0.0403 intracellular protein transport and endocytosis; two heavy chains form the clathrin triskelion structural component; the light chain (CLC1) is thought to regulate function RPB2 YOR151C RNA polymerase II second largest subunit B150, part of central 1.0088 0.0301 core; similar to bacterial beta subunit

130

log2 (mtr10[Pf/N adj.p.v Symbols ORF Description P.f]/WT[Pf/ al NP.f]) TCB3 YML072C Lipid‐binding protein, localized to the bud via specific mRNA 1.0075 0.0416 transport; non‐tagged protein detected in a phosphorylated state in mitochondria; GFP‐fusion protein localizes to the cell periphery; C‐termini of Tcb1p, Tcb2p and Tcb3p interact NA YGR054W Eukaryotic initiation factor (eIF) 2A; associates specifically with 0.9970 0.0326 both 40S subunits and 80 S ribosomes, and interacts genetically with both eIF5b and eIF4E; homologous to mammalian eIF2A PMA1 YGL008C Plasma membrane H+‐ATPase, pumps protons out of the cell; 0.9908 0.0377 major regulator of cytoplasmic pH and plasma membrane potential; part of the P2 subgroup of cation‐transporting ATPases; Hsp30p plays a role in Pma1p regulation SFC1 YJR095W Mitochondrial succinate‐fumarate transporter, transports 0.9668 0.0293 succinate into and fumarate out of the mitochondrion; required for ethanol and acetate utilization DED1 YOR204W ATP‐dependent DEAD (Asp‐Glu‐Ala‐Asp)‐box RNA helicase, 0.9665 0.0410 required for translation initiation of all yeast mRNAs; mutations in human DEAD‐box DBY are a frequent cause of male infertility NA YBR056W‐A Dubious open reading frame unlikely to encode a protein, based on 0.9631 0.0330 available experimental and comparative sequence data; partially overlaps the dubious ORF YBR056C‐B NA YHR210C Putative protein of unknown function; non‐essential gene; highly 0.9419 0.0171 expressed under anaeorbic conditions; sequence similarity to aldose 1‐epimerases such as GAL10 COS7 YDL248W Protein of unknown function, member of the DUP380 subfamily of 0.9406 0.0459 conserved, often subtelomerically‐encoded proteins; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies PIR3 YKL163W O‐glycosylated covalently‐bound cell wall protein required for cell 0.9395 0.0248 wall stability; expression is cell cycle regulated, peaking in M/G1 and also subject to regulation by the cell integrity pathway JLP1 YLL057C Fe(II)‐dependent sulfonate/alpha‐ketoglutarate dioxygenase, 0.9375 0.0205 involved in sulfonate catabolism for use as a sulfur source; contains sequence that resembles a J domain (typified by the E. coli DnaJ protein); induced by sulphur starvation FAA4 YMR246W Long chain fatty acyl‐CoA synthetase, activates imported fatty acids 0.9120 0.0459 with a preference for C12:0‐C16:0 chain lengths; functions in long chain fatty acid import; important for survival during stationary phase; localized to lipid particles NOT3 YIL038C Subunit of the CCR4‐NOT complex, which is a global transcriptional 0.9069 0.0366 regulator with roles in transcription initiation and elongation and in mRNA degradation CRM1 YGR218W Major karyopherin, involved in export of proteins, RNAs, and 0.8817 0.0464 ribosomal subunits from the nucleus; exportin NA YBL095W Putative protein of unknown function; the authentic, non‐tagged 0.8798 0.0295 protein is detected in highly purified mitochondria in high‐ throughput studies FLC3 YGL139W Putative FAD transporter, similar to Flc1p and Flc2p; localized to 0.8766 0.0215 the ER TRA1 YHR099W Subunit of SAGA and NuA4 histone acetyltransferase complexes; 0.8766 0.0488 interacts with acidic activators (e.g., Gal4p) which leads to transcription activation; similar to human TRRAP, which is a cofactor for c‐Myc mediated oncogenic transformation

131

log2 (mtr10[Pf/N adj.p.v Symbols ORF Description P.f]/WT[Pf/ al NP.f]) NUM1 YDR150W Protein required for nuclear migration, localizes to the mother cell 0.8647 0.0454 cortex and the bud tip; may mediate interactions of dynein and cytoplasmic microtubules with the cell cortex NA YBR196C‐B Putative protein of unknown function; identified by expression 0.8608 0.0293 profiling and mass spectrometry AAD6 YFL056C Putative aryl‐alcohol dehydrogenase with similarity to P. 0.8545 0.0312 chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin DCP2 YNL118C Catalytic subunit of the Dcp1p‐Dcp2p decapping enzyme complex, 0.8334 0.0459 which removes the 5' cap structure from mRNAs prior to their degradation; member of the Nudix hydrolase family PRP16 YKR086W RNA helicase in the DEAH‐box family involved in the second 0.8202 0.0308 catalytic step of splicing, exhibits ATP‐dependent RNA unwinding activity NA YMR102C Protein of unknown function; transcription is activated by 0.8193 0.0408 paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance; mutant shows increased resistance to azoles; YMR102C is not an essential gene PDH1 YPR002W Mitochondrial protein that participates in respiration, induced by 0.8185 0.0426 diauxic shift; homologous to E. coli PrpD, may take part in the conversion of 2‐methylcitrate to 2‐methylisocitrate AFFX‐ NA NA 0.8087 0.0288 YER022w5_ at MCM7 YBR202W Component of the hexameric MCM complex, which is important 0.8077 0.0366 for priming origins of DNA replication in G1 and becomes an active ATP‐dependent helicase that promotes DNA melting and elongation when activated by Cdc7p‐Dbf4p in S‐phase SAC1 YKL212W Phosphatidylinositol phosphate (PtdInsP) phosphatase involved in 0.8050 0.0291 hydrolysis of PtdIns[4]P; transmembrane protein localizes to ER and Golgi; involved in protein trafficking and processing, secretion, and cell wall maintenance VIP1 YLR410W Inositol hexakisphosphate (IP6) and inositol heptakisphosphate 0.7931 0.0366 (IP7) kinase; IP7 production is important for phosphate signaling; involved in cortical actin cytoskeleton function, and invasive pseudohyphal growth analogous to S. pombe asp1 IRC7 YFR055W Putative cystathionine beta‐lyase; involved in copper ion 0.7880 0.0437 homeostasis and sulfur metabolism; null mutant displays increased levels of spontaneous Rad52p foci; expression induced by nitrogen limitation in a GLN3, GAT1‐dependent manner IRR1 YIL026C Subunit of the cohesin complex, which is required for sister 0.7801 0.0288 chromatid cohesion during mitosis and meiosis and interacts with centromeres and chromosome arms, essential for viability

RTS1 YOR014W B‐type regulatory subunit of protein phosphatase 2A (PP2A); 0.7654 0.0301 homolog of the mammalian B' subunit of PP2A MCM1 YMR043W Transcription factor involved in cell‐type‐specific transcription and 0.7526 0.0488 pheromone response; plays a central role in the formation of both repressor and activator complexes RPN2 YIL075C Subunit of the 26S proteasome, substrate of the N‐ 0.7460 0.0349 acetyltransferase Nat1p

132

log2 (mtr10[Pf/N adj.p.v Symbols ORF Description P.f]/WT[Pf/ al NP.f]) SMI1 YGR229C Protein involved in the regulation of cell wall synthesis; proposed 0.7433 0.0301 to be involved in coordinating cell cycle progression with cell wall integrity DIA1 YMR316W Protein of unknown function, involved in invasive and 0.7421 0.0454 pseudohyphal growth; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern GFA1 YKL104C Glutamine‐fructose‐6‐phosphate amidotransferase, catalyzes the 0.7396 0.0254 formation of glucosamine‐6‐P and glutamate from fructose‐6‐P and glutamine in the first step of chitin biosynthesis

TCB1 YOR086C Lipid‐binding protein containing three calcium and lipid binding 0.7338 0.0293 domains; non‐tagged protein localizes to mitochondria and GFP‐ fusion protein localizes to the cell periphery; C‐termini of Tcb1p, Tcb2p and Tcb3p interact UFD2 YDL190C Ubiquitin chain assembly factor (E4) that cooperates with a 0.7338 0.0293 ubiquitin‐activating enzyme (E1), a ubiquitin‐conjugating enzyme (E2), and a ubiquitin protein ligase (E3) to conjugate ubiquitin to substrates; also functions as an E3 NDD1 YOR372C Transcriptional activator essential for nuclear division; localized to 0.7332 0.0252 the nucleus; essential component of the mechanism that activates the expression of a set of late‐S‐phase‐specific genes

SIC1 YLR079W Inhibitor of Cdc28‐Clb kinase complexes that controls G1/S phase 0.7241 0.0459 transition, preventing premature S phase and ensuring genomic integrity; phosphorylation targets Sic1p for SCF(CDC4)‐dependent turnover; functional homolog of mammalian Kip1 SEC27 YGL137W Essential beta'‐coat protein of the COPI coatomer, involved in ER‐ 0.7130 0.0437 to‐Golgi and Golgi‐to‐ER transport; contains WD40 domains that mediate cargo selective interactions; 45% sequence identity to mammalian beta'‐COP SIS2 YKR072C Negative regulatory subunit of protein phosphatase 1 Ppz1p and 0.7129 0.0326 also a subunit of the phosphopantothenoylcysteine decarboxylase (PPCDC; Cab3p, Sis2p, Vhs3p) complex, which catalyzes the third step of coenzyme A biosynthesis RAD51 YER095W Strand exchange protein, forms a helical filament with DNA that 0.7101 0.0301 searches for homology; involved in the recombinational repair of double‐strand breaks in DNA during vegetative growth and meiosis; homolog of Dmc1p and bacterial RecA protein LHS1 YKL073W Molecular chaperone of the endoplasmic reticulum lumen, 0.7092 0.0288 involved in polypeptide translocation and folding; nucleotide exchange factor for the ER lumenal Hsp70 chaperone Kar2p; regulated by the unfolded protein response pathway MSN4 YKL062W Transcriptional activator related to Msn2p; activated in stress 0.7027 0.0326 conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression ADE2 YOR128C Phosphoribosylaminoimidazole carboxylase, catalyzes a step in the 0.7018 0.0454 'de novo' purine nucleotide biosynthetic pathway; red pigment accumulates in mutant cells deprived of adenine

133

log2 (mtr10[Pf/N adj.p.v Symbols ORF Description P.f]/WT[Pf/ al NP.f]) STP1 YDR463W Transcription factor, undergoes proteolytic processing by SPS 0.7012 0.0454 (Ssy1p‐Ptr3p‐Ssy5p)‐sensor component Ssy5p in response to extracellular amino acids; activates transcription of amino acid permease genes and may have a role in tRNA processing ACS2 YLR153C Acetyl‐coA synthetase isoform which, along with Acs1p, is the 0.6811 0.0368 nuclear source of acetyl‐coA for histone acetylation; mutants affect global transcription; required for growth on glucose; expressed under anaerobic conditions NUP133 YKR082W Subunit of the Nup84p subcomplex of the nuclear pore complex 0.6787 0.0464 (NPC), localizes to both sides of the NPC, required to establish a normal nucleocytoplasmic concentration gradient of the GTPase Gsp1p MNN5 YJL186W Alpha‐1,2‐mannosyltransferase, responsible for addition of the 0.6765 0.0366 second alpha‐1,2‐linked mannose of the branches on the mannan backbone of oligosaccharides, localizes to an early Golgi compartment PSD2 YGR170W Phosphatidylserine decarboxylase of the Golgi and vacuolar 0.6765 0.0384 membranes, converts phosphatidylserine to phosphatidylethanolamine JJJ2 YJL162C Protein of unknown function, contains a J‐domain, which is a 0.6749 0.0431 region with homology to the E. coli DnaJ protein RIO2 YNL207W Essential serine kinase involved in the processing of the 20S pre‐ 0.6679 0.0408 rRNA into mature 18S rRNA; has similarity to Rio1p MUD1 YBR119W U1 snRNP A protein, homolog of human U1‐A; involved in nuclear 0.6666 0.0301 mRNA splicing CDC20 YGL116W Cell‐cycle regulated activator of anaphase‐promoting 0.6666 0.0301 complex/cyclosome (APC/C), which is required for metaphase/anaphase transition; directs ubiquitination of mitotic cyclins, Pds1p, and other anaphase inhibitors; potential Cdc28p substrate RFC4 YOL094C Subunit of heteropentameric Replication factor C (RF‐C), which is a 0.6648 0.0301 DNA binding protein and ATPase that acts as a clamp loader of the proliferating cell nuclear antigen (PCNA) processivity factor for DNA polymerases delta and epsilon TFA1 YKL028W TFIIE large subunit, involved in recruitment of RNA polymerase II to 0.6596 0.0459 the promoter, activation of TFIIH, and promoter opening

YPT32 YGL210W Rab family GTPase, very similar to Ypt31p; involved in the exocytic 0.6574 0.0301 pathway; mediates intra‐Golgi traffic or the budding of post‐Golgi vesicles from the trans‐Golgi NA YGL140C Putative protein of unknown function; non‐essential gene; contains 0.6567 0.0454 multiple predicted transmembrane domains ARO9 YHR137W Aromatic aminotransferase II, catalyzes the first step of 0.6498 0.0431 tryptophan, phenylalanine, and tyrosine catabolism PFK27 YOL136C 6‐phosphofructo‐2‐kinase, catalyzes synthesis of fructose‐2,6‐ 0.6479 0.0330 bisphosphate; inhibited by phosphoenolpyruvate and sn‐glycerol 3‐ phosphate, expression induced by glucose and sucrose, transcriptional regulation involves protein kinase A TPD3 YAL016W Regulatory subunit A of the heterotrimeric protein phosphatase 2A 0.6442 0.0400 (PP2A), which also contains regulatory subunit Cdc55p and either catalytic subunit Pph21p or Pph22p; required for cell morphogenesis and transcription by RNA polymerase III

134

log2 (mtr10[Pf/N adj.p.v Symbols ORF Description P.f]/WT[Pf/ al NP.f]) REB1 YBR049C RNA polymerase I enhancer binding protein; DNA binding protein 0.6403 0.0431 which binds to genes transcribed by both RNA polymerase I and RNA polymerase II; required for termination of RNA polymerase I transcription SMP1 YBR182C Putative transcription factor involved in regulating the response to 0.6394 0.0485 osmotic stress; member of the MADS‐box family of transcription factors NUP145 YGL092W Essential nucleoporin, catalyzes its own cleavage in vivo to 0.6392 0.0431 generate a C‐terminal fragment that assembles into the Nup84p subcomplex of the nuclear pore complex, and an N‐terminal fragment of unknown function that is homologous to Nup100p KES1 YPL145C Member of the oxysterol binding protein family, which includes 0.6191 0.0478 seven yeast homologs; involved in negative regulation of Sec14p‐ dependent Golgi complex secretory functions, peripheral membrane protein that localizes to the Golgi complex MNN2 YBR015C Alpha‐1,2‐mannosyltransferase, responsible for addition of the first 0.5941 0.0459 alpha‐1,2‐linked mannose to form the branches on the mannan backbone of oligosaccharides, localizes to an early Golgi compartment NA YOL098C Putative metalloprotease 0.5910 0.0459 CDC55 YGL190C Non‐essential regulatory subunit B of protein phosphatase 2A 0.5698 0.0459 (PP2A), which has multiple roles in mitosis and protein biosynthesis; involved in regulation of mitotic exit; found in the nucleus of most cells, also at bud neck and bud tip CDC3 YLR314C Component of the septin ring of the mother‐bud neck that is 0.5571 0.0458 required for cytokinesis; septins recruit proteins to the neck and can act as a barrier to diffusion at the membrane, and they comprise the 10nm filaments seen with EM ARO7 YPR060C Chorismate mutase, catalyzes the conversion of chorismate to 0.5515 0.0454 prephenate to initiate the tyrosine/phenylalanine‐specific branch of aromatic amino acid biosynthesis

135

APPENDIX D: Transcripts with changed translation activity index in mtr10Δ cells in amino acid starvation condition

This section includes the transcripts with decreased P/NP ratio (cutoff condition: log2 FC

0.6 and adjusted p-value 0.05) and the transcripts with increase P/NP ratio (log2

FC 0.6 and adjusted p-value 0.05) in mtr10Δ cells while compared to wild-type cells

in amino acid starvation condition. The affected transcripts are ordered according to log2

(fold-change).

Transcripts with decreased P/NP ratio in amino acid starved mtr10Δ cells.

log2 (mtr10[Ps/ adj.p. Symbols ORF Description NP.s]/WT[ val Ps/NP.s]) AAD14 YNL331C Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium ‐1.9155 0.0302 aryl‐alcohol dehydrogenase; mutational analysis has not yet revealed a physiological role AMS1 YGL156W Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) ‐1.1781 0.0479 degradation; delivered to the vacuole in a novel pathway separate from the secretory pathway CIR2 YOR356W Putative ortholog of human electron transfer flavoprotein ‐1.0468 0.0479 dehydrogenase (ETF‐dH); found in a large supramolecular complex with other mitochondrial dehydrogenases; may have a role in oxidative stress response NSE4 YDL105W Nuclear protein that plays a role in the function of the Smc5p‐Rhc18p ‐1.0143 0.0479 complex FLO9 YAL063C Lectin‐like protein with similarity to Flo1p, thought to be expressed and ‐0.9790 0.0479 involved in flocculation

136

Transcripts with increased P/NP ratio in amino acid starved mtr10Δ cells.

log2 (mtr10[Ps/ adj.P.V symbols ORF Description NP.s]/WT[ al Ps/NP.s]) NA YLR154W‐E Dubious open reading frame unlikely to encode a protein; encoded 2.6224 0.0302 within the the 35S rRNA gene on the opposite strand

NA YHL012W Putative protein of unknown function, has some homology to Ugp1p, 1.8017 0.0479 which encodes UDP‐glucose pyrophosphorylase

137

APPENDIX E: Transcripts with decreased translation activity index in fed msn5Δ cells

The transcripts with decreased P/NP ratio (cutoff condition: log2 FC 0.6 and adjusted p-value 0.05) in msn5Δ cells while compared to wild-type cells in fed condition are listed below and ordered according to log2 (fold-change).

Transcripts with decreased P/NP ratio in fed msn5Δ cells.

log2 (msn5[Pf/ adj.p. Symbols ORF Description NP.f]/WT[ val Pf/NP.f]) STR3 YGL184C Peroxisomal cystathionine beta‐lyase, converts cystathionine into ‐2.6447 0.0099 homocysteine; may be redox regulated by Gto1p MSN5 YDR335W Karyopherin involved in nuclear import and export of proteins, ‐2.5962 0.0205 including import of replication protein A and export of Swi6p, Far1p, and Pho4p; required for re‐export of mature tRNAs after their retrograde import from the cytoplasm SUL1 YBR294W High affinity sulfate permease; sulfate uptake is mediated by specific ‐2.4354 0.0239 sulfate transporters Sul1p and Sul2p, which control the concentration of endogenous activated sulfate intermediates SEO1 YAL067C Putative permease, member of the allantoate transporter subfamily of ‐1.8658 0.0099 the major facilitator superfamily; mutation confers resistance to ethionine sulfoxide ARG3 YJL088W Ornithine carbamoyltransferase (carbamoylphosphate:L‐ornithine ‐1.6423 0.0246 carbamoyltransferase), catalyzes the sixth step in the biosynthesis of the arginine precursor ornithine MMP1 YLL061W High‐affinity S‐methylmethionine permease, required for utilization of ‐1.5790 0.0099 S‐methylmethionine as a sulfur source; has similarity to S‐ adenosylmethionine permease Sam3p MET3 YJR010W ATP sulfurylase, catalyzes the primary step of intracellular sulfate ‐1.4117 0.0246 activation, essential for assimilatory reduction of sulfate to sulfide, involved in methionine metabolism MHT1 YLL062C S‐methylmethionine‐homocysteine methyltransferase, functions along ‐1.3841 0.0239 with Sam4p in the conversion of S‐adenosylmethionine (AdoMet) to methionine to control the methionine/AdoMet ratio

138

PRM1 YNL279W Pheromone‐regulated multispanning membrane protein involved in ‐1.0819 0.0291 membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p

139

APPENDIX F: Summary tables of functional catalogue analysis for affected transcripts in mtr10Δ cells in fed or amino acid starvation conditions

This section includes four summary results of functional catalogue (FunCat) analysis of transcriptionally differentially expressed genes (cutoff conditions: log2 FC 0.6 or log2

FC 0.6 and adjusted p-value < 0.001) in mtr10Δ cells in fed or amino acid starvation conditions. The FunCat analysis was executed in the website: http://mips.helmholtz- muenchen.de/proj/funcatDB/ (Ruepp et al., 2004)

Table F. 1. FunCat analysis of down-regulated transcripts in mtr10Δ cells in fed condition. numbers FUNCTIONAL CATALOGUE of gene p-value matches METABOLISM 65 0.003177 lipid, fatty acid and isoprenoid metabolism 22 8.86E‐05 membrane lipid metabolism 8 0.004182 phospholipid metabolism 7 0.005404 modification with fatty acids (e.g. myristylation, palmitylation, farnesylation) 4 0.019417 thiamine pyrophosphate binding 1 0.031648 transported compounds (substrates) 32 0.001356 ion transport 11 0.007357 cation transport (H+, Na+, K+, Ca2+ , NH4+, etc.) 8 0.038983 heavy metal ion transport (Cu+, Fe3+, etc.) 6 0.006192 siderophore‐iron transport 3 0.005559 lipid/fatty acid transport 6 0.002408 nucleotide/nucleoside/nucleobase transport 4 0.003164 140 continued.

Table F. 1. continued. numbers FUNCTIONAL CATALOGUE of gene p-value matches vitamine/cofactor transport 3 0.008779 drug/toxin transport 8 2.31E‐05 transport facilities 13 0.008971 transport ATPases 5 0.027214 ABC transporters 7 1.92E‐05

Table F. 2. FunCat analysis of up-regulated transcripts in mtr10Δ cells in fed condition. numbers FUNCTIONAL CATALOGUE of gene p-value matches metabolism of lysine 4 0.009055 biosynthesis of lysine 4 0.001352 aminoadipic acid pathway 4 0.000847 degradation of lysine 2 0.026075 metabolism of phenylalanine 4 0.011347 nitrogen, sulfur and selenium metabolism 11 0.014891 nitrogen metabolism 3 0.00464 catabolism of nitrogenous compounds 3 0.00464 purin nucleotide/nucleoside/nucleobase metabolism 10 0.00141 purine nucleotide /nucleoside/nucleobase catabolism 2 0.00841 purine nucleotide/nucleoside/nucleobase anabolism 5 0.018126 electron transport and membrane‐associated energy conservation 7 0.044798 aerobic respiration 10 0.00799 fermentation 6 0.039273 lactate fermentation 2 0.01622 DNA repair 17 0.005148 mRNA processing (splicing, 5'‐, 3'‐end processing) 16 0.0429 modification by ubiquitin‐related proteins 4 0.024079 transmembrane signal transduction 7 0.007529 detoxification involving cytochrome P450 2 0.01622 chemoperception and response 20 0.034217 pheromone response, mating‐type determination, sex‐specific proteins 17 0.025928 CELL TYPE DIFFERENTIATION 35 0.018017 fungal/microorganismic cell type differentiation 35 0.018017 fungal and other eukaryotic cell type differentiation 35 0.018017 development of asco‐ basidio‐ or zygospore 21 0.000228 UNCLASSIFIED PROTEINS 81 0.236462

141

Table F. 3. FunCat analysis of down-regulated transcripts in mtr10Δ cells in amino acid starved condition. numbers FUNCTIONAL CATALOGUE of gene p-value matches METABOLISM 167 0.0013 phosphate metabolism 49 0.032306 C‐compound and carbohydrate metabolism 58 0.030207 sugar, glucoside, polyol and carboxylate anabolism 7 0.034247 polysaccharide metabolism 12 0.0124 glycogen metabolism 4 0.000307 glycogen anabolism 4 0.000307 lipid, fatty acid and isoprenoid metabolism 47 3.05E‐05 catabolism of vitamins, cofactors, and prosthetic groups 2 0.022994 metabolism of secondary products derived from primary amino acids 5 0.02366 metabolism of nonprotein amino acids 4 0.008902 metabolism of energy reserves (e.g. glycogen, trehalose) 10 0.026663 oxidation of fatty acids 3 0.040793 transcription activation 8 0.031922 modification with sugar residues (e.g. glycosylation, deglycosylation) 65 0.043824 CELLULAR TRANSPORT, TRANSPORT FACILITIES AND TRANSPORT ROUTES 11 0.001018 transported compounds (substrates) 121 4.71E‐07 ion transport 88 5.08E‐05 cation transport (H+, Na+, K+, Ca2+ , NH4+, etc.) 29 0.001191 heavy metal ion transport (Cu+, Fe3+, etc.) 22 4.41E‐05 siderophore‐iron transport 15 0.000305 C‐compound and carbohydrate transport 6 0.009692 amino acid/amino acid derivatives transport 12 2.45E‐05 amine / polyamine transport 14 0.024365 lipid/fatty acid transport 4 0.001436 nucleotide/nucleoside/nucleobase transport 11 0.0002 allantoin and allantoate transport 8 0.029111 vitamine/cofactor transport 3 0.031735 drug/toxin transport 4 5.87E‐07 transport facilities 15 2.17E‐08 channel / pore class transport 43 0.04027 carrier (electrochemical potential‐driven transport) 4 0.018793 symporter 5 0.043248 proton driven symporter 2 0.022994 ABC transporters 2 2.25E‐09 peroxisomal transport 15 0.02366 MAPKKK cascade 5 0.030374 osmotic and salt stress response 6 0.036928 disease, virulence and defense 10 0.034247 resistance proteins 7 0.025432 chemical agent resistance 7 0.012719 detoxification 7 0.001624 INTERACTION WITH THE ENVIRONMENT 21 0.000276 continued 142

Table. F.3. continued. numbers FUNCTIONAL CATALOGUE of gene p-value matches homeostasis 64 0.001681 homeostasis of cations 29 0.002586 homeostasis of metal ions (Na, K, Ca etc.) 26 0.000386 UNCLASSIFIED PROTEINS 20 0.208561

Table F. 4. FunCat analysis of up-regulated transcripts in mtr10Δ cells in amino acid starved condition. numbers FUNCTIONAL CATALOGUE of gene p-value matches degradation of arginine 2 0.026315 CELL CYCLE AND DNA PROCESSING 140 1.88E‐06 DNA processing 73 0.000536 DNA synthesis and replication 20 0.042889 DNA recombination and DNA repair 36 0.010629 DNA repair 29 0.000556 DNA restriction or modification 28 0.027059 DNA conformation modification (e.g. chromatin) 26 0.036794 cell cycle 91 0.000135 mitotic cell cycle and cell cycle control 60 0.004847 mitotic cell cycle 25 0.01546 M phase 10 0.022457 meiosis 25 0.011516 nuclear and chromosomal cycle 24 0.000119 chromosome condensation 6 0.01559 chromosome segregation/division 13 0.003567 nuclear division 4 0.016547 cell cycle dependent cytoskeleton reorganization 12 0.001971 spindle pole body/centrosome and microtubule cycle 9 0.017142 cell cycle dependent actin filament reorganization 3 0.023532 mRNA processing (splicing, 5'‐, 3'‐end processing) 30 0.003396 splicing 25 0.001982 PROTEIN FATE (folding, modification, destination) 145 0.000223 protein folding and stabilization 27 9.87E‐08 modification by ubiquitin‐related proteins 6 0.012322 cytoplasmic and nuclear protein degradation 29 0.007476 proteasomal degradation (ubiquitin/proteasomal pathway) 23 0.002473 PROTEIN WITH BINDING FUNCTION OR COFACTOR REQUIREMENT (structural or catalytic) 137 5.55E‐05 protein binding 67 1.66E‐06 amino acid/amino acid derivatives binding 2 0.026315 143 continued.

Table. F. 4. continued. numbers FUNCTIONAL CATALOGUE of gene p-value matches magnesium binding 2 0.049269 protease activator 2 0.009375 nuclear transport 14 0.032722 unfolded protein response (e.g. ER quality control) 15 0.002077 cellular sensing and response to external stimulus 37 0.03647 chemoperception and response 34 0.014459 pheromone response, mating‐type determination, sex‐specific proteins 26 0.0412 BIOGENESIS OF CELLULAR COMPONENTS 102 0.014298 cytoskeleton/structural proteins 37 0.006243 microtubule cytoskeleton 11 0.004383 UNCLASSIFIED PROTEINS 139 0.356087

144

APPENDIX G: Down-regulated genes in mtr10Δ cells in fed condition

This section includes the list of transcriptionally differentially expressed genes (cutoff

conditions: log2 FC 0.6 and adjusted p-value < 0.001) in mtr10Δ cells in fed

condition.

Down-regulated genes in mtr10Δ cells in fed condition

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) MTR10 YOR160W Nuclear import receptor, mediates the nuclear localization of ‐7.0599 0.0000 proteins involved in mRNA‐nucleus export; promotes dissociation of mRNAs from the nucleus‐cytoplasm mRNA shuttling protein Npl3p; required for retrograde import of mature tRNAs QDR2 YIL121W Multidrug transporter of the major facilitator superfamily, required ‐4.0758 0.0000 for resistance to quinidine, barban, cisplatin, and bleomycin; may have a role in potassium uptake FCY21 YER060W Putative purine‐cytosine permease, very similar to Fcy2p but cannot ‐3.1458 0.0000 substitute for its function BDH2 YAL061W Putative medium‐chain alcohol dehydrogenase with similarity to ‐2.7008 0.0001 BDH1; transcription induced by constitutively active PDR1 and PDR3

PNS1 YOR161C Protein of unknown function; has similarity to Torpedo californica ‐2.4530 0.0000 tCTL1p, which is postulated to be a choline transporter, neither null mutation nor overexpression affects choline transport NA NA NA ‐2.1966 0.0002 NA NA NA ‐1.9974 0.0001 FIT3 YOR383C Mannoprotein that is incorporated into the cell wall via a ‐1.9076 0.0003 glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall RGS2 YOR107W Negative regulator of glucose‐induced cAMP signaling; directly ‐1.8591 0.0000 activates the GTPase activity of the heterotrimeric G protein alpha subunit Gpa2p GTO3 YMR251W Omega class glutathione transferase; putative cytosolic localization ‐1.8261 0.0005 TPO4 YOR273C Polyamine transport protein, recognizes spermine, putrescine, and ‐1.7975 0.0000 spermidine; localizes to the plasma membrane; member of the major facilitator superfamily

145

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) HOR2 YER062C One of two redundant DL‐glycerol‐3‐phosphatases (RHR2/GPP1 ‐1.6977 0.0002 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition HOP1 YIL072W Meiosis‐specific DNA binding protein that displays Red1p dependent ‐1.6539 0.0007 localization to the unsynapsed axial‐lateral elements of the synaptonemal complex; required for homologous chromosome synapsis and chiasma formation ICS2 YBR157C Protein of unknown function; null mutation does not confer any ‐1.6524 0.0002 obvious defects in growth, spore germination, viability, or carbohydrate utilization ARN2 YHL047C Transporter, member of the ARN family of transporters that ‐1.6499 0.0006 specifically recognize siderophore‐iron chelates; responsible for uptake of iron bound to the siderophore triacetylfusarinine C FMP48 YGR052W Putative protein of unknown function; the authentic, non‐tagged ‐1.6387 0.0004 protein is detected in highly purified mitochondria in high‐ throughput studies; induced by treatment with 8‐methoxypsoralen and UVA irradiation FIT2 YOR382W Mannoprotein that is incorporated into the cell wall via a ‐1.6293 0.0009 glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall RSB1 YOR049C Suppressor of sphingoid long chain base (LCB) sensitivity of an LCB‐ ‐1.5722 0.0003 lyase mutation; putative integral membrane transporter or flippase that may transport LCBs from the cytoplasmic side toward the extracytoplasmic side of the membrane ERC1 YHR032W Member of the multi‐drug and toxin extrusion (MATE) family of the ‐1.5321 0.0002 multidrug/oligosaccharidyl‐lipid/polysaccharide (MOP) exporter superfamily; overproduction confers ethionine resistance and accumulation of S‐adenosylmethionine NA YCR061W Protein of unknown function; green fluorescent protein (GFP)‐fusion ‐1.5255 0.0003 protein localizes to the cytoplasm in a punctate pattern; induced by treatment with 8‐methoxypsoralen and UVA irradiation

SAP4 YGL229C Protein required for function of the Sit4p protein phosphatase, ‐1.5182 0.0001 member of a family of similar proteins that form complexes with Sit4p, including Sap155p, Sap185p, and Sap190p SFK1 YKL051W Plasma membrane protein that may act together with or upstream ‐1.5072 0.0000 of Stt4p to generate normal levels of the essential phospholipid PI4P, at least partially mediates proper localization of Stt4p to the plasma membrane NA YHR022C Putative protein of unknown function; YHR022C is not an essential ‐1.4996 0.0001 gene THO1 YER063W Conserved nuclear RNA‐binding protein; specifically binds to ‐1.4748 0.0001 transcribed chromatin in a THO‐ and RNA‐dependent manner, genetically interacts with shuttling hnRNP NAB2; overproduction suppresses transcriptional defect caused by hpr1 mutation ARN1 YHL040C Transporter, member of the ARN family of transporters that ‐1.4686 0.0002 specifically recognize siderophore‐iron chelates; responsible for uptake of iron bound to ferrirubin, ferrirhodin, and related siderophores NA YHR140W Putative integral membrane protein of unknown function ‐1.4314 0.0002 TYE7 YOR344C Serine‐rich protein that contains a basic‐helix‐loop‐helix (bHLH) DNA ‐1.4233 0.0003 binding motif; binds E‐boxes of glycolytic genes and contributes to their activation; may function as a transcriptional activator in Ty1‐ mediated gene expression

146

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) NA YOR152C Putative protein of unknown function; has no similarity to any ‐1.4142 0.0001 known protein; YOR152C is not an essential gene TDH1 YJL052W Glyceraldehyde‐3‐phosphate dehydrogenase, isozyme 1, involved in ‐1.3912 0.0003 glycolysis and gluconeogenesis; tetramer that catalyzes the reaction of glyceraldehyde‐3‐phosphate to 1,3 bis‐phosphoglycerate; detected in the cytoplasm and cell wall YRO2 YBR054W Putative protein of unknown function; the authentic, non‐tagged ‐1.3897 0.0004 protein is detected in a phosphorylated state in highly purified mitochondria in high‐throughput studies; transcriptionally regulated by Haa1p PRY1 YJL079C Protein of unknown function ‐1.3703 0.0000 PDR3 YBL005W Transcriptional activator of the pleiotropic drug resistance network, ‐1.3401 0.0002 regulates expression of ATP‐binding cassette (ABC) transporters through binding to cis‐acting sites known as PDREs (PDR responsive elements) NA NA NA ‐1.3381 0.0003 RPS14B YJL191W Ribosomal protein 59 of the small subunit, required for ribosome ‐1.3157 0.0002 assembly and 20S pre‐rRNA processing; mutations confer cryptopleurine resistance; nearly identical to Rps14Ap and similar to E. coli S11 and rat S14 ribosomal proteins TIR1 YER011W Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐ ‐1.3027 0.0001 rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking PGM2 YMR105C Phosphoglucomutase, catalyzes the conversion from glucose‐1‐ ‐1.3001 0.0004 phosphate to glucose‐6‐phosphate, which is a key step in hexose metabolism; functions as the acceptor for a Glc‐phosphotransferase NA YAR066W Putative GPI protein ‐1.2845 0.0002 DSE1 YER124C Daughter cell‐specific protein, may regulate cross‐talk between the ‐1.2744 0.0006 mating and filamentation pathways; deletion affects cell separation after division and sensitivity to alpha‐factor and drugs affecting the cell wall AAR2 YBL074C Component of the U5 snRNP, required for splicing of U3 precursors; ‐1.2717 0.0002 originally described as a splicing factor specifically required for splicing pre‐mRNA of the MATa1 cistron NA NA NA ‐1.2710 0.0003 IRC15 YPL017C Microtubule associated protein; regulates microtubule dynamics; ‐1.2560 0.0004 required for accurate meiotic chromosome segregation; null mutant displays large budded cells due to delayed mitotic progression, increased levels of spontaneous Rad52 foci NA YLR126C Putative protein of unknown function with similarity to glutamine ‐1.2482 0.0004 amidotransferase proteins; has Aft1p‐binding motif in the promoter; may be involved in copper and iron homeostasis; YLR126C is not an essential protein ENO1 YGR254W Enolase I, a phosphopyruvate hydratase that catalyzes the ‐1.2413 0.0002 conversion of 2‐phosphoglycerate to phosphoenolpyruvate during glycolysis and the reverse reaction during gluconeogenesis; expression is repressed in response to glucose ENB1 YOL158C Endosomal ferric enterobactin transporter, expressed under ‐1.2397 0.0004 conditions of iron deprivation; member of the major facilitator superfamily; expression is regulated by Rcs1p and affected by chloroquine treatment FCY22 YER060W‐ Putative purine‐cytosine permease, very similar to Fcy2p but cannot ‐1.2287 0.0006 A substitute for its function

147

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) SPS19 YNL202W Peroxisomal 2,4‐dienoyl‐CoA reductase, auxiliary enzyme of fatty ‐1.2265 0.0004 acid beta‐oxidation; homodimeric enzyme required for growth and sporulation on petroselineate medium; expression induced during late sporulation and in the presence of oleate SHE4 YOR035C Protein containing a UCS (UNC‐45/CRO1/SHE4) domain, binds to ‐1.2201 0.0001 myosin motor domains to regulate myosin function; involved in endocytosis, polarization of the actin cytoskeleton, and asymmetric mRNA localization VMR1 YHL035C Vacuolar membrane protein involved in multiple drug resistance and ‐1.2097 0.0001 metal sensitivity; ATP‐binding cassette (ABC) family member involved in drug transport; potential Cdc28p substrate; induced under respiratory conditions TPK1 YJL164C cAMP‐dependent protein kinase catalytic subunit; promotes ‐1.1856 0.0004 vegetative growth in response to nutrients via the Ras‐cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p PDR5 YOR153W Plasma membrane ATP‐binding cassette (ABC) transporter, ‐1.1815 0.0002 multidrug transporter actively regulated by Pdr1p; also involved in steroid transport, cation resistance, and cellular detoxification during exponential growth PLB2 YMR006C Phospholipase B (lysophospholipase) involved in phospholipid ‐1.1746 0.0003 metabolism; displays transacylase activity in vitro; overproduction confers resistance to lysophosphatidylcholine KRE5 YOR336W Protein required for beta‐1,6 glucan biosynthesis; mutations result in ‐1.1615 0.0001 aberrant morphology and severe growth defects

RPS28B YLR264W Protein component of the small (40S) ribosomal subunit; nearly ‐1.1388 0.0004 identical to Rps28Ap and has similarity to rat S28 ribosomal protein SMF1 YOL122C Divalent metal ion transporter with a broad specificity for di‐valent ‐1.1302 0.0003 and tri‐valent metals; post‐translationally regulated by levels of metal ions; member of the Nramp family of metal transport proteins PDR15 YDR406W Plasma membrane ATP binding cassette (ABC) transporter, ‐1.1257 0.0002 multidrug transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element NA YPR172W Protein of unknown function, transcriptionally activated by Yrm1p ‐1.1220 0.0004 along with genes involved in multidrug resistance SKN1 YGR143W Protein involved in sphingolipid biosynthesis; type II membrane ‐1.1034 0.0003 protein with similarity to Kre6p MDS3 YGL197W Putative component of the TOR regulatory pathway; negative ‐1.0982 0.0010 regulator of early meiotic gene expression; required, with Pmd1p, for growth under alkaline conditions; has an N‐terminal kelch‐like domain COA4 YLR218C Twin Cx(9)C protein involved in cytochrome c oxidase assembly or ‐1.0981 0.0001 stability; localizes to the mitochondrial intermembrane space via the Mia40p‐Erv1p system; interacts genetically with CYC1 and with cytochrome c oxidase assembly factors URA1 YKL216W Dihydroorotate dehydrogenase, catalyzes the fourth enzymatic step ‐1.0842 0.0005 in the de novo biosynthesis of pyrimidines, converting dihydroorotic acid into orotic acid ULA1 YPL003W Protein that acts together with Uba3p to activate Rub1p before its ‐1.0828 0.0007 conjugation to proteins (neddylation), which may play a role in protein degradation

148

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) NA YMR102C Protein of unknown function; transcription is activated by ‐1.0802 0.0002 paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance; mutant shows increased resistance to azoles; YMR102C is not an essential gene NA YNL040W Putative protein of unknown function with strong similarity to ‐1.0736 0.0004 alanyl‐tRNA synthases from Eubacteria; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; YNL040W is not an essential gene RPL18B YNL301C Protein component of the large (60S) ribosomal subunit, identical to ‐1.0700 0.0009 Rpl18Ap and has similarity to rat L18 ribosomal protein YPC1 YBR183W Alkaline ceramidase that also has reverse (CoA‐independent) ‐1.0673 0.0003 ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance PXA1 YPL147W Subunit of a heterodimeric peroxisomal ATP‐binding cassette ‐1.0534 0.0005 transporter complex (Pxa1p‐Pxa2p), required for import of long‐ chain fatty acids into peroxisomes; similarity to human adrenoleukodystrophy transporter and ALD‐related proteins GPD1 YDL022W NAD‐dependent glycerol‐3‐phosphate dehydrogenase, key enzyme ‐1.0485 0.0008 of glycerol synthesis, essential for growth under osmotic stress; expression regulated by high‐osmolarity glycerol response pathway; homolog of Gpd2p NA YHR131C Putative protein of unknown function; green fluorescent protein ‐1.0441 0.0005 (GFP)‐fusion protein localizes to the cytoplasm; overexpression causes a cell cycle delay or arrest TCA17 YEL048C Protein that interacts with subunits of the TRAPP complex and may ‐1.0432 0.0006 play a role its assembly or stability; mutation is synthetically lethal with gcs1 deletion; Sedlin_N family member; human Sedlin mutations cause the skeletal disorder SEDT NA YBL029W Non‐essential protein of unknown function ‐1.0329 0.0004 NA YHL044W Putative integral membrane protein, member of DUP240 gene ‐1.0264 0.0007 family; green fluorescent protein (GFP)‐fusion protein localizes to the plasma membrane in a punctate pattern COX11 YPL132W Mitochondrial inner membrane protein required for delivery of ‐1.0067 0.0003 copper to the Cox1p subunit of cytochrome c oxidase; association with mitochondrial ribosomes suggests that copper delivery may occur during translation of Cox1p NPP1 YCR026C Nucleotide pyrophosphatase/phosphodiesterase family member; ‐1.0040 0.0007 mediates extracellular nucleotide phosphate hydrolysis along with Npp2p and Pho5p; activity and expression enhanced during conditions of phosphate starvation PPT2 YPL148C Phosphopantetheine:protein transferase (PPTase), activates ‐0.9971 0.0002 mitochondrial acyl carrier protein (Acp1p) by phosphopantetheinylation PET111 YMR257C Mitochondrial translational activator specific for the COX2 mRNA; ‐0.9938 0.0003 located in the mitochondrial inner membrane FAA3 YIL009W Long chain fatty acyl‐CoA synthetase, activates imported fatty acids; ‐0.9862 0.0002 green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery PCI8 YIL071C Possible shared subunit of Cop9 signalosome (CSN) and eIF3, binds ‐0.9855 0.0006 eIF3b subunit Prt1p, has possible dual functions in transcriptional and translational control, contains a PCI (Proteasome‐COP9 signalosome (CSN)‐eIF3) domain SCW11 YGL028C Cell wall protein with similarity to glucanases; may play a role in ‐0.9825 0.0003 conjugation during mating based on its regulation by Ste12p

149

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) RDS2 YPL133C Transcription factor involved in regulating gluconeogenesis and ‐0.9706 0.0004 glyoxylate cycle genes; member of the zinc cluster family of proteins; confers resistance to ketoconazole NA YNL234W Protein of unknown function with similarity to globins; has a ‐0.9686 0.0010 functional heme‐binding domain; mutant has aneuploidy tolerance; transcription induced by stress conditions; may be involved in glucose signaling or metabolism; regulated by Rgt1 NA YIL151C Putative protein of unknown function, predicted to contain a PINc ‐0.9617 0.0005 domain AIM41 YOR215C Putative protein of unknown function; the authentic protein is ‐0.9591 0.0005 detected in highly purified mitochondria in high‐throughput studies; null mutant displays reduced frequency of mitochondrial genome loss PCL6 YER059W Pho85p cyclin of the Pho80p subfamily; forms the major Glc8p ‐0.9587 0.0004 kinase together with Pcl7p and Pho85p; involved in the control of glycogen storage by Pho85p; stabilized by Elongin C binding

YPK9 YOR291W Vacuolar protein with a possible role in sequestering heavy metals; ‐0.9567 0.0002 has similarity to the type V P‐type ATPase Spf1p; homolog of human ATP13A2 (PARK9), mutations in which are associated with Parkinson disease and Kufor‐Rakeb syndrome NA YGR122W Probable ortholog of A. nidulans PalC, which is involved in pH ‐0.9528 0.0004 regulation and binds to the ESCRT‐III complex; null mutant does not properly process Rim101p and has decreased resistance to rapamycin; GFP‐fusion protein is cytoplasmic BNA5 YLR231C Kynureninase, required for the de novo biosynthesis of NAD from ‐0.9440 0.0005 tryptophan via kynurenine; expression regulated by Hst1p MNN1 YER001W Alpha‐1,3‐mannosyltransferase, integral membrane glycoprotein of ‐0.9379 0.0004 the Golgi complex, required for addition of alpha1,3‐mannose linkages to N‐linked and O‐linked oligosaccharides, one of five S. cerevisiae proteins of the MNN1 family VPS62 YGR141W Vacuolar protein sorting (VPS) protein required for cytoplasm to ‐0.9327 0.0005 vacuole targeting of proteins CMC4 YMR194C‐ Protein that localizes to the mitochondrial intermembrane space via ‐0.9317 0.0008 B the Mia40p‐Erv1p system; contains twin cysteine‐x(9)‐cysteine motifs CMK1 YFR014C Calmodulin‐dependent protein kinase; may play a role in stress ‐0.9263 0.0004 response, many CA++/calmodulan dependent phosphorylation substrates demonstrated in vitro, amino acid sequence similar to Cmk2p and mammalian Cam Kinase II RRN10 YBL025W Protein involved in promoting high level transcription of rDNA, ‐0.9259 0.0003 subunit of UAF (upstream activation factor) for RNA polymerase I MRF1 YGL143C Mitochondrial translation release factor, involved in stop codon ‐0.9250 0.0003 recognition and hydrolysis of the peptidyl‐tRNA bond during mitochondrial translation; lack of MRF1 causes mitochondrial genome instability NA YOR292C Putative protein of unknown function; green fluorescent protein ‐0.9242 0.0002 (GFP)‐fusion protein localizes to the vacuole; YOR292C is not an essential gene NA YPR147C Putative protein of unknown function; green fluorescent protein ‐0.9219 0.0002 (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS

150

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) NA YBL095W Putative protein of unknown function; the authentic, non‐tagged ‐0.9141 0.0002 protein is detected in highly purified mitochondria in high‐ throughput studies COX10 YPL172C Heme A:farnesyltransferase, catalyzes the first step in the ‐0.9025 0.0005 conversion of protoheme to the heme A prosthetic group required for cytochrome c oxidase activity; human ortholog is associated with mitochondrial disorders LAG1 YHL003C Ceramide synthase component, involved in synthesis of ceramide ‐0.9025 0.0005 from C26(acyl)‐coenzyme A and dihydrosphingosine or phytosphingosine, functionally equivalent to Lac1p PSY2 YNL201C Putative subunit of an evolutionarily conserved protein phosphatase ‐0.9007 0.0003 complex containing the catalytic subunit Pph3p and the regulatory subunit Psy4p; required for cisplatin and oxaliplatin resistance; putative homolog of mammalian R3 CPS1 YJL172W Vacuolar carboxypeptidase yscS; expression is induced under low‐ ‐0.8991 0.0010 nitrogen conditions NA YLR137W Putative S‐adenosylmethionine‐dependent methyltransferase ‐0.8976 0.0002 DCR2 YLR361C Phosphoesterase involved in downregulation of the unfolded protein ‐0.8970 0.0009 response, at least in part via dephosphorylation of Ire1p; dosage‐ dependent positive regulator of the G1/S phase transition through control of the timing of START CKI1 YLR133W Choline kinase, catalyzing the first step in phosphatidylcholine ‐0.8898 0.0004 synthesis via the CDP‐choline (Kennedy pathway); exhibits some ethanolamine kinase activity contributing to phosphatidylethanolamine synthesis via the CDP‐ethanolamine pathway NA YHL012W Putative protein of unknown function, has some homology to ‐0.8837 0.0004 Ugp1p, which encodes UDP‐glucose pyrophosphorylase NA YJR030C Putative protein of unknown function; expression repressed in ‐0.8808 0.0003 carbon limited vs carbon replete chemostat cultures; YJR030C is a non‐essential gene RTT105 YER104W Protein with a role in regulation of Ty1 transposition ‐0.8801 0.0009 YGK3 YOL128C Protein kinase related to mammalian glycogen synthase kinases of ‐0.8783 0.0007 the GSK‐3 family; GSK‐3 homologs (Mck1p, Rim11p, Mrk1p, Ygk3p) are involved in control of Msn2p‐dependent transcription of stress responsive genes and in protein degradation NA YMR262W Protein of unknown function; interacts weakly with Knr4p; ‐0.8782 0.0005 YMR262W is not an essential gene AIM22 YJL046W Putative lipoate‐protein ligase, required along with Lip2 and Lip5 for ‐0.8759 0.0003 lipoylation of Lat1p and Kgd2p; similar to E. coli LplA; null mutant displays reduced frequency of mitochondrial genome loss NA YLR031W Putative protein of unknown function ‐0.8722 0.0004 AFT2 YPL202C Iron‐regulated transcriptional activator; activates genes involved in ‐0.8697 0.0002 intracellular iron use and required for iron homeostasis and resistance to oxidative stress; similar to Aft1p ARI1 YGL157W NADPH‐dependent aldehyde reductase, utilizes aromatic and ‐0.8694 0.0003 alophatic aldehyde substrates; member of the short‐chain dehydrogenase/reductase superfamily SPI1 YER150W GPI‐anchored cell wall protein involved in weak acid resistance; ‐0.8671 0.0006 basal expression requires Msn2p/Msn4p; expression is induced under conditions of stress and during the diauxic shift; similar to Sed1p SMF3 YLR034C Putative divalent metal ion transporter involved in iron homeostasis; ‐0.8656 0.0005 transcriptionally regulated by metal ions; member of the Nramp family of metal transport proteins NA YPR013C Putative zinc finger protein; YPR013C is not an essential gene ‐0.8648 0.0002 151

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) YOR1 YGR281W Plasma membrane ATP‐binding cassette (ABC) transporter, ‐0.8613 0.0002 multidrug transporter mediates export of many different organic anions including oligomycin; similar to human cystic fibrosis transmembrane receptor (CFTR) NA YER130C Protein of unknown function; transcription is regulated by Haa1p, ‐0.8566 0.0004 Sok2p and Zap1p transcriptional activators; the C. Albicans homolog (MNL1) plays a role in adaptation to stress ELO1 YJL196C Elongase I, medium‐chain acyl elongase, catalyzes carboxy‐terminal ‐0.8537 0.0002 elongation of unsaturated C12‐C16 fatty acyl‐CoAs to C16‐C18 fatty acids MSF1 YPR047W Mitochondrial phenylalanyl‐tRNA synthetase, active as a monomer, ‐0.8411 0.0003 unlike the cytoplasmic subunit which is active as a dimer complexed to a beta subunit dimer; similar to the alpha subunit of E. coli phenylalanyl‐tRNA synthetase TRZ1 YKR079C tRNA 3'‐end processing endonuclease tRNase Z; also localized to ‐0.8386 0.0004 mitochondria and interacts genetically with Rex2 exonuclease; homolog of the human candidate prostate cancer susceptibility gene ELAC2 NA YKR070W Putative protein of unknown function; the authentic, non‐tagged ‐0.8352 0.0009 protein is detected in highly purified mitochondria in high‐ throughput studies SPT14 YPL175W UDP‐GlcNAc‐binding and catalytic subunit of the enzyme that ‐0.8336 0.0005 mediates the first step in glycosylphosphatidylinositol (GPI) biosynthesis, mutations cause defects in transcription and in biogenesis of cell wall proteins NA YGL140C Putative protein of unknown function; non‐essential gene; contains ‐0.8322 0.0002 multiple predicted transmembrane domains OCT1 YKL134C Mitochondrial intermediate peptidase, cleaves N‐terminal residues ‐0.8304 0.0005 of a subset of proteins upon import, after their cleavage by mitochondrial processing peptidase (Mas1p‐Mas2p); may contribute to mitochondrial iron homeostasis FLX1 YIL134W Protein required for transport of flavin adenine dinucleotide (FAD), a ‐0.8250 0.0010 synthesis product of riboflavin, across the mitochondrial membrane NMA1 YLR328W Nicotinic acid mononucleotide adenylyltransferase, involved in ‐0.8160 0.0002 pathways of NAD biosynthesis, including the de novo, NAD(+) salvage, and nicotinamide riboside salvage pathways RMR1 YGL250W Protein required for meiotic recombination and gene conversion; ‐0.8142 0.0004 null mutant displays reduced PIS1 expression and growth defects on non‐fermentable carbon sources and minimal media; GFP‐fusion protein localizes to both cytoplasm and nucleus BUR2 YLR226W Cyclin for the Sgv1p (Bur1p) protein kinase; Sgv1p and Bur2p ‐0.8083 0.0002 comprise a CDK‐cyclin complex involved in transcriptional regulation through its phosphorylation of the carboxy‐terminal domain of the largest subunit of RNA polymerase II TOR1 YJR066W PIK‐related protein kinase and rapamycin target; subunit of TORC1, a ‐0.8081 0.0008 complex that controls growth in response to nutrients by regulating translation, transcription, ribosome biogenesis, nutrient transport and autophagy; involved in meiosis RIM15 YFL033C Glucose‐repressible protein kinase involved in signal transduction ‐0.8070 0.0007 during cell proliferation in response to nutrients, specifically the establishment of stationary phase; identified as a regulator of IME2; substrate of Pho80p‐Pho85p kinase RTC4 YNL254C Protein of unknown function; null mutation suppresses cdc13‐1 ‐0.7990 0.0006 temperature sensitivity; (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 152

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) UBR2 YLR024C Cytoplasmic ubiquitin‐protein ligase (E3); required for ubiquitylation ‐0.7978 0.0009 of Rpn4p; mediates formation of a Mub1p‐Ubr2p‐Rad6p complex POL12 YBL035C B subunit of DNA polymerase alpha‐primase complex, required for ‐0.7921 0.0004 initiation of DNA replication during mitotic and premeiotic DNA synthesis; also functions in telomere capping and length regulation RIB4 YOL143C Lumazine synthase (6,7‐dimethyl‐8‐ribityllumazine synthase, also ‐0.7916 0.0002 known as DMRL synthase); catalyzes synthesis of immediate precursor to riboflavin GPI12 YMR281W ER membrane protein involved in the second step of ‐0.7909 0.0009 glycosylphosphatidylinositol (GPI) anchor assembly, the de‐N‐ acetylation of the N‐acetylglucosaminylphosphatidylinositol intermediate; functional homolog of human PIG‐Lp RIM2 YBR192W Mitochondrial pyrimidine nucleotide transporter; imports pyrimidine ‐0.7889 0.0004 nucleoside triphosphates and exports pyrimidine nucleoside monophosphates; member of the mitochondrial carrier family RPL8A YHL033C Ribosomal protein L4 of the large (60S) ribosomal subunit, nearly ‐0.7880 0.0005 identical to Rpl8Bp and has similarity to rat L7a ribosomal protein; mutation results in decreased amounts of free 60S subunits MGA1 YGR249W Protein similar to heat shock transcription factor; multicopy ‐0.7877 0.0008 suppressor of pseudohyphal growth defects of ammonium permease mutants MDM32 YOR147W Mitochondrial inner membrane protein with similarity to Mdm31p, ‐0.7823 0.0006 required for normal mitochondrial morphology and inheritance; interacts genetically with MMM1, MDM10, MDM12, and MDM34 RAD16 YBR114W Protein that recognizes and binds damaged DNA in an ATP‐ ‐0.7820 0.0002 dependent manner (with Rad7p) during nucleotide excision repair; subunit of Nucleotide Excision Repair Factor 4 (NEF4) and the Elongin‐Cullin‐Socs (ECS) ligase complex CAX4 YGR036C Dolichyl pyrophosphate (Dol‐P‐P) phosphatase with a luminally ‐0.7805 0.0004 oriented active site in the ER, cleaves the anhydride linkage in Dol‐P‐ P, required for Dol‐P‐P‐linked oligosaccharide intermediate synthesis and protein N‐glycosylation COS9 YKL219W Protein of unknown function, member of the DUP380 subfamily of ‐0.7794 0.0009 conserved, often subtelomerically‐encoded proteins NA YCR015C Putative protein of unknown function; YCR015C is not an essential ‐0.7785 0.0002 gene MNS1 YJR131W Alpha‐1,2‐mannosidase involved in ER quality control; catalyzes the ‐0.7763 0.0007 removal of one mannose residue from Man9GlcNAc to produce a single isomer of Man8GlcNAc in N‐linked oligosaccharide biosynthesis; integral to ER membrane AKR2 YOR034C Ankyrin repeat‐containing protein similar to Akr1p; member of a ‐0.7750 0.0005 family of putative palmitoyltransferases containing an Asp‐His‐His‐ Cys‐cysteine rich (DHHC‐CRD) domain; possibly involved in constitutive endocytosis of Ste3p TNA1 YGR260W High affinity nicotinic acid plasma membrane permease, responsible ‐0.7745 0.0004 for uptake of low levels of nicotinic acid; expression of the gene increases in the absence of extracellular nicotinic acid or para‐ aminobenzoate (PABA) NA YMR210W Putative acyltransferase with similarity to Eeb1p and Eht1p, has a ‐0.7716 0.0007 minor role in medium‐chain fatty acid ethyl ester biosynthesis; may be involved in lipid metabolism and detoxification YAP5 YIR018W Basic leucine zipper (bZIP) transcription factor ‐0.7633 0.0003 NA YBR220C Putative protein of unknown function; YBR220C is not an essential ‐0.7625 0.0004 gene

153

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) NA YMR010W Putative protein of unknown function; green fluorescent protein ‐0.7545 0.0009 (GFP)‐fusion protein localizes to the cytoplasm; YMR010W is not an essential gene; YMR010W mRNA is transcribed with ADI1 TUF1 YOR187W Mitochondrial translation elongation factor Tu; comprises both ‐0.7500 0.0003 GTPase and guanine nucleotide exchange factor activities, while these activities are found in separate proteins in S. pombe and humans GDT1 YBR187W Putative protein of unknown function; expression is reduced in a ‐0.7455 0.0003 gcr1 null mutant; GFP‐fusion protein localizes to the vacuole; expression pattern and physical interactions suggest a possible role in ribosome biogenesis NA YOR390W Putative protein of unknown function ‐0.7427 0.0004 VPS75 YNL246W NAP family histone chaperone; binds to histones and Rtt109p, ‐0.7414 0.0004 stimulating histone acetyltransferase activity; possesses nucleosome assembly activity in vitro; proposed role in vacuolar protein sorting and in double‐strand break repair AMD1 YML035C AMP deaminase, tetrameric enzyme that catalyzes the deamination ‐0.7304 0.0006 of AMP to form IMP and ammonia; may be involved in regulation of intracellular adenine nucleotide pools MRPS35 YGR165W Mitochondrial ribosomal protein of the small subunit ‐0.7297 0.0009 HEK2 YBL032W RNA binding protein involved in the asymmetric localization of ASH1 ‐0.7296 0.0004 mRNA; represses translation of ASH1 mRNA, an effect reversed by Yck1p‐dependent phosphoryation; regulates telomere position effect and length; similarity to hnRNP‐K ATP2 YJR121W Beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase, ‐0.7208 0.0008 which is a large, evolutionarily conserved enzyme complex required for ATP synthesis; phosphorylated MSG5 YNL053W Dual‐specificity protein phosphatase; exists in 2 isoforms; required ‐0.7194 0.0005 for maintenance of a low level of signaling through the cell integrity pathway, adaptive response to pheromone; regulates and is regulated by Slt2p; dephosphorylates Fus3p ARO4 YBR249C 3‐deoxy‐D‐arabino‐heptulosonate‐7‐phosphate (DAHP) synthase, ‐0.7156 0.0009 catalyzes the first step in aromatic amino acid biosynthesis and is feedback‐inhibited by tyrosine or high concentrations of phenylalanine or tryptophan STE4 YOR212W G protein beta subunit, forms a dimer with Ste18p to activate the ‐0.7112 0.0009 mating signaling pathway, forms a heterotrimer with Gpa1p and Ste18p to dampen signaling; may recruit Rho1p to the polarized growth site during mating; contains WD40 repeats SCS7 YMR272C Sphingolipid alpha‐hydroxylase, functions in the alpha‐hydroxylation ‐0.7091 0.0008 of sphingolipid‐associated very long chain fatty acids, has both cytochrome b5‐like and hydroxylase/desaturase domains, not essential for growth SCS3 YGL126W Protein required for inositol prototrophy, identified as an ortholog of ‐0.7065 0.0009 the FIT family of proteins involved in triglyceride droplet biosynthesis; disputed role in the synthesis of inositol phospholipids from inositol MKK1 YOR231W Mitogen‐activated kinase kinase involved in protein kinase C ‐0.7036 0.0003 signaling pathway that controls cell integrity; upon activation by Bck1p phosphorylates downstream target, Slt2p; functionally redundant with Mkk2p SSY5 YJL156C Serine protease of SPS plasma membrane amino acid sensor system ‐0.7007 0.0008 (Ssy1p‐Ptr3p‐Ssy5p); contains an inhibitory domain that dissociates in response to extracellular amino acids, freeing a catalytic domain to activate transcription factor Stp1p

154

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) VBA1 YMR088C Permease of basic amino acids in the vacuolar membrane ‐0.6986 0.0009 MNP1 YGL068W Protein associated with the mitochondrial nucleoid; putative ‐0.6984 0.0003 mitochondrial ribosomal protein with similarity to E. coli L7/L12 ribosomal protein; required for normal respiratory growth LEU5 YHR002W Mitochondrial carrier protein involved in the accumulation of CoA in ‐0.6910 0.0004 the mitochondrial matrix; homolog of human Graves disease protein; does not encode an isozyme of Leu4p, as first hypothesized PET117 YER058W Protein required for assembly of cytochrome c oxidase ‐0.6893 0.0005 COT1 YOR316C Vacuolar transporter that mediates zinc transport into the vacuole; ‐0.6873 0.0009 overexpression confers resistance to cobalt and rhodium BLM10 YFL007W Proteasome activator subunit; found in association with core ‐0.6859 0.0004 particles, with and without the 19S regulatory particle; required for resistance to bleomycin, may be involved in protecting against oxidative damage; similar to mammalian PA200 NA YMR291W Putative kinase of unknown function; green fluorescent protein ‐0.6857 0.0007 (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YMR291W is not an essential gene NA YLR278C Zinc‐cluster protein; GFP‐fusion protein localizes to the nucleus; ‐0.6741 0.0004 mutant shows moderate growth defect on caffeine; has a prion‐ domain like fragment that increases frequency of [URE3]; YLR278C is not an essential gene YLF2 YHL014C Protein of unknown function, has weak similarity to E. coli GTP‐ ‐0.6738 0.0010 binding protein gtp1; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies CIN2 YPL241C GTPase‐activating protein (GAP) for Cin4p; tubulin folding factor C ‐0.6734 0.0007 involved in beta‐tubulin (Tub2p) folding; mutants display increased chromosome loss and benomyl sensitivity; deletion complemented by human GAP, retinitis pigmentosa 2 NA YOL098C Putative metalloprotease ‐0.6659 0.0006 POL2 YNL262W Catalytic subunit of DNA polymerase (II) epsilon, a chromosomal ‐0.6624 0.0009 DNA replication polymerase that exhibits processivity and proofreading exonuclease activity; also involved in DNA synthesis during DNA repair; interacts extensively with Mrc1p SAT4 YCR008W Ser/Thr protein kinase involved in salt tolerance; funtions in ‐0.6603 0.0009 regulation of Trk1p‐Trk2p potassium transporter; partially redundant with Hal5p; has similarity to Npr1p HIR2 YOR038C Subunit of the HIR complex, a nucleosome assembly complex ‐0.6587 0.0009 involved in regulation of histone gene transcription; recruits Swi‐Snf complexes to histone gene promoters; promotes heterochromatic gene silencing with Asf1p CAN1 YEL063C Plasma membrane arginine permease, requires phosphatidyl ‐0.6553 0.0003 ethanolamine (PE) for localization, exclusively associated with lipid rafts; mutation confers canavanine resistance PSD1 YNL169C Phosphatidylserine decarboxylase of the mitochondrial inner ‐0.6495 0.0006 membrane, converts phosphatidylserine to phosphatidylethanolamine DIA4 YHR011W Probable mitochondrial seryl‐tRNA synthetase, mutant displays ‐0.6491 0.0005 increased invasive and pseudohyphal growth KGD1 YIL125W Component of the mitochondrial alpha‐ketoglutarate ‐0.6467 0.0006 dehydrogenase complex, which catalyzes a key step in the tricarboxylic acid (TCA) cycle, the oxidative decarboxylation of alpha‐ ketoglutarate to form succinyl‐CoA MRPL6 YHR147C Mitochondrial ribosomal protein of the large subunit ‐0.6456 0.0008

155

log2(mtr10 Symbols ORF Description adj.p.val .Tf/WT.Tf) POR2 YIL114C Putative mitochondrial porin (voltage‐dependent anion channel), ‐0.6446 0.0004 related to Por1p but not required for mitochondrial membrane permeability or mitochondrial osmotic stability PET127 YOR017W Protein with a role in 5'‐end processing of mitochondrial RNAs, ‐0.6425 0.0007 located in the mitochondrial membrane RPO41 YFL036W Mitochondrial RNA polymerase; single subunit enzyme similar to ‐0.6413 0.0005 those of T3 and T7 bacteriophages; requires a specificity subunit encoded by MTF1 for promoter recognition EGT2 YNL327W Glycosylphosphatidylinositol (GPI)‐anchored cell wall endoglucanase ‐0.6364 0.0005 required for proper cell separation after cytokinesis, expression is activated by Swi5p and tightly regulated in a cell cycle‐dependent manner CDH1 YGL003C Cell‐cycle regulated activator of the anaphase‐promoting ‐0.6317 0.0009 complex/cyclosome (APC/C), which directs ubiquitination of cyclins resulting in mitotic exit; targets the APC/C to specific substrates including Cdc20p, Ase1p, Cin8p and Fin1p PEX32 YBR168W Peroxisomal integral membrane protein, involved in negative ‐0.6298 0.0004 regulation of peroxisome size; partially functionally redundant with Pex31p; genetic interactions suggest action at a step downstream of steps mediated by Pex28p and Pex29p OST6 YML019W Subunit of the oligosaccharyltransferase complex of the ER lumen, ‐0.6281 0.0008 which catalyzes asparagine‐linked glycosylation of newly synthesized proteins; similar to and partially functionally redundant with Ost3p PIR1 YKL164C O‐glycosylated protein required for cell wall stability; attached to the ‐0.6244 0.0006 cell wall via beta‐1,3‐glucan; mediates mitochondrial translocation of Apn1p; expression regulated by the cell integrity pathway and by Swi5p during the cell cycle CDS1 YBR029C Phosphatidate cytidylyltransferase (CDP‐diglyceride synthetase); an ‐0.6241 0.0010 enzyme that catalyzes that conversion of CTP + phosphate into diphosphate + CDP‐diaclglyerol, a critical step in the synthesis of all major yeast phospholipids PEX2 YJL210W RING‐finger peroxin and E3 ubiquitin ligase, peroxisomal membrane ‐0.6189 0.0010 protein with a C‐terminal zinc‐binding RING domain, forms translocation subcomplex with Pex10p and Pex12p which functions in peroxisomal matrix protein import FAA1 YOR317W Long chain fatty acyl‐CoA synthetase, activates imported fatty acids ‐0.6161 0.0006 with a preference for C12:0‐C16:0 chain lengths; functions in long chain fatty acid import; accounts for most acyl‐CoA synthetase activity; localized to lipid particles IGO2 YHR132W‐ Protein required for initiation of G0 program; prevents degradation ‐0.6088 0.0009 A of nutrient‐regulated mRNAs via the 5'‐3' mRNA decay pathway; phosphorylated by Rim15p; GFP protein localizes to the cytoplasm and nucleus; similar to Igo1p NA YKL100C Putative protein of unknown function with similarity to a human ‐0.6087 0.0008 minor histocompatibility antigen and signal peptide peptidases; YKL100C is not an essential gene CFT2 YLR115W Subunit of the mRNA cleavage and polyadenlylation factor (CPF); ‐0.6062 0.0008 required for pre‐mRNA cleavage, polyadenylation and poly(A) site recognition, 43% similarity with the mammalian CPSF‐100 protein. NA YOR093C Putative protein of unknown function; deletion causes sensitivity to ‐0.6029 0.0007 unfolded protein response‐inducing agents

156

APPENDIX H: Up-regulated genes in mtr10Δ cells in fed condition

This section includes the list of transcriptionally differentially expressed genes (cutoff

conditions: log2 FC 0.6 and adjusted p-value < 0.001) in mtr10Δ cells in fed condition.

Up-regulated genes in mtr10Δ cells in fed condition

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l AGA2 YGL032C Adhesion subunit of a‐agglutinin of a‐cells, C‐terminal sequence acts 3.6923 0.0001 as a ligand for alpha‐agglutinin (Sag1p) during agglutination, modified with O‐linked oligomannosyl chains, linked to anchorage subunit Aga1p via two disulfide bonds MFA1 YDR461W Mating pheromone a‐factor, made by a cells; interacts with alpha 3.5838 0.0000 cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C‐terminal modification, N‐terminal proteolysis, and export; also encoded by MFA2 NA YDL114W Putative protein of unknown function with similarity to acyl‐carrier‐ 3.2686 0.0000 protein reductases; YDL114W is not an essential gene MFA2 YNL145W Mating pheromone a‐factor, made by a cells; interacts with alpha 3.2579 0.0001 cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C‐terminal modification, N‐terminal proteolysis, and export; also encoded by MFA1 STL1 YDR536W Glycerol proton symporter of the plasma membrane, subject to 3.2372 0.0000 glucose‐induced inactivation, strongly but transiently induced when cells are subjected to osmotic shock ARO10 YDR380W Phenylpyruvate decarboxylase, catalyzes decarboxylation of 2.9917 0.0004 phenylpyruvate to phenylacetaldehyde, which is the first specific step in the Ehrlich pathway NA YNR062C Putative membrane protein of unknown function 2.9628 0.0000 SRT1 YMR101C Cis‐prenyltransferase involved in synthesis of long‐chain dolichols 2.6672 0.0000 (19‐22 isoprene units; as opposed to Rer2p which synthesizes shorter‐chain dolichols); localizes to lipid bodies; transcription is induced during stationary phase SPG4 YMR107W Protein required for survival at high temperature during stationary 2.6514 0.0002 phase; not required for growth on nonfermentable carbon sources NA YDR374C Putative protein of unknown function 2.5782 0.0000

157

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l ANS1 YHR126C Putative protein of unknown function; transcription dependent upon 2.4575 0.0002 Azf1p ARO9 YHR137W Aromatic aminotransferase II, catalyzes the first step of tryptophan, 2.3991 0.0002 phenylalanine, and tyrosine catabolism SPR3 YGR059W Sporulation‐specific homolog of the yeast CDC3/10/11/12 family of 2.3575 0.0001 bud neck microfilament genes; septin protein involved in sporulation; regulated by ABFI NA YDR034W‐B Predicted tail‐anchored plasma membrane protein containing a 2.2665 0.0000 conserved CYSTM module; related proteins in other organisms may be involved in response to stress; green fluorescent protein (GFP)‐ fusion protein localizes to the cell periphery CDA1 YLR307W Chitin deacetylase, together with Cda2p involved in the biosynthesis 2.2479 0.0001 ascospore wall component, chitosan; required for proper rigidity of the ascospore wall RNP1 YLL046C Ribonucleoprotein that contains two RNA recognition motifs (RRM) 2.1298 0.0002 NA YNR064C Epoxide hydrolase, member of the alpha/beta hydrolase fold family; 2.1183 0.0000 may have a role in detoxification of epoxides CSN9 YDR179C Subunit of the Cop9 signalosome, which is required for 2.1149 0.0001 deneddylation, or removal of the ubiquitin‐like protein Rub1p from Cdc53p (cullin); involved in adaptation to pheromone signaling

ECM8 YBR076W Non‐essential protein of unknown function 2.0530 0.0001 BOP2 YLR267W Protein of unknown function 2.0185 0.0001 FMP16 YDR070C Putative protein of unknown function; proposed to be involved in 1.9711 0.0007 responding to conditions of stress; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐ throughput studies DAL80 YKR034W Negative regulator of genes in multiple nitrogen degradation 1.9184 0.0002 pathways; expression is regulated by nitrogen levels and by Gln3p; member of the GATA‐binding family, forms homodimers and heterodimers with Deh1p NA YBR056W‐A Dubious open reading frame unlikely to encode a protein, based on 1.8641 0.0002 available experimental and comparative sequence data; partially overlaps the dubious ORF YBR056C‐B

DIT1 YDR403W Sporulation‐specific enzyme required for spore wall maturation, 1.7701 0.0002 involved in the production of a soluble LL‐dityrosine‐containing precursor of the spore wall; transcripts accumulate at the time of prospore enclosure NA YDR042C Putative protein of unknown function; expression is increased in 1.7677 0.0000 ssu72‐ts69 mutant NA YFR012W‐A Putative protein of unknown function; identified by homology 1.7649 0.0001 PES4 YFR023W Poly(A) binding protein, suppressor of DNA polymerase epsilon 1.7269 0.0001 mutation, similar to Mip6p PRR2 YDL214C Serine/threonine protein kinase that inhibits pheromone induced 1.7018 0.0000 signalling downstream of MAPK, possibly at the level of the Ste12p transcription factor; mutant has increased aneuploidy tolerance

ZIP1 YDR285W Transverse filament protein of the synaptonemal complex; required 1.7002 0.0001 for normal levels of meiotic recombination and pairing between homologous chromosome during meiosis; potential Cdc28p substrate NA YJR149W Putative protein of unknown function; green fluorescent protein 1.6709 0.0001 (GFP)‐fusion protein localizes to the cytoplasm

158

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l ATO2 YNR002C Putative transmembrane protein involved in export of ammonia, a 1.6697 0.0003 starvation signal that promotes cell death in aging colonies; phosphorylated in mitochondria; member of the TC 9.B.33 YaaH family; homolog of Ady2p and Y. lipolytica Gpr1p JLP1 YLL057C Fe(II)‐dependent sulfonate/alpha‐ketoglutarate dioxygenase, 1.6563 0.0002 involved in sulfonate catabolism for use as a sulfur source; contains sequence that resembles a J domain (typified by the E. coli DnaJ protein); induced by sulphur starvation BNA2 YJR078W Putative tryptophan 2,3‐dioxygenase or indoleamine 2,3‐ 1.6391 0.0003 dioxygenase, required for de novo biosynthesis of NAD from tryptophan via kynurenine; interacts genetically with telomere capping gene CDC13; regulated by Hst1p and Aftp LYS20 YDL182W Homocitrate synthase isozyme, catalyzes the condensation of acetyl‐ 1.6276 0.0002 CoA and alpha‐ketoglutarate to form homocitrate, which is the first step in the lysine biosynthesis pathway; highly similar to the other isozyme, Lys21p MCH2 YKL221W Protein with similarity to mammalian monocarboxylate permeases, 1.6150 0.0005 which are involved in transport of monocarboxylic acids across the plasma membrane; mutant is not deficient in monocarboxylate transport HXT9 YJL219W Putative hexose transporter that is nearly identical to Hxt11p, has 1.6118 0.0004 similarity to major facilitator superfamily (MFS) transporters, expression of HXT9 is regulated by transcription factors Pdr1p and Pdr3p NA YGL015C Putative protein of unknown function; null mutants accumulate 1.6100 0.0001 cargo in the Golgi BAR1 YIL015W Aspartyl protease secreted into the periplasmic space of mating type 1.5974 0.0005 a cells, helps cells find mating partners, cleaves and inactivates alpha factor allowing cells to recover from alpha‐factor‐induced cell cycle arrest PUT1 YLR142W Proline oxidase, nuclear‐encoded mitochondrial protein involved in 1.5578 0.0001 utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source NA YML083C Putative protein of unknown function; strong increase in transcript 1.5547 0.0001 abundance during anaerobic growth compared to aerobic growth; cells deleted for YML083C do not exhibit growth defects in anerobic or anaerobic conditions DON1 YDR273W Meiosis‐specific component of the spindle pole body, part of the 1.5545 0.0001 leading edge protein (LEP) coat, forms a ring‐like structure at the leading edge of the prospore membrane during meiosis II TFB5 YDR079C‐A Component of the RNA polymerase II general transcription and DNA 1.5532 0.0001 repair factor TFIIH; involved in transcription initiation and in nucleotide‐excision repair; homolog of Chlamydomonas reinhardtii REX1‐S protein involved in DNA repair GSC2 YGR032W Catalytic subunit of 1,3‐beta‐glucan synthase, involved in formation 1.5527 0.0001 of the inner layer of the spore wall; activity positively regulated by Rho1p and negatively by Smk1p; has similarity to an alternate catalytic subunit, Fks1p (Gsc1p) LOH1 YJL038C Protein of unknown function with proposed roles in maintenance of 1.5458 0.0002 genome integrity and also in spore wall assembly; induced during sporulation; repressed during vegetative growth by Sum1p and Hst1p; sequence similar to IRC1

159

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l NA YDL186W Putative protein of unknown function; YDL186W is not an essential 1.5209 0.0002 gene GAL3 YDR009W Transcriptional regulator involved in activation of the GAL genes in 1.5134 0.0000 response to galactose; forms a complex with Gal80p to relieve Gal80p inhibition of Gal4p; binds galactose and ATP but does not have galactokinase activity NA YDL177C Putative protein of unknown function; similar to the mouse IMPACT 1.4974 0.0000 gene; YDL177C is not an essential gene UGA4 YDL210W Permease that serves as a gamma‐aminobutyrate (GABA) transport 1.4882 0.0001 protein involved in the utilization of GABA as a nitrogen source; catalyzes the transport of putrescine and delta‐aminolevulinic acid (ALA); localized to the vacuolar membrane JAC1 YGL018C Specialized J‐protein that functions with Hsp70 in Fe‐S cluster 1.4697 0.0000 biogenesis in mitochondria, involved in iron metabolism; contains a J domain typical to J‐type chaperones; localizes to the mitochondrial matrix SMA1 YPL027W Protein of unknown function involved in the assembly of the 1.4625 0.0006 prospore membrane during sporulation; interacts with Spo14p MGT1 YDL200C DNA repair methyltransferase (6‐O‐methylguanine‐DNA methylase) 1.4582 0.0001 involved in protection against DNA alkylation damage DIT2 YDR402C N‐formyltyrosine oxidase, sporulation‐specific microsomal enzyme 1.4464 0.0001 involved in the production of N,N‐bisformyl dityrosine required for spore wall maturation, homologous to cytochrome P‐450s KRE28 YDR532C Subunit of a kinetochore‐microtubule binding complex with Spc105p 1.3761 0.0003 that bridges centromeric heterochromatin and kinetochore MAPs and motors, and is also required for sister chromatid bi‐orientation and kinetochore binding of SAC components DIA3 YDL024C Protein of unknown function, involved in invasive and pseudohyphal 1.3759 0.0002 growth STF1 YDL130W‐A Protein involved in regulation of the mitochondrial F1F0‐ATP 1.3700 0.0001 synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein CWC15 YDR163W Non‐essential protein involved in pre‐mRNA splicing, component of 1.3445 0.0001 a complex containing Cef1p; has similarity to S. pombe Cwf15p IRC18 YJL037W Putative protein of unknown function; expression induced in 1.3377 0.0004 respiratory‐deficient cells and in carbon‐limited chemostat cultures; similar to adjacent ORF, YJL038C; null mutant displays increased levels of spontaneous Rad52p foci PLM2 YDR501W Forkhead Associated domain containing protein and putative 1.3218 0.0001 transcription factor found associated with chromatin; target of SBF transcription factor; induced in response to DNA damaging agents and deletion of telomerase; similar to TOS4 CYB2 YML054C Cytochrome b2 (L‐lactate cytochrome‐c oxidoreductase), component 1.3192 0.0001 of the mitochondrial intermembrane space, required for lactate utilization; expression is repressed by glucose and anaerobic conditions BUG1 YDL099W Cis‐golgi localized protein involved in ER to Golgi transport; forms a 1.3176 0.0002 complex with the mammalian GRASP65 homolog, Grh1p; mutants are compromised for the fusion of ER‐derived vesicles with Golgi membranes PAR32 YDL173W Putative protein of unknown function; hyperphosphorylated upon 1.3165 0.0001 rapamycin treatment in a Tap42p‐dependent manner; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; PAR32 is not an essential gene

160

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l RAD34 YDR314C Protein involved in nucleotide excision repair (NER); homologous to 1.2996 0.0002 RAD4 MAL32 YBR299W Maltase (alpha‐D‐glucosidase), inducible protein involved in maltose 1.2986 0.0004 catabolism; encoded in the MAL3 complex locus; functional in genomic reference strain S288C; hydrolyzes the disaccharides maltose, turanose, maltotriose, and sucrose CRR1 YLR213C Putative glycoside hydrolase of the spore wall envelope; required for 1.2845 0.0002 normal spore wall assembly, possibly for cross‐linking between the glucan and chitosan layers; expressed during sporulation PAU4 YLR461W Member of the seripauperin multigene family encoded mainly in 1.2753 0.0001 subtelomeric regions; active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme SSU1 YPL092W Plasma membrane sulfite pump involved in sulfite metabolism and 1.2676 0.0004 required for efficient sulfite efflux; major facilitator superfamily protein LYS21 YDL131W Homocitrate synthase isozyme, catalyzes the condensation of acetyl‐ 1.2633 0.0006 CoA and alpha‐ketoglutarate to form homocitrate, which is the first step in the lysine biosynthesis pathway; highly similar to the other isozyme, Lys20p HIM1 YDR317W Protein of unknown function involved in DNA repair 1.2462 0.0001 MPC54 YOR177C Component of the meiotic outer plaque, a membrane‐organizing 1.2229 0.0002 center which is assembled on the cytoplasmic face of the spindle pole body during meiosis II and triggers the formation of the prospore membrane; potential Cdc28p substrate MUP3 YHL036W Low affinity methionine permease, similar to Mup1p 1.2217 0.0010 OSW2 YLR054C Protein of unknown function proposed to be involved in the 1.2215 0.0005 assembly of the spore wall HXT14 YNL318C Protein with similarity to hexose transporter family members, 1.2165 0.0006 expression is induced in low glucose and repressed in high glucose; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies YSW1 YBR148W Protein required for normal prospore membrane formation; 1.2147 0.0001 interacts with Gip1p, which is the meiosis‐specific regulatory subunit of the Glc7p protein phosphatase; expressed specifically in spores and localizes to the prospore membrane ECM11 YDR446W Non‐essential protein apparently involved in meiosis, GFP fusion 1.2101 0.0003 protein is present in discrete clusters in the nucleus throughout mitosis; may be involved in maintaining chromatin structure THI13 YDL244W Protein involved in synthesis of the thiamine precursor 1.2080 0.0002 hydroxymethylpyrimidine (HMP); member of a subtelomeric gene family including THI5, THI11, THI12, and THI13 NA YDR379C‐A Protein involved in the assembly of the mitochondrial succinate 1.2051 0.0007 dehydrogenase complex; mutations in human ortholog SDHAF1 are associated with infantile leukoencephalopathy SSP2 YOR242C Sporulation specific protein that localizes to the spore wall; required 1.2000 0.0005 for sporulation at a point after meiosis II and during spore wall formation; SSP2 expression is induced midway in meiosis NA YLL066W‐B Putative protein of unknown function; overexpression causes a cell 1.1877 0.0008 cycle delay or arrest UGA3 YDL170W Transcriptional activator necessary for gamma‐aminobutyrate 1.1791 0.0003 (GABA)‐dependent induction of GABA genes (such as UGA1, UGA2, UGA4); zinc‐finger transcription factor of the Zn(2)‐Cys(6) binuclear cluster domain type; localized to the nucleus

161

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l NA YCR102C Putative protein of unknown function, involved in copper 1.1627 0.0002 metabolism; similar to C. carbonum toxD gene; member of the quinone oxidoreductase family ARG1 YOL058W Arginosuccinate synthetase, catalyzes the formation of L‐ 1.1627 0.0007 argininosuccinate from citrulline and L‐aspartate in the arginine biosynthesis pathway; potential Cdc28p substrate HNT2 YDR305C Dinucleoside triphosphate hydrolase; has similarity to the tumor 1.1561 0.0001 suppressor FHIT and belongs to the histidine triad (HIT) superfamily of nucleotide‐binding proteins NA YDR018C Probable membrane protein with three predicted transmembrane 1.1517 0.0003 domains; homologous to Ybr042cp, similar to C. elegans F55A11.5 and maize 1‐acyl‐glycerol‐3‐phosphate acyltransferase DAL1 YIR027C Allantoinase, converts allantoin to allantoate in the first step of 1.1459 0.0004 allantoin degradation; expression sensitive to nitrogen catabolite repression NA YLR466C‐B Dubious open reading frame unlikely to encode a protein, based on 1.1438 0.0001 available experimental and comparative sequence data DSF1 YEL070W Deletion suppressor of mpt5 mutation 1.1398 0.0004 NA YLR460C Member of the quinone oxidoreductase family, up‐regulated in 1.1386 0.0002 response to the fungicide mancozeb; possibly up‐regulated by iodine MTH1 YDR277C Negative regulator of the glucose‐sensing signal transduction 1.1369 0.0006 pathway, required for repression of transcription by Rgt1p; interacts with Rgt1p and the Snf3p and Rgt2p glucose sensors; phosphorylated by Yck1p, triggering Mth1p degradation CTS2 YDR371W Putative chitinase, functionally complements A. gossypii cts2 mutant 1.1306 0.0004 sporulation defect REC8 YPR007C Meiosis‐specific component of sister chromatid cohesion complex; 1.1304 0.0007 maintains cohesion between sister chromatids during meiosis I; maintains cohesion between centromeres of sister chromatids until meiosis II; homolog of S. pombe Rec8p CTA1 YDR256C Catalase A, breaks down hydrogen peroxide in the peroxisomal 1.1300 0.0005 matrix formed by acyl‐CoA oxidase (Pox1p) during fatty acid beta‐ oxidation SNA4 YDL123W Protein of unknown function, localized to the vacuolar outer 1.1236 0.0002 membrane; predicted to be palmitoylated SHS1 YDL225W One of five related septins (Cdc3p, Cdc10p, Cdc11p, Cdc12p, Shs1p) 1.1057 0.0008 that form a cortical filamentous collar at the mother‐bud neck which is necessary for normal morphogenesis and cytokinesis NDT80 YHR124W Meiosis‐specific transcription factor required for exit from 1.1043 0.0003 pachytene and for full meiotic recombination; activates middle sporulation genes; competes with Sum1p for binding to promoters containing middle sporulation elements (MSE) NA YDL233W Putative protein of unknown function; green fluorescent protein 1.1031 0.0001 (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YDL233W is not an essential gene NA YDR186C Putative protein of unknown function; may interact with ribosomes, 1.0952 0.0001 based on co‐purification experiments; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm GYP7 YDL234C GTPase‐activating protein for yeast Rab family members including: 1.0918 0.0002 Ypt7p (most effective), Ypt1p, Ypt31p, and Ypt32p (in vitro); involved in vesicle mediated protein trafficking NA YLL066W‐B Putative protein of unknown function; overexpression causes a cell 1.0896 0.0007 cycle delay or arrest

162

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l DYN2 YDR424C Cytoplasmic light chain dynein, microtubule motor protein; 1.0875 0.0002 proposed to be involved in the assembly of the nuclear pore complex SUE1 YPR151C Mitochondrial protein required for degradation of unstable forms of 1.0856 0.0002 cytochrome c RTK1 YDL025C Putative protein kinase, potentially phosphorylated by Cdc28p; 1.0824 0.0002 interacts with ribosome biogenesis factors, Cka2, Gus1 and Arc1 CDC36 YDL165W Component of the CCR4‐NOT complex, which has multiple roles in 1.0794 0.0002 regulating mRNA levels including regulation of transcription and destabilizing mRNAs by deadenylation; basal transcription factor

CWC21 YDR482C Protein involved in RNA splicing by the spliceosome; component of a 1.0788 0.0001 complex containing Cef1p; interacts genetically with ISY1 and BUD13; may bind RNA; has similarity to S. pombe Cwf21p SPO23 YBR250W Protein of unknown function; associates with meiosis‐specific 1.0787 0.0003 protein Spo1p AAD4 YDL243C Putative aryl‐alcohol dehydrogenase with similarity to P. 1.0740 0.0002 chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin PAU3 YCR104W Member of the seripauperin multigene family encoded mainly in 1.0732 0.0004 subtelomeric regions, active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme RAD9 YDR217C DNA damage‐dependent checkpoint protein, required for cell‐cycle 1.0708 0.0004 arrest in G1/S, intra‐S, and G2/M; transmits checkpoint signal by activating Rad53p and Chk1p; hyperphosphorylated by Mec1p and Tel1p; potential Cdc28p substrate AAD4 YDL243C Putative aryl‐alcohol dehydrogenase with similarity to P. 1.0706 0.0002 chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin NA YKL107W Putative protein of unknown function; proposed to be a 1.0621 0.0010 palmitoylated membrane protein MCH1 YDL054C Protein with similarity to mammalian monocarboxylate permeases, 1.0609 0.0003 which are involved in transport of monocarboxylic acids across the plasma membrane; mutant is not deficient in monocarboxylate transport SRB7 YDR308C Subunit of the RNA polymerase II mediator complex; associates with 1.0608 0.0001 core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; target of the global repressor Tup1p YOS9 YDR057W ER quality‐control lectin; integral subunit of the HRD ligase; binds to 1.0606 0.0005 glycans with terminal alpha‐1,6 linked mannose on misfolded N‐ glycosylated proteins and participates in targeting proteins to ERAD; member of the OS‐9 protein family PAU18 YLL064C Protein of unknown function, member of the seripauperin multigene 1.0587 0.0002 family encoded mainly in subtelomeric regions; identical to Pau6p NA YDR366C Putative protein of unknown function 1.0567 0.0001 LCD1 YDR499W Essential protein required for the DNA integrity checkpoint 1.0543 0.0009 pathways; interacts physically with Mec1p; putative homolog of S. pombe Rad26 and human ATRIP

163

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l PET100 YDR079W Chaperone that specifically facilitates the assembly of cytochrome c 1.0495 0.0001 oxidase, integral to the mitochondrial inner membrane; interacts with a subcomplex of subunits VII, VIIa, and VIII (Cox7p, Cox9p, and Cox8p) but not with the holoenzyme DUR3 YHL016C Plasma membrane transporter for both urea and polyamines, 1.0471 0.0001 expression is highly sensitive to nitrogen catabolite repression and induced by allophanate, the last intermediate of the allantoin degradative pathway COA2 YPL189C‐A Cytochrome oxidase assembly factor; null mutation results in 1.0452 0.0006 respiratory deficiency with specific loss of cytochrome oxidase activity; functions downstream of assembly factors Mss51p and Coa1p and interacts with assembly factor Shy1p MTD1 YKR080W NAD‐dependent 5,10‐methylenetetrahydrafolate dehydrogenase, 1.0384 0.0001 plays a catalytic role in oxidation of cytoplasmic one‐carbon units; expression is regulated by Bas1p and Bas2p, repressed by adenine, and may be induced by inositol and choline NA YLR466C‐B Dubious open reading frame unlikely to encode a protein, based on 1.0374 0.0002 available experimental and comparative sequence data DFM1 YDR411C Endoplasmic reticulum (ER) localized protein involved in ER‐ 1.0350 0.0002 associated protein degradation (ERAD), ER stress and homeostasis; interacts with components of ERAD‐L and ERAD‐C and Cdc48p; derlin‐like family member similar to Der1p NA YDL073W Putative protein of unknown function; YDL073W is not an essential 1.0313 0.0002 gene NA YDR248C Putative protein of unknown function; sequence similarity to 1.0260 0.0002 bacterial and human gluconokinase; green fluorescent protein (GFP)‐ fusion protein localizes to the cytoplasm; upregulated by deletion of the RNAP‐II associated factor, PAF1 BUR6 YER159C Subunit of a heterodimeric NC2 transcription regulator complex with 1.0236 0.0003 Ncb2p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2alpha RTC2 YBR147W Protein of unknown function; identified in a screen for mutants with 1.0235 0.0003 decreased levels of rDNA transcription; detected in highly purified mitochondria; null mutant suppresses cdc13‐1; similar to a G‐protein coupled receptor from S. pombe SLM3 YDL033C tRNA‐specific 2‐thiouridylase, responsible for 2‐thiolation of the 1.0226 0.0003 wobble base of mitochondrial tRNAs; human ortholog is implicated in myoclonus epilepsy associated with ragged red fibers (MERRF) PAU8 YAL068C Protein of unknown function, member of the seripauperin multigene 1.0213 0.0002 family encoded mainly in subtelomeric regions NA YBR085C‐A Putative protein of unknown function; green fluorescent protein 1.0140 0.0003 (GFP)‐fusion protein localizes to the cytoplasm and to the nucleus LYS1 YIR034C Saccharopine dehydrogenase (NAD+, L‐lysine‐forming), catalyzes the 1.0115 0.0009 conversion of saccharopine to L‐lysine, which is the final step in the lysine biosynthesis pathway; also has mRNA binding activity LRS4 YDR439W Nucleolar protein that forms a complex with Csm1p, and then 1.0093 0.0003 Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to the replication fork barrier site and rDNA repeat segregation POL3 YDL102W Catalytic subunit of DNA polymerase delta; required for 1.0085 0.0001 chromosomal DNA replication during mitosis and meiosis, intragenic recombination, repair of double strand DNA breaks, and DNA replication during nucleotide excision repair (NER)

164

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l QRI7 YDL104C Highly conserved mitochondrial protein, essential for t6A 1.0077 0.0006 modification of mitochondrial tRNAs that decode ANN codons; similar to Kae1p and E. coli YgjD, both of which are also required for tRNA t6A modification SNN1 YNL086W Putative protein of unknown function; likely member of BLOC 1.0006 0.0002 complex involved in endosomal cargo sorting; green fluorescent protein (GFP)‐fusion protein localizes to endosomes EKI1 YDR147W Ethanolamine kinase, primarily responsible for 0.9881 0.0001 phosphatidylethanolamine synthesis via the CDP‐ethanolamine pathway; exhibits some choline kinase activity, thus contributing to phosphatidylcholine synthesis via the CDP‐choline pathway NKP1 YDR383C Non‐essential kinetochore protein, subunit of the Ctf19 central 0.9880 0.0001 kinetochore complex (Ctf19p‐Mcm21p‐Okp1p‐Mcm22p‐Mcm16p‐ Ctf3p‐Chl4p‐Mcm19p‐Nkp1p‐Nkp2p‐Ame1p‐Mtw1p) NA YDR132C Putative protein of unknown function 0.9870 0.0002 DIN7 YDR263C Mitochondrial nuclease functioning in DNA repair and replication, 0.9836 0.0003 modulates the stability of the mitochondrial genome, induced by exposure to mutagens, also induced during meiosis at a time nearly coincident with commitment to recombination GCV1 YDR019C T subunit of the mitochondrial glycine decarboxylase complex, 0.9817 0.0003 required for the catabolism of glycine to 5,10‐methylene‐THF; expression is regulated by levels of levels of 5,10‐methylene‐THF in the cytoplasm SHU2 YDR078C Protein involved in a Rad51p‐, Rad54p‐dependent pathway for 0.9733 0.0002 homologous recombination repair, important for error‐free repair of spontaneous and induced DNA lesions to protect the genome from mutation; associates with Shu1p, Psy3p, and Csm2p ARO80 YDR421W Zinc finger transcriptional activator of the Zn2Cys6 family; activates 0.9711 0.0001 transcription of aromatic amino acid catabolic genes in the presence of aromatic amino acids RNH202 YDR279W Ribonuclease H2 subunit, required for RNase H2 activity; related to 0.9698 0.0001 human AGS2 that causes Aicardi‐Goutieres syndrome UBX3 YDL091C UBX (ubiquitin regulatory X) domain‐containing protein that 0.9661 0.0004 interacts with Cdc48p, green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern CBS1 YDL069C Mitochondrial translational activator of the COB mRNA; membrane 0.9651 0.0007 protein that interacts with translating ribosomes, acts on the COB mRNA 5'‐untranslated leader MBR1 YKL093W Protein involved in mitochondrial functions and stress response; 0.9647 0.0003 overexpression suppresses growth defects of hap2, hap3, and hap4 mutants SCM3 YDL139C Nonhistone component of centromeric chromatin that binds 0.9641 0.0001 stoichiometrically to CenH3‐H4 histones, required for kinetochore assembly; required for G2/M progression and localization of Cse4p; may protect Cse4p from ubiquitylation PFA5 YDR459C Palmitoyltransferase with autoacylation activity; likely functions in 0.9595 0.0003 pathway(s) outside Ras; member of a family of putative palmitoyltransferases containing an Asp‐His‐His‐Cys‐cysteine rich (DHHC‐CRD) domain QCR7 YDR529C Subunit 7 of the ubiquinol cytochrome‐c reductase complex, which is 0.9559 0.0001 a component of the mitochondrial inner membrane electron transport chain; oriented facing the mitochondrial matrix; N‐ terminus appears to play a role in complex assembly POX1 YGL205W Fatty‐acyl coenzyme A oxidase, involved in the fatty acid beta‐ 0.9550 0.0006 oxidation pathway; localized to the peroxisomal matrix 165

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l YPS7 YDR349C Putative GPI‐anchored aspartic protease, member of the yapsin 0.9548 0.0001 family of proteases involved in cell wall growth and maintenance; located in the cytoplasm and endoplasmic reticulum NA YDR109C Putative kinase 0.9515 0.0001 NA YER078W‐A Putative protein of unknown function; identified by fungal homology 0.9512 0.0009 and RT‐PCR SDH4 YDR178W Membrane anchor subunit of succinate dehydrogenase (Sdh1p, 0.9420 0.0004 Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain ASF2 YDL197C Anti‐silencing protein that causes derepression of silent loci when 0.9388 0.0002 overexpressed PLP1 YDR183W Protein that interacts with CCT (chaperonin containing TCP‐1) 0.9385 0.0002 complex and has a role in actin and tubulin folding; has weak similarity to phosducins, which are G‐protein regulators

PEX3 YDR329C Peroxisomal membrane protein (PMP) required for proper 0.9377 0.0001 localization and stability of PMPs; anchors peroxisome retention factor Inp1p at the peroxisomal membrane; interacts with Pex19p

NA YDR239C Protein of unknown function that may interact with ribosomes, 0.9375 0.0002 based on co‐purification experiments SEC1 YDR164C Sm‐like protein involved in docking and fusion of exocytic vesicles 0.9349 0.0001 through binding to assembled SNARE complexes at the membrane; localization to sites of secretion (bud neck and bud tip) is dependent on SNARE function REF2 YDR195W RNA‐binding protein involved in the cleavage step of mRNA 3'‐end 0.9342 0.0002 formation prior to polyadenylation, and in snoRNA maturation; part of holo‐CPF subcomplex APT, which associates with 3'‐ends of snoRNA‐ and mRNA‐encoding genes VPS60 YDR486C Cytoplasmic and vacuolar membrane protein involved in late 0.9334 0.0002 endosome to vacuole transport; required for normal filament maturation during pseudohyphal growth; may function in targeting cargo proteins for degradation; interacts with Vta1p NA YGR146C‐A Putative protein of unknown function 0.9322 0.0004 SPC19 YDR201W Essential subunit of the Dam1 complex (aka DASH complex), couples 0.9291 0.0003 kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; also localized to nuclear side of spindle pole body NA YCR108C Putative protein of unknown function; identified by fungal homology 0.9270 0.0002 and RT‐PCR PRM9 YAR031W Pheromone‐regulated protein with 3 predicted transmembrane 0.9258 0.0002 segments and an FF sequence, a motif involved in COPII binding; member of DUP240 gene family AAD14 YNL331C Putative aryl‐alcohol dehydrogenase with similarity to P. 0.9206 0.0002 chrysosporium aryl‐alcohol dehydrogenase; mutational analysis has not yet revealed a physiological role CRG1 YHR209W mRNA binding protein and putative S‐adenosylmethionine‐ 0.9196 0.0003 dependent methyltransferase; mediates cantharidin resistance QRI1 YDL103C UDP‐N‐acetylglucosamine pyrophosphorylase, catalyzes the 0.9185 0.0002 formation of UDP‐N‐acetylglucosamine (UDP‐GlcNAc), which is important in cell wall biosynthesis, protein N‐glycosylation, and GPI anchor biosynthesis

166

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l TFB3 YDR460W Subunit of TFIIH and nucleotide excision repair factor 3 complexes, 0.9177 0.0002 involved in transcription initiation, required for nucleotide excision repair; ring finger protein similar to mammalian CAK and TFIIH subunit TGL2 YDR058C Triacylglycerol lipase that is localized to the mitochondria; has 0.9150 0.0004 lipolytic activity towards triacylglycerols and diacylglycerols when expressed in E. coli TAF10 YDR167W Subunit (145 kDa) of TFIID and SAGA complexes, involved in RNA 0.9088 0.0009 polymerase II transcription initiation and in chromatin modification ADE17 YMR120C Enzyme of 'de novo' purine biosynthesis containing both 5‐ 0.9074 0.0002 aminoimidazole‐4‐carboxamide ribonucleotide transformylase and inosine monophosphate cyclohydrolase activities, isozyme of Ade16p; ade16 ade17 mutants require adenine and histidine MCT1 YOR221C Predicted malonyl‐CoA:ACP transferase, putative component of a 0.9028 0.0002 type‐II mitochondrial fatty acid synthase that produces intermediates for phospholipid remodeling NA YDR514C Putative protein of unknown function 0.8995 0.0009 NA YNL195C Putative protein of unknown function; shares a promoter with 0.8991 0.0004 YNL194C; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies NA YDR056C Putative protein of unknown function; green fluorescent protein 0.8946 0.0002 (GFP)‐fusion protein localizes to the endoplasmic reticulum; YDR056C is not an essential protein NA YAL064W Protein of unknown function; may interact with ribosomes, based on 0.8929 0.0003 co‐purification experiments NA YPL071C Putative protein of unknown function; green fluorescent protein 0.8918 0.0004 (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus

PTP1 YDL230W Phosphotyrosine‐specific protein phosphatase that 0.8882 0.0002 dephosphorylates a broad range of substrates in vivo, including Fpr3p; localized to the cytoplasm and the mitochondria

APA2 YDR530C Diadenosine 5',5''‐P1,P4‐tetraphosphate phosphorylase II (AP4A 0.8841 0.0002 phosphorylase), involved in catabolism of bis(5'‐nucleosidyl) tetraphosphates; has similarity to Apa1p PEP7 YDR323C Multivalent adaptor protein that facilitates vesicle‐mediated 0.8804 0.0007 vacuolar protein sorting by ensuring high‐fidelity vesicle docking and fusion, which are essential for targeting of vesicles to the endosome; required for vacuole inheritance ADE4 YMR300C Phosphoribosylpyrophosphate amidotransferase (PRPPAT; 0.8738 0.0007 amidophosphoribosyltransferase), catalyzes first step of the 'de novo' purine nucleotide biosynthetic pathway RAM1 YDL090C Beta subunit of the CAAX farnesyltransferase (FTase) that prenylates 0.8734 0.0002 the a‐factor mating pheromone and Ras proteins; required for the membrane localization of Ras proteins and a‐factor; homolog of the mammalian FTase beta subunit DOS2 YDR068W Protein of unknown function, green fluorescent protein (GFP)‐fusion 0.8733 0.0002 protein localizes to the cytoplasm KIN1 YDR122W Serine/threonine protein kinase involved in regulation of exocytosis; 0.8690 0.0006 localizes to the cytoplasmic face of the plasma membrane; closely related to Kin2p VMS1 YDR049W Zinc finger protein, forms a mitochondrially‐associated complex with 0.8680 0.0002 Cdc48p and Npl4p under oxidative stress that is required for ubiquitin‐mediated mitochondria‐associated protein degradation (MAD); conserved in C. elegans and human 167

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l NA YDR246W‐A Putative protein of unknown function; identified by fungal homology 0.8669 0.0009 and RT‐PCR NA YDR026C Protein of unknown function that may interact with ribosomes, 0.8669 0.0003 based on co‐purification experiments; Myb‐like DNA‐binding protein that may bind to the Ter region of rDNA; interacts physically with Fob1p SNF3 YDL194W Plasma membrane low glucose sensor that regulates glucose 0.8669 0.0003 transport; contains 12 predicted transmembrane segments and a long C‐terminal tail required for induction of hexose transporters; also senses fructose and mannose; similar to Rgt2p NRG1 YDR043C Transcriptional repressor that recruits the Cyc8p‐Tup1p complex to 0.8664 0.0009 promoters; mediates glucose repression and negatively regulates a variety of processes including filamentous growth and alkaline pH response QCR2 YPR191W Subunit 2 of the ubiquinol cytochrome‐c reductase complex, which is 0.8652 0.0003 a component of the mitochondrial inner membrane electron transport chain; phosphorylated; transcription is regulated by Hap1p, Hap2p/Hap3p, and heme NBP2 YDR162C Protein involved in the HOG (high osmolarity glycerol) pathway, 0.8637 0.0003 negatively regulates Hog1p by recruitment of phosphatase Ptc1p the Pbs2p‐Hog1p complex, found in the nucleus and cytoplasm, contains an SH3 domain that binds Pbs2p DAL4 YIR028W Allantoin permease; expression sensitive to nitrogen catabolite 0.8630 0.0007 repression and induced by allophanate, an intermediate in allantoin degradation NA YDR179W‐A Putative protein of unknown function 0.8618 0.0004 DAD1 YDR016C Essential subunit of the Dam1 complex (aka DASH complex), couples 0.8603 0.0006 kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis NA YDR262W Putative protein of unknown function; green fluorescent protein 0.8577 0.0003 (GFP)‐fusion protein localizes to the vacuole and is induced in response to the DNA‐damaging agent MMS; gene expression increases in response to Zymoliase treatment ATG10 YLL042C Conserved E2‐like conjugating enzyme that mediates formation of 0.8574 0.0008 the Atg12p‐Atg5p conjugate, which is a critical step in autophagy YPD1 YDL235C Phosphorelay intermediate protein, phosphorylated by the plasma 0.8542 0.0004 membrane sensor Sln1p in response to osmotic stress and then in turn phosphorylates the response regulators Ssk1p in the cytosol and Skn7p in the nucleus NA YJL144W Cytoplasmic hydrophilin of unknown function, possibly involved in 0.8533 0.0004 the dessication response; expression induced by osmotic stress, starvation and during stationary phase; GFP‐fusion protein is induced by the DNA‐damaging agent MMS DPB4 YDR121W Shared subunit of DNA polymerase (II) epsilon and of ISW2/yCHRAC 0.8505 0.0009 chromatin accessibility complex; involved in both chromosomal DNA replication and in inheritance of telomeric silencing NA YHL048C‐A Putative protein of unknown function; identified by expression 0.8493 0.0006 profiling and mass spectrometry NA YDR131C F‐box protein, substrate‐specific adaptor subunit that recruits 0.8471 0.0002 substrates to a core ubiquitination complex RAV2 YDR202C Subunit of RAVE (Rav1p, Rav2p, Skp1p), a complex that associates 0.8461 0.0003 with the V1 domain of the vacuolar membrane (H+)‐ATPase (V‐ ATPase) and promotes assembly and reassembly of the holoenzyme 168

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l SSA3 YBL075C ATPase involved in protein folding and the response to stress; plays 0.8460 0.0005 a role in SRP‐dependent cotranslational protein‐membrane targeting and translocation; member of the heat shock protein 70 (HSP70) family; localized to the cytoplasm LSM8 YJR022W Lsm (Like Sm) protein; forms heteroheptameric complex (with 0.8442 0.0009 Lsm2p, Lsm3p, Lsm4p, Lsm5p, Lsm6p, and Lsm7p) that is part of spliceosomal U6 snRNP and is also implicated in processing of pre‐ tRNA, pre‐snoRNA, and pre‐rRNA CKS1 YBR135W Cyclin‐dependent protein kinase regulatory subunit and adaptor; 0.8431 0.0003 modulates proteolysis of M‐phase targets through interactions with the proteasome; role in transcriptional regulation, recruiting proteasomal subunits to target gene promoters NA YIL082W‐A Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated 0.8429 0.0004 as one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes PEX19 YDL065C Chaperone and import receptor for newly‐synthesized class I 0.8410 0.0008 peroxisomal membrane proteins (PMPs), binds PMPs in the cytoplasm and delivers them to the peroxisome for subsequent insertion into the peroxisomal membrane DAL3 YIR032C Ureidoglycolate hydrolase, converts ureidoglycolate to glyoxylate 0.8359 0.0005 and urea in the third step of allantoin degradation; expression sensitive to nitrogen catabolite repression

NA YDL086W Putative protein of unknown function; the authentic, non‐tagged 0.8359 0.0003 protein is detected in highly purified mitochondria in high‐ throughput studies; YDL086W is not an essential gene NA YOL155W‐A Putative protein of unknown function; identified by expression 0.8341 0.0003 profiling and mass spectrometry OCA6 YDR067C Cytoplasmic protein required for replication of Brome mosaic virus 0.8333 0.0002 in S. cerevisiae, which is a model system for studying positive‐strand RNA virus replication; null mutation confers sensitivity to tunicamycin and DTT SNU23 YDL098C Component of U4/U6.U5 snRNP involved in mRNA splicing via 0.8318 0.0004 spliceosome SDC1 YDR469W Subunit of the COMPASS (Set1C) complex, which methylates lysine 4 0.8307 0.0008 of histone H3 and is required in chromatin silencing at telomeres; contains a Dpy‐30 domain that mediates interaction with Bre2p; similar to C. elegans and human DPY‐30 CDC7 YDL017W DDK (Dbf4‐dependent kinase) catalytic subunit required for firing 0.8304 0.0003 origins and replication fork progression in S phase through phosphorylation of Mcm2‐7p complexes and Cdc45p; kinase activity correlates with cyclical DBF4 expression PDS1 YDR113C Securin, inhibits anaphase by binding separin Esp1p; blocks cyclin 0.8265 0.0004 destruction and mitotic exit, essential for meiotic progression and mitotic cell cycle arrest; localization is cell‐cycle dependent and regulated by Cdc28p phosphorylation IPK1 YDR315C Inositol 1,3,4,5,6‐pentakisphosphate 2‐kinase, nuclear protein 0.8220 0.0009 required for synthesis of 1,2,3,4,5,6‐hexakisphosphate (phytate), which is integral to cell function; has 2 motifs conserved in other fungi; ipk1 gle1 double mutant is inviable REG1 YDR028C Regulatory subunit of type 1 protein phosphatase Glc7p, involved in 0.8218 0.0004 negative regulation of glucose‐repressible genes

169

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l UBC1 YDR177W Ubiquitin‐conjugating enzyme that mediates selective degradation 0.8193 0.0005 of short‐lived and abnormal proteins; plays a role in vesicle biogenesis and ER‐associated protein degradation (ERAD); component of the cellular stress response ECM18 YDR125C Protein of unknown function, similar to Rlp24p 0.8192 0.0002 LYS9 YNR050C Saccharopine dehydrogenase (NADP+, L‐glutamate‐forming); 0.8153 0.0007 catalyzes the formation of saccharopine from alpha‐aminoadipate 6‐ semialdehyde, the seventh step in lysine biosynthesis pathway; exhibits genetic and physical interactions with TRM112 EAF7 YNL136W Subunit of the NuA4 histone acetyltransferase complex, which 0.8142 0.0005 acetylates the N‐terminal tails of histones H4 and H2A DIG2 YDR480W MAP kinase‐responsive inhibitor of the Ste12p transcription factor, 0.8129 0.0004 involved in the regulation of mating‐specific genes and the invasive growth pathway; related regulators Dig1p and Dig2p bind to Ste12p

ACN9 YDR511W Protein of the mitochondrial intermembrane space, required for 0.8123 0.0003 acetate utilization and gluconeogenesis; has orthologs in higher eukaryotes HIS4 YCL030C Multifunctional enzyme containing phosphoribosyl‐ATP 0.8070 0.0003 pyrophosphatase, phosphoribosyl‐AMP cyclohydrolase, and histidinol dehydrogenase activities; catalyzes the second, third, ninth and tenth steps in histidine biosynthesis RBS1 YDL189W Protein of unknown function, identified as a high copy suppressor of 0.8008 0.0003 psk1 psk2 mutations that confer temperature‐sensitivity for galactose utilization; proposed to bind single‐stranded nucleic acids via its R3H domain SSF2 YDR312W Protein required for ribosomal large subunit maturation, functionally 0.8005 0.0006 redundant with Ssf1p; member of the Brix family DLD2 YDL178W D‐lactate dehydrogenase, located in the mitochondrial matrix 0.7929 0.0008 SMD3 YLR147C Core Sm protein Sm D3; part of heteroheptameric complex (with 0.7861 0.0008 Smb1p, Smd1p, Smd2p, Sme1p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm D3 SNM1 YDR478W Subunit of RNase MRP, which cleaves pre‐rRNA and has a role in cell 0.7850 0.0004 cycle‐regulated degradation of daughter cell‐specific mRNAs; binds to the NME1 RNA subunit of RNase MRP

PRM5 YIL117C Pheromone‐regulated protein, predicted to have 1 transmembrane 0.7824 0.0005 segment; induced during cell integrity signaling UFD2 YDL190C Ubiquitin chain assembly factor (E4) that cooperates with a 0.7821 0.0007 ubiquitin‐activating enzyme (E1), a ubiquitin‐conjugating enzyme (E2), and a ubiquitin protein ligase (E3) to conjugate ubiquitin to substrates; also functions as an E3 SSP1 YHR184W Protein involved in the control of meiotic nuclear division and 0.7797 0.0004 coordination of meiosis with spore formation; transcription is induced midway through meiosis MRP10 YDL045W‐A Mitochondrial ribosomal protein of the small subunit; contains twin 0.7797 0.0004 cysteine‐x9‐cysteine motifs PTC1 YDL006W Type 2C protein phosphatase (PP2C); dephosphorylates Hog1p, 0.7767 0.0003 inactivating osmosensing MAPK cascade; involved in Fus3p activation during pheromone response; deletion affects precursor tRNA splicing, mitochondrial inheritance, and sporulation

170

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l RGA2 YDR379W GTPase‐activating protein for the polarity‐establishment protein 0.7750 0.0009 Cdc42p; implicated in control of septin organization, pheromone response, and haploid invasive growth; regulated by Pho85p and Cdc28p VPS54 YDR027C Component of the GARP (Golgi‐associated retrograde protein) 0.7746 0.0003 complex, Vps51p‐Vps52p‐Vps53p‐Vps54p, which is required for the recycling of proteins from endosomes to the late Golgi; potentially phosphorylated by Cdc28p GCD6 YDR211W Catalytic epsilon subunit of the translation initiation factor eIF2B, the 0.7711 0.0006 guanine‐nucleotide exchange factor for eIF2; activity subsequently regulated by phosphorylated eIF2; first identified as a negative regulator of GCN4 expression MCM21 YDR318W Protein involved in minichromosome maintenance; component of 0.7708 0.0009 the COMA complex (Ctf19p, Okp1p, Mcm21p, Ame1p) that bridges kinetochore subunits that are in contact with centromeric DNA and the subunits bound to microtubules KIN28 YDL108W Serine/threonine protein kinase, subunit of the transcription factor 0.7704 0.0002 TFIIH; involved in transcription initiation at RNA polymerase II promoters JNM1 YMR294W Component of the yeast dynactin complex, consisting of Nip100p, 0.7699 0.0008 Jnm1p, and Arp1p; required for proper nuclear migration and spindle partitioning during mitotic anaphase B

COX20 YDR231C Mitochondrial inner membrane protein, required for proteolytic 0.7690 0.0004 processing of Cox2p and its assembly into cytochrome c oxidase HEM13 YDR044W Coproporphyrinogen III oxidase, an oxygen requiring enzyme that 0.7686 0.0006 catalyzes the sixth step in the heme biosynthetic pathway; transcription is repressed by oxygen and heme (via Rox1p and Hap1p) STP1 YDR463W Transcription factor, undergoes proteolytic processing by SPS (Ssy1p‐ 0.7677 0.0004 Ptr3p‐Ssy5p)‐sensor component Ssy5p in response to extracellular amino acids; activates transcription of amino acid permease genes and may have a role in tRNA processing SWA2 YDR320C Auxilin‐like protein involved in vesicular transport; clathrin‐binding 0.7654 0.0009 protein required for uncoating of clathrin‐coated vesicles AIR2 YDL175C Zinc knuckle protein, involved in nuclear RNA processing and 0.7639 0.0004 degredation as a component of the TRAMP complex; stimulates the poly(A) polymerase activity of Pap2p in vitro; functionally redundant with Air1p DET1 YDR051C Acid phosphatase involved in the non‐vesicular transport of sterols 0.7615 0.0004 in both directions between the endoplasmic reticulum and plasma membrane; deletion confers sensitivity to nickel

COX9 YDL067C Subunit VIIa of cytochrome c oxidase, which is the terminal member 0.7525 0.0003 of the mitochondrial inner membrane electron transport chain DUN1 YDL101C Cell‐cycle checkpoint serine‐threonine kinase required for DNA 0.7516 0.0006 damage‐induced transcription of certain target genes, phosphorylation of Rad55p and Sml1p, and transient G2/M arrest after DNA damage; also regulates postreplicative DNA repair NA YDL012C Tail‐anchored plasma membrane protein containing a conserved 0.7508 0.0003 CYSTM module, possibly involved in response to stress; may contribute to non‐homologous end‐joining (NHEJ) based on ydl012c htz1 double null phenotype PAU14 YIL176C Protein of unknown function, member of the seripauperin multigene 0.7465 0.0005 family encoded mainly in subtelomeric regions; identical to Pau1p 171

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l UBA2 YDR390C Subunit of a heterodimeric nuclear SUMO activating enzyme (E1) 0.7462 0.0003 with Aos1p; activates Smt3p (SUMO) before its conjugation to proteins (sumoylation), which may play a role in protein targeting; essential for viability UBC5 YDR059C Ubiquitin‐conjugating enzyme that mediates selective degradation 0.7460 0.0008 of short‐lived, abnormal, or excess proteins, including histone H3; central component of the cellular stress response; expression is heat inducible SPO13 YHR014W Meiosis‐specific protein, involved in maintaining sister chromatid 0.7424 0.0009 cohesion during meiosis I as well as promoting proper attachment of kinetochores to the spindle during meiosis I and meiosis II

FRQ1 YDR373W N‐myristoylated calcium‐binding protein that may have a role in 0.7416 0.0003 intracellular signaling through its regulation of the phosphatidylinositol 4‐kinase Pik1p; member of the recoverin/frequenin branch of the EF‐hand superfamily NPL3 YDR432W RNA‐binding protein that promotes elongation, regulates 0.7413 0.0003 termination, and carries poly(A) mRNA from nucleus to cytoplasm; required for pre‐mRNA splicing; dissociation from mRNAs promoted by Mtr10p; phosphorylated by Sky1p in the cytoplasm MRPL28 YDR462W Mitochondrial ribosomal protein of the large subunit 0.7407 0.0004 GIC2 YDR309C Redundant rho‐like GTPase Cdc42p effector; homolog of Gic1p; 0.7396 0.0004 involved in initiation of budding and cellular polarization; interacts with Cdc42p via the Cdc42/Rac‐interactive binding (CRIB) domain and with PI(4,5)P2 via a polybasic region GIR2 YDR152W Highly‐acidic cytoplasmic RWD domain‐containing protein of 0.7382 0.0007 unknown function; forms a complex with Rbg2p; interacts with Rbg1p and Gcn1p; associates with translating ribosomes; putative intrinsically unstructured protein STE7 YDL159W Signal transducing MAP kinase kinase involved in pheromone 0.7365 0.0004 response, where it phosphorylates Fus3p, and in the pseudohyphal/invasive growth pathway, through phosphorylation of Kss1p; phosphorylated by Ste11p, degraded by ubiquitin pathway PDC2 YDR081C Transcription factor required for the synthesis of the glycolytic 0.7351 0.0003 enzyme pyruvate decarboxylase, required for high level expression of both the THI and the PDC genes APC4 YDR118W Subunit of the Anaphase‐Promoting Complex/Cyclosome (APC/C), 0.7349 0.0004 which is a ubiquitin‐protein ligase required for degradation of anaphase inhibitors, including mitotic cyclins, during the metaphase/anaphase transition GCS1 YDL226C ADP‐ribosylation factor GTPase activating protein (ARF GAP), 0.7328 0.0010 involved in ER‐Golgi transport; shares functional similarity with Glo3p NA YDL176W Protein of unknown function, predicted by computational methods 0.7307 0.0008 to be involved in fructose‐1,6‐bisphosphatase (Fbp1p) degradation; interacts with components of the GID complex; YDL176W is not an essential gene CWC2 YDL209C Member of the NineTeen Complex (NTC) that contains Prp19p and 0.7295 0.0006 stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; binds directly to U6 snRNA; similar to S. pombe Cwf2 OPT2 YPR194C Oligopeptide transporter; member of the OPT family, with potential 0.7236 0.0008 orthologs in S. pombe and C. albicans; also plays a role in formation of mature vacuoles 172

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l BIO4 YNR057C Dethiobiotin synthetase, catalyzes the third step in the biotin 0.7226 0.0006 biosynthesis pathway; BIO4 is in a cluster of 3 genes (BIO3, BIO4, and BIO5) that mediate biotin synthesis; expression appears to be repressed at low iron levels PAM1 YDR251W Essential protein of unknown function; exhibits variable expression 0.7219 0.0004 during colony morphogenesis; overexpression permits survival without protein phosphatase 2A, inhibits growth, and induces a filamentous phenotype TRS23 YDR246W One of 10 subunits of the transport protein particle (TRAPP) complex 0.7207 0.0006 of the cis‐Golgi which mediates vesicle docking and fusion; involved in endoplasmic reticulum (ER) to Golgi membrane traffic; human homolog is TRAPPC4 TMN2 YDR107C Protein with a role in cellular adhesion and filamentous growth; 0.7190 0.0006 similar to Emp70p and Tmn3p; member of the evolutionarily conserved Transmembrane Nine family of proteins with nine membrane‐spanning segments IVY1 YDR229W Phospholipid‐binding protein that interacts with both Ypt7p and 0.7179 0.0004 Vps33p, may partially counteract the action of Vps33p and vice versa, localizes to the rim of the vacuole as cells approach stationary phase NA YDR348C Protein of unknown function; green fluorescent protein (GFP)‐fusion 0.7140 0.0003 protein localizes to the cell periphery and bud neck; potential Cdc28p substrate STN1 YDR082W Telomere end‐binding and capping protein, plays a key role with 0.7138 0.0005 Pol12p in linking telomerase action with completion of lagging strand synthesis, and in a regulatory step required for telomere capping PCF11 YDR228C mRNA 3' end processing factor, essential component of cleavage and 0.7107 0.0004 polyadenylation factor IA (CF IA), involved in pre‐mRNA 3' end processing and in transcription termination; binds C‐terminal domain of largest subunit of RNA pol II (Rpo21p) HDA2 YDR295C Subunit of a possibly tetrameric trichostatin A‐sensitive class II 0.7102 0.0006 histone deacetylase complex containing an Hda1p homodimer and an Hda2p‐Hda3p heterodimer; involved in telomere maintenance

SPG1 YGR236C Protein required for survival at high temperature during stationary 0.7072 0.0008 phase; not required for growth on nonfermentable carbon sources; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies NA YGR067C Putative protein of unknown function; contains a zinc finger motif 0.7071 0.0005 similar to that of Adr1p PBP4 YDL053C Pbp1p binding protein, interacts strongly with Pab1p‐binding protein 0.7068 0.0008 1 (Pbp1p) in the yeast two‐hybrid system; also interacts with Lsm12p in a copurification assay NA YGR226C Dubious open reading frame, unlikely to encode a protein; not 0.7066 0.0009 conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W RPC11 YDR045C RNA polymerase III subunit C11; mediates pol III RNA cleavage 0.7057 0.0005 activity and is important for termination of transcription; homologous to TFIIS SIZ1 YDR409W SUMO/Smt3 ligase that promotes the attachment of sumo (Smt3p; 0.7030 0.0003 small ubiquitin‐related modifier) to proteins; binds Ubc9p and may bind septins; specifically required for sumoylation of septins in vivo; localized to the septin ring

173

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l TMS1 YDR105C Vacuolar membrane protein of unknown function that is conserved 0.7028 0.0004 in mammals; predicted to contain eleven transmembrane helices; interacts with Pdr5p, a protein involved in multidrug resistance YSP2 YDR326C Protein involved in programmed cell death; mutant shows resistance 0.7024 0.0010 to cell death induced by amiodarone or intracellular acidification GIP2 YER054C Putative regulatory subunit of the protein phosphatase Glc7p, 0.7013 0.0004 involved in glycogen metabolism; contains a conserved motif (GVNK motif) that is also found in Gac1p, Pig1p, and Pig2p ENT1 YDL161W Epsin‐like protein involved in endocytosis and actin patch assembly 0.6979 0.0003 and functionally redundant with Ent2p; binds clathrin via a clathrin‐ binding domain motif at C‐terminus SFA1 YDL168W Bifunctional enzyme containing both alcohol dehydrogenase and 0.6977 0.0004 glutathione‐dependent formaldehyde dehydrogenase activities, functions in formaldehyde detoxification and formation of long chain and complex alcohols, regulated by Hog1p‐Sko1p SAP30 YMR263W Subunit of a histone deacetylase complex, along with Rpd3p and 0.6971 0.0009 Sin3p, that is involved in silencing at telomeres, rDNA, and silent mating‐type loci; involved in telomere maintenance

GRX3 YDR098C Hydroperoxide and superoxide‐radical responsive glutathione‐ 0.6967 0.0003 dependent oxidoreductase; monothiol glutaredoxin subfamily member along with Grx4p and Grx5p; protects cells from oxidative damage THI7 YLR237W Plasma membrane transporter responsible for the uptake of 0.6912 0.0006 thiamine, member of the major facilitator superfamily of transporters; mutation of human ortholog causes thiamine‐ responsive megaloblastic anemia NA YDR115W Putative mitochondrial ribosomal protein of the large subunit, has 0.6897 0.0009 similarity to E. coli L34 ribosomal protein; required for respiratory growth, as are most mitochondrial ribosomal proteins GDH2 YDL215C NAD(+)‐dependent glutamate dehydrogenase, degrades glutamate 0.6887 0.0004 to ammonia and alpha‐ketoglutarate; expression sensitive to nitrogen catabolite repression and intracellular ammonia levels

SPT3 YDR392W Subunit of the SAGA and SAGA‐like transcriptional regulatory 0.6878 0.0008 complexes, interacts with Spt15p to activate transcription of some RNA polymerase II‐dependent genes, also functions to inhibit transcription at some promoters PCK1 YKR097W Phosphoenolpyruvate carboxykinase, key enzyme in 0.6870 0.0003 gluconeogenesis, catalyzes early reaction in carbohydrate biosynthesis, glucose represses transcription and accelerates mRNA degradation, regulated by Mcm1p and Cat8p, located in the cytosol PEX5 YDR244W Peroxisomal membrane signal receptor for the C‐terminal tripeptide 0.6823 0.0008 signal sequence (PTS1) of peroxisomal matrix proteins, required for peroxisomal matrix protein import; also proposed to have PTS1‐ receptor independent functions NTG2 YOL043C DNA N‐glycosylase and apurinic/apyrimidinic (AP) lyase involved in 0.6777 0.0004 base excision repair, localizes to the nucleus; sumoylated GLE1 YDL207W Cytoplasmic nucleoporin required for polyadenylated RNA export 0.6772 0.0004 but not for protein import; component of Nup82p nuclear pore subcomplex; contains a nuclear export signal GPR1 YDL035C Plasma membrane G protein coupled receptor (GPCR) that interacts 0.6758 0.0005 with the heterotrimeric G protein alpha subunit, Gpa2p, and with Plc1p; sensor that integrates nutritional signals with the modulation of cell fate via PKA and cAMP synthesis

174

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l RRP42 YDL111C Exosome non‐catalytic core component; involved in 3'‐5' RNA 0.6737 0.0005 processing and degradation in both the nucleus and the cytoplasm; has similarity to E. coli RNase PH and to human hRrp42p (EXOSC7)

NA YNL146W Putative protein of unknown function; green fluorescent protein 0.6725 0.0006 (GFP)‐fusion protein localizes to the endoplasmic reticulum; YNL146W is not an essential gene YSY6 YBR162W‐A Protein whose expression suppresses a secretory pathway mutation 0.6723 0.0010 in E. coli; has similarity to the mammalian RAMP4 protein involved in secretion NA YDR391C Putative protein of unknown function, possibly involved in zinc 0.6706 0.0004 homeostasis; Bdf1p‐dependent transcription induced by salt stress; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus SYF1 YDR416W Member of the NineTeen Complex (NTC) that contains Prp19p and 0.6684 0.0007 stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; null mutant has splicing defect and arrests in G2/M; homologs in human and C. elegans MSL1 YIR009W U2B component of U2 snRNP, involved in splicing, binds the U2 0.6682 0.0008 snRNA stem‐loop IV in vitro but requires association of Lea1p for in vivo binding; does not contain the conserved C‐terminal RNA binding domain found in other family members PSF1 YDR013W Subunit of the GINS complex (Sld5p, Psf1p, Psf2p, Psf3p), which is 0.6675 0.0005 localized to DNA replication origins and implicated in assembly of the DNA replication machinery SPO12 YHR152W Nucleolar protein of unknown function, positive regulator of mitotic 0.6662 0.0003 exit; involved in regulating release of Cdc14p from the nucleolus in early anaphase, may play similar role in meiosis NA YDL157C Putative protein of unknown function; the authentic, non‐tagged 0.6653 0.0007 protein is detected in highly purified mitochondria in high‐ throughput studies ADE1 YAR015W N‐succinyl‐5‐aminoimidazole‐4‐carboxamide ribotide (SAICAR) 0.6634 0.0006 synthetase, required for 'de novo' purine nucleotide biosynthesis; red pigment accumulates in mutant cells deprived of adenine PKH1 YDR490C Serine/threonine protein kinase involved in sphingolipid‐mediated 0.6596 0.0009 signaling pathway that controls endocytosis; activates Ypk1p and Ykr2p, components of signaling cascade required for maintenance of cell wall integrity; redundant with Pkh2p NA YCR076C Putative protein of unknown function; YCR076C is not an essential 0.6595 0.0010 gene SLY1 YDR189W Hydrophilic protein involved in vesicle trafficking between the ER 0.6574 0.0007 and Golgi; SM (Sec1/Munc‐18) family protein that binds the tSNARE Sed5p and stimulates its assembly into a trans‐SNARE membrane‐ protein complex PHO8 YDR481C Repressible alkaline phosphatase, a glycoprotein localized to the 0.6553 0.0005 vacuole; regulated by levels of inorganic phosphate and by a system consisting of Pho4p, Pho9p, Pho80p, Pho81p and Pho85p; dephosphorylates phosphotyrosyl peptides DAL2 YIR029W Allantoicase, converts allantoate to urea and ureidoglycolate in the 0.6542 0.0008 second step of allantoin degradation; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation PRM3 YPL192C Pheromone‐regulated protein required for nuclear envelope fusion 0.6539 0.0005 during karyogamy; localizes to the outer face of the nuclear membrane; interacts with Kar5p at the spindle pole body 175

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l MIM1 YOL026C Mitochondrial outer membrane protein, required for assembly of 0.6496 0.0004 the translocase of the outer membrane (TOM) complex and thereby for mitochondrial protein import; N terminus is exposed to the cytosol: transmembrane segment is highly conserved TRS85 YDR108W Subunit of TRAPPIII (transport protein particle), a multimeric guanine 0.6490 0.0007 nucleotide‐exchange factor for Ypt1p, required for membrane expansion during autophagy and the CVT pathway; directs Ypt1p to the PAS; late post‐replication meiotic role MSS2 YDL107W Peripherally bound inner membrane protein of the mitochondrial 0.6489 0.0009 matrix involved in membrane insertion of C‐terminus of Cox2p, interacts genetically and physically with Cox18p

DIF1 YLR437C Protein that regulates the nuclear localization of ribonucleotide 0.6489 0.0008 reductase Rnr2p and Rnr4p subunits; phosphorylated by Dun1p in response to DNA damage and degraded; N‐terminal half has similarity to S. pombe Spd1 protein NTG1 YAL015C DNA N‐glycosylase and apurinic/apyrimidinic (AP) lyase involved in 0.6471 0.0005 base excision repair; acts in both nucleus and mitochondrion; creates a double‐strand break at mtDNA origins that stimulates replication in response to oxidative stress PRP9 YDL030W Subunit of the SF3a splicing factor complex, required for 0.6412 0.0005 spliceosome assembly; acts after the formation of the U1 snRNP‐ pre‐mRNA complex SME1 YOR159C Core Sm protein Sm E; part of heteroheptameric complex (with 0.6371 0.0005 Smb1p, Smd1p, Smd2p, Smd3p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm E SLX5 YDL013W Subunit of the Slx5‐Slx8 SUMO‐targeted ubiquitin ligase (STUbL) 0.6345 0.0009 complex, stimulated by SUMO‐modified substrates; contains a RING domain and two SIMs (SUMO‐interacting motifs); forms SUMO‐ dependent nuclear foci, including DNA repair centers CRP1 YHR146W Protein that binds to cruciform DNA structures 0.6345 0.0004 FMP32 YFL046W Putative protein of unknown function; the authentic, non‐tagged 0.6308 0.0006 protein is detected in highly purified mitochondria in high‐ throughput studies SEC20 YDR498C Membrane glycoprotein v‐SNARE involved in retrograde transport 0.6284 0.0010 from the Golgi to the ER; required for N‐ and O‐glycosylation in the Golgi but not in the ER; interacts with the Dsl1p complex through Tip20p NA YDR061W Protein with similarity to ATP‐binding cassette (ABC) transporter 0.6282 0.0009 family members; lacks predicted membrane‐spanning regions; transcriptionally activated by Yrm1p along with genes involved in multidrug resistance CTH1 YDR151C Member of the CCCH zinc finger family; has similarity to mammalian 0.6258 0.0007 Tis11 protein, which activates transcription and also has a role in mRNA degradation; may function with Tis11p in iron homeostasis SLI15 YBR156C Subunit of the conserved chromosomal passenger complex (CPC; 0.6227 0.0004 Ipl1p‐Sli15p‐Bir1p‐Nbl1p), which regulates kinetochore‐microtubule attachments, activation of the spindle tension checkpoint, and mitotic spindle disassembly SOK1 YDR006C Protein whose overexpression suppresses the growth defect of 0.6209 0.0007 mutants lacking protein kinase A activity; involved in cAMP‐ mediated signaling; localized to the nucleus; similar to the mouse testis‐specific protein PBS13

176

log2(mtr10 adj.p.va Symbols ORF Description .Tf/WT.Tf) l FAD1 YDL045C Flavin adenine dinucleotide (FAD) synthetase, performs the second 0.6176 0.0006 step in synthesis of FAD from riboflavin RPN4 YDL020C Transcription factor that stimulates expression of proteasome genes; 0.6161 0.0009 Rpn4p levels are in turn regulated by the 26S proteasome in a negative feedback control mechanism; RPN4 is transcriptionally regulated by various stress responses TMA64 YDR117C Protein of unknown function that associates with ribosomes; has a 0.6159 0.0007 putative RNA binding domain; in mammals the corresponding protein, eIF2D, has been shown to possess translation initiation factor activity RSM10 YDR041W Mitochondrial ribosomal protein of the small subunit, has similarity 0.6157 0.0009 to E. coli S10 ribosomal protein; essential for viability, unlike most other mitoribosomal proteins BLS1 YLR408C Putative protein of unknown function; likely member of BLOC 0.6137 0.0005 complex involved in endosomal cargo sorting; green fluorescent protein (GFP)‐fusion protein localizes to the endosome; YLR408C is not an essential gene NA YDR319C Putative protein of unknown function, identified as an ortholog of 0.6133 0.0008 the highly conserved FIT family of proteins involved in triglyceride droplet biosynthesis; interacts with Sst2p and Hsp82p in high‐ throughput two‐hybrid screens MTC5 YDR128W Protein of unknown function; mtc5 is synthetically sick with cdc13‐1 0.6131 0.0006 RAD30 YDR419W DNA polymerase eta, involved in translesion synthesis during post‐ 0.6125 0.0008 replication repair; catalyzes the synthesis of DNA opposite cyclobutane pyrimidine dimers and other lesions; mutations in human pol eta are responsible for XPV TFB1 YDR311W Subunit of TFIIH and nucleotide excision repair factor 3 complexes, 0.6007 0.0005 required for nucleotide excision repair, target for transcriptional activators

177

APPENDIX I: Down-regulated genes in mtr10Δ cells in amino acid starvation condition

This section includes the list of transcriptionally differentially expressed genes (cutoff conditions: log2 FC 0.6 and adjusted p-value < 0.001) in mtr10Δ cells in amino acid starved condition.

Down-regulated genes in mtr10Δ cells in amino acid starved condition

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al MTR10 YOR160W Nuclear import receptor, mediates the nuclear localization of ‐6.5259 0.0000 proteins involved in mRNA‐nucleus export; promotes dissociation of mRNAs from the nucleus‐cytoplasm mRNA shuttling protein Npl3p; required for retrograde import of mature tRNAs GTO3 YMR251W Omega class glutathione transferase; putative cytosolic localization ‐3.5739 0.0000 FCY21 YER060W Putative purine‐cytosine permease, very similar to Fcy2p but cannot ‐2.9267 0.0000 substitute for its function PNS1 YOR161C Protein of unknown function; has similarity to Torpedo californica ‐2.9240 0.0000 tCTL1p, which is postulated to be a choline transporter, neither null mutation nor overexpression affects choline transport

NA YHR022C Putative protein of unknown function; YHR022C is not an essential ‐2.8403 0.0000 gene QDR2 YIL121W Multidrug transporter of the major facilitator superfamily, required ‐2.7694 0.0000 for resistance to quinidine, barban, cisplatin, and bleomycin; may have a role in potassium uptake NA YHR140W Putative integral membrane protein of unknown function ‐2.6771 0.0000 FRE5 YOR384W Putative ferric reductase with similarity to Fre2p; expression induced ‐2.6487 0.0005 by low iron levels; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies

ASG7 YJL170C Protein that regulates signaling from a G protein beta subunit Ste4p ‐2.6013 0.0001 and its relocalization within the cell; specific to a‐cells and induced by alpha‐factor NA YHL012W Putative protein of unknown function, has some homology to Ugp1p, ‐2.5857 0.0000 which encodes UDP‐glucose pyrophosphorylase

178

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al HOP1 YIL072W Meiosis‐specific DNA binding protein that displays Red1p dependent ‐2.5684 0.0001 localization to the unsynapsed axial‐lateral elements of the synaptonemal complex; required for homologous chromosome synapsis and chiasma formation TIS11 YLR136C mRNA‐binding protein expressed during iron starvation; binds to a ‐2.5208 0.0003 sequence element in the 3'‐untranslated regions of specific mRNAs to mediate their degradation; involved in iron homeostasis

ECM13 YBL043W Non‐essential protein of unknown function; induced by treatment ‐2.4759 0.0002 with 8‐methoxypsoralen and UVA irradiation IRC15 YPL017C Microtubule associated protein; regulates microtubule dynamics; ‐2.4546 0.0000 required for accurate meiotic chromosome segregation; null mutant displays large budded cells due to delayed mitotic progression, increased levels of spontaneous Rad52 foci FIT2 YOR382W Mannoprotein that is incorporated into the cell wall via a ‐2.4289 0.0001 glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall NA NA NA ‐2.3974 0.0000 NA NA NA ‐2.3489 0.0001 RGS2 YOR107W Negative regulator of glucose‐induced cAMP signaling; directly ‐2.2947 0.0000 activates the GTPase activity of the heterotrimeric G protein alpha subunit Gpa2p NA YHL044W Putative integral membrane protein, member of DUP240 gene ‐2.2924 0.0000 family; green fluorescent protein (GFP)‐fusion protein localizes to the plasma membrane in a punctate pattern BSC5 YNR069C Protein of unknown function, ORF exhibits genomic organization ‐2.2588 0.0000 compatible with a translational readthrough‐dependent mode of expression SFK1 YKL051W Plasma membrane protein that may act together with or upstream ‐2.2187 0.0000 of Stt4p to generate normal levels of the essential phospholipid PI4P, at least partially mediates proper localization of Stt4p to the plasma membrane NA YOL163W Putative protein of unknown function; member of the Dal5p ‐2.2123 0.0002 subfamily of the major facilitator family BDH2 YAL061W Putative medium‐chain alcohol dehydrogenase with similarity to ‐2.2117 0.0001 BDH1; transcription induced by constitutively active PDR1 and PDR3 DCI1 YOR180C Peroxisomal protein; identification as a delta(3,5)‐delta(2,4)‐dienoyl‐ ‐2.0800 0.0000 CoA isomerase involved in fatty acid metabolism is disputed FTR1 YER145C High affinity iron permease involved in the transport of iron across ‐2.0392 0.0001 the plasma membrane; forms complex with Fet3p; expression is regulated by iron ARN1 YHL040C Transporter, member of the ARN family of transporters that ‐1.9903 0.0000 specifically recognize siderophore‐iron chelates; responsible for uptake of iron bound to ferrirubin, ferrirhodin, and related siderophores PTH1 YHR189W One of two (see also PTH2) mitochondrially‐localized peptidyl‐tRNA ‐1.9587 0.0004 hydrolases; dispensable for respiratory growth on rich medium, but required for respiratory growth on minimal medium RSB1 YOR049C Suppressor of sphingoid long chain base (LCB) sensitivity of an LCB‐ ‐1.9518 0.0001 lyase mutation; putative integral membrane transporter or flippase that may transport LCBs from the cytoplasmic side toward the extracytoplasmic side of the membrane ENT4 YLL038C Protein of unknown function, contains an N‐terminal epsin‐like ‐1.9459 0.0002 domain; proposed to be involved in the trafficking of Arn1p in the absence of ferrichrome

179

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al CWP1 YKL096W Cell wall mannoprotein that localizes specifically to birth scars of ‐1.9204 0.0001 daughter cells, linked to a beta‐1,3‐ and beta‐1,6‐glucan heteropolymer through a phosphodiester bond; required for propionic acid resistance ARN2 YHL047C Transporter, member of the ARN family of transporters that ‐1.9007 0.0002 specifically recognize siderophore‐iron chelates; responsible for uptake of iron bound to the siderophore triacetylfusarinine C PGM2 YMR105C Phosphoglucomutase, catalyzes the conversion from glucose‐1‐ ‐1.8989 0.0000 phosphate to glucose‐6‐phosphate, which is a key step in hexose metabolism; functions as the acceptor for a Glc‐phosphotransferase NA YAR066W Putative GPI protein ‐1.8971 0.0000 SPS19 YNL202W Peroxisomal 2,4‐dienoyl‐CoA reductase, auxiliary enzyme of fatty ‐1.8932 0.0000 acid beta‐oxidation; homodimeric enzyme required for growth and sporulation on petroselineate medium; expression induced during late sporulation and in the presence of oleate NA YHL018W Putative protein of unknown function; green fluorescent protein ‐1.8807 0.0001 (GFP)‐fusion protein localizes to mitochondria and is induced in response to the DNA‐damaging agent MMS VPS73 YGL104C Mitochondrial protein; mutation affects vacuolar protein sorting; ‐1.8740 0.0001 putative transporter; member of the sugar porter family VMR1 YHL035C Vacuolar membrane protein involved in multiple drug resistance and ‐1.8671 0.0000 metal sensitivity; ATP‐binding cassette (ABC) family member involved in drug transport; potential Cdc28p substrate; induced under respiratory conditions ICS2 YBR157C Protein of unknown function; null mutation does not confer any ‐1.8568 0.0001 obvious defects in growth, spore germination, viability, or carbohydrate utilization SAP4 YGL229C Protein required for function of the Sit4p protein phosphatase, ‐1.8559 0.0000 member of a family of similar proteins that form complexes with Sit4p, including Sap155p, Sap185p, and Sap190p BAR1 YIL015W Aspartyl protease secreted into the periplasmic space of mating type ‐1.8466 0.0002 a cells, helps cells find mating partners, cleaves and inactivates alpha factor allowing cells to recover from alpha‐factor‐induced cell cycle arrest NRT1 YOR071C High‐affinity nicotinamide riboside transporter; also transports ‐1.8354 0.0001 thiamine with low affinity; shares sequence similarity with Thi7p and Thi72p; proposed to be involved in 5‐fluorocytosine sensitivity NA YPL113C Glyoxylate reductase; acts on glyoxylate and hydroxypyruvate ‐1.8255 0.0001 substrates; YPL113C is not an essential gene MAL13 YGR288W MAL‐activator protein, part of complex locus MAL1; nonfunctional in ‐1.8198 0.0001 genomic reference strain S288C FIT3 YOR383C Mannoprotein that is incorporated into the cell wall via a ‐1.8045 0.0002 glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall CMC4 YMR194C‐ Protein that localizes to the mitochondrial intermembrane space via ‐1.8038 0.0000 B the Mia40p‐Erv1p system; contains twin cysteine‐x(9)‐cysteine motifs AAR2 YBL074C Component of the U5 snRNP, required for splicing of U3 precursors; ‐1.7559 0.0000 originally described as a splicing factor specifically required for splicing pre‐mRNA of the MATa1 cistron FRE8 YLR047C Protein with sequence similarity to iron/copper reductases, involved ‐1.7489 0.0006 in iron homeostasis; deletion mutant has iron deficiency/accumulation growth defects; expression increased in the absence of copper‐responsive transcription factor Mac1p

180

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al STE2 YFL026W Receptor for alpha‐factor pheromone; seven transmembrane‐ ‐1.7461 0.0003 domain GPCR that interacts with both pheromone and a heterotrimeric G protein to initiate the signaling response that leads to mating between haploid a and alpha cells COS9 YKL219W Protein of unknown function, member of the DUP380 subfamily of ‐1.7450 0.0000 conserved, often subtelomerically‐encoded proteins RRT6 YGL146C Putative protein of unknown function; non‐essential gene identified ‐1.7288 0.0003 in a screen for mutants with increased levels of rDNA transcription; contains two putative transmembrane spans, but no significant homology to other known proteins NA YCR100C Putative protein of unknown function ‐1.7260 0.0001 JEN1 YKL217W Lactate transporter, required for uptake of lactate and pyruvate; ‐1.7220 0.0003 phosphorylated; expression is derepressed by transcriptional activator Cat8p during respiratory growth, and repressed in the presence of glucose, fructose, and mannose PPT2 YPL148C Phosphopantetheine:protein transferase (PPTase), activates ‐1.6967 0.0000 mitochondrial acyl carrier protein (Acp1p) by phosphopantetheinylation PMA2 YPL036W Plasma membrane H+‐ATPase, isoform of Pma1p, involved in ‐1.6932 0.0000 pumping protons out of the cell; regulator of cytoplasmic pH and plasma membrane potential RDS1 YCR106W Zinc cluster transcription factor involved in conferring resistance to ‐1.6585 0.0001 cycloheximide NA YJR154W Putative protein of unknown function; green fluorescent protein ‐1.6521 0.0000 (GFP)‐fusion protein localizes to the cytoplasm FRE2 YKL220C Ferric reductase and cupric reductase, reduces siderophore‐bound ‐1.6436 0.0000 iron and oxidized copper prior to uptake by transporters; expression induced by low iron levels but not by low copper levels TPO4 YOR273C Polyamine transport protein, recognizes spermine, putrescine, and ‐1.6415 0.0000 spermidine; localizes to the plasma membrane; member of the major facilitator superfamily STE3 YKL178C Receptor for a factor pheromone, couples to MAP kinase cascade to ‐1.6289 0.0000 mediate pheromone response; transcribed in alpha cells and required for mating by alpha cells, ligand bound receptors endocytosed and recycled to the plasma membrane; GPCR ENB1 YOL158C Endosomal ferric enterobactin transporter, expressed under ‐1.6237 0.0001 conditions of iron deprivation; member of the major facilitator superfamily; expression is regulated by Rcs1p and affected by chloroquine treatment NA YLR152C Putative protein of unknown function; YLR152C is not an essential ‐1.6226 0.0000 gene PRM1 YNL279W Pheromone‐regulated multispanning membrane protein involved in ‐1.6171 0.0002 membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p GEM1 YAL048C Evolutionarily‐conserved tail‐anchored outer mitochondrial ‐1.6141 0.0001 membrane GTPase which regulates mitochondrial morphology; cells lacking Gem1p contain collapsed, globular, or grape‐like mitochondria; not required for pheromone‐induced cell death PEX18 YHR160C Peroxin required for targeting of peroxisomal matrix proteins ‐1.5940 0.0002 containing PTS2; interacts with Pex7p; partially redundant with Pex21p

181

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al SST2 YLR452C GTPase‐activating protein for Gpa1p, regulates desensitization to ‐1.5914 0.0002 alpha factor pheromone; also required to prevent receptor‐ independent signaling of the mating pathway; member of the RGS (regulator of G‐protein signaling) family GSY1 YFR015C Glycogen synthase with similarity to Gsy2p, the more highly ‐1.5879 0.0001 expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary phase LAG1 YHL003C Ceramide synthase component, involved in synthesis of ceramide ‐1.5733 0.0000 from C26(acyl)‐coenzyme A and dihydrosphingosine or phytosphingosine, functionally equivalent to Lac1p TYE7 YOR344C Serine‐rich protein that contains a basic‐helix‐loop‐helix (bHLH) DNA ‐1.5672 0.0001 binding motif; binds E‐boxes of glycolytic genes and contributes to their activation; may function as a transcriptional activator in Ty1‐ mediated gene expression SIT1 YEL065W Ferrioxamine B transporter, member of the ARN family of ‐1.5529 0.0004 transporters that specifically recognize siderophore‐iron chelates; transcription is induced during iron deprivation and diauxic shift; potentially phosphorylated by Cdc28p TCA17 YEL048C Protein that interacts with subunits of the TRAPP complex and may ‐1.5262 0.0001 play a role its assembly or stability; mutation is synthetically lethal with gcs1 deletion; Sedlin_N family member; human Sedlin mutations cause the skeletal disorder SEDT NA YOR316C‐ Putative protein of unknown function; identified by fungal homology ‐1.5260 0.0006 A and RT‐PCR GDH3 YAL062W NADP(+)‐dependent glutamate dehydrogenase, synthesizes ‐1.5230 0.0005 glutamate from ammonia and alpha‐ketoglutarate; rate of alpha‐ ketoglutarate utilization differs from Gdh1p; expression regulated by nitrogen and carbon sources SCS7 YMR272C Sphingolipid alpha‐hydroxylase, functions in the alpha‐hydroxylation ‐1.5021 0.0000 of sphingolipid‐associated very long chain fatty acids, has both cytochrome b5‐like and hydroxylase/desaturase domains, not essential for growth FCY22 YER060W‐ Putative purine‐cytosine permease, very similar to Fcy2p but cannot ‐1.5015 0.0001 A substitute for its function NFT1 YKR103W Putative transporter of the multidrug resistance‐associated protein ‐1.5011 0.0006 (MRP) subfamily; adjacent ORFs YKR103W and YKR104W are merged in different strain backgrounds. PPM2 YOL141W AdoMet‐dependent tRNA methyltransferase also involved in ‐1.4985 0.0001 methoxycarbonylation; required for the synthesis of wybutosine (yW), a modified guanosine found at the 3'‐position adjacent to the anticodon of phe‐tRNA; similarity to Ppm1p SDP1 YIL113W Stress‐inducible dual‐specificity MAP kinase phosphatase, negatively ‐1.4830 0.0006 regulates Slt2p MAP kinase by direct dephosphorylation, diffuse localization under normal conditions shifts to punctate localization after heat shock NA YCR061W Protein of unknown function; green fluorescent protein (GFP)‐fusion ‐1.4802 0.0001 protein localizes to the cytoplasm in a punctate pattern; induced by treatment with 8‐methoxypsoralen and UVA irradiation NA YJL160C Putative protein of unknown function; member of the PIR (proteins ‐1.4756 0.0002 with internal repeats) family of cell wall proteins; non‐essential gene that is required for sporulation; mRNA is weakly cell cycle regulated, peaking in mitosis CRC1 YOR100C Mitochondrial inner membrane carnitine transporter, required for ‐1.4702 0.0001 carnitine‐dependent transport of acetyl‐CoA from peroxisomes to mitochondria during fatty acid beta‐oxidation

182

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al ERC1 YHR032W Member of the multi‐drug and toxin extrusion (MATE) family of the ‐1.4639 0.0001 multidrug/oligosaccharidyl‐lipid/polysaccharide (MOP) exporter superfamily; overproduction confers ethionine resistance and accumulation of S‐adenosylmethionine THI72 YOR192C Transporter of thiamine or related compound; shares sequence ‐1.4613 0.0002 similarity with Thi7p WHI5 YOR083W Repressor of G1 transcription that binds to SCB binding factor (SBF) ‐1.4612 0.0007 at SCB target promoters in early G1; phosphorylation of Whi5p by the CDK, Cln3p/Cdc28p relieves repression and promoter binding by Whi5; periodically expressed in G1 YJU2 YKL095W Essential protein required for pre‐mRNA splicing; associates ‐1.4600 0.0001 transiently with the spliceosomal NTC ("nineteen complex") and acts after Prp2p to promote the first catalytic reaction of splicing

FET3 YMR058W Ferro‐O2‐oxidoreductase required for high‐affinity iron uptake and ‐1.4573 0.0003 involved in mediating resistance to copper ion toxicity, belongs to class of integral membrane multicopper oxidases NA YMR262W Protein of unknown function; interacts weakly with Knr4p; ‐1.4455 0.0000 YMR262W is not an essential gene GAL7 YBR018C Galactose‐1‐phosphate uridyl transferase, synthesizes glucose‐1‐ ‐1.4409 0.0001 phosphate and UDP‐galactose from UDP‐D‐glucose and alpha‐D‐ galactose‐1‐phosphate in the second step of galactose catabolism

NA YGL081W Putative protein of unknown function; non‐essential gene; interacts ‐1.4402 0.0001 genetically with CHS5, a gene involved in chitin biosynthesis SMF3 YLR034C Putative divalent metal ion transporter involved in iron homeostasis; ‐1.4194 0.0000 transcriptionally regulated by metal ions; member of the Nramp family of metal transport proteins NA YMR279C Putative paralog of ATR1, but not required for boron tolerance; ‐1.4192 0.0000 identified as a heat‐induced gene in a high‐throughout screen; YMR279C is not an essential gene PXA1 YPL147W Subunit of a heterodimeric peroxisomal ATP‐binding cassette ‐1.4104 0.0001 transporter complex (Pxa1p‐Pxa2p), required for import of long‐ chain fatty acids into peroxisomes; similarity to human adrenoleukodystrophy transporter and ALD‐related proteins DCR2 YLR361C Phosphoesterase involved in downregulation of the unfolded protein ‐1.3977 0.0001 response, at least in part via dephosphorylation of Ire1p; dosage‐ dependent positive regulator of the G1/S phase transition through control of the timing of START NA YJL213W Protein of unknown function that may interact with ribosomes; ‐1.3949 0.0000 periodically expressed during the yeast metabolic cycle; phosphorylated in vitro by the mitotic exit network (MEN) kinase complex, Dbf2p/Mob1p ATG29 YPL166W Autophagy‐specific protein that is required for recruitment of other ‐1.3914 0.0002 ATG proteins to the pre‐autophagosomal structure (PAS); interacts with Atg17p and localizas to the PAS in a manner interdependent with Atg17p and Cis1p; not conserved SKN1 YGR143W Protein involved in sphingolipid biosynthesis; type II membrane ‐1.3789 0.0000 protein with similarity to Kre6p GSY2 YLR258W Glycogen synthase, similar to Gsy1p; expression induced by glucose ‐1.3707 0.0003 limitation, nitrogen starvation, heat shock, and stationary phase; activity regulated by cAMP‐dependent, Snf1p and Pho85p kinases as well as by the Gac1p‐Glc7p phosphatase

183

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al NA YLR446W Putative protein of unknown function with similarity to hexokinases; ‐1.3653 0.0000 transcript is upregulated during sporulation and the unfolded protein response; YLR446W is not an essential gene

YPT35 YHR105W Endosomal protein of unknown function that contains a phox (PX) ‐1.3632 0.0009 homology domain and binds to both phosphatidylinositol‐3‐ phosphate (PtdIns(3)P) and proteins involved in ER‐Golgi or vesicular transport AUS1 YOR011W Transporter of the ATP‐binding cassette family, involved in uptake of ‐1.3577 0.0003 sterols and anaerobic growth MCH5 YOR306C Plasma membrane riboflavin transporter; facilitates the uptake of ‐1.3486 0.0002 vitamin B2; required for FAD‐dependent processes; sequence similarity to mammalian monocarboxylate permeases, however mutants are not deficient in monocarboxylate transport VBA2 YBR293W Permease of basic amino acids in the vacuolar membrane ‐1.3380 0.0002 ATP10 YLR393W Mitochondrial inner membrane protein required for assembly of the ‐1.3348 0.0002 F0 sector of mitochondrial F1F0 ATP synthase, interacts genetically with ATP6 SPS100 YHR139C Protein required for spore wall maturation; expressed during ‐1.3317 0.0001 sporulation; may be a component of the spore wall; expression also induced in cells treated with the mycotoxin patulin

RPS28B YLR264W Protein component of the small (40S) ribosomal subunit; nearly ‐1.3233 0.0001 identical to Rps28Ap and has similarity to rat S28 ribosomal protein MRS4 YKR052C Iron transporter that mediates Fe2+ transport across the inner ‐1.3206 0.0003 mitochondrial membrane; mitochondrial carrier family member, similar to and functionally redundant with Mrs3p; active under low‐ iron conditions; may transport other cations NA YGR117C Putative protein of unknown function; green fluorescent protein ‐1.3190 0.0001 (GFP)‐fusion protein localizes to the cytoplasm MMT2 YPL224C Putative metal transporter involved in mitochondrial iron ‐1.3181 0.0000 accumulation; closely related to Mmt1p ROD1 YOR018W Membrane protein that binds the ubiquitin ligase Rsp5p via its 2 PY ‐1.3108 0.0006 motifs; overexpression confers resistance to the GST substrate o‐ dinitrobenzene,zinc, and calcium; proposed to regulate the endocytosis of plasma membrane proteins KRE5 YOR336W Protein required for beta‐1,6 glucan biosynthesis; mutations result in ‐1.3035 0.0000 aberrant morphology and severe growth defects NA YLR126C Putative protein of unknown function with similarity to glutamine ‐1.3034 0.0002 amidotransferase proteins; has Aft1p‐binding motif in the promoter; may be involved in copper and iron homeostasis; YLR126C is not an essential protein DTR1 YBR180W Putative dityrosine transporter, required for spore wall synthesis; ‐1.3009 0.0002 expressed during sporulation; member of the major facilitator superfamily (DHA1 family) of multidrug resistance transporters

NA YKR104W Putative transporter of the multidrug resistance‐associated protein ‐1.2994 0.0000 (MRP) subfamily; contains a stop codon in S288C; adjacent ORFs YKR103W and YKR104W are merged in different strain backgrounds RTC4 YNL254C Protein of unknown function; null mutation suppresses cdc13‐1 ‐1.2966 0.0000 temperature sensitivity; (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus NA YER085C Putative protein of unknown function ‐1.2916 0.0004 NA YKR041W Putative protein of unknown function; green fluorescent protein ‐1.2874 0.0008 (GFP)‐fusion protein localizes to the cytoplasm and nucleus

184

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al YBP1 YBR216C Protein required for oxidation of specific cysteine residues of the ‐1.2870 0.0002 transcription factor Yap1p, resulting in the nuclear localization of Yap1p in response to stress PDC6 YGR087C Minor isoform of pyruvate decarboxylase, decarboxylates pyruvate ‐1.2821 0.0001 to acetaldehyde, involved in amino acid catabolism; transcription is glucose‐ and ethanol‐dependent, and is strongly induced during sulfur limitation ATG15 YCR068W Lipase required for intravacuolar lysis of autophagic bodies and Cvt ‐1.2792 0.0002 bodies; targeted to intravacuolar vesicles during autophagy via the multivesicular body (MVB) pathway SEC59 YMR013C Dolichol kinase, catalyzes the terminal step in dolichyl ‐1.2789 0.0000 monophosphate (Dol‐P) biosynthesis; required for viability and for normal rates of lipid intermediate synthesis and protein N‐ glycosylation PRY1 YJL079C Protein of unknown function ‐1.2753 0.0000 SFP1 YLR403W Transcription factor that controls expression of ribosome biogenesis ‐1.2672 0.0002 genes in response to nutrients and stress, regulates G2/M transitions during mitotic cell cycle and DNA‐damage response, modulates cell size; regulated by TORC1 and Mrs6p RPL8A YHL033C Ribosomal protein L4 of the large (60S) ribosomal subunit, nearly ‐1.2662 0.0000 identical to Rpl8Bp and has similarity to rat L7a ribosomal protein; mutation results in decreased amounts of free 60S subunits RRN10 YBL025W Protein involved in promoting high level transcription of rDNA, ‐1.2646 0.0000 subunit of UAF (upstream activation factor) for RNA polymerase I MPD2 YOL088C Member of the protein disulfide isomerase (PDI) family, exhibits ‐1.2607 0.0000 chaperone activity; overexpression suppresses the lethality of a pdi1 deletion but does not complement all Pdi1p functions; undergoes oxidation by Ero1p NBL1 YHR199C‐ Subunit of the conserved chromosomal passenger complex (CPC; ‐1.2588 0.0004 A Ipl1p‐Sli15p‐Bir1p‐Nbl1p), which regulates mitotic chromosome segregation; not required for the kinase activity of the complex; mediates the interaction of Sli15p and Bir1p NA YPL264C Putative membrane protein of unknown function; physically ‐1.2550 0.0000 interacts with Hsp82p; YPL264C is not an essential gene FUS1 YCL027W Membrane protein localized to the shmoo tip, required for cell ‐1.2361 0.0004 fusion; expression regulated by mating pheromone; proposed to coordinate signaling, fusion, and polarization events required for fusion; potential Cdc28p substrate FMP43 YGR243W Putative protein of unknown function; expression regulated by ‐1.2345 0.0006 osmotic and alkaline stresses; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies BDS1 YOL164W Bacterially‐derived sulfatase required for use of alkyl‐ and aryl‐ ‐1.2324 0.0003 sulfates as sulfur sources AVT6 YER119C Vacuolar aspartate and glutamate exporter; member of a family of ‐1.2318 0.0002 seven genes (AVT1‐7) related to vesicular GABA‐glycine transporters; involved in compartmentalizing acidic amino acids in response to nitrogen starvation NA YGR205W ATP‐binding protein of unknown function; crystal structure ‐1.2307 0.0005 resembles that of E.coli pantothenate kinase and other small kinases SIP4 YJL089W C6 zinc cluster transcriptional activator that binds to the carbon ‐1.2269 0.0004 source‐responsive element (CSRE) of gluconeogenic genes; involved in the positive regulation of gluconeogenesis; regulated by Snf1p protein kinase; localized to the nucleus

185

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al MSN4 YKL062W Transcriptional activator related to Msn2p; activated in stress ‐1.2260 0.0001 conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression NA YHR210C Putative protein of unknown function; non‐essential gene; highly ‐1.2259 0.0000 expressed under anaeorbic conditions; sequence similarity to aldose 1‐epimerases such as GAL10 SMF1 YOL122C Divalent metal ion transporter with a broad specificity for di‐valent ‐1.2249 0.0001 and tri‐valent metals; post‐translationally regulated by levels of metal ions; member of the Nramp family of metal transport proteins

NA NA NA ‐1.2236 0.0002 SDS3 YIL084C Component of the Rpd3p/Sin3p deacetylase complex required for its ‐1.2199 0.0002 structural integrity and catalytic activity, involved in transcriptional silencing and required for sporulation; cells defective in SDS3 display pleiotropic phenotypes VAC8 YEL013W Phosphorylated and palmitoylated vacuolar membrane protein that ‐1.2193 0.0002 interacts with Atg13p, required for the cytoplasm‐to‐vacuole targeting (Cvt) pathway; interacts with Nvj1p to form nucleus‐ vacuole junctions ELO1 YJL196C Elongase I, medium‐chain acyl elongase, catalyzes carboxy‐terminal ‐1.2160 0.0000 elongation of unsaturated C12‐C16 fatty acyl‐CoAs to C16‐C18 fatty acids ULA1 YPL003W Protein that acts together with Uba3p to activate Rub1p before its ‐1.2092 0.0002 conjugation to proteins (neddylation), which may play a role in protein degradation NA YOR214C Putative protein of unknown function; YOR214C is not an essential ‐1.2084 0.0002 gene BNA4 YBL098W Kynurenine 3‐mono oxygenase, required for the de novo ‐1.2011 0.0000 biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p; putative therapeutic target for Huntington disease MUC1 YIR019C GPI‐anchored cell surface glycoprotein (flocculin) required for ‐1.1963 0.0002 pseudohyphal formation, invasive growth, flocculation, and biofilms; transcriptionally regulated by the MAPK pathway (via Ste12p and Tec1p) and the cAMP pathway (via Flo8p) NA YOL014W Putative protein of unknown function ‐1.1961 0.0004 ICL1 YER065C Isocitrate lyase, catalyzes the formation of succinate and glyoxylate ‐1.1951 0.0006 from isocitrate, a key reaction of the glyoxylate cycle; expression of ICL1 is induced by growth on ethanol and repressed by growth on glucose RTG1 YOL067C Transcription factor (bHLH) involved in interorganelle ‐1.1927 0.0002 communication between mitochondria, peroxisomes, and nucleus GYP6 YJL044C GTPase‐activating protein (GAP) for the yeast Rab family member, ‐1.1918 0.0000 Ypt6p; involved in vesicle mediated protein transport PDR5 YOR153W Plasma membrane ATP‐binding cassette (ABC) transporter, multidrug ‐1.1879 0.0001 transporter actively regulated by Pdr1p; also involved in steroid transport, cation resistance, and cellular detoxification during exponential growth NA YNR068C Putative protein of unknown function ‐1.1876 0.0002 SFG1 YOR315W Nuclear protein, putative transcription factor required for growth of ‐1.1804 0.0006 superficial pseudohyphae (which do not invade the agar substrate) but not for invasive pseudohyphal growth; may act together with Phd1p; potential Cdc28p substrate YAP5 YIR018W Basic leucine zipper (bZIP) transcription factor ‐1.1781 0.0000 186

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al PIC2 YER053C Mitochondrial phosphate carrier, imports inorganic phosphate into ‐1.1708 0.0001 mitochondria; functionally redundant with Mir1p but less abundant than Mir1p under normal conditions; expression is induced at high temperature PEX32 YBR168W Peroxisomal integral membrane protein, involved in negative ‐1.1673 0.0000 regulation of peroxisome size; partially functionally redundant with Pex31p; genetic interactions suggest action at a step downstream of steps mediated by Pex28p and Pex29p SHE4 YOR035C Protein containing a UCS (UNC‐45/CRO1/SHE4) domain, binds to ‐1.1664 0.0000 myosin motor domains to regulate myosin function; involved in endocytosis, polarization of the actin cytoskeleton, and asymmetric mRNA localization YEF1 YEL041W ATP‐NADH kinase; phosphorylates both NAD and NADH; ‐1.1660 0.0002 homooctameric structure consisting of 60‐kDa subunits; sequence similarity to Utr1p and Pos5p; overexpression complements certain pos5 phenotypes OAR1 YKL055C Mitochondrial 3‐oxoacyl‐[acyl‐carrier‐protein] reductase, may ‐1.1610 0.0001 comprise a type II mitochondrial fatty acid synthase along with Mct1p NA YLR031W Putative protein of unknown function ‐1.1590 0.0001 DIA2 YOR080W Origin‐binding F‐box protein that forms an SCF ubiquitin ligase ‐1.1574 0.0002 complex with Skp1p and Cdc53p; plays a role in DNA replication, involved in invasive and pseudohyphal growth STE12 YHR084W Transcription factor that is activated by a MAP kinase signaling ‐1.1567 0.0001 cascade, activates genes involved in mating or pseudohyphal/invasive growth pathways; cooperates with Tec1p transcription factor to regulate genes specific for invasive growth NA YER039C‐A Putative protein of unknown function; YER039C‐A is not an essential ‐1.1560 0.0003 gene GLN3 YER040W Transcriptional activator of genes regulated by nitrogen catabolite ‐1.1541 0.0003 repression (NCR), localization and activity regulated by quality of nitrogen source AGX1 YFL030W Alanine:glyoxylate aminotransferase (AGT), catalyzes the synthesis of ‐1.1526 0.0001 glycine from glyoxylate, which is one of three pathways for glycine biosynthesis in yeast; has similarity to mammalian and plant alanine:glyoxylate aminotransferases YPC1 YBR183W Alkaline ceramidase that also has reverse (CoA‐independent) ‐1.1476 0.0001 ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance ROG3 YFR022W Protein that binds the ubiquitin ligase Rsp5p via its 2 PY motifs; has ‐1.1472 0.0001 similarity to Rod1p; mutation suppresses the temperature sensitivity of an mck1 rim11 double mutant; proposed to regulate the endocytosis of plasma membrane proteins TDH1 YJL052W Glyceraldehyde‐3‐phosphate dehydrogenase, isozyme 1, involved in ‐1.1443 0.0003 glycolysis and gluconeogenesis; tetramer that catalyzes the reaction of glyceraldehyde‐3‐phosphate to 1,3 bis‐phosphoglycerate; detected in the cytoplasm and cell wall NA YMR253C Putative protein of unknown function; green fluorescent protein ‐1.1336 0.0003 (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern; YMR253C is not an essential gene DFG16 YOR030W Probable multiple transmembrane protein, involved in diploid ‐1.1248 0.0003 invasive and pseudohyphal growth upon nitrogen starvation; required for accumulation of processed Rim101p

187

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al YSP1 YHR155W Mitochondrial protein with a potential role in promoting ‐1.1127 0.0004 mitochondrial fragmentation during programmed cell death in response to high levels of alpha‐factor mating pheromone or the drug amiodarone NA YLR173W Putative protein of unknown function ‐1.1111 0.0002 PPE1 YHR075C Protein with carboxyl methyl esterase activity that may have a role in ‐1.1105 0.0000 demethylation of the phosphoprotein phosphatase catalytic subunit; also identified as a small subunit mitochondrial ribosomal protein

HOR2 YER062C One of two redundant DL‐glycerol‐3‐phosphatases (RHR2/GPP1 ‐1.1097 0.0005 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition PHO5 YBR093C Repressible acid phosphatase (1 of 3) that also mediates extracellular ‐1.1082 0.0001 nucleotide‐derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2 RRT13 YER066W Putative protein of unknown function; non‐essential gene identified ‐1.1061 0.0001 in a screen for mutants with decreased levels of rDNA transcription PHO80 YOL001W Cyclin, interacts with cyclin‐dependent kinase Pho85p; regulates the ‐1.1057 0.0001 response to nutrient levels and environmental conditions, including the response to phosphate limitation and stress‐dependent calcium signaling NA YEL025C Putative protein of unknown function; green fluorescent protein ‐1.1055 0.0002 (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus FEN2 YCR028C Plasma membrane H+‐pantothenate symporter; confers sensitivity ‐1.1051 0.0001 to the antifungal agent fenpropimorph ICP55 YER078C Mitochondrial aminopeptidase; cleaves the N termini of at least 38 ‐1.1051 0.0000 imported proteins after cleavage by the mitochondrial processing peptidase (MPP), thereby increasing their stability; member of the aminopeptidase P family PDR18 YNR070W Putative transporter of the ATP‐binding cassette (ABC) family, ‐1.1007 0.0001 implicated in pleiotropic drug resistance; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐ throughput studies FIT1 YDR534C Mannoprotein that is incorporated into the cell wall via a ‐1.0976 0.0006 glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall SGF29 YCL010C Probable subunit of SAGA histone acetyltransferase complex ‐1.0947 0.0002 YPK9 YOR291W Vacuolar protein with a possible role in sequestering heavy metals; ‐1.0924 0.0001 has similarity to the type V P‐type ATPase Spf1p; homolog of human ATP13A2 (PARK9), mutations in which are associated with Parkinson disease and Kufor‐Rakeb syndrome SRB8 YCR081W Subunit of the RNA polymerase II mediator complex; associates with ‐1.0917 0.0001 core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; involved in glucose repression PDR15 YDR406W Plasma membrane ATP binding cassette (ABC) transporter, multidrug ‐1.0877 0.0001 transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element YPK2 YMR104C Protein kinase with similarity to serine/threonine protein kinase ‐1.0858 0.0009 Ypk1p; functionally redundant with YPK1 at the genetic level; participates in a signaling pathway required for optimal cell wall integrity; homolog of mammalian kinase SGK 188

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al NA YKL100C Putative protein of unknown function with similarity to a human ‐1.0832 0.0000 minor histocompatibility antigen and signal peptide peptidases; YKL100C is not an essential gene EEB1 YPL095C Acyl‐coenzymeA:ethanol O‐acyltransferase responsible for the major ‐1.0828 0.0002 part of medium‐chain fatty acid ethyl ester biosynthesis during fermentation; possesses short‐chain esterase activity; may be involved in lipid metabolism and detoxification NA YPR071W Putative membrane protein; YPR071W is not an essential gene ‐1.0822 0.0000 GUT2 YIL155C Mitochondrial glycerol‐3‐phosphate dehydrogenase; expression is ‐1.0817 0.0004 repressed by both glucose and cAMP and derepressed by non‐ fermentable carbon sources in a Snf1p, Rsf1p, Hap2/3/4/5 complex dependent manner TPO1 YLL028W Polyamine transporter that recognizes spermine, putrescine, and ‐1.0812 0.0001 spermidine; catalyzes uptake of polyamines at alkaline pH and excretion at acidic pH; phosphorylation enhances activity and sorting to the plasma membrane FRE6 YLL051C Putative ferric reductase with similarity to Fre2p; expression induced ‐1.0798 0.0001 by low iron levels NA YNL040W Putative protein of unknown function with strong similarity to alanyl‐ ‐1.0787 0.0002 tRNA synthases from Eubacteria; green fluorescent protein (GFP)‐ fusion protein localizes to the cytoplasm; YNL040W is not an essential gene NA YPR157W Putative protein of unknown function; induced by treatment with 8‐ ‐1.0739 0.0006 methoxypsoralen and UVA irradiation AQY2 YLL052C Water channel that mediates the transport of water across cell ‐1.0738 0.0001 membranes, only expressed in proliferating cells, controlled by osmotic signals, may be involved in freeze tolerance; disrupted by a stop codon in many S. cerevisiae strains NA YMR102C Protein of unknown function; transcription is activated by ‐1.0731 0.0001 paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance; mutant shows increased resistance to azoles; YMR102C is not an essential gene TAL1 YLR354C Transaldolase, enzyme in the non‐oxidative pentose phosphate ‐1.0717 0.0000 pathway; converts sedoheptulose 7‐phosphate and glyceraldehyde 3‐phosphate to erythrose 4‐phosphate and fructose 6‐phosphate NA YLR164W Mitochondrial inner membrane of unknown function; similar to ‐1.0683 0.0000 Tim18p and Sdh4p; expression induced by nitrogen limitation in a GLN3, GAT1‐dependent manner ECL1 YGR146C Protein of unknown function, affects chronological lifespan; induced ‐1.0671 0.0003 by iron homeostasis transcription factor Aft2p; multicopy suppressor of temperature sensitive hsf1 mutant; induced by treatment with 8‐ methoxypsoralen and UVA irradiation PAC1 YOR269W Protein involved in nuclear migration, part of the dynein/dynactin ‐1.0662 0.0001 pathway; targets dynein to microtubule tips, which is necessary for sliding of microtubules along bud cortex; synthetic lethal with bni1; homolog of human LIS1 MAL33 YBR297W MAL‐activator protein, part of complex locus MAL3; nonfunctional in ‐1.0646 0.0003 genomic reference strain S288C PIP2 YOR363C Autoregulatory oleate‐specific transcriptional activator of ‐1.0645 0.0001 peroxisome proliferation, contains Zn(2)‐Cys(6) cluster domain, forms heterodimer with Oaf1p, binds oleate response elements (OREs), activates beta‐oxidation genes

189

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al NA YJL107C Putative protein of unknown function; expression is induced by ‐1.0630 0.0000 activation of the HOG1 mitogen‐activated signaling pathway and this induction is Hog1p/Pbs2p dependent; YJL107C and adjacent ORF, YJL108C are merged in related fungi GLG1 YKR058W Self‐glucosylating initiator of glycogen synthesis, also glucosylates n‐ ‐1.0627 0.0004 dodecyl‐beta‐D‐maltoside; similar to mammalian glycogenin NA NA NA ‐1.0611 0.0002 YKE4 YIL023C Zinc transporter; localizes to the ER; null mutant is sensitive to ‐1.0600 0.0001 calcofluor white, leads to zinc accumulation in cytosol; ortholog of the mouse KE4 and member of the ZIP (ZRT, IRT‐like Protein) family SPT10 YJL127C Putative histone acetylase with a role in transcriptional silencing, ‐1.0592 0.0002 sequence‐specific activator of histone genes, binds specifically and cooperatively to pairs of UAS elements in core histone promoters, functions at or near the TATA box NA YIL089W Putative protein of unknown function ‐1.0588 0.0002 MPS2 YGL075C Essential membrane protein localized at the nuclear envelope and ‐1.0585 0.0006 spindle pole body (SPB), required for insertion of the newly duplicated SPB into the nuclear envelope; potentially phosphorylated by Cdc28p FMP30 YPL103C Mitochondrial inner membrane protein with a role in maintaining ‐1.0585 0.0006 mitochondrial morphology and normal cardiolipin levels; proposed to be involved in N‐acylethanolamine metabolism; related to mammalian N‐acylPE‐specific phospholipase D NA YGR126W Putative protein of unknown function; green fluorescent protein ‐1.0449 0.0003 (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus and is induced in response to the DNA‐damaging agent MMS NA YPL041C Protein of unknown function involved in maintenance of proper ‐1.0407 0.0001 telomere length NA NA NA ‐1.0368 0.0004 NA YGL140C Putative protein of unknown function; non‐essential gene; contains ‐1.0345 0.0000 multiple predicted transmembrane domains NA YPR013C Putative zinc finger protein; YPR013C is not an essential gene ‐1.0341 0.0000 NA YOR152C Putative protein of unknown function; has no similarity to any known ‐1.0308 0.0001 protein; YOR152C is not an essential gene OST6 YML019W Subunit of the oligosaccharyltransferase complex of the ER lumen, ‐1.0293 0.0001 which catalyzes asparagine‐linked glycosylation of newly synthesized proteins; similar to and partially functionally redundant with Ost3p SAD1 YFR005C Conserved zinc‐finger domain protein involved in pre‐mRNA splicing, ‐1.0274 0.0001 required for assembly of U4 snRNA into the U4/U6 particle NIT1 YIL164C Nitrilase, member of the nitrilase branch of the nitrilase superfamily; ‐1.0235 0.0001 in closely related species and other S. cerevisiae strain backgrounds YIL164C and adjacent ORF, YIL165C, likely constitute a single ORF encoding a nitrilase gene HCM1 YCR065W Forkhead transcription factor that drives S‐phase specific expression ‐1.0222 0.0004 of genes involved in chromosome segregation, spindle dynamics, and budding; suppressor of calmodulin mutants with specific SPB assembly defects; telomere maintenance role ZRT2 YLR130C Low‐affinity zinc transporter of the plasma membrane; transcription ‐1.0193 0.0003 is induced under low‐zinc conditions by the Zap1p transcription factor NA YAL037W Putative protein of unknown function ‐1.0187 0.0001 PDR3 YBL005W Transcriptional activator of the pleiotropic drug resistance network, ‐1.0176 0.0003 regulates expression of ATP‐binding cassette (ABC) transporters through binding to cis‐acting sites known as PDREs (PDR responsive elements) 190

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al FAA3 YIL009W Long chain fatty acyl‐CoA synthetase, activates imported fatty acids; ‐1.0170 0.0001 green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery NA YAL018C Putative protein of unknown function ‐1.0150 0.0009 NA YGR031W Putative protein of unknown function; the authentic, non‐tagged ‐1.0138 0.0002 protein is detected in highly purified mitochondria in high‐ throughput studies ERS1 YCR075C Protein with similarity to human cystinosin, which is a H(+)‐driven ‐1.0047 0.0001 transporter involved in L‐cystine export from lysosomes and implicated in the disease cystinosis; contains seven transmembrane domains ARG80 YMR042W Transcription factor involved in regulation of arginine‐responsive ‐1.0047 0.0006 genes; acts with Arg81p and Arg82p NA YBL029W Non‐essential protein of unknown function ‐0.9999 0.0002 ARG8 YOL140W Acetylornithine aminotransferase, catalyzes the fourth step in the ‐0.9993 0.0001 biosynthesis of the arginine precursor ornithine HST2 YPL015C Cytoplasmic member of the silencing information regulator 2 (Sir2) ‐0.9981 0.0008 family of NAD(+)‐dependent protein deacetylases; modulates nucleolar (rDNA) and telomeric silencing; possesses NAD(+)‐ dependent histone deacetylase activity in vitro EDS1 YBR033W Putative zinc cluster protein; YBR033W is not an essential gene ‐0.9975 0.0003 EAR1 YMR171C Specificity factor required for Rsp5p‐dependent ubiquitination and ‐0.9972 0.0001 sorting of specific cargo proteins at the multivesicular body; mRNA is targeted to the bud via the mRNA transport system involving She2p TTI1 YKL033W Putative protein of unknown function; subunit of the ASTRA complex ‐0.9968 0.0002 which is part of the chromatin remodeling machinery; similar to S. pombe Tti1p; detected in highly purified mitochondria in high‐ throughput studies NA YBL095W Putative protein of unknown function; the authentic, non‐tagged ‐0.9932 0.0001 protein is detected in highly purified mitochondria in high‐ throughput studies MAL11 YGR289C Inducible high‐affinity maltose transporter (alpha‐glucoside ‐0.9924 0.0004 transporter); encoded in the MAL1 complex locus; broad substrate specificity that includes maltotriose; required for isomaltose utilization NA YPR003C Putative sulfate permease; physically interacts with Hsp82p; green ‐0.9902 0.0001 fluorescent protein (GFP)‐fusion protein localizes to the ER; YPR003C is not an essential gene MCM3 YEL032W Protein involved in DNA replication; component of the Mcm2‐7 ‐0.9890 0.0002 hexameric complex that binds chromatin as a part of the pre‐ replicative complex NA YPL191C Putative protein of unknown function; diploid deletion strain exhibits ‐0.9887 0.0002 high budding index; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm ALG6 YOR002W Alpha 1,3 glucosyltransferase, involved in transfer of ‐0.9852 0.0002 oligosaccharides from dolichyl pyrophosphate to asparagine residues of proteins during N‐linked protein glycosylation; mutations in human ortholog are associated with disease SER3 YER081W 3‐phosphoglycerate dehydrogenase, catalyzes the first step in serine ‐0.9837 0.0001 and glycine biosynthesis; isozyme of Ser33p DSD1 YGL196W D‐serine dehydratase (aka D‐serine ammonia‐lyase); converts D‐ ‐0.9830 0.0002 serine to pyruvate and ammonia by a reaction dependent on pyridoxal 5'‐phosphate and zinc; may play a role in D‐serine detoxification; L‐serine is not a substrate

191

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al NA YGR122W Probable ortholog of A. nidulans PalC, which is involved in pH ‐0.9814 0.0002 regulation and binds to the ESCRT‐III complex; null mutant does not properly process Rim101p and has decreased resistance to rapamycin; GFP‐fusion protein is cytoplasmic NA YKL133C Putative protein of unknown function; has similarity to Mgr3p, but ‐0.9811 0.0006 unlike MGR3, is not required for growth of cells lacking the mitochondrial genome (null mutation does not confer a petite‐ negative phenotype) PIR3 YKL163W O‐glycosylated covalently‐bound cell wall protein required for cell ‐0.9810 0.0001 wall stability; expression is cell cycle regulated, peaking in M/G1 and also subject to regulation by the cell integrity pathway

THO1 YER063W Conserved nuclear RNA‐binding protein; specifically binds to ‐0.9795 0.0002 transcribed chromatin in a THO‐ and RNA‐dependent manner, genetically interacts with shuttling hnRNP NAB2; overproduction suppresses transcriptional defect caused by hpr1 mutation GUT1 YHL032C Glycerol kinase, converts glycerol to glycerol‐3‐phosphate; glucose ‐0.9757 0.0001 repression of expression is mediated by Adr1p and Ino2p‐Ino4p; derepression of expression on non‐fermentable carbon sources is mediated by Opi1p and Rsf1p HTD2 YHR067W Mitochondrial 3‐hydroxyacyl‐thioester dehydratase involved in fatty ‐0.9748 0.0001 acid biosynthesis, required for respiratory growth and for normal mitochondrial morphology MUM3 YOR298W Protein of unknown function involved in the organization of the ‐0.9732 0.0010 outer spore wall layers; has similarity to the tafazzins superfamily of acyltransferases NA YPL236C NA ‐0.9695 0.0001 NA YOR292C Putative protein of unknown function; green fluorescent protein ‐0.9685 0.0001 (GFP)‐fusion protein localizes to the vacuole; YOR292C is not an essential gene PLB2 YMR006C Phospholipase B (lysophospholipase) involved in phospholipid ‐0.9672 0.0003 metabolism; displays transacylase activity in vitro; overproduction confers resistance to lysophosphatidylcholine NA YPR196W Putative maltose activator ‐0.9672 0.0002 MRK1 YDL079C Glycogen synthase kinase 3 (GSK‐3) homolog; one of four GSK‐3 ‐0.9658 0.0002 homologs in S. cerevisiae that function to activate Msn2p‐dependent transcription of stress responsive genes and that function in protein degradation LYS5 YGL154C Phosphopantetheinyl transferase involved in lysine biosynthesis; ‐0.9650 0.0002 converts inactive apo‐form of Lys2p (alpha‐aminoadipate reductase) into catalytically active holo‐form by posttranslational addition of phosphopantetheine BUR2 YLR226W Cyclin for the Sgv1p (Bur1p) protein kinase; Sgv1p and Bur2p ‐0.9645 0.0000 comprise a CDK‐cyclin complex involved in transcriptional regulation through its phosphorylation of the carboxy‐terminal domain of the largest subunit of RNA polymerase II MNS1 YJR131W Alpha‐1,2‐mannosidase involved in ER quality control; catalyzes the ‐0.9639 0.0001 removal of one mannose residue from Man9GlcNAc to produce a single isomer of Man8GlcNAc in N‐linked oligosaccharide biosynthesis; integral to ER membrane NA YJR030C Putative protein of unknown function; expression repressed in ‐0.9639 0.0001 carbon limited vs carbon replete chemostat cultures; YJR030C is a non‐essential gene

192

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al NA YNL108C Putative protein of unknown function with similarity to Tfc7p and ‐0.9619 0.0003 prokaryotic phosphotransfer enzymes; null mutant shows alterations in glucose metabolism; GFP‐fusion protein localizes to the cytoplasm and nucleus NA YJR124C Putative protein of unknown function; expression induced under ‐0.9593 0.0004 calcium shortage NA YHR131C Putative protein of unknown function; green fluorescent protein ‐0.9593 0.0004 (GFP)‐fusion protein localizes to the cytoplasm; overexpression causes a cell cycle delay or arrest TPK1 YJL164C cAMP‐dependent protein kinase catalytic subunit; promotes ‐0.9571 0.0006 vegetative growth in response to nutrients via the Ras‐cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p NIS1 YNL078W Protein localized in the bud neck at G2/M phase; physically interacts ‐0.9533 0.0002 with septins; possibly involved in a mitotic signaling network STE4 YOR212W G protein beta subunit, forms a dimer with Ste18p to activate the ‐0.9501 0.0001 mating signaling pathway, forms a heterotrimer with Gpa1p and Ste18p to dampen signaling; may recruit Rho1p to the polarized growth site during mating; contains WD40 repeats RAD16 YBR114W Protein that recognizes and binds damaged DNA in an ATP‐ ‐0.9497 0.0000 dependent manner (with Rad7p) during nucleotide excision repair; subunit of Nucleotide Excision Repair Factor 4 (NEF4) and the Elongin‐Cullin‐Socs (ECS) ligase complex NA YGL036W Putative protein of unknown function; green fluorescent protein ‐0.9474 0.0006 (GFP)‐fusion protein localizes to the cytoplasm; YGL036W is not an essential gene HER1 YOR227W Protein of unknown function required for proliferation or remodeling ‐0.9443 0.0002 of the ER that is caused by overexpression of Hmg2p; may interact with ribosomes, based on co‐purification experiments

YAT2 YER024W Carnitine acetyltransferase; has similarity to Yat1p, which is a ‐0.9440 0.0008 carnitine acetyltransferase associated with the mitochondrial outer membrane NA YPL272C Putative protein of unknown function; gene expression induced in ‐0.9436 0.0003 response to ketoconazole; YPL272C is not an essential gene RPL9B YNL067W Protein component of the large (60S) ribosomal subunit, nearly ‐0.9432 0.0001 identical to Rpl9Ap and has similarity to E. coli L6 and rat L9 ribosomal proteins FAR1 YJL157C Cyclin‐dependent kinase inhibitor that mediates cell cycle arrest in ‐0.9400 0.0003 response to pheromone; also forms a complex with Cdc24p, Ste4p, and Ste18p that may specify the direction of polarized growth during mating; potential Cdc28p substrate RDS2 YPL133C Transcription factor involved in regulating gluconeogenesis and ‐0.9391 0.0002 glyoxylate cycle genes; member of the zinc cluster family of proteins; confers resistance to ketoconazole KAR9 YPL269W Karyogamy protein required for correct positioning of the mitotic ‐0.9366 0.0002 spindle and for orienting cytoplasmic microtubules, localizes at the shmoo tip in mating cells and at the tip of the growing bud in small‐ budded cells through anaphase FHL1 YPR104C Regulator of ribosomal protein transcription; has forkhead ‐0.9336 0.0004 associated domain that binds phosphorylated proteins; also has forkhead DNA‐binding domain but does not bind DNA in vitro; suppresses RNA pol III and splicing factor prp4 mutants

193

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al POS5 YPL188W Mitochondrial NADH kinase, phosphorylates NADH; also ‐0.9297 0.0002 phosphorylates NAD(+) with lower specificity; required for the response to oxidative stress BST1 YFL025C GPI inositol deacylase of the ER that negatively regulates COPII ‐0.9257 0.0001 vesicle formation, prevents production of vesicles with defective subunits, required for proper discrimination between resident ER proteins and Golgi‐bound cargo molecules ATG32 YIL146C Mitochondrial‐anchored transmembrane receptor that interacts with ‐0.9237 0.0002 the autophagy adaptor protein, Atg11p, and is essential for mitophagy, the selective vacuolar degradation of mitochondria in response to starvation PRY3 YJL078C Protein of unknown function ‐0.9213 0.0003 NA YER130C Protein of unknown function; transcription is regulated by Haa1p, ‐0.9211 0.0002 Sok2p and Zap1p transcriptional activators; the C. Albicans homolog (MNL1) plays a role in adaptation to stress

NA YEL057C Protein of unknown function involved in telomere maintenance; ‐0.9197 0.0005 target of UME6 regulation ART5 YGR068C Protein proposed to regulate the endocytosis of plasma membrane ‐0.9171 0.0002 proteins by recruiting the ubiquitin ligase Rsp5p to its target in the plasma membrane PSF2 YJL072C Subunit of the GINS complex (Sld5p, Psf1p, Psf2p, Psf3p), which is ‐0.9164 0.0002 localized to DNA replication origins and implicated in assembly of the DNA replication machinery NA YPR147C Putative protein of unknown function; green fluorescent protein ‐0.9160 0.0001 (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS HMLALPHA YCL066W Silenced copy of ALPHA1 at HML, encoding a transcriptional ‐0.9150 0.0003 1 coactivator involved in the regulation of mating‐type alpha‐specific gene expression TOS3 YGL179C Protein kinase, related to and functionally redundant with Elm1p and ‐0.9136 0.0002 Sak1p for the phosphorylation and activation of Snf1p; functionally orthologous to LKB1, a mammalian kinase associated with Peutz‐ Jeghers cancer‐susceptibility syndrome NA YOL024W Putative protein of unknown function; predicted to have thiol‐ ‐0.9128 0.0001 disulfide oxidoreductase active site AGP2 YBR132C High affinity polyamine permease, preferentially uses spermidine ‐0.9121 0.0004 over putrescine; expression is down‐regulated by osmotic stress; plasma membrane carnitine transporter, also functions as a low‐ affinity amino acid permease IRC23 YOR044W Putative protein of unknown function; green fluorescent protein ‐0.9119 0.0001 (GFP)‐fusion localizes to the ER; null mutant displays increased levels of spontaneous Rad52p foci NA YMR010W Putative protein of unknown function; green fluorescent protein ‐0.9113 0.0002 (GFP)‐fusion protein localizes to the cytoplasm; YMR010W is not an essential gene; YMR010W mRNA is transcribed with ADI1 YGK3 YOL128C Protein kinase related to mammalian glycogen synthase kinases of ‐0.9102 0.0003 the GSK‐3 family; GSK‐3 homologs (Mck1p, Rim11p, Mrk1p, Ygk3p) are involved in control of Msn2p‐dependent transcription of stress responsive genes and in protein degradation PET127 YOR017W Protein with a role in 5'‐end processing of mitochondrial RNAs, ‐0.9086 0.0001 located in the mitochondrial membrane

194

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al JID1 YPR061C Probable Hsp40p co‐chaperone, has a DnaJ‐like domain and appears ‐0.9078 0.0001 to be involved in ER‐associated degradation of misfolded proteins containing a tightly folded cytoplasmic domain; inhibits replication of Brome mosaic virus in S. cerevisiae ATH1 YPR026W Acid trehalase required for utilization of extracellular trehalose ‐0.9075 0.0002 IST2 YBR086C Plasma membrane protein that may be involved in osmotolerance, ‐0.9068 0.0004 localizes to the mother cell in small‐budded cells and to the bud in medium‐ and large‐budded cells; mRNA is transported to the bud tip by an actomyosin‐driven process SCW11 YGL028C Cell wall protein with similarity to glucanases; may play a role in ‐0.9062 0.0002 conjugation during mating based on its regulation by Ste12p NA YBR220C Putative protein of unknown function; YBR220C is not an essential ‐0.9047 0.0001 gene NA YLR137W Putative S‐adenosylmethionine‐dependent methyltransferase ‐0.9044 0.0001 BNA1 YJR025C 3‐hydroxyanthranilic acid dioxygenase, required for the de novo ‐0.9031 0.0002 biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p ORC5 YNL261W Subunit of the origin recognition complex, which directs DNA ‐0.9023 0.0002 replication by binding to replication origins and is also involved in transcriptional silencing GAL10 YBR019C UDP‐glucose‐4‐epimerase, catalyzes the interconversion of UDP‐ ‐0.9008 0.0006 galactose and UDP‐D‐glucose in galactose metabolism; also catalyzes the conversion of alpha‐D‐glucose or alpha‐D‐galactose to their beta‐ anomers NA YKR070W Putative protein of unknown function; the authentic, non‐tagged ‐0.9008 0.0003 protein is detected in highly purified mitochondria in high‐ throughput studies ECM3 YOR092W Non‐essential protein of unknown function; involved in signal ‐0.8967 0.0001 transduction and the genotoxic response; induced rapidly in response to treatment with 8‐methoxypsoralen and UVA irradiation

USA1 YML029W Scaffold subunit of the Hrd1p ubiquitin ligase that also promotes ‐0.8952 0.0002 ligase oligomerization; involved in ER‐associated protein degradation (ERAD); interacts with the U1 snRNP‐specific protein, Snp1p

NA YOR302W CPA1 uORF, Arginine attenuator peptide, regulates translation of the ‐0.8937 0.0006 CPA1 mRNA NA YER140W Putative protein of unknown function; the authentic, non‐tagged ‐0.8931 0.0003 protein is detected in highly purified mitochondria in high‐ throughput studies; genetic interactions suggest a role in folding of ER membrane proteins RPS7B YNL096C Protein component of the small (40S) ribosomal subunit, nearly ‐0.8891 0.0005 identical to Rps7Ap; interacts with Kti11p; deletion causes hypersensitivity to zymocin; has similarity to rat S7 and Xenopus S8 ribosomal proteins TNA1 YGR260W High affinity nicotinic acid plasma membrane permease, responsible ‐0.8880 0.0001 for uptake of low levels of nicotinic acid; expression of the gene increases in the absence of extracellular nicotinic acid or para‐ aminobenzoate (PABA) APL3 YBL037W Alpha‐adaptin, large subunit of the clathrin associated protein ‐0.8878 0.0003 complex (AP‐2); involved in vesicle mediated transport

195

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al PDR12 YPL058C Plasma membrane ATP‐binding cassette (ABC) transporter, weak‐ ‐0.8864 0.0001 acid‐inducible multidrug transporter required for weak organic acid resistance; induced by sorbate and benzoate and regulated by War1p; mutants exhibit sorbate hypersensitivity MSF1 YPR047W Mitochondrial phenylalanyl‐tRNA synthetase, active as a monomer, ‐0.8855 0.0001 unlike the cytoplasmic subunit which is active as a dimer complexed to a beta subunit dimer; similar to the alpha subunit of E. coli phenylalanyl‐tRNA synthetase NA YHR202W Putative protein of unknown function; green fluorescent protein ‐0.8824 0.0002 (GFP)‐fusion protein localizes to the vacuole, while HA‐tagged protein is found in the soluble fraction, suggesting cytoplasmic localization BNA6 YFR047C Quinolinate phosphoribosyl transferase, required for the de novo ‐0.8819 0.0002 biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p AMD1 YML035C AMP deaminase, tetrameric enzyme that catalyzes the deamination ‐0.8779 0.0001 of AMP to form IMP and ammonia; may be involved in regulation of intracellular adenine nucleotide pools

TOR1 YJR066W PIK‐related protein kinase and rapamycin target; subunit of TORC1, a ‐0.8779 0.0003 complex that controls growth in response to nutrients by regulating translation, transcription, ribosome biogenesis, nutrient transport and autophagy; involved in meiosis TEL1 YBL088C Protein kinase primarily involved in telomere length regulation; ‐0.8760 0.0001 contributes to cell cycle checkpoint control in response to DNA damage; functionally redundant with Mec1p; homolog of human ataxia telangiectasia (ATM) gene NA YBR074W Putative metalloprotease ‐0.8758 0.0001 MIG3 YER028C Probable transcriptional repressor involved in response to toxic ‐0.8750 0.0006 agents such as hydroxyurea that inhibit ribonucleotide reductase; phosphorylation by Snf1p or the Mec1p pathway inactivates Mig3p, allowing induction of damage response genes PRP8 YHR165C Component of the U4/U6‐U5 snRNP complex, involved in the second ‐0.8737 0.0001 catalytic step of splicing; mutations of human Prp8 cause retinitis pigmentosa NA YMR147W Putative protein of unknown function ‐0.8728 0.0003 ATR1 YML116W Multidrug efflux pump of the major facilitator superfamily, required ‐0.8719 0.0004 for resistance to aminotriazole and 4‐nitroquinoline‐N‐oxide SPO21 YOL091W Component of the meiotic outer plaque of the spindle pole body, ‐0.8718 0.0009 involved in modifying the meiotic outer plaque that is required prior to prospore membrane formation MRF1 YGL143C Mitochondrial translation release factor, involved in stop codon ‐0.8716 0.0002 recognition and hydrolysis of the peptidyl‐tRNA bond during mitochondrial translation; lack of MRF1 causes mitochondrial genome instability NA YOR186W Putative protein of unknown function; proper regulation of ‐0.8711 0.0005 expression during heat stress is sphingolipid‐dependent RTC2 YBR147W Protein of unknown function; identified in a screen for mutants with ‐0.8693 0.0002 decreased levels of rDNA transcription; detected in highly purified mitochondria; null mutant suppresses cdc13‐1; similar to a G‐protein coupled receptor from S. pombe NSE5 YML023C Essential subunit of the Mms21‐Smc5‐Smc6 complex; required for ‐0.8640 0.0001 cell viability and DNA repair

196

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al RPS14B YJL191W Ribosomal protein 59 of the small subunit, required for ribosome ‐0.8635 0.0007 assembly and 20S pre‐rRNA processing; mutations confer cryptopleurine resistance; nearly identical to Rps14Ap and similar to E. coli S11 and rat S14 ribosomal proteins SMK1 YPR054W Middle sporulation‐specific mitogen‐activated protein kinase (MAPK) ‐0.8620 0.0001 required for production of the outer spore wall layers; negatively regulates activity of the glucan synthase subunit Gsc2p UBP11 YKR098C Ubiquitin‐specific protease that cleaves ubiquitin from ubiquitinated ‐0.8615 0.0006 proteins HUL4 YJR036C Protein with similarity to hect domain E3 ubiquitin‐protein ligases, ‐0.8606 0.0006 not essential for viability NA YGR071C Putative protein of unknown function; deletion mutant has increased ‐0.8586 0.0002 glycogen accumulation and displays elongated buds; green fluorescent protein (GFP)‐fusion protein localizes to the nucleus NA YLL054C Putative protein of unknown function with similarity to Pip2p, an ‐0.8578 0.0006 oleate‐specific transcriptional activator of peroxisome proliferation; YLL054C is not an essential gene STE13 YOR219C Dipeptidyl aminopeptidase, Golgi integral membrane protein that ‐0.8570 0.0001 cleaves on the carboxyl side of repeating ‐X‐Ala‐ sequences, required for maturation of alpha factor, transcription is induced by a‐factor GDS1 YOR355W Protein of unknown function, required for growth on glycerol as a ‐0.8554 0.0006 carbon source; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies VTH1 YIL173W Putative membrane glycoprotein with strong similarity to Vth2p and ‐0.8536 0.0001 Pep1p/Vps10p, may be involved in vacuolar protein sorting HAL9 YOL089C Putative transcription factor containing a zinc finger; overexpression ‐0.8528 0.0002 increases salt tolerance through increased expression of the ENA1 (Na+/Li+ extrusion pump) gene while gene disruption decreases both salt tolerance and ENA1 expression YAP7 YOL028C Putative basic leucine zipper (bZIP) transcription factor ‐0.8501 0.0007 PEP8 YJL053W Vacuolar protein sorting protein that forms part of the multimeric ‐0.8499 0.0006 membrane‐associated retromer complex along with Vps35p, Vps29p, Vps17p, and Vps5p; essential for endosome‐to‐Golgi retrograde protein transport NA YNR061C Putative protein of unknown function ‐0.8476 0.0003 ODC1 YPL134C Mitochondrial inner membrane transporter, exports 2‐oxoadipate ‐0.8435 0.0002 and 2‐oxoglutarate from the mitochondrial matrix to the cytosol for lysine and glutamate biosynthesis and lysine catabolism; suppresses, in multicopy, an fmc1 null mutation NA YBL112C Putative protein of unknown function; YBL112C is contained within ‐0.8435 0.0006 TEL02L PCI8 YIL071C Possible shared subunit of Cop9 signalosome (CSN) and eIF3, binds ‐0.8421 0.0006 eIF3b subunit Prt1p, has possible dual functions in transcriptional and translational control, contains a PCI (Proteasome‐COP9 signalosome (CSN)‐eIF3) domain MSB2 YGR014W Mucin family member involved in the Cdc42p‐ and MAP kinase‐ ‐0.8396 0.0002 dependent filamentous growth signaling pathway; also functions as an osmosensor in parallel to the Sho1p‐mediated pathway; potential Cdc28p substrate DSE2 YHR143W Daughter cell‐specific secreted protein with similarity to glucanases, ‐0.8379 0.0003 degrades cell wall from the daughter side causing daughter to separate from mother; expression is repressed by cAMP

197

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al URA8 YJR103W Minor CTP synthase isozyme (see also URA7), catalyzes the ATP‐ ‐0.8373 0.0002 dependent transfer of the amide nitrogen from glutamine to UTP, forming CTP, the final step in de novo biosynthesis of pyrimidines; involved in phospholipid biosynthesis SYM1 YLR251W Protein required for ethanol metabolism; induced by heat shock and ‐0.8367 0.0008 localized to the inner mitochondrial membrane; homologous to mammalian peroxisomal membrane protein Mpv17

GLG2 YJL137C Self‐glucosylating initiator of glycogen synthesis, also glucosylates n‐ ‐0.8360 0.0001 dodecyl‐beta‐D‐maltoside; similar to mammalian glycogenin SPO73 YER046W Meiosis‐specific protein of unknown function, required for spore wall ‐0.8351 0.0002 formation during sporulation; dispensible for both nuclear divisions during meiosis CLG1 YGL215W Cyclin‐like protein that interacts with Pho85p; has sequence ‐0.8347 0.0006 similarity to G1 cyclins PCL1 and PCL2 NA YHR080C Protein of unknown function that may interact with ribosomes, ‐0.8346 0.0009 based on co‐purification experiments; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐ throughput studies GZF3 YJL110C GATA zinc finger protein and Dal80p homolog that negatively ‐0.8323 0.0001 regulates nitrogen catabolic gene expression by competing with Gat1p for GATA site binding; function requires a repressive carbon source; dimerizes with Dal80p and binds to Tor1p INP52 YNL106C Polyphosphatidylinositol phosphatase, dephosphorylates a number ‐0.8315 0.0007 of phosphatidylinositols (PIs) to PI; involved in endocytosis; hyperosmotic stress causes translocation to actin patches; synaptojanin‐like protein with a Sac1 domain RAD1 YPL022W Single‐stranded DNA endonuclease (with Rad10p), cleaves single‐ ‐0.8298 0.0003 stranded DNA during nucleotide excision repair and double‐strand break repair; subunit of Nucleotide Excision Repair Factor 1 (NEF1); homolog of human XPF protein YSC84 YHR016C Actin‐binding protein involved in bundling of actin filaments and ‐0.8286 0.0004 endocytosis of actin cortical patches; activity stimulated by Las17p; contains SH3 domain similar to Rvs167p CTL1 YMR180C RNA 5'‐triphosphatase, localizes to both the nucleus and cytoplasm ‐0.8259 0.0001 ATP2 YJR121W Beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase, ‐0.8250 0.0002 which is a large, evolutionarily conserved enzyme complex required for ATP synthesis; phosphorylated

PET111 YMR257C Mitochondrial translational activator specific for the COX2 mRNA; ‐0.8245 0.0002 located in the mitochondrial inner membrane DBF20 YPR111W Ser/Thr kinase involved in late nuclear division, one of the mitotic ‐0.8236 0.0008 exit network (MEN) proteins; necessary for the execution of cytokinesis ANT1 YPR128C Peroxisomal adenine nucleotide transporter; involved in beta‐ ‐0.8231 0.0001 oxidation of medium‐chain fatty acid; required for peroxisome proliferation AVT1 YJR001W Vacuolar transporter, imports large neutral amino acids into the ‐0.8216 0.0003 vacuole; member of a family of seven S. cerevisiae genes (AVT1‐7) related to vesicular GABA‐glycine transporters NA YCR023C Vacuolar membrane protein of unknown function; member of the ‐0.8214 0.0001 multidrug resistance family; YCR023C is not an essential gene TIR4 YOR009W Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐ ‐0.8214 0.0003 rich proteins; expressed under anaerobic conditions and required for anaerobic growth; transcription is also induced by cold shock

198

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al ECM25 YJL201W Non‐essential protein of unknown function; promoter contains a ‐0.8212 0.0005 consensus binding sequence for factor Abf1p NA YMR210W Putative acyltransferase with similarity to Eeb1p and Eht1p, has a ‐0.8207 0.0003 minor role in medium‐chain fatty acid ethyl ester biosynthesis; may be involved in lipid metabolism and detoxification NA YGR266W Protein of unknown function, predicted to contain a single ‐0.8206 0.0002 transmembrane domain; mutant has increased aneuploidy tolerance; localized to both the mitochondrial outer membrane and the plasma membrane RRT8 YOL048C Putative protein of unknown function; identified in a screen for ‐0.8196 0.0005 mutants with increased levels of rDNA transcription; green fluorescent protein (GFP)‐fusion protein localizes to lipid particles BNA5 YLR231C Kynureninase, required for the de novo biosynthesis of NAD from ‐0.8181 0.0005 tryptophan via kynurenine; expression regulated by Hst1p MSG5 YNL053W Dual‐specificity protein phosphatase; exists in 2 isoforms; required ‐0.8162 0.0002 for maintenance of a low level of signaling through the cell integrity pathway, adaptive response to pheromone; regulates and is regulated by Slt2p; dephosphorylates Fus3p SLM4 YBR077C Component of the EGO complex, which is involved in the regulation ‐0.8146 0.0002 of microautophagy, and of the GSE complex, which is required for proper sorting of amino acid permease Gap1p; gene exhibits synthetic genetic interaction with MSS4 NA YMR265C Putative protein of unknown function ‐0.8143 0.0001 HOL1 YNR055C Putative transporter in the major facilitator superfamily (DHA1 ‐0.8129 0.0001 family) of multidrug resistance transporters; mutations in membrane‐spanning domains permit cation and histidinol uptake RMR1 YGL250W Protein required for meiotic recombination and gene conversion; ‐0.8118 0.0002 null mutant displays reduced PIS1 expression and growth defects on non‐fermentable carbon sources and minimal media; GFP‐fusion protein localizes to both cytoplasm and nucleus RPS0B YLR048W Protein component of the small (40S) ribosomal subunit, nearly ‐0.8110 0.0002 identical to Rps0Ap; required for maturation of 18S rRNA along with Rps0Ap; deletion of either RPS0 gene reduces growth rate, deletion of both genes is lethal MNN2 YBR015C Alpha‐1,2‐mannosyltransferase, responsible for addition of the first ‐0.8106 0.0006 alpha‐1,2‐linked mannose to form the branches on the mannan backbone of oligosaccharides, localizes to an early Golgi compartment AKR2 YOR034C Ankyrin repeat‐containing protein similar to Akr1p; member of a ‐0.8073 0.0002 family of putative palmitoyltransferases containing an Asp‐His‐His‐ Cys‐cysteine rich (DHHC‐CRD) domain; possibly involved in constitutive endocytosis of Ste3p RIM15 YFL033C Glucose‐repressible protein kinase involved in signal transduction ‐0.8063 0.0004 during cell proliferation in response to nutrients, specifically the establishment of stationary phase; identified as a regulator of IME2; substrate of Pho80p‐Pho85p kinase FLO10 YKR102W Lectin‐like protein with similarity to Flo1p, thought to be involved in ‐0.8044 0.0006 flocculation NA YPL067C Putative protein of unknown function; green fluorescent protein ‐0.8044 0.0003 (GFP)‐fusion protein localizes to the cytoplasm; YPL067C is not an essential gene YBP2 YGL060W Central kinetochore associated protein that mediates mitotic ‐0.8033 0.0001 progression; interacts with several central kinetochore proteins and the centromeric histone Cse4p; role in resistance to oxidative stress; similarity to Ybp1p and Slk19p 199

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al LEU3 YLR451W Zinc‐finger transcription factor that regulates genes involved in ‐0.8030 0.0003 branched chain amino acid biosynthesis and ammonia assimilation; positively regulated by alpha‐isopropylmalate, an intermediate in leucine biosynthesis HAL1 YPR005C Cytoplasmic protein involved in halotolerance; decreases ‐0.7989 0.0002 intracellular Na+ (via Ena1p) and increases intracellular K+ by decreasing efflux; expression repressed by Ssn6p‐Tup1p and Sko1p and induced by NaCl, KCl, and sorbitol through Gcn4p GPI10 YGL142C Integral membrane protein involved in glycosylphosphatidylinositol ‐0.7988 0.0001 (GPI) anchor synthesis; putative alpha 1,2 mannosyltransferase required for addition of the third mannose onto the GPI core structure; human PIG‐Bp is a functional homolog ECM38 YLR299W Gamma‐glutamyltranspeptidase, major glutathione‐degrading ‐0.7968 0.0006 enzyme; involved in detoxification of electrophilic xenobiotics; expression induced mainly by nitrogen starvation TKL2 YBR117C Transketolase, similar to Tkl1p; catalyzes conversion of xylulose‐5‐ ‐0.7956 0.0009 phosphate and ribose‐5‐phosphate to sedoheptulose‐7‐phosphate and glyceraldehyde‐3‐phosphate in the pentose phosphate pathway; needed for synthesis of aromatic amino acids GTO1 YGR154C Omega‐class glutathione transferase; induced under oxidative stress; ‐0.7953 0.0004 putative peroxisomal localization NA YFL054C Putative channel‐like protein; similar to Fps1p; mediates passive ‐0.7943 0.0008 diffusion of glycerol in the presence of ethanol CLN3 YAL040C G1 cyclin involved in cell cycle progression; activates Cdc28p kinase ‐0.7939 0.0001 to promote the G1 to S phase transition; plays a role in regulating transcription of the other G1 cyclins, CLN1 and CLN2; regulated by phosphorylation and proteolysis EXO5 YBR163W Mitochondrial 5'‐3' exonuclease and sliding exonuclease, required ‐0.7923 0.0002 for mitochondrial genome maintenance; distantly related to the RecB nuclease domain of bacterial RecBCD recombinases; may be regulated by the transcription factor Ace2 DSS1 YMR287C 3'‐5' exoribonuclease, component of the mitochondrial ‐0.7906 0.0004 degradosome along with the ATP‐dependent RNA helicase Suv3p; the degradosome associates with the ribosome and mediates turnover of aberrant or unprocessed RNAs NAM7 YMR080C ATP‐dependent RNA helicase of the SFI superfamily involved in ‐0.7897 0.0002 nonsense mediated mRNA decay; required for efficient translation termination at nonsense codons and targeting of NMD substrates to P‐bodies; involved in telomere maintenance LAA1 YJL207C AP‐1 accessory protein; colocalizes with clathrin to the late‐Golgi ‐0.7891 0.0006 apparatus; involved in TGN‐endosome transport; physically interacts with AP‐1; similar to the mammalian p200; may interact with ribosomes; YJL207C is a non‐essential gene USE1 YGL098W Essential SNARE protein localized to the ER, involved in retrograde ‐0.7867 0.0003 traffic from the Golgi to the ER; forms a complex with the SNAREs Sec22p, Sec20p and Ufe1p NA YGR016W Putative protein of unknown function ‐0.7861 0.0006 CYC1 YJR048W Cytochrome c, isoform 1; electron carrier of the mitochondrial ‐0.7861 0.0002 intermembrane space that transfers electrons from ubiquinone‐ cytochrome c oxidoreductase to cytochrome c oxidase during cellular respiration

200

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al 1‐Oct YKL134C Mitochondrial intermediate peptidase, cleaves N‐terminal residues ‐0.7851 0.0003 of a subset of proteins upon import, after their cleavage by mitochondrial processing peptidase (Mas1p‐Mas2p); may contribute to mitochondrial iron homeostasis RPL6B YLR448W Protein component of the large (60S) ribosomal subunit, has ‐0.7845 0.0003 similarity to Rpl6Ap and to rat L6 ribosomal protein; binds to 5.8S rRNA GPI16 YHR188C Transmembrane protein subunit of the glycosylphosphatidylinositol ‐0.7839 0.0003 transamidase complex that adds GPIs to newly synthesized proteins; human PIG‐Tp homolog YME1 YPR024W Catalytic subunit of the mitochondrial inner membrane i‐AAA ‐0.7835 0.0006 protease complex, which is responsible for degradation of unfolded or misfolded mitochondrial gene products; mutation causes an elevated rate of mitochondrial turnover HIR2 YOR038C Subunit of the HIR complex, a nucleosome assembly complex ‐0.7819 0.0002 involved in regulation of histone gene transcription; recruits Swi‐Snf complexes to histone gene promoters; promotes heterochromatic gene silencing with Asf1p PAU2 YEL049W Member of the seripauperin multigene family encoded mainly in ‐0.7817 0.0003 subtelomeric regions, active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme

ERD1 YDR414C Predicted membrane protein required for the retention of lumenal ‐0.7807 0.0006 endoplasmic reticulum proteins; mutants secrete the endogenous ER protein, BiP (Kar2p) CAT2 YML042W Carnitine acetyl‐CoA transferase present in both mitochondria and ‐0.7803 0.0001 peroxisomes, transfers activated acetyl groups to carnitine to form acetylcarnitine which can be shuttled across membranes STE6 YKL209C Plasma membrane ATP‐binding cassette (ABC) transporter required ‐0.7801 0.0006 for the export of a‐factor, catalyzes ATP hydrolysis coupled to a‐ factor transport; contains 12 transmembrane domains and two ATP binding domains; expressed only in MATa cells GCY1 YOR120W Putative NADP(+) coupled glycerol dehydrogenase, proposed to be ‐0.7769 0.0006 involved in an alternative pathway for glycerol catabolism; also has mRNA binding activity; member of the aldo‐keto reductase (AKR) family COG4 YPR105C Essential component of the conserved oligomeric Golgi complex ‐0.7747 0.0006 (Cog1p through Cog8p), a cytosolic tethering complex that functions in protein trafficking to mediate fusion of transport vesicles to Golgi compartments MEC1 YBR136W Genome integrity checkpoint protein and PI kinase superfamily ‐0.7746 0.0002 member; signal transducer required for cell cycle arrest and transcriptional responses prompted by damaged or unreplicated DNA; monitors and participates in meiotic recombination RPL18A YOL120C Protein component of the large (60S) ribosomal subunit, identical to ‐0.7744 0.0003 Rpl18Bp and has similarity to rat L18 ribosomal protein; intron of RPL18A pre‐mRNA forms stem‐loop structures that are a target for Rnt1p cleavage leading to degradation SHR5 YOL110W Subunit of a palmitoyltransferase, composed of Shr5p and Erf2p, ‐0.7740 0.0008 that adds a palmitoyl lipid moiety to heterolipidated substrates such as Ras1p and Ras2p through a thioester linkage; palmitoylation is required for Ras2p membrane localization AGC1 YPR021C Mitochondrial amino acid transporter, acts both as a glutamate ‐0.7738 0.0002 uniporter and as an aspartate‐glutamate exchanger; involved in nitrogen metabolism and nitrogen compound biosynthesis

201

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al IZH3 YLR023C Membrane protein involved in zinc ion homeostasis, member of the ‐0.7738 0.0003 four‐protein IZH family, expression induced by zinc deficiency; deletion reduces sensitivity to elevated zinc and shortens lag phase, overexpression reduces Zap1p activity PET8 YNL003C S‐adenosylmethionine transporter of the mitochondrial inner ‐0.7728 0.0003 membrane, member of the mitochondrial carrier family; required for biotin biosynthesis and respiratory growth NA YNL217W Putative protein of unknown function; weak sequence similarity to ‐0.7702 0.0006 bis (5'‐nucleotidyl)‐tetraphosphatases; (GFP)‐fusion protein localizes to the vacuole; null mutant is highly sensitive to azaserine and resistant to sodium‐O‐vandate ALG8 YOR067C Glucosyl transferase, involved in N‐linked glycosylation; adds glucose ‐0.7697 0.0002 to the dolichol‐linked oligosaccharide precursor prior to transfer to protein during lipid‐linked oligosaccharide biosynthesis; similar to Alg6p YSW1 YBR148W Protein required for normal prospore membrane formation; ‐0.7684 0.0002 interacts with Gip1p, which is the meiosis‐specific regulatory subunit of the Glc7p protein phosphatase; expressed specifically in spores and localizes to the prospore membrane MNN5 YJL186W Alpha‐1,2‐mannosyltransferase, responsible for addition of the ‐0.7670 0.0001 second alpha‐1,2‐linked mannose of the branches on the mannan backbone of oligosaccharides, localizes to an early Golgi compartment SWD1 YAR003W Subunit of the COMPASS (Set1C) complex, which methylates histone ‐0.7666 0.0002 H3 on lysine 4 and is required in transcriptional silencing near telomeres; WD40 beta propeller superfamily member with similarity to mammalian Rbbp7 STO1 YMR125W Large subunit of the nuclear mRNA cap‐binding protein complex, ‐0.7659 0.0009 interacts with Npl3p to carry nuclear poly(A)+ mRNA to cytoplasm; also involved in nuclear mRNA degradation and telomere maintenance; orthologous to mammalian CBP80 NA YIL151C Putative protein of unknown function, predicted to contain a PINc ‐0.7623 0.0007 domain NA YNR021W Putative protein of unknown function; green fluorescent protein ‐0.7622 0.0002 (GFP)‐fusion protein localizes to the endoplasmic reticulum; YNR021W is not an essential gene NA YHR078W High osmolarity‐regulated gene of unknown function ‐0.7619 0.0006 ASK10 YGR097W Component of RNA polymerase II holoenzyme, phosphorylated in ‐0.7610 0.0002 response to oxidative stress; has a role in destruction of Ssn8p; proposed to function in activation of the glycerol channel Fps1p; paralogous to Rgc1p HIP1 YGR191W High‐affinity histidine permease, also involved in the transport of ‐0.7601 0.0008 manganese ions RPL16B YNL069C N‐terminally acetylated protein component of the large (60S) ‐0.7586 0.0005 ribosomal subunit, binds to 5.8 S rRNA; has similarity to Rpl16Ap, E. coli L13 and rat L13a ribosomal proteins; transcriptionally regulated by Rap1p UBP8 YMR223W Ubiquitin‐specific protease that is a component of the SAGA (Spt‐ ‐0.7583 0.0005 Ada‐Gcn5‐Acetyltransferase) acetylation complex; required for SAGA‐mediated deubiquitination of histone H2B ESBP6 YNL125C Protein with similarity to monocarboxylate permeases, appears not ‐0.7573 0.0006 to be involved in transport of monocarboxylates such as lactate, pyruvate or acetate across the plasma membrane CIN2 YPL241C GTPase‐activating protein (GAP) for Cin4p; tubulin folding factor C ‐0.7545 0.0002 involved in beta‐tubulin (Tub2p) folding; mutants display increased chromosome loss and benomyl sensitivity; deletion complemented by human GAP, retinitis pigmentosa 2 202

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al UBP13 YBL067C Putative ubiquitin carboxyl‐terminal hydrolase, ubiquitin‐specific ‐0.7540 0.0004 protease that cleaves ubiquitin‐protein fusions NAB6 YML117W Putative RNA‐binding protein that associates with mRNAs encoding ‐0.7519 0.0006 cell wall proteins in high‐throughput studies; deletion mutants display increased sensitivity to some cell wall disrupting agents; expression negatively regulated by cAMP NA YGR127W Putative protein of unknown function; expression is regulated by ‐0.7517 0.0007 Msn2p/Msn4p, indicating a possible role in stress response ICE2 YIL090W Integral ER membrane protein with type‐III transmembrane ‐0.7515 0.0004 domains; mutations cause defects in cortical ER morphology in both the mother and daughter cells KSS1 YGR040W Mitogen‐activated protein kinase (MAPK) involved in signal ‐0.7505 0.0005 transduction pathways that control filamentous growth and pheromone response; the KSS1 gene is nonfunctional in S288C strains and functional in W303 strains TIR1 YER011W Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐ ‐0.7499 0.0004 rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking NTH2 YBR001C Putative neutral trehalase, required for thermotolerance and may ‐0.7498 0.0002 mediate resistance to other cellular stresses BER1 YLR412W Protein involved in microtubule‐related processes, N‐acetylation; ‐0.7491 0.0003 GFP‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS; YLR412W is not an essential gene; similar to Arabidopsis SRR1 gene PRM8 YGL053W Pheromone‐regulated protein with 2 predicted transmembrane ‐0.7490 0.0001 segments and an FF sequence, a motif involved in COPII binding; forms a complex with Prp9p in the ER; member of DUP240 gene family KSP1 YHR082C Ser/thr protein kinase; nuclear translocation required for haploid ‐0.7458 0.0006 filamentous growth; regulates filamentous growth induced nuclear translocation of Bcy1p, Fus3p, and Sks1p; overproduction causes allele‐specific suppression of prp20‐10 GDT1 YBR187W Putative protein of unknown function; expression is reduced in a ‐0.7451 0.0001 gcr1 null mutant; GFP‐fusion protein localizes to the vacuole; expression pattern and physical interactions suggest a possible role in ribosome biogenesis NA YKL091C Putative homolog of Sec14p, which is a ‐0.7450 0.0007 phosphatidylinositol/phosphatidylcholine transfer protein involved in lipid metabolism; localizes to the nucleus AIM22 YJL046W Putative lipoate‐protein ligase, required along with Lip2 and Lip5 for ‐0.7440 0.0002 lipoylation of Lat1p and Kgd2p; similar to E. coli LplA; null mutant displays reduced frequency of mitochondrial genome loss HOG1 YLR113W Mitogen‐activated protein kinase involved in osmoregulation via ‐0.7433 0.0003 three independent osmosensors; mediates the recruitment and activation of RNA Pol II at Hot1p‐dependent promoters; localization regulated by Ptp2p and Ptp3p TRZ1 YKR079C tRNA 3'‐end processing endonuclease tRNase Z; also localized to ‐0.7416 0.0003 mitochondria and interacts genetically with Rex2 exonuclease; homolog of the human candidate prostate cancer susceptibility gene ELAC2 MST1 YKL194C Mitochondrial threonyl‐tRNA synthetase ‐0.7414 0.0004 FAR11 YNL127W Protein involved in recovery from cell cycle arrest in response to ‐0.7404 0.0007 pheromone, in a Far1p‐independent pathway; interacts with Far3p, Far7p, Far8p, Far9p, and Far10p; has similarity to the N‐ and C‐ termini of N. crassa HAM‐2

203

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al QNS1 YHR074W Glutamine‐dependent NAD(+) synthetase, essential for the ‐0.7401 0.0003 formation of NAD(+) from nicotinic acid adenine dinucleotide MRS6 YOR370C Rab escort protein, forms a complex with the Ras‐like small GTPase ‐0.7383 0.0001 Ypt1p that is required for the prenylation of Ypt1p by protein geranylgeranyltransferase type II (Bet2p‐Bet4p); sequence similarity to mammalian choroideraemia gene ECM22 YLR228C Sterol regulatory element binding protein, regulates transcription of ‐0.7383 0.0006 sterol biosynthetic genes; contains Zn[2]‐Cys[6] binuclear cluster; homologous to Upc2p; relocates from intracellular membranes to perinuclear foci on sterol depletion YOR1 YGR281W Plasma membrane ATP‐binding cassette (ABC) transporter, multidrug ‐0.7374 0.0002 transporter mediates export of many different organic anions including oligomycin; similar to human cystic fibrosis transmembrane receptor (CFTR) NA YOR390W Putative protein of unknown function ‐0.7338 0.0002 NA YOR296W Putative protein of unknown function; green fluorescent protein ‐0.7302 0.0004 (GFP)‐fusion protein localizes to the cytoplasm; expressed during copper starvation; YOR296W is not an essential gene NEJ1 YLR265C Protein involved in regulation of nonhomologous end joining; ‐0.7282 0.0003 interacts with DNA ligase IV components Dnl4p and Lif1p; repressed by MAT heterozygosity; regulates cellular distribution of Lif1p RPL12A YEL054C Protein component of the large (60S) ribosomal subunit, nearly ‐0.7282 0.0008 identical to Rpl12Bp; rpl12a rpl12b double mutant exhibits slow growth and slow translation; has similarity to E. coli L11 and rat L12 ribosomal proteins YHC3 YJL059W Vacuolar membrane protein involved in the ATP‐dependent ‐0.7275 0.0005 transport of arginine into the vacuole and possibly in balancing ion homeostasis; homolog of human CLN3 involved in Batten disease (juvenile onset neuronal ceroid lipofuscinosis) CMK1 YFR014C Calmodulin‐dependent protein kinase; may play a role in stress ‐0.7269 0.0006 response, many CA++/calmodulan dependent phosphorylation substrates demonstrated in vitro, amino acid sequence similar to Cmk2p and mammalian Cam Kinase II AIM18 YHR198C Putative protein of unknown function; the authentic, non‐tagged ‐0.7253 0.0010 protein is detected in highly purified mitochondria in high‐ throughput studies; null mutant displays elevated frequency of mitochondrial genome loss UTP22 YGR090W Possible U3 snoRNP protein involved in maturation of pre‐18S rRNA, ‐0.7240 0.0002 based on computational analysis of large‐scale protein‐protein interaction data MAL31 YBR298C Maltose permease, high‐affinity maltose transporter (alpha‐ ‐0.7239 0.0006 glucoside transporter); encoded in the MAL3 complex locus; member of the 12 transmembrane domain superfamily of sugar transporters; functional in genomic reference strain S288C NCR1 YPL006W Vacuolar membrane protein that transits through the biosynthetic ‐0.7234 0.0009 vacuolar protein sorting pathway, involved in sphingolipid metabolism; glycoprotein and functional orthologue of human Niemann Pick C1 (NPC1) protein PEX2 YJL210W RING‐finger peroxin and E3 ubiquitin ligase, peroxisomal membrane ‐0.7187 0.0003 protein with a C‐terminal zinc‐binding RING domain, forms translocation subcomplex with Pex10p and Pex12p which functions in peroxisomal matrix protein import AXL1 YPR122W Haploid specific endoprotease that performs one of two N‐terminal ‐0.7183 0.0007 cleavages during maturation of a‐factor mating pheromone; required for axial budding pattern of haploid cells

204

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al SFT2 YBL102W Non‐essential tetra‐spanning membrane protein found mostly in the ‐0.7170 0.0003 late Golgi, can suppress some sed5 alleles; may be part of the transport machinery, but precise function is unknown; similar to mammalian syntaxin 5 NMA1 YLR328W Nicotinic acid mononucleotide adenylyltransferase, involved in ‐0.7166 0.0001 pathways of NAD biosynthesis, including the de novo, NAD(+) salvage, and nicotinamide riboside salvage pathways NA YJL147C Mitochondrial protein of unknown function; homozygous diploid ‐0.7149 0.0008 deletion strain has a sporulation defect characterized by elevated dityrosine in the soluble fraction; expression induced by calcium shortage; YJL147W is a non‐essential gene NA YHR159W Putative protein of unknown function; green fluorescent protein ‐0.7148 0.0003 (GFP)‐fusion protein localizes to the cytoplasm; potential Cdc28p substrate CST6 YIL036W Basic leucine zipper (bZIP) transcription factor of the ATF/CREB ‐0.7148 0.0010 family, proposed to be a regulator of oleate responsive genes; involved in utilization of non‐optimal carbon sources and chromosome stability RFT1 YBL020W Essential integral membrane protein that is required for ‐0.7110 0.0002 translocation of Man5GlcNac2‐PP‐Dol from the cytoplasmic side to the lumenal side of the ER membrane but is not the flippase; mutation is suppressed by expression of human p53 protein PAU5 YFL020C Member of the seripauperin multigene family encoded mainly in ‐0.7083 0.0009 subtelomeric regions; induced during alcoholic fermentation; induced by low temperature and also by anaerobic conditions; negatively regulated by oxygen and repressed by heme NA YHR035W Putative protein of unknown function; not an essential gene ‐0.7073 0.0003

STP22 YCL008C Component of the ESCRT‐I complex, which is involved in ubiquitin‐ ‐0.7068 0.0004 dependent sorting of proteins into the endosome; homologous to the mouse and human Tsg101 tumor susceptibility gene; mutants exhibit a Class E Vps phenotype NUP157 YER105C Abundant subunit of the nuclear pore complex (NPC), present on ‐0.7064 0.0004 both sides of the NPC; has similarity to Nup170p; essential role, with Nup170p, in NPC assembly BTS1 YPL069C Geranylgeranyl diphosphate synthase, increases the intracellular ‐0.7058 0.0005 pool of geranylgeranyl diphosphate, suppressor of bet2 mutation that causes defective geranylgeranylation of small GTP‐binding proteins that mediate vesicular traffic TOK1 YJL093C Outward‐rectifier potassium channel of the plasma membrane with ‐0.7051 0.0004 two pore domains in tandem, each of which forms a functional channel permeable to potassium; carboxy tail functions to prevent inner gate closures; target of K1 toxin PCL8 YPL219W Cyclin, interacts with Pho85p cyclin‐dependent kinase (Cdk) to ‐0.7047 0.0003 phosphorylate and regulate glycogen synthase, also activates Pho85p for Glc8p phosphorylation TUL1 YKL034W Golgi‐localized RING‐finger ubiquitin ligase (E3), involved in ‐0.7047 0.0009 ubiquitinating and sorting membrane proteins that contain polar transmembrane domains to multivesicular bodies for delivery to the vacuole for quality control purposes RSF2 YJR127C Zinc‐finger protein involved in transcriptional control of both nuclear ‐0.7046 0.0006 and mitochondrial genes, many of which specify products required for glycerol‐based growth, respiration, and other functions

205

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al COT1 YOR316C Vacuolar transporter that mediates zinc transport into the vacuole; ‐0.7045 0.0004 overexpression confers resistance to cobalt and rhodium SGF11 YPL047W Integral subunit of SAGA histone acetyltransferase complex, ‐0.7041 0.0004 regulates transcription of a subset of SAGA‐regulated genes, required for the Ubp8p association with SAGA and for H2B deubiquitylation NA YIL092W Putative protein of unknown function; green fluorescent protein ‐0.7027 0.0004 (GFP)‐fusion protein localizes to the cytoplasm and to the nucleus AMN1 YBR158W Protein required for daughter cell separation, multiple mitotic ‐0.7024 0.0009 checkpoints, and chromosome stability; contains 12 degenerate leucine‐rich repeat motifs; expression is induced by the Mitotic Exit Network (MEN) NA YKR005C Putative protein of unknown function ‐0.7022 0.0006 NA YJL016W Putative protein of unknown function; GFP‐fusion protein localizes to ‐0.7015 0.0002 the cytoplasm; conserved in closely related Saccharomyces species

NA NA NA ‐0.7014 0.0007 SPI1 YER150W GPI‐anchored cell wall protein involved in weak acid resistance; basal ‐0.7005 0.0009 expression requires Msn2p/Msn4p; expression is induced under conditions of stress and during the diauxic shift; similar to Sed1p

MSN1 YOL116W Transcriptional activator involved in regulation of invertase and ‐0.6982 0.0003 glucoamylase expression, invasive growth and pseudohyphal differentiation, iron uptake, chromium accumulation, and response to osmotic stress; localizes to the nucleus NA YKL027W Protein of unknown function, localized to the mitochondrial outer ‐0.6977 0.0007 membrane ARG2 YJL071W Acetylglutamate synthase (glutamate N‐acetyltransferase), ‐0.6976 0.0006 mitochondrial enzyme that catalyzes the first step in the biosynthesis of the arginine precursor ornithine; forms a complex with Arg5,6p

PHO91 YNR013C Low‐affinity phosphate transporter of the vacuolar membrane; ‐0.6970 0.0002 deletion of pho84, pho87, pho89, pho90, and pho91 causes synthetic lethality; transcription independent of Pi and Pho4p activity; overexpression results in vigorous growth NA YJR015W Putative protein of unknown function; localizes to the endoplasmic ‐0.6967 0.0002 reticulum and cytoplasm; predicted to encode a membrane transporter based on phylogenetic analysis; YJR015W is a non‐ essential gene SUR1 YPL057C Probable catalytic subunit of a mannosylinositol phosphorylceramide ‐0.6954 0.0007 (MIPC) synthase, forms a complex with probable regulatory subunit Csg2p; function in sphingolipid biosynthesis is overlapping with that of Csh1p TED1 YIL039W Conserved phosphoesterase domain‐containing protein that acts ‐0.6950 0.0002 together with Emp24p/Erv25p in cargo exit from the ER; deletion confers sensitivity to 4‐(N‐(S‐glutathionylacetyl)amino) phenylarsenoxide (GSAO) SAS5 YOR213C Subunit of the SAS complex (Sas2p, Sas4p, Sas5p), which acetylates ‐0.6915 0.0008 free histones and nucleosomes and regulates transcriptional silencing; stimulates Sas2p HAT activity NA YKR051W Putative protein of unknown function ‐0.6914 0.0003 KEG1 YFR042W Integral membrane protein of the ER; physically interacts with Kre6p; ‐0.6877 0.0007 has a role in the synthesis of beta‐1,6‐glucan in the cell wall; required for cell viability 206

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al CWH43 YCR017C Putative sensor/transporter protein involved in cell wall biogenesis; ‐0.6876 0.0006 contains 14‐16 transmembrane segments and several putative glycosylation and phosphorylation sites; null mutation is synthetically lethal with pkc1 deletion CDC20 YGL116W Cell‐cycle regulated activator of anaphase‐promoting ‐0.6843 0.0001 complex/cyclosome (APC/C), which is required for metaphase/anaphase transition; directs ubiquitination of mitotic cyclins, Pds1p, and other anaphase inhibitors; potential Cdc28p substrate ARV1 YLR242C Protein functioning in transport of glycosylphosphatidylinositol ‐0.6839 0.0010 intermediates into ER lumen; required for normal intracellular sterol distribution; human ARV1 required for normal cholesterol and bile acid homeostasis; similar to Nup120p KEX2 YNL238W Subtilisin‐like protease (proprotein convertase), a calcium‐ ‐0.6821 0.0003 dependent serine protease involved in the activation of proproteins of the secretory pathway NSG1 YHR133C Protein involved in regulation of sterol biosynthesis; specifically ‐0.6797 0.0002 stabilizes Hmg2p, one of two HMG‐CoA isoenzymes that catalyze the rate‐limiting step in sterol biosynthesis; homolog of mammalian INSIG proteins RIM2 YBR192W Mitochondrial pyrimidine nucleotide transporter; imports pyrimidine ‐0.6788 0.0003 nucleoside triphosphates and exports pyrimidine nucleoside monophosphates; member of the mitochondrial carrier family POR2 YIL114C Putative mitochondrial porin (voltage‐dependent anion channel), ‐0.6786 0.0001 related to Por1p but not required for mitochondrial membrane permeability or mitochondrial osmotic stability EST3 YIL009C‐A Component of the telomerase holoenzyme, involved in telomere ‐0.6782 0.0007 replication NA YPR127W Protein of unknown function, differentially expressed during ‐0.6777 0.0005 alcoholic fermentation; expression activated by transcription factor YRM1/YOR172W; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus ERG24 YNL280C C‐14 sterol reductase, acts in ergosterol biosynthesis; mutants ‐0.6772 0.0008 accumulate the abnormal sterol ignosterol (ergosta‐8,14 dienol), and are viable under anaerobic growth conditions but inviable on rich medium under aerobic conditions RML2 YEL050C Mitochondrial ribosomal protein of the large subunit, has similarity ‐0.6771 0.0006 to E. coli L2 ribosomal protein; fat21 mutant allele causes inability to utilize oleate and may interfere with activity of the Adr1p transcription factor CLB4 YLR210W B‐type cyclin involved in cell cycle progression; activates Cdc28p to ‐0.6756 0.0003 promote the G2/M transition; may be involved in DNA replication and spindle assembly; accumulates during S phase and G2, then targeted for ubiquitin‐mediated degradation LSB3 YFR024C‐A Protein containing a C‐terminal SH3 domain; binds Las17p, which is a ‐0.6733 0.0002 homolog of human Wiskott‐Aldrich Syndrome protein involved in actin patch assembly and actin polymerization YUR1 YJL139C Mannosyltransferase of the KTR1 family, involved in protein N‐ ‐0.6709 0.0006 glycosylation; located in the Golgi apparatus TYW3 YGL050W tRNA methyltransferase required for synthesis of wybutosine, a ‐0.6693 0.0002 modified guanosine found at the 3'‐position adjacent to the anticodon of phenylalanine tRNA which supports reading frame maintenance by stabilizing codon‐anticodon interactions

207

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al ALG1 YBR110W Mannosyltransferase, involved in asparagine‐linked glycosylation in ‐0.6684 0.0005 the endoplasmic reticulum (ER); essential for viability, mutation is functionally complemented by human ortholog

NA YMR258C Protein of unknown function with similarity to F‐box proteins; ‐0.6683 0.0004 physically interacts with Skp1p; green fluorescent protein (GFP)‐ fusion protein localizes to the cytoplasm and nucleus; YMR258C is not an essential gene NA YCR015C Putative protein of unknown function; YCR015C is not an essential ‐0.6653 0.0002 gene SYP1 YCR030C Protein of unknown function that is involved in endocytic site ‐0.6649 0.0006 formation; may regulate assembly and disassembly of the septin ring; colocalizes and interacts with septin subunits; potential role in actin cytoskeletal organization NA YOR019W Protein of unknown function that may interact with ribosomes, ‐0.6644 0.0003 based on co‐purification experiments PSY2 YNL201C Putative subunit of an evolutionarily conserved protein phosphatase ‐0.6640 0.0005 complex containing the catalytic subunit Pph3p and the regulatory subunit Psy4p; required for cisplatin and oxaliplatin resistance; putative homolog of mammalian R3 NA YFR035C Putative protein of unknown function, deletion mutant exhibits ‐0.6639 0.0009 synthetic phenotype with alpha‐synuclein ADH4 YGL256W Alcohol dehydrogenase isoenzyme type IV, dimeric enzyme ‐0.6615 0.0004 demonstrated to be zinc‐dependent despite sequence similarity to iron‐activated alcohol dehydrogenases; transcription is induced in response to zinc deficiency PRR2 YDL214C Serine/threonine protein kinase that inhibits pheromone induced ‐0.6613 0.0003 signalling downstream of MAPK, possibly at the level of the Ste12p transcription factor; mutant has increased aneuploidy tolerance

MKK1 YOR231W Mitogen‐activated kinase kinase involved in protein kinase C ‐0.6594 0.0002 signaling pathway that controls cell integrity; upon activation by Bck1p phosphorylates downstream target, Slt2p; functionally redundant with Mkk2p RGD2 YFL047W GTPase‐activating protein (RhoGAP) for Cdc42p and Rho5p ‐0.6585 0.0002 MDM38 YOL027C Mitochondrial inner membrane protein, involved in membrane ‐0.6572 0.0005 integration of a subset of mitochondrial proteins; required for K+/H+ exchange; associates with mitochondrial ribosomes; human ortholog Letm1 implicated in Wolf‐Hirschhorn syndrome VID28 YIL017C Protein involved in proteasome‐dependent catabolite degradation of ‐0.6572 0.0006 fructose‐1,6‐bisphosphatase (FBPase); localized to the nucleus and the cytoplasm AFI1 YOR129C Arf3p polarization‐specific docking factor, required for the polarized ‐0.6569 0.0009 distribution of the ADP‐ribosylation factor, Arf3p; participates in polarity development and maintenance of a normal haploid budding pattern; interacts with Cnm7p PGA1 YNL158W Essential component of GPI‐mannosyltransferase II, responsible for ‐0.6565 0.0009 second mannose addition to GPI precursors as a partner of Gpi18p; required for maturation of Gas1p and Pho8p; has synthetic genetic interations with secretory pathway genes COX15 YER141W Protein required for the hydroxylation of heme O to form heme A, ‐0.6562 0.0005 which is an essential prosthetic group for cytochrome c oxidase

208

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al PMA1 YGL008C Plasma membrane H+‐ATPase, pumps protons out of the cell; major ‐0.6516 0.0003 regulator of cytoplasmic pH and plasma membrane potential; part of the P2 subgroup of cation‐transporting ATPases; Hsp30p plays a role in Pma1p regulation JJJ2 YJL162C Protein of unknown function, contains a J‐domain, which is a region ‐0.6508 0.0007 with homology to the E. coli DnaJ protein LSB6 YJL100W Type II phosphatidylinositol 4‐kinase that binds Las17p, which is a ‐0.6499 0.0006 homolog of human Wiskott‐Aldrich Syndrome protein involved in actin patch assembly and actin polymerization

HEK2 YBL032W RNA binding protein involved in the asymmetric localization of ASH1 ‐0.6497 0.0003 mRNA; represses translation of ASH1 mRNA, an effect reversed by Yck1p‐dependent phosphoryation; regulates telomere position effect and length; similarity to hnRNP‐K CPR8 YNR028W Peptidyl‐prolyl cis‐trans isomerase (cyclophilin), catalyzes the cis‐ ‐0.6473 0.0003 trans isomerization of peptide bonds N‐terminal to proline residues; similarity to Cpr4p suggests a potential role in the secretory pathway

NA YLR177W Putative protein of unknown function; phosphorylated by Dbf2p‐ ‐0.6469 0.0008 Mob1p in vitro; some strains contain microsatellite polymophisms at this locus; YLR177W is not an essential gene

WRS1 YOL097C Cytoplasmic tryptophanyl‐tRNA synthetase, aminoacylates ‐0.6458 0.0006 tryptophanyl‐tRNA AIM19 YIL087C Putative protein of unknown function; the authentic, non‐tagged ‐0.6412 0.0004 protein is detected in purified mitochondria in high‐throughput studies; null mutant displays reduced respiratory growth ATG7 YHR171W Autophagy‐related protein and dual specificity member of the E1 ‐0.6401 0.0010 family of ubiquitin‐activating enzymes; mediates the conjugation of Atg12p with Atg5p and Atg8p with phosphatidylethanolamine, required steps in autophagosome formation DOG1 YHR044C 2‐deoxyglucose‐6‐phosphate phosphatase, similar to Dog2p, ‐0.6398 0.0005 member of a family of low molecular weight phosphatases; confers 2‐deoxyglucose resistance when overexpressed, in vivo substrate has not yet been identified PDR17 YNL264C Phosphatidylinositol transfer protein (PITP), downregulates Plb1p‐ ‐0.6393 0.0003 mediated turnover of phosphatidylcholine, found in the cytosol and microsomes, homologous to Pdr16p, deletion affects phospholipid composition YDC1 YPL087W Alkaline dihydroceramidase, involved in sphingolipid metabolism; ‐0.6369 0.0007 preferentially hydrolyzes dihydroceramide to a free fatty acid and dihydrosphingosine; has a minor reverse activity RKR1 YMR247C RING domain E3 ubiquitin ligase; involved in the ubiquitin‐mediated ‐0.6334 0.0002 degradation of non‐stop proteins; functional connections to chromatin modification; nuclear protein that also co‐localizes with ribosomes; homolog of mouse listerin IRC20 YLR247C Putative helicase; localizes to the mitochondrion and the nucleus; ‐0.6333 0.0008 YLR247C is not an essential gene; null mutant displays increased levels of spontaneous Rad52p foci PTK1 YKL198C Putative serine/threonine protein kinase that regulates spermine ‐0.6332 0.0003 uptake; involved in polyamine transport; possible mitochondrial protein GCD7 YLR291C Beta subunit of the translation initiation factor eIF2B, the guanine‐ ‐0.6312 0.0003 nucleotide exchange factor for eIF2; activity subsequently regulated by phosphorylated eIF2; first identified as a negative regulator of GCN4 expression

209

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al NA YBR219C Putative protein of unknown function; YBR219C is not an essential ‐0.6312 0.0006 gene NA NA NA ‐0.6311 0.0010 RPL17A YKL180W Protein component of the large (60S) ribosomal subunit, nearly ‐0.6284 0.0007 identical to Rpl17Bp and has similarity to E. coli L22 and rat L17 ribosomal proteins; copurifies with the Dam1 complex (aka DASH complex) ARR1 YPR199C Transcriptional activator of the basic leucine zipper (bZIP) family, ‐0.6266 0.0006 required for transcription of genes involved in resistance to arsenic compounds CHS3 YBR023C Chitin synthase III, catalyzes the transfer of N‐acetylglucosamine ‐0.6262 0.0004 (GlcNAc) to chitin; required for synthesis of the majority of cell wall chitin, the chitin ring during bud emergence, and spore wall chitosan

LDB16 YCL005W Protein of unknown function; null mutants have decreased net ‐0.6218 0.0002 negative cell surface charge; GFP‐fusion protein expression is induced in response to the DNA‐damaging agent MMS; native protein is detected in purified mitochondria RPS18B YML026C Protein component of the small (40S) ribosomal subunit; nearly ‐0.6213 0.0002 identical to Rps18Ap and has similarity to E. coli S13 and rat S18 ribosomal proteins HVG1 YER039C Protein of unknown function, has homology to Vrg4p ‐0.6209 0.0003 CPT1 YNL130C Cholinephosphotransferase, required for phosphatidylcholine ‐0.6207 0.0004 biosynthesis and for inositol‐dependent regulation of EPT1 transcription NA YBR235W Putative ion transporter, similar to mammalian electroneutral Na(+)‐ ‐0.6202 0.0006 (K+)‐C1‐ cotransporter family; YBR235W is not an essential gene

YMD8 YML038C Putative nucleotide sugar transporter, has similarity to Vrg4p ‐0.6174 0.0004

DFG10 YIL049W Protein of unknown function, involved in filamentous growth ‐0.6172 0.0004

NA YHR045W Putative protein of unknown function; possible role in iron ‐0.6166 0.0004 metabolism and/or amino acid and carbohydrate metabolism; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum YCK2 YNL154C Palmitoylated plasma membrane‐bound casein kinase I isoform; ‐0.6162 0.0006 shares redundant functions with Yck1p in morphogenesis, proper septin assembly, endocytic trafficking; provides an essential function overlapping with that of Yck1p CAN1 YEL063C Plasma membrane arginine permease, requires phosphatidyl ‐0.6149 0.0002 ethanolamine (PE) for localization, exclusively associated with lipid rafts; mutation confers canavanine resistance ODC2 YOR222W Mitochondrial inner membrane transporter, exports 2‐oxoadipate ‐0.6146 0.0002 and 2‐oxoglutarate from the mitochondrial matrix to the cytosol for use in lysine and glutamate biosynthesis and in lysine catabolism

LEU5 YHR002W Mitochondrial carrier protein involved in the accumulation of CoA in ‐0.6127 0.0004 the mitochondrial matrix; homolog of human Graves disease protein; does not encode an isozyme of Leu4p, as first hypothesized

NA YOL098C Putative metalloprotease ‐0.6120 0.0004 CIR2 YOR356W Putative ortholog of human electron transfer flavoprotein ‐0.6118 0.0006 dehydrogenase (ETF‐dH); found in a large supramolecular complex with other mitochondrial dehydrogenases; may have a role in oxidative stress response

210

log2(mtr10. adj.p.v Symbols ORF Description Ts/WT.TS) al NA YIL067C Uncharacterized protein of unknown function ‐0.6094 0.0008 TIR3 YIL011W Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐ ‐0.6073 0.0003 rich proteins; expressed under anaerobic conditions and required for anaerobic growth AFT2 YPL202C Iron‐regulated transcriptional activator; activates genes involved in ‐0.6049 0.0004 intracellular iron use and required for iron homeostasis and resistance to oxidative stress; similar to Aft1p

MDL2 YPL270W Mitochondrial inner membrane half‐type ATP‐binding cassette (ABC) ‐0.6019 0.0010 transporter, required for respiratory growth at high temperature; similar to human TAP1 and TAP2 implicated in bare lymphocyte syndrome and Wegener‐like granulomatosis SCS3 YGL126W Protein required for inositol prototrophy, identified as an ortholog of ‐0.6013 0.0010 the FIT family of proteins involved in triglyceride droplet biosynthesis; disputed role in the synthesis of inositol phospholipids from inositol

211

APPENDIX J: Up-regulated genes in mtr10Δ cells in amino acid starved condition

This section includes the list of transcriptionally differentially expressed genes (cutoff conditions: log2 FC 0.6 and adjusted p-value < 0.001) in mtr10Δ cells in amino acid starved condition.

Up-regulated genes in mtr10Δ cells in amino acid starved condition.

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) CSN9 YDR179C Subunit of the Cop9 signalosome, which is required for 3.1021 0.0000 deneddylation, or removal of the ubiquitin‐like protein Rub1p from Cdc53p (cullin); involved in adaptation to pheromone signaling

STL1 YDR536W Glycerol proton symporter of the plasma membrane, subject to 2.4358 0.0000 glucose‐induced inactivation, strongly but transiently induced when cells are subjected to osmotic shock NA YNR062C Putative membrane protein of unknown function 2.4040 0.0000 NA YDR034W‐B Predicted tail‐anchored plasma membrane protein containing a 2.3777 0.0000 conserved CYSTM module; related proteins in other organisms may be involved in response to stress; green fluorescent protein (GFP)‐ fusion protein localizes to the cell periphery BUG1 YDL099W Cis‐golgi localized protein involved in ER to Golgi transport; forms a 2.1003 0.0000 complex with the mammalian GRASP65 homolog, Grh1p; mutants are compromised for the fusion of ER‐derived vesicles with Golgi membranes NA YBR056W‐A Dubious open reading frame unlikely to encode a protein, based on 2.0108 0.0001 available experimental and comparative sequence data; partially overlaps the dubious ORF YBR056C‐B NA YDL114W Putative protein of unknown function with similarity to acyl‐carrier‐ 2.0075 0.0001 protein reductases; YDL114W is not an essential gene

SDC1 YDR469W Subunit of the COMPASS (Set1C) complex, which methylates lysine 4 1.9835 0.0000 of histone H3 and is required in chromatin silencing at telomeres; contains a Dpy‐30 domain that mediates interaction with Bre2p; similar to C. elegans and human DPY‐30

212

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) KRE28 YDR532C Subunit of a kinetochore‐microtubule binding complex with 1.9616 0.0000 Spc105p that bridges centromeric heterochromatin and kinetochore MAPs and motors, and is also required for sister chromatid bi‐ orientation and kinetochore binding of SAC components SLF1 YDR515W RNA binding protein that associates with polysomes; proposed to be 1.9587 0.0000 involved in regulating mRNA translation; involved in the copper‐ dependent mineralization of copper sulfide complexes on cell surface in cells cultured in copper salts NA YFR012W‐A Putative protein of unknown function; identified by homology 1.9170 0.0000

DON1 YDR273W Meiosis‐specific component of the spindle pole body, part of the 1.8897 0.0000 leading edge protein (LEP) coat, forms a ring‐like structure at the leading edge of the prospore membrane during meiosis II

NA YDR514C Putative protein of unknown function 1.8877 0.0000 CSM4 YPL200W Protein required for accurate chromosome segregation during 1.8867 0.0001 meiosis; involved in meiotic telomere clustering (bouquet formation) and telomere‐led rapid prophase movements

SRT1 YMR101C Cis‐prenyltransferase involved in synthesis of long‐chain dolichols 1.8689 0.0000 (19‐22 isoprene units; as opposed to Rer2p which synthesizes shorter‐chain dolichols); localizes to lipid bodies; transcription is induced during stationary phase NA YAR064W Putative protein of unknown function 1.8530 0.0000 NSE4 YDL105W Nuclear protein that plays a role in the function of the Smc5p‐ 1.8367 0.0001 Rhc18p complex TFB5 YDR079C‐A Component of the RNA polymerase II general transcription and DNA 1.8357 0.0000 repair factor TFIIH; involved in transcription initiation and in nucleotide‐excision repair; homolog of Chlamydomonas reinhardtii REX1‐S protein involved in DNA repair DAD4 YDR320C‐A Essential subunit of the Dam1 complex (aka DASH complex), couples 1.8149 0.0000 kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis PEX19 YDL065C Chaperone and import receptor for newly‐synthesized class I 1.7924 0.0000 peroxisomal membrane proteins (PMPs), binds PMPs in the cytoplasm and delivers them to the peroxisome for subsequent insertion into the peroxisomal membrane NOP6 YDL213C rRNA‐binding protein required for 40S ribosomal subunit biogenesis; 1.7819 0.0000 contains an RNA recognition motif (RRM) and has similarity to hydrophilins; NOP6 may be a fungal‐specific gene as no homologs have been yet identified in higher eukaryotes SNN1 YNL086W Putative protein of unknown function; likely member of BLOC 1.7769 0.0000 complex involved in endosomal cargo sorting; green fluorescent protein (GFP)‐fusion protein localizes to endosomes

MSH6 YDR097C Protein required for mismatch repair in mitosis and meiosis, forms a 1.7721 0.0000 complex with Msh2p to repair both single‐base & insertion‐deletion mispairs; potentially phosphorylated by Cdc28p

NA YDR374C Putative protein of unknown function 1.7619 0.0000 NA YBR219C Putative protein of unknown function; YBR219C is not an essential 1.7564 0.0001 gene

213

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) NA YDL160C‐A Putative protein of unknown function; mutant in a srs2 mutant 1.7098 0.0000 background displays MMS hypersensitivity; ortholog of human MHF2, a component of the Fanconi anemia (FA) complex that is involved in maintaining genome stability RRP17 YDR412W Component of the pre‐60S pre‐ribosomal particle; required for cell 1.7033 0.0001 viability under standard (aerobic) conditions but not under anaerobic conditions; exonuclease required for 5′ end processing of pre‐60S ribosomal RNA RAD34 YDR314C Protein involved in nucleotide excision repair (NER); homologous to 1.6958 0.0000 RAD4 TAF10 YDR167W Subunit (145 kDa) of TFIID and SAGA complexes, involved in RNA 1.6930 0.0000 polymerase II transcription initiation and in chromatin modification

PES4 YFR023W Poly(A) binding protein, suppressor of DNA polymerase epsilon 1.6841 0.0000 mutation, similar to Mip6p JAC1 YGL018C Specialized J‐protein that functions with Hsp70 in Fe‐S cluster 1.6789 0.0000 biogenesis in mitochondria, involved in iron metabolism; contains a J domain typical to J‐type chaperones; localizes to the mitochondrial matrix ZIP1 YDR285W Transverse filament protein of the synaptonemal complex; required 1.6739 0.0000 for normal levels of meiotic recombination and pairing between homologous chromosome during meiosis; potential Cdc28p substrate DYN2 YDR424C Cytoplasmic light chain dynein, microtubule motor protein; 1.6724 0.0000 proposed to be involved in the assembly of the nuclear pore complex HXT9 YJL219W Putative hexose transporter that is nearly identical to Hxt11p, has 1.6722 0.0001 similarity to major facilitator superfamily (MFS) transporters, expression of HXT9 is regulated by transcription factors Pdr1p and Pdr3p NA YOR072W‐B Putative protein of unknown function; identified by expression 1.6602 0.0006 profiling and mass spectrometry RAD28 YDR030C Protein involved in DNA repair, related to the human CSA protein 1.6540 0.0000 that is involved in transcription‐coupled repair nucleotide excision repair CWC15 YDR163W Non‐essential protein involved in pre‐mRNA splicing, component of 1.6455 0.0000 a complex containing Cef1p; has similarity to S. pombe Cwf15p

MGT1 YDL200C DNA repair methyltransferase (6‐O‐methylguanine‐DNA methylase) 1.6327 0.0000 involved in protection against DNA alkylation damage

TMA23 YMR269W Nucleolar protein of unknown function implicated in ribosome 1.6318 0.0006 biogenesis; TMA23 may be a fungal‐specific gene as no homologs have been yet identified in higher eukaryotes

URM1 YIL008W Ubiquitin‐like protein involved in thiolation of cytoplasmic tRNAs; 1.6288 0.0001 receives sulfur from the E1‐like enzyme Uba4p and transfers it to tRNA; also functions as a protein tag with roles in nutrient sensing and oxidative stress response RPT2 YDL007W One of six ATPases of the 19S regulatory particle of the 26S 1.6213 0.0000 proteasome involved in the degradation of ubiquitinated substrates; required for normal peptide hydrolysis by the core 20S particle

214

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) HSP82 YPL240C Hsp90 chaperone required for pheromone signaling and negative 1.6164 0.0002 regulation of Hsf1p; docks with Tom70p for mitochondrial preprotein delivery; promotes telomerase DNA binding and nucleotide addition; interacts with Cns1p, Cpr6p, Cpr7p, Sti1p NA YGR146C‐A Putative protein of unknown function 1.6157 0.0000 MER1 YNL210W Protein with RNA‐binding motifs required for meiosis‐specific mRNA 1.6117 0.0000 splicing; required for chromosome pairing and meiotic recombination FAP7 YDL166C Essential NTPase required for small ribosome subunit synthesis, 1.5956 0.0001 mediates processing of the 20S pre‐rRNA at site D in the cytoplasm but associates only transiently with 43S preribosomes via Rps14p, may be the endonuclease for site D YPS3 YLR121C Aspartic protease, member of the yapsin family of proteases 1.5860 0.0002 involved in cell wall growth and maintenance; attached to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor

CNL1 YDR357C Protein of unknown function; likely member of BLOC complex 1.5805 0.0001 involved in endosomal cargo sorting; null mutant is sensitive to drug inducing secretion of vacuolar cargo; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm MBP1 YDL056W Transcription factor involved in regulation of cell cycle progression 1.5753 0.0001 from G1 to S phase, forms a complex with Swi6p that binds to MluI cell cycle box regulatory element in promoters of DNA synthesis genes SAS10 YDL153C Essential subunit of U3‐containing Small Subunit (SSU) processome 1.5740 0.0007 complex involved in production of 18S rRNA and assembly of small ribosomal subunit; disrupts silencing when overproduced; mutant has increased aneuploidy tolerance CAR1 YPL111W Arginase, responsible for arginine degradation, expression responds 1.5642 0.0001 to both induction by arginine and nitrogen catabolite repression; disruption enhances freeze tolerance RPC53 YDL150W RNA polymerase III subunit C53 1.5616 0.0003 ESF1 YDR365C Nucleolar protein involved in pre‐rRNA processing; depletion causes 1.5547 0.0001 severely decreased 18S rRNA levels NA YDL177C Putative protein of unknown function; similar to the mouse IMPACT 1.5505 0.0000 gene; YDL177C is not an essential gene VPS64 YDR200C Protein required for cytoplasm to vacuole targeting of proteins; 1.5494 0.0002 forms a complex with Far3p and Far7p to Far11p involved in recovery from pheromone‐induced cell cycle arrest; mutant has increased aneuploidy tolerance NA YLR154C‐H Putative protein of unknown function identified by fungal homology 1.5435 0.0003 comparisons and RT‐PCR; this ORF partially overlaps RND5‐2 SEM1 YDR363W‐A Component of the lid subcomplex of the regulatory subunit of the 1.5263 0.0000 26S proteasome; involved in mRNA export mediated by the TREX‐2 complex (Sac3p‐Thp1p); ortholog of human DSS1

SSA2 YLL024C ATP binding protein involved in protein folding and vacuolar import 1.5248 0.0001 of proteins; member of heat shock protein 70 (HSP70) family; associated with the chaperonin‐containing T‐complex; present in the cytoplasm, vacuolar membrane and cell wall RAD9 YDR217C DNA damage‐dependent checkpoint protein, required for cell‐cycle 1.5213 0.0001 arrest in G1/S, intra‐S, and G2/M; transmits checkpoint signal by activating Rad53p and Chk1p; hyperphosphorylated by Mec1p and Tel1p; potential Cdc28p substrate

215

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) PCC1 YKR095W‐A Component of the EKC/KEOPS protein complex with Kae1p, Gon7p, 1.5068 0.0000 Bud32p, and Cgi121p; EKC/KEOPS complex is required for t6A tRNA modification and may have roles in telomere maintenance and transcription RRP8 YDR083W Nucleolar protein involved in rRNA processing, pre‐rRNA cleavage at 1.5057 0.0007 site A2; also involved in telomere maintenance; mutation is synthetically lethal with a gar1 mutation

FAL1 YDR021W Nucleolar protein required for maturation of 18S rRNA, member of 1.5047 0.0006 the eIF4A subfamily of DEAD‐box ATP‐dependent RNA helicases NA YLR361C‐A Putative protein of unknown function 1.5011 0.0000 CWC21 YDR482C Protein involved in RNA splicing by the spliceosome; component of 1.4971 0.0000 a complex containing Cef1p; interacts genetically with ISY1 and BUD13; may bind RNA; has similarity to S. pombe Cwf21p

VBA3 YCL069W Permease of basic amino acids in the vacuolar membrane 1.4959 0.0001 QRI7 YDL104C Highly conserved mitochondrial protein, essential for t6A 1.4790 0.0001 modification of mitochondrial tRNAs that decode ANN codons; similar to Kae1p and E. coli YgjD, both of which are also required for tRNA t6A modification NA YCR108C Putative protein of unknown function; identified by fungal 1.4760 0.0000 homology and RT‐PCR SMD3 YLR147C Core Sm protein Sm D3; part of heteroheptameric complex (with 1.4698 0.0000 Smb1p, Smd1p, Smd2p, Sme1p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm D3 YOS9 YDR057W ER quality‐control lectin; integral subunit of the HRD ligase; binds to 1.4680 0.0001 glycans with terminal alpha‐1,6 linked mannose on misfolded N‐ glycosylated proteins and participates in targeting proteins to ERAD; member of the OS‐9 protein family BUR6 YER159C Subunit of a heterodimeric NC2 transcription regulator complex 1.4676 0.0000 with Ncb2p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2alpha NA YDR379C‐A Protein involved in the assembly of the mitochondrial succinate 1.4671 0.0002 dehydrogenase complex; mutations in human ortholog SDHAF1 are associated with infantile leukoencephalopathy

NA YFL067W Protein of unknown function, down‐regulated at low calcium levels 1.4639 0.0000

BTN2 YGR142W v‐SNARE binding protein that facilitates specific protein retrieval 1.4614 0.0001 from a late endosome to the Golgi; modulates arginine uptake, possible role in mediating pH homeostasis between the vacuole and plasma membrane H(+)‐ATPase GIR2 YDR152W Highly‐acidic cytoplasmic RWD domain‐containing protein of 1.4579 0.0000 unknown function; forms a complex with Rbg2p; interacts with Rbg1p and Gcn1p; associates with translating ribosomes; putative intrinsically unstructured protein SSA1 YAL005C ATPase involved in protein folding and nuclear localization signal 1.4578 0.0001 (NLS)‐directed nuclear transport; member of heat shock protein 70 (HSP70) family; forms a chaperone complex with Ydj1p; localized to the nucleus, cytoplasm, and cell wall PDS1 YDR113C Securin, inhibits anaphase by binding separin Esp1p; blocks cyclin 1.4565 0.0000 destruction and mitotic exit, essential for meiotic progression and mitotic cell cycle arrest; localization is cell‐cycle dependent and regulated by Cdc28p phosphorylation 216

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) NA YDR161W Putative protein of unknown function; non‐essential gene; proposed 1.4502 0.0005 function in rRNA and ribosome biosynthesis based on transcriptional co‐regulation; genetic interactions suggest a role in ER‐associated protein degradation (ERAD) NA YLR194C Structural constituent of the cell wall attached to the plasma 1.4448 0.0000 membrane by a GPI‐anchor; expression is upregulated in response to cell wall stress NA YGR226C Dubious open reading frame, unlikely to encode a protein; not 1.4351 0.0000 conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W RNH202 YDR279W Ribonuclease H2 subunit, required for RNase H2 activity; related to 1.4311 0.0000 human AGS2 that causes Aicardi‐Goutieres syndrome NA YDL157C Putative protein of unknown function; the authentic, non‐tagged 1.4202 0.0000 protein is detected in highly purified mitochondria in high‐ throughput studies NA YLR363W‐A Putative protein of unknown function; green fluorescent protein 1.4082 0.0003 (GFP)‐fusion protein localizes to the nucleus DAD1 YDR016C Essential subunit of the Dam1 complex (aka DASH complex), couples 1.4068 0.0000 kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis PET100 YDR079W Chaperone that specifically facilitates the assembly of cytochrome c 1.4037 0.0000 oxidase, integral to the mitochondrial inner membrane; interacts with a subcomplex of subunits VII, VIIa, and VIII (Cox7p, Cox9p, and Cox8p) but not with the holoenzyme SPC19 YDR201W Essential subunit of the Dam1 complex (aka DASH complex), couples 1.3975 0.0000 kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; also localized to nuclear side of spindle pole body VPS60 YDR486C Cytoplasmic and vacuolar membrane protein involved in late 1.3818 0.0000 endosome to vacuole transport; required for normal filament maturation during pseudohyphal growth; may function in targeting cargo proteins for degradation; interacts with Vta1p NA YOL155W‐A Putative protein of unknown function; identified by expression 1.3807 0.0000 profiling and mass spectrometry RTT103 YDR289C Protein that interacts with exonuclease Rat1p and Rai1p and plays a 1.3805 0.0000 role in transcription termination by RNA polymerase II, has an RPR domain (carboxy‐terminal domain interacting domain); also involved in regulation of Ty1 transposition NA YHR214C‐E Putative protein of unknown function; identified by gene‐trapping, 1.3786 0.0000 microarray‐based expression analysis, and genome‐wide homology searching NA YLR154W‐E Dubious open reading frame unlikely to encode a protein; encoded 1.3693 0.0001 within the the 35S rRNA gene on the opposite strand IRC18 YJL037W Putative protein of unknown function; expression induced in 1.3632 0.0002 respiratory‐deficient cells and in carbon‐limited chemostat cultures; similar to adjacent ORF, YJL038C; null mutant displays increased levels of spontaneous Rad52p foci NA YDR132C Putative protein of unknown function 1.3617 0.0000 EMI1 YDR512C Non‐essential protein required for transcriptional induction of the 1.3548 0.0001 early meiotic‐specific transcription factor IME1, also required for sporulation; contains twin cysteine‐x9‐cysteine motifs

217

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) LCD1 YDR499W Essential protein required for the DNA integrity checkpoint 1.3532 0.0002 pathways; interacts physically with Mec1p; putative homolog of S. pombe Rad26 and human ATRIP MRP10 YDL045W‐A Mitochondrial ribosomal protein of the small subunit; contains twin 1.3525 0.0000 cysteine‐x9‐cysteine motifs DBP10 YDL031W Putative ATP‐dependent RNA helicase of the DEAD‐box protein 1.3512 0.0001 family, constituent of 66S pre‐ribosomal particles; essential protein involved in ribosome biogenesis SLM3 YDL033C tRNA‐specific 2‐thiouridylase, responsible for 2‐thiolation of the 1.3455 0.0001 wobble base of mitochondrial tRNAs; human ortholog is implicated in myoclonus epilepsy associated with ragged red fibers (MERRF)

SLU7 YDR088C RNA splicing factor, required for ATP‐independent portion of 2nd 1.3448 0.0001 catalytic step of spliceosomal RNA splicing; interacts with Prp18p; contains zinc knuckle domain FYV7 YLR068W Essential protein required for maturation of 18S rRNA; required for 1.3426 0.0009 survival upon exposure to K1 killer toxin NA YDL233W Putative protein of unknown function; green fluorescent protein 1.3378 0.0000 (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YDL233W is not an essential gene SPR3 YGR059W Sporulation‐specific homolog of the yeast CDC3/10/11/12 family of 1.3268 0.0004 bud neck microfilament genes; septin protein involved in sporulation; regulated by ABFI HUB1 YNR032C‐A Ubiquitin‐like protein modifier, may function in modification of 1.3228 0.0002 Sph1p and Hbt1p, functionally complemented by the human or S. pombe ortholog; mechanism of Hub1p adduct formation not yet clear SHS1 YDL225W One of five related septins (Cdc3p, Cdc10p, Cdc11p, Cdc12p, Shs1p) 1.3215 0.0002 that form a cortical filamentous collar at the mother‐bud neck which is necessary for normal morphogenesis and cytokinesis

QRI1 YDL103C UDP‐N‐acetylglucosamine pyrophosphorylase, catalyzes the 1.3194 0.0000 formation of UDP‐N‐acetylglucosamine (UDP‐GlcNAc), which is important in cell wall biosynthesis, protein N‐glycosylation, and GPI anchor biosynthesis MCD1 YDL003W Essential subunit of the cohesin complex required for sister 1.3111 0.0001 chromatid cohesion in mitosis and meiosis; apoptosis induces cleavage and translocation of a C‐terminal fragment to mitochondria; expression peaks in S phase SSP1 YHR184W Protein involved in the control of meiotic nuclear division and 1.3097 0.0000 coordination of meiosis with spore formation; transcription is induced midway through meiosis PAR32 YDL173W Putative protein of unknown function; hyperphosphorylated upon 1.3079 0.0000 rapamycin treatment in a Tap42p‐dependent manner; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; PAR32 is not an essential gene HNT2 YDR305C Dinucleoside triphosphate hydrolase; has similarity to the tumor 1.3061 0.0000 suppressor FHIT and belongs to the histidine triad (HIT) superfamily of nucleotide‐binding proteins MTC3 YGL226W Protein of unknown function; green fluorescent protein (GFP)‐fusion 1.3041 0.0000 protein localizes to the mitochondrion; mtc3 is synthetically sick with cdc13‐1

218

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) SME1 YOR159C Core Sm protein Sm E; part of heteroheptameric complex (with 1.3010 0.0000 Smb1p, Smd1p, Smd2p, Smd3p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm E LSM8 YJR022W Lsm (Like Sm) protein; forms heteroheptameric complex (with 1.2949 0.0001 Lsm2p, Lsm3p, Lsm4p, Lsm5p, Lsm6p, and Lsm7p) that is part of spliceosomal U6 snRNP and is also implicated in processing of pre‐ tRNA, pre‐snoRNA, and pre‐rRNA TRS23 YDR246W One of 10 subunits of the transport protein particle (TRAPP) 1.2870 0.0000 complex of the cis‐Golgi which mediates vesicle docking and fusion; involved in endoplasmic reticulum (ER) to Golgi membrane traffic; human homolog is TRAPPC4 PLP1 YDR183W Protein that interacts with CCT (chaperonin containing TCP‐1) 1.2869 0.0000 complex and has a role in actin and tubulin folding; has weak similarity to phosducins, which are G‐protein regulators

NPL3 YDR432W RNA‐binding protein that promotes elongation, regulates 1.2866 0.0000 termination, and carries poly(A) mRNA from nucleus to cytoplasm; required for pre‐mRNA splicing; dissociation from mRNAs promoted by Mtr10p; phosphorylated by Sky1p in the cytoplasm OMS1 YDR316W Protein integral to the mitochondrial membrane; has a conserved 1.2856 0.0002 methyltransferase motif; multicopy suppressor of respiratory defects caused by OXA1 mutations EAF7 YNL136W Subunit of the NuA4 histone acetyltransferase complex, which 1.2851 0.0000 acetylates the N‐terminal tails of histones H4 and H2A

NA YNR064C Epoxide hydrolase, member of the alpha/beta hydrolase fold family; 1.2835 0.0000 may have a role in detoxification of epoxides MKC7 YDR144C GPI‐anchored aspartyl protease, member of the yapsin family of 1.2790 0.0001 proteases involved in cell wall growth and maintenance; shares functions with Yap3p and Kex2p CWC2 YDL209C Member of the NineTeen Complex (NTC) that contains Prp19p and 1.2785 0.0000 stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; binds directly to U6 snRNA; similar to S. pombe Cwf2 BDF2 YDL070W Protein involved in transcription initiation at TATA‐containing 1.2756 0.0002 promoters; associates with the basal transcription factor TFIID; contains two bromodomains; corresponds to the C‐terminal region of mammalian TAF1; redundant with Bdf1p ERV2 YPR037C Flavin‐linked sulfhydryl oxidase localized to the endoplasmic 1.2755 0.0000 reticulum lumen, involved in disulfide bond formation within the ER

DPB4 YDR121W Shared subunit of DNA polymerase (II) epsilon and of ISW2/yCHRAC 1.2686 0.0001 chromatin accessibility complex; involved in both chromosomal DNA replication and in inheritance of telomeric silencing

CDC37 YDR168W Essential Hsp90p co‐chaperone; necessary for passage through the 1.2674 0.0001 START phase of the cell cycle; stabilizes protein kinase nascent chains and participates along with Hsp90p in their folding

NA YFL065C Putative protein of unknown function; induced by treatment with 8‐ 1.2670 0.0006 methoxypsoralen and UVA irradiation

219

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) LYS21 YDL131W Homocitrate synthase isozyme, catalyzes the condensation of 1.2639 0.0003 acetyl‐CoA and alpha‐ketoglutarate to form homocitrate, which is the first step in the lysine biosynthesis pathway; highly similar to the other isozyme, Lys20p INO2 YDR123C Component of the heteromeric Ino2p/Ino4p basic helix‐loop‐helix 1.2629 0.0002 transcription activator that binds inositol/choline‐responsive elements (ICREs), required for derepression of phospholipid biosynthetic genes in response to inositol depletion NA YDR506C Possible membrane‐localized protein 1.2483 0.0002 GAL3 YDR009W Transcriptional regulator involved in activation of the GAL genes in 1.2480 0.0000 response to galactose; forms a complex with Gal80p to relieve Gal80p inhibition of Gal4p; binds galactose and ATP but does not have galactokinase activity UBC1 YDR177W Ubiquitin‐conjugating enzyme that mediates selective degradation 1.2349 0.0000 of short‐lived and abnormal proteins; plays a role in vesicle biogenesis and ER‐associated protein degradation (ERAD); component of the cellular stress response NA YDL218W Putative protein of unknown function; YDL218W transcription is 1.2347 0.0002 regulated by Azf1p and induced by starvation and aerobic conditions; expression also induced in cells treated with the mycotoxin patulin DAL4 YIR028W Allantoin permease; expression sensitive to nitrogen catabolite 1.2322 0.0001 repression and induced by allophanate, an intermediate in allantoin degradation NCB2 YDR397C Subunit of a heterodimeric NC2 transcription regulator complex 1.2308 0.0002 with Bur6p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2beta DUN1 YDL101C Cell‐cycle checkpoint serine‐threonine kinase required for DNA 1.2291 0.0000 damage‐induced transcription of certain target genes, phosphorylation of Rad55p and Sml1p, and transient G2/M arrest after DNA damage; also regulates postreplicative DNA repair NA YHR213W‐A Putative protein of unknown function; identified by gene‐trapping, 1.2277 0.0002 microarray‐based expression analysis, and genome‐wide homology searching CPR6 YLR216C Peptidyl‐prolyl cis‐trans isomerase (cyclophilin), catalyzes the cis‐ 1.2266 0.0000 trans isomerization of peptide bonds N‐terminal to proline residues; binds to Hsp82p and contributes to chaperone activity

CRP1 YHR146W Protein that binds to cruciform DNA structures 1.2205 0.0000 COX17 YLL009C Copper metallochaperone that transfers copper to Sco1p and 1.2191 0.0001 Cox11p for eventual delivery to cytochrome c oxidase; contains twin cysteine‐x9‐cysteine motifs KCC4 YCL024W Protein kinase of the bud neck involved in the septin checkpoint, 1.2177 0.0001 associates with septin proteins, negatively regulates Swe1p by phosphorylation, shows structural homology to bud neck kinases Gin4p and Hsl1p DOS2 YDR068W Protein of unknown function, green fluorescent protein (GFP)‐fusion 1.2162 0.0000 protein localizes to the cytoplasm NA YER137C Putative protein of unknown function 1.2108 0.0006

220

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) APC11 YDL008W Catalytic core subunit of the Anaphase‐Promoting 1.2096 0.0000 Complex/Cyclosome (APC/C), which is a ubiquitin‐protein ligase required for degradation of anaphase inhibitors, including mitotic cyclins, during the metaphase/anaphase transition DGR2 YKL121W Protein of unknown function; null mutant is resistant to 2‐deoxy‐D‐ 1.2082 0.0001 glucose and displays abnormally elongated buds DTD1 YDL219W D‐Tyr‐tRNA(Tyr) deacylase, functions in protein translation, may 1.2068 0.0000 affect nonsense suppression via alteration of the protein synthesis machinery; ubiquitous among eukaryotes MIC14 YDR031W Mitochondrial intermembrane space protein, required for normal 1.2065 0.0000 oxygen consumption; contains twin cysteine‐x9‐cysteine motifs

SPO12 YHR152W Nucleolar protein of unknown function, positive regulator of mitotic 1.2051 0.0000 exit; involved in regulating release of Cdc14p from the nucleolus in early anaphase, may play similar role in meiosis IVY1 YDR229W Phospholipid‐binding protein that interacts with both Ypt7p and 1.2039 0.0000 Vps33p, may partially counteract the action of Vps33p and vice versa, localizes to the rim of the vacuole as cells approach stationary phase DOT1 YDR440W Nucleosomal histone H3‐Lys79 methylase; methylation is required 1.1991 0.0001 for telomeric silencing, meiotic checkpoint control, and DNA damage response GAL2 YLR081W Galactose permease, required for utilization of galactose; also able 1.1990 0.0009 to transport glucose CDA1 YLR307W Chitin deacetylase, together with Cda2p involved in the biosynthesis 1.1976 0.0007 ascospore wall component, chitosan; required for proper rigidity of the ascospore wall YCG1 YDR325W Subunit of the condensin complex; required for establishment and 1.1965 0.0001 maintenance of chromosome condensation, chromosome segregation and chromatin binding of the condensin complex; required for clustering of tRNA genes at the nucleolus NA YDR239C Protein of unknown function that may interact with ribosomes, 1.1939 0.0000 based on co‐purification experiments STF1 YDL130W‐A Protein involved in regulation of the mitochondrial F1F0‐ATP 1.1886 0.0001 synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein EKI1 YDR147W Ethanolamine kinase, primarily responsible for 1.1874 0.0000 phosphatidylethanolamine synthesis via the CDP‐ethanolamine pathway; exhibits some choline kinase activity, thus contributing to phosphatidylcholine synthesis via the CDP‐choline pathway RUB1 YDR139C Ubiquitin‐like protein with similarity to mammalian NEDD8; 1.1848 0.0001 conjugation (neddylation) substrates include the cullins Cdc53p, Rtt101p, and Cul3p; activated by Ula1p and Uba3p (E1 enzyme pair); conjugation mediated by Ubc12p (E2 enzyme) NA YDR042C Putative protein of unknown function; expression is increased in 1.1844 0.0000 ssu72‐ts69 mutant SPO22 YIL073C Meiosis‐specific protein essential for chromosome synapsis, 1.1840 0.0001 involved in completion of nuclear divisions during meiosis; induced early in meiosis YSY6 YBR162W‐A Protein whose expression suppresses a secretory pathway mutation 1.1787 0.0001 in E. coli; has similarity to the mammalian RAMP4 protein involved in secretion SNU23 YDL098C Component of U4/U6.U5 snRNP involved in mRNA splicing via 1.1786 0.0001 spliceosome 221

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) HO YDL227C Site‐specific endonuclease required for gene conversion at the MAT 1.1763 0.0007 locus (homothallic switching) through the generation of a ds DNA break; expression restricted to mother cells in late G1 as controlled by Swi4p‐Swi6p, Swi5p and Ash1p NA YLR412C‐A Putative protein of unknown function 1.1741 0.0002 SAP30 YMR263W Subunit of a histone deacetylase complex, along with Rpd3p and 1.1732 0.0001 Sin3p, that is involved in silencing at telomeres, rDNA, and silent mating‐type loci; involved in telomere maintenance

GLE1 YDL207W Cytoplasmic nucleoporin required for polyadenylated RNA export 1.1727 0.0000 but not for protein import; component of Nup82p nuclear pore subcomplex; contains a nuclear export signal ECO1 YFR027W Acetyltransferase required for sister chromatid cohesion; modifies 1.1724 0.0000 Smc3p at DNA replication forks during S‐phase; modifies Mcd1p in response to double‐strand DNA breaks during G2/M; mutations in human homolog ESCO2 cause Roberts syndrome STI1 YOR027W Hsp90 cochaperone, interacts with the Ssa group of the cytosolic 1.1722 0.0001 Hsp70 chaperones and activates Ssa1p ATPase activity; interacts with Hsp90 chaperones and inhibits their ATPase activity; homolog of mammalian Hop NA YDR246W‐A Putative protein of unknown function; identified by fungal 1.1708 0.0001 homology and RT‐PCR PUF2 YPR042C Member of the PUF protein family, which is defined by the presence 1.1686 0.0000 of Pumilio homology domains that confer RNA binding activity; preferentially binds mRNAs encoding membrane‐associated proteins CDC7 YDL017W DDK (Dbf4‐dependent kinase) catalytic subunit required for firing 1.1602 0.0000 origins and replication fork progression in S phase through phosphorylation of Mcm2‐7p complexes and Cdc45p; kinase activity correlates with cyclical DBF4 expression ACM1 YPL267W Pseudosubstrate inhibitor of the anaphase‐promoting 1.1601 0.0001 complex/cyclosome (APC/C), that suppresses APC/C [Cdh1]‐ mediated proteolysis of mitotic cyclins; associates with Cdh1p, Bmh1p and Bmh2p; cell cycle regulated protein MED2 YDL005C Subunit of the RNA polymerase II mediator complex; associates with 1.1594 0.0001 core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation

JNM1 YMR294W Component of the yeast dynactin complex, consisting of Nip100p, 1.1592 0.0001 Jnm1p, and Arp1p; required for proper nuclear migration and spindle partitioning during mitotic anaphase B

NA YDR056C Putative protein of unknown function; green fluorescent protein 1.1568 0.0000 (GFP)‐fusion protein localizes to the endoplasmic reticulum; YDR056C is not an essential protein DIA1 YMR316W Protein of unknown function, involved in invasive and pseudohyphal 1.1550 0.0008 growth; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern

LSM7 YNL147W Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p‐ 1.1490 0.0002 7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA MRPL28 YDR462W Mitochondrial ribosomal protein of the large subunit 1.1477 0.0000

222

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) LRS4 YDR439W Nucleolar protein that forms a complex with Csm1p, and then 1.1447 0.0001 Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to the replication fork barrier site and rDNA repeat segregation HSC82 YMR186W Cytoplasmic chaperone of the Hsp90 family, redundant in function 1.1445 0.0002 and nearly identical with Hsp82p, and together they are essential; expressed constitutively at 10‐fold higher basal levels than HSP82 and induced 2‐3 fold by heat shock NGG1 YDR176W Transcriptional regulator involved in glucose repression of Gal4p‐ 1.1441 0.0002 regulated genes; component of transcriptional adaptor and histone acetyltransferase complexes, the ADA complex, the SAGA complex, and the SLIK complex PAU4 YLR461W Member of the seripauperin multigene family encoded mainly in 1.1436 0.0000 subtelomeric regions; active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme PIB1 YDR313C RING‐type ubiquitin ligase of the endosomal and vacuolar 1.1433 0.0001 membranes, binds phosphatidylinositol(3)‐phosphate; contains a FYVE finger domain DIT1 YDR403W Sporulation‐specific enzyme required for spore wall maturation, 1.1419 0.0003 involved in the production of a soluble LL‐dityrosine‐containing precursor of the spore wall; transcripts accumulate at the time of prospore enclosure HPF1 YOL155C Haze‐protective mannoprotein that reduces the particle size of 1.1410 0.0001 aggregated proteins in white wines GPR1 YDL035C Plasma membrane G protein coupled receptor (GPCR) that interacts 1.1394 0.0000 with the heterotrimeric G protein alpha subunit, Gpa2p, and with Plc1p; sensor that integrates nutritional signals with the modulation of cell fate via PKA and cAMP synthesis MRPL7 YDR237W Mitochondrial ribosomal protein of the large subunit 1.1389 0.0001 SRB7 YDR308C Subunit of the RNA polymerase II mediator complex; associates with 1.1340 0.0000 core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; target of the global repressor Tup1p NA YCR075W‐A Putative protein of unknown function; identified by homology to 1.1325 0.0001 Ashbya gossypii SPT3 YDR392W Subunit of the SAGA and SAGA‐like transcriptional regulatory 1.1291 0.0001 complexes, interacts with Spt15p to activate transcription of some RNA polymerase II‐dependent genes, also functions to inhibit transcription at some promoters NA YDR348C Protein of unknown function; green fluorescent protein (GFP)‐fusion 1.1278 0.0000 protein localizes to the cell periphery and bud neck; potential Cdc28p substrate PLM2 YDR501W Forkhead Associated domain containing protein and putative 1.1275 0.0001 transcription factor found associated with chromatin; target of SBF transcription factor; induced in response to DNA damaging agents and deletion of telomerase; similar to TOS4 RRP42 YDL111C Exosome non‐catalytic core component; involved in 3'‐5' RNA 1.1274 0.0000 processing and degradation in both the nucleus and the cytoplasm; has similarity to E. coli RNase PH and to human hRrp42p (EXOSC7)

223

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) CSM1 YCR086W Nucleolar protein that forms a complex with Lrs4p and then Mam1p 1.1273 0.0002 at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to the replication fork barrier site and rDNA repeat segregation YHC1 YLR298C Component of the U1 snRNP complex required for pre‐mRNA 1.1248 0.0001 splicing; putative ortholog of human U1C protein, which is involved in formation of a complex between U1 snRNP and the pre‐mRNA 5' splice site NA YER188C‐A Putative protein of unknown function 1.1247 0.0005 RNH203 YLR154C Ribonuclease H2 subunit, required for RNase H2 activity; related to 1.1238 0.0000 human AGS3 that causes Aicardi‐Goutieres syndrome

LSM3 YLR438C‐A Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p‐ 1.1232 0.0001 7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA RRP14 YKL082C Essential protein, constituent of 66S pre‐ribosomal particles; 1.1230 0.0005 interacts with proteins involved in ribosomal biogenesis and cell polarity; member of the SURF‐6 family TLG1 YDR468C Essential t‐SNARE that forms a complex with Tlg2p and Vti1p and 1.1220 0.0001 mediates fusion of endosome‐derived vesicles with the late Golgi; binds the docking complex VFT (Vps fifty‐three) through interaction with Vps51p AHA1 YDR214W Co‐chaperone that binds to Hsp82p and activates its ATPase activity; 1.1212 0.0002 similar to Hch1p; expression is regulated by stresses such as heat shock TOA1 YOR194C TFIIA large subunit; involved in transcriptional activation, acts as 1.1157 0.0004 antirepressor or as coactivator; homologous to largest and second largest subunits of human and Drosophila TFIIA

SCM3 YDL139C Nonhistone component of centromeric chromatin that binds 1.1153 0.0000 stoichiometrically to CenH3‐H4 histones, required for kinetochore assembly; required for G2/M progression and localization of Cse4p; may protect Cse4p from ubiquitylation NA YNL146W Putative protein of unknown function; green fluorescent protein 1.1144 0.0000 (GFP)‐fusion protein localizes to the endoplasmic reticulum; YNL146W is not an essential gene PUT1 YLR142W Proline oxidase, nuclear‐encoded mitochondrial protein involved in 1.1121 0.0002 utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source ENT1 YDL161W Epsin‐like protein involved in endocytosis and actin patch assembly 1.1117 0.0000 and functionally redundant with Ent2p; binds clathrin via a clathrin‐ binding domain motif at C‐terminus OGG1 YML060W Mitochondrial glycosylase/lyase that specifically excises 7,8‐dihydro‐ 1.1106 0.0005 8‐oxoguanine residues located opposite cytosine or thymine residues in DNA, repairs oxidative damage to mitochondrial DNA, contributes to UVA resistance SPC29 YPL124W Inner plaque spindle pole body (SPB) component, links the central 1.1105 0.0000 plaque component Spc42p to the inner plaque component Spc110p; required for SPB duplication

224

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) NKP1 YDR383C Non‐essential kinetochore protein, subunit of the Ctf19 central 1.1092 0.0000 kinetochore complex (Ctf19p‐Mcm21p‐Okp1p‐Mcm22p‐Mcm16p‐ Ctf3p‐Chl4p‐Mcm19p‐Nkp1p‐Nkp2p‐Ame1p‐Mtw1p)

SVF1 YDR346C Protein with a potential role in cell survival pathways, required for 1.1080 0.0002 the diauxic growth shift; expression in mammalian cells increases survival under conditions inducing apoptosis; mutant has increased aneuploidy tolerance SLK19 YOR195W Kinetochore‐associated protein required for normal segregation of 1.1078 0.0005 chromosomes in meiosis and mitosis; component of the FEAR regulatory network, which promotes Cdc14p release from the nucleolus during anaphase; potential Cdc28p substrate SEN34 YAR008W Subunit of the tRNA splicing endonuclease, which is composed of 1.1054 0.0000 Sen2p, Sen15p, Sen34p, and Sen54p; Sen34p contains the active site for tRNA 3' splice site cleavage and has similarity to Sen2p and to Archaeal tRNA splicing endonuclease SWI5 YDR146C Transcription factor that activates transcription of genes expressed 1.1050 0.0005 at the M/G1 phase boundary and in G1 phase; localization to the nucleus occurs during G1 and appears to be regulated by phosphorylation by Cdc28p kinase GIN4 YDR507C Protein kinase involved in bud growth and assembly of the septin 1.1048 0.0002 ring, proposed to have kinase‐dependent and kinase‐independent activities; undergoes autophosphorylation; similar to Kcc4p and Hsl1p SNM1 YDR478W Subunit of RNase MRP, which cleaves pre‐rRNA and has a role in cell 1.0996 0.0000 cycle‐regulated degradation of daughter cell‐specific mRNAs; binds to the NME1 RNA subunit of RNase MRP

NA NA NA 1.0981 0.0001 NA YIL014C‐A Putative protein of unknown function 1.0964 0.0002 MHR1 YDR296W Protein involved in homologous recombination in mitochondria; 1.0960 0.0001 required for recombination‐dependent mtDNA partitioning; involved in stimulation of mitochondrial DNA replication in response to oxidative stress MPS1 YDL028C Dual‐specificity kinase required for spindle pole body (SPB) 1.0936 0.0001 duplication and spindle checkpoint function; substrates include SPB proteins Spc42p, Spc110p, and Spc98p, mitotic exit network protein Mob1p, and checkpoint protein Mad1p SWA2 YDR320C Auxilin‐like protein involved in vesicular transport; clathrin‐binding 1.0901 0.0001 protein required for uncoating of clathrin‐coated vesicles

CDC31 YOR257W Calcium‐binding component of the spindle pole body (SPB) half‐ 1.0887 0.0001 bridge, required for SPB duplication in mitosis and meiosis II; homolog of mammalian centrin; binds multiubiquitinated proteins and is involved in proteasomal protein degradation ATG10 YLL042C Conserved E2‐like conjugating enzyme that mediates formation of 1.0870 0.0001 the Atg12p‐Atg5p conjugate, which is a critical step in autophagy

UGX2 YDL169C Protein of unknown function, transcript accumulates in response to 1.0848 0.0004 any combination of stress conditions NA YDL012C Tail‐anchored plasma membrane protein containing a conserved 1.0845 0.0000 CYSTM module, possibly involved in response to stress; may contribute to non‐homologous end‐joining (NHEJ) based on ydl012c htz1 double null phenotype NA YFR012W Putative protein of unknown function 1.0824 0.0007 225

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) ENA5 YDR038C Protein with similarity to P‐type ATPase sodium pumps, member of 1.0798 0.0002 the Na+ efflux ATPase family SPC110 YDR356W Inner plaque spindle pole body (SPB) component, ortholog of 1.0789 0.0001 human kendrin; involved in connecting nuclear microtubules to SPB; interacts with Tub4p‐complex and calmodulin; phosphorylated by Mps1p in cell cycle‐dependent manner MUS81 YDR386W Subunit of the structure‐specific Mms4p‐Mus81p endonuclease that 1.0781 0.0001 cleaves branched DNA; involved in DNA repair, replication fork stability, and joint molecule formation/resolution during meiotic recombination; helix‐hairpin‐helix protein HXT14 YNL318C Protein with similarity to hexose transporter family members, 1.0773 0.0005 expression is induced in low glucose and repressed in high glucose; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies FCF1 YDR339C Putative PINc domain nuclease required for early cleavages of 35S 1.0764 0.0003 pre‐rRNA and maturation of 18S rRNA; component of the SSU (small subunit) processome involved in 40S ribosomal subunit biogenesis; copurifies with Faf1p NHP2 YDL208W Nuclear protein related to mammalian high mobility group (HMG) 1.0750 0.0009 proteins, essential for function of H/ACA‐type snoRNPs, which are involved in 18S rRNA processing CDC9 YDL164C DNA ligase found in the nucleus and mitochondria, an essential 1.0744 0.0002 enzyme that joins Okazaki fragments during DNA replication; also acts in nucleotide excision repair, base excision repair, and recombination TFB3 YDR460W Subunit of TFIIH and nucleotide excision repair factor 3 complexes, 1.0731 0.0001 involved in transcription initiation, required for nucleotide excision repair; ring finger protein similar to mammalian CAK and TFIIH subunit NA YDR248C Putative protein of unknown function; sequence similarity to 1.0724 0.0001 bacterial and human gluconokinase; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; upregulated by deletion of the RNAP‐II associated factor, PAF1 PGM3 YMR278W Phosphoglucomutase, catalyzes interconversion of glucose‐1‐ 1.0717 0.0001 phosphate and glucose‐6‐phospate; transcription induced in response to stress; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; non‐essential NA YBR196C‐A Putative protein of unknown function; identified by fungal 1.0686 0.0002 homology and RT‐PCR SSF2 YDR312W Protein required for ribosomal large subunit maturation, 1.0678 0.0001 functionally redundant with Ssf1p; member of the Brix family

RKM2 YDR198C Ribosomal protein lysine methyltransferase, responsible for 1.0671 0.0001 trimethylation of the lysine residue at position 3 of Rpl12Ap and Rpl12Bp RMD1 YDL001W Cytoplasmic protein required for sporulation 1.0655 0.0001 UGA4 YDL210W Permease that serves as a gamma‐aminobutyrate (GABA) transport 1.0625 0.0002 protein involved in the utilization of GABA as a nitrogen source; catalyzes the transport of putrescine and delta‐aminolevulinic acid (ALA); localized to the vacuolar membrane TMA7 YLR262C‐A Protein of unknown that associates with ribosomes; null mutant 1.0617 0.0002 exhibits translation defects, altered polyribosome profiles, and resistance to the translation inhibitor anisomcyin

226

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) SEC1 YDR164C Sm‐like protein involved in docking and fusion of exocytic vesicles 1.0606 0.0000 through binding to assembled SNARE complexes at the membrane; localization to sites of secretion (bud neck and bud tip) is dependent on SNARE function PUS9 YDL036C Mitochondrial tRNA:pseudouridine synthase, catalyzes the 1.0593 0.0000 formation of pseudouridine at position 32 in mitochondrial tRNAs; contains an N‐terminal mitochondrial targeting sequence

NA YDR115W Putative mitochondrial ribosomal protein of the large subunit, has 1.0590 0.0001 similarity to E. coli L34 ribosomal protein; required for respiratory growth, as are most mitochondrial ribosomal proteins

NA YHL048C‐A Putative protein of unknown function; identified by expression 1.0550 0.0001 profiling and mass spectrometry LIF1 YGL090W Component of the DNA ligase IV complex that mediates 1.0515 0.0002 nonhomologous end joining in DNA double‐strand break repair; physically interacts with Dnl4p and Nej1p; homologous to mammalian XRCC4 protein ARO80 YDR421W Zinc finger transcriptional activator of the Zn2Cys6 family; activates 1.0499 0.0000 transcription of aromatic amino acid catabolic genes in the presence of aromatic amino acids GYP7 YDL234C GTPase‐activating protein for yeast Rab family members including: 1.0489 0.0001 Ypt7p (most effective), Ypt1p, Ypt31p, and Ypt32p (in vitro); involved in vesicle mediated protein trafficking

CIN4 YMR138W GTP‐binding protein involved in beta‐tubulin (Tub2p) folding; 1.0480 0.0004 isolated as mutant with increased chromosome loss and sensitivity to benomyl; regulated by the GTPase‐activating protein, Cin2p, the human retinitis pigmentosa 2 (RP2) homolog MZM1 YDR493W Mitochondrial matrix protein with a role in maintaining the labile 1.0463 0.0000 mitochondrial zinc pool; null mutant has a respiratory growth defect and an elevated frequency of mitochondrial genome loss; overexpression causes cell cycle delay or arrest GPI11 YDR302W ER membrane protein involved in a late step of 1.0453 0.0002 glycosylphosphatidylinositol (GPI) anchor assembly; involved in the addition of phosphoethanolamine to the multiply mannosylated GPI intermediate; human PIG‐Fp is a functional homolog CSE4 YKL049C Centromere protein that resembles histone H3, required for proper 1.0420 0.0002 kinetochore function; homolog of human CENP‐A; levels are regulated by E3 ubiquitin ligase Psh1p SEC20 YDR498C Membrane glycoprotein v‐SNARE involved in retrograde transport 1.0418 0.0001 from the Golgi to the ER; required for N‐ and O‐glycosylation in the Golgi but not in the ER; interacts with the Dsl1p complex through Tip20p RTT102 YGR275W Component of both the SWI/SNF and RSC chromatin remodeling 1.0416 0.0001 complexes, suggested role in chromosome maintenance; possible weak regulator of Ty1 transposition NA YMR244C‐A Putative protein of unknown function; green fluorescent protein 1.0404 0.0001 (GFP)‐fusion protein localizes to both the cytoplasm and nucleus and is induced in response to the DNA‐damaging agent MMS; YMR244C‐A is not an essential gene SVS1 YPL163C Cell wall and vacuolar protein, required for wild‐type resistance to 1.0397 0.0001 vanadate

227

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) ASF1 YJL115W Nucleosome assembly factor, involved in chromatin assembly and 1.0389 0.0000 disassembly, anti‐silencing protein that causes derepression of silent loci when overexpressed; plays a role in regulating Ty1 transposition

COX7 YMR256C Subunit VII of cytochrome c oxidase, which is the terminal member 1.0300 0.0001 of the mitochondrial inner membrane electron transport chain

NA YBR071W Putative protein of unknown function; (GFP)‐fusion and epitope‐ 1.0222 0.0001 tagged proteins localize to the cytoplasm; mRNA expression may be regulated by the cell cycle and/or cell wall stress

SGT2 YOR007C Glutamine‐rich cytoplasmic protein that serves as a scaffold for 1.0178 0.0001 binding Get4/5p and other proteins required to mediate posttranslational insertion of tail‐anchored proteins into the ER membrane; has similarity to human cochaperone SGT SMT3 YDR510W Ubiquitin‐like protein of the SUMO family, conjugated to lysine 1.0156 0.0001 residues of target proteins; regulates chromatid cohesion, chromosome segregation, APC‐mediated proteolysis, DNA replication and septin ring dynamics; phosphorylated at Ser2 UBC9 YDL064W SUMO‐conjugating enzyme involved in the Smt3p conjugation 1.0136 0.0000 pathway; nuclear protein required for S‐ and M‐phase cyclin degradation and mitotic control; involved in proteolysis mediated by the anaphase‐promoting complex cyclosome (APCC) RPC11 YDR045C RNA polymerase III subunit C11; mediates pol III RNA cleavage 1.0118 0.0001 activity and is important for termination of transcription; homologous to TFIIS RGA2 YDR379W GTPase‐activating protein for the polarity‐establishment protein 1.0105 0.0002 Cdc42p; implicated in control of septin organization, pheromone response, and haploid invasive growth; regulated by Pho85p and Cdc28p PBI2 YNL015W Cytosolic inhibitor of vacuolar proteinase B (PRB1), required for 1.0099 0.0002 efficient vacuole inheritance; with thioredoxin forms protein complex LMA1, which assists in priming SNARE molecules and promotes vacuole fusion NUP42 YDR192C Subunit of the nuclear pore complex (NPC) that localizes exclusively 1.0084 0.0003 to the cytoplasmic side; involved in RNA export, most likely at a terminal step; interacts with Gle1p SLY1 YDR189W Hydrophilic protein involved in vesicle trafficking between the ER 1.0084 0.0001 and Golgi; SM (Sec1/Munc‐18) family protein that binds the tSNARE Sed5p and stimulates its assembly into a trans‐SNARE membrane‐ protein complex GCD6 YDR211W Catalytic epsilon subunit of the translation initiation factor eIF2B, 1.0055 0.0001 the guanine‐nucleotide exchange factor for eIF2; activity subsequently regulated by phosphorylated eIF2; first identified as a negative regulator of GCN4 expression PRP3 YDR473C Splicing factor, component of the U4/U6‐U5 snRNP complex 1.0039 0.0000 ENT5 YDR153C Protein containing an N‐terminal epsin‐like domain involved in 1.0031 0.0001 clathrin recruitment and traffic between the Golgi and endosomes; associates with the clathrin adaptor Gga2p, clathrin adaptor complex AP‐1, and clathrin CDC36 YDL165W Component of the CCR4‐NOT complex, which has multiple roles in 1.0030 0.0001 regulating mRNA levels including regulation of transcription and destabilizing mRNAs by deadenylation; basal transcription factor

228

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) TIF35 YDR429C eIF3g subunit of the core complex of translation initiation factor 3 1.0028 0.0008 (eIF3), which is essential for translation; stimulates resumption of ribosomal scanning during translation reinitiation

VMS1 YDR049W Zinc finger protein, forms a mitochondrially‐associated complex 1.0025 0.0000 with Cdc48p and Npl4p under oxidative stress that is required for ubiquitin‐mediated mitochondria‐associated protein degradation (MAD); conserved in C. elegans and human MOD5 YOR274W Delta 2‐isopentenyl pyrophosphate:tRNA isopentenyl transferase, 0.9998 0.0005 required for biosynthesis of the modified base isopentenyladenosine in mitochondrial and cytoplasmic tRNAs; gene is nuclear and encodes two isozymic forms TEN1 YLR010C Protein that regulates telomeric length; protects telomeric ends in a 0.9983 0.0001 complex with Cdc13p and Stn1p PTP1 YDL230W Phosphotyrosine‐specific protein phosphatase that 0.9980 0.0000 dephosphorylates a broad range of substrates in vivo, including Fpr3p; localized to the cytoplasm and the mitochondria

MRPS16 YPL013C Mitochondrial ribosomal protein of the small subunit 0.9975 0.0003 ACN9 YDR511W Protein of the mitochondrial intermembrane space, required for 0.9966 0.0001 acetate utilization and gluconeogenesis; has orthologs in higher eukaryotes PDC2 YDR081C Transcription factor required for the synthesis of the glycolytic 0.9940 0.0000 enzyme pyruvate decarboxylase, required for high level expression of both the THI and the PDC genes MAD1 YGL086W Coiled‐coil protein involved in the spindle‐assembly checkpoint; 0.9920 0.0002 phosphorylated by Mps1p upon checkpoint activation which leads to inhibition of the activity of the anaphase promoting complex; forms a complex with Mad2p PEX3 YDR329C Peroxisomal membrane protein (PMP) required for proper 0.9917 0.0000 localization and stability of PMPs; anchors peroxisome retention factor Inp1p at the peroxisomal membrane; interacts with Pex19p

HSP104 YLL026W Heat shock protein that cooperates with Ydj1p (Hsp40) and Ssa1p 0.9916 0.0004 (Hsp70) to refold and reactivate previously denatured, aggregated proteins; responsive to stresses including: heat, ethanol, and sodium arsenite; involved in [PSI+] propagation IZH1 YDR492W Membrane protein involved in zinc ion homeostasis, member of the 0.9907 0.0002 four‐protein IZH family; transcription is regulated directly by Zap1p, expression induced by zinc deficiency and fatty acids; deletion increases sensitivity to elevated zinc YFH1 YDL120W Mitochondrial matrix iron chaperone; oxidizes and stores iron; 0.9823 0.0002 interacts with Isu1p to promote Fe‐S cluster assembly; mutation results in multiple Fe/S‐dependent enzyme deficiencies; human frataxin homolog is mutated in Friedrich's ataxia SFA1 YDL168W Bifunctional enzyme containing both alcohol dehydrogenase and 0.9756 0.0000 glutathione‐dependent formaldehyde dehydrogenase activities, functions in formaldehyde detoxification and formation of long chain and complex alcohols, regulated by Hog1p‐Sko1p UBA2 YDR390C Subunit of a heterodimeric nuclear SUMO activating enzyme (E1) 0.9726 0.0000 with Aos1p; activates Smt3p (SUMO) before its conjugation to proteins (sumoylation), which may play a role in protein targeting; essential for viability

229

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) NA YDR186C Putative protein of unknown function; may interact with ribosomes, 0.9718 0.0001 based on co‐purification experiments; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm

DLD2 YDL178W D‐lactate dehydrogenase, located in the mitochondrial matrix 0.9696 0.0002

GTR2 YGR163W Putative GTP binding protein that negatively regulates Ran/Tc4 0.9679 0.0007 GTPase cycle; activates transcription; subunit of EGO and GSE complexes; required for sorting of Gap1p; localizes to cytoplasm and to chromatin; homolog of human RagC and RagD MTQ2 YDR140W S‐adenosylmethionine‐dependent methyltransferase of the seven 0.9671 0.0002 beta‐strand family; subunit of complex with Trm112p that methylates translation release factor Sup45p (eRF1) in the ternary complex eRF1‐eRF3‐GTP; similar to E.coli PrmC BLS1 YLR408C Putative protein of unknown function; likely member of BLOC 0.9668 0.0000 complex involved in endosomal cargo sorting; green fluorescent protein (GFP)‐fusion protein localizes to the endosome; YLR408C is not an essential gene NA YHR138C Putative protein of unknown function; has similarity to Pbi2p; 0.9634 0.0002 double null mutant lacking Pbi2p and Yhr138p exhibits highly fragmented vacuoles NA YJL144W Cytoplasmic hydrophilin of unknown function, possibly involved in 0.9623 0.0001 the dessication response; expression induced by osmotic stress, starvation and during stationary phase; GFP‐fusion protein is induced by the DNA‐damaging agent MMS HEM13 YDR044W Coproporphyrinogen III oxidase, an oxygen requiring enzyme that 0.9613 0.0001 catalyzes the sixth step in the heme biosynthetic pathway; transcription is repressed by oxygen and heme (via Rox1p and Hap1p) PRP9 YDL030W Subunit of the SF3a splicing factor complex, required for 0.9609 0.0000 spliceosome assembly; acts after the formation of the U1 snRNP‐ pre‐mRNA complex CRH1 YGR189C Chitin transglycosylase that functions in the transfer of chitin to 0.9581 0.0001 beta(1‐6) and beta(1‐3) glucans in the cell wall; similar and functionally redundant to Utr2; localizes to sites of polarized growth; expression induced by cell wall stress JEM1 YJL073W DnaJ‐like chaperone required for nuclear membrane fusion during 0.9574 0.0001 mating, localizes to the ER membrane; exhibits genetic interactions with KAR2 NA YLL066W‐B Putative protein of unknown function; overexpression causes a cell 0.9551 0.0008 cycle delay or arrest PRO1 YDR300C Gamma‐glutamyl kinase, catalyzes the first step in proline 0.9528 0.0005 biosynthesis NA YLL066W‐B Putative protein of unknown function; overexpression causes a cell 0.9523 0.0006 cycle delay or arrest DFM1 YDR411C Endoplasmic reticulum (ER) localized protein involved in ER‐ 0.9511 0.0001 associated protein degradation (ERAD), ER stress and homeostasis; interacts with components of ERAD‐L and ERAD‐C and Cdc48p; derlin‐like family member similar to Der1p PAU18 YLL064C Protein of unknown function, member of the seripauperin 0.9495 0.0001 multigene family encoded mainly in subtelomeric regions; identical to Pau6p

230

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) SAS4 YDR181C Subunit of the SAS complex (Sas2p, Sas4p, Sas5p), which acetylates 0.9494 0.0001 free histones and nucleosomes and regulates transcriptional silencing; required for the HAT activity of Sas2p

PRM3 YPL192C Pheromone‐regulated protein required for nuclear envelope fusion 0.9489 0.0001 during karyogamy; localizes to the outer face of the nuclear membrane; interacts with Kar5p at the spindle pole body

TIM22 YDL217C Essential core component of the mitochondrial TIM22 complex 0.9480 0.0001 involved in insertion of polytopic proteins into the inner membrane; forms the channel through which proteins are imported

RTR2 YDR066C Protein of unknown function with high similarity to Rtr1p; exhibits 0.9477 0.0001 genetic interactions with Rtr1p; green fluorescent protein (GFP)‐ fusion protein localizes to the cytoplasm; YDR066C is not an essential gene MRPL51 YPR100W Mitochondrial ribosomal protein of the large subunit 0.9476 0.0002 POL3 YDL102W Catalytic subunit of DNA polymerase delta; required for 0.9453 0.0000 chromosomal DNA replication during mitosis and meiosis, intragenic recombination, repair of double strand DNA breaks, and DNA replication during nucleotide excision repair (NER) NA YDL211C Putative protein of unknown function; green fluorescent protein 0.9435 0.0003 (GFP)‐fusion protein localizes to the vacuole ALG14 YBR070C Component of UDP‐GlcNAc transferase required for the second step 0.9365 0.0001 of dolichyl‐linked oligosaccharide synthesis; anchors the catalytic subunit Alg13p to the ER membrane; similar to bacterial and human glycosyltransferases GRX3 YDR098C Hydroperoxide and superoxide‐radical responsive glutathione‐ 0.9362 0.0000 dependent oxidoreductase; monothiol glutaredoxin subfamily member along with Grx4p and Grx5p; protects cells from oxidative damage NRM1 YNR009W Transcriptional co‐repressor of MBF (MCB binding factor)‐regulated 0.9335 0.0005 gene expression; Nrm1p associates stably with promoters via MBF to repress transcription upon exit from G1 phase

OST5 YGL226C‐A Zeta subunit of the oligosaccharyltransferase complex of the ER 0.9335 0.0001 lumen, which catalyzes asparagine‐linked glycosylation of newly synthesized proteins NA YDR282C Putative protein of unknown function 0.9304 0.0001 RPB11 YOL005C RNA polymerase II subunit B12.5; part of central core; similar to 0.9296 0.0001 Rpc19p and bacterial alpha subunit SHE9 YDR393W Mitochondrial inner membrane protein required for normal 0.9295 0.0002 mitochondrial morphology, may be involved in fission of the inner membrane; forms a homo‐oligomeric complex

PAM16 YJL104W Constituent of the import motor (PAM complex) component of the 0.9265 0.0001 Translocase of the Inner Mitochondrial membrane (TIM23 complex); forms a 1:1 subcomplex with Pam18p and inhibits its cochaperone activity; contains a J‐like domain MUD2 YKL074C Protein involved in early pre‐mRNA splicing; component of the pre‐ 0.9256 0.0002 mRNA‐U1 snRNP complex, the commitment complex; interacts with Msl5p/BBP splicing factor and Sub2p; similar to metazoan splicing factor U2AF65

231

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) VMA22 YHR060W Peripheral membrane protein that is required for vacuolar H+‐ 0.9246 0.0001 ATPase (V‐ATPase) function, although not an actual component of the V‐ATPase complex; functions in the assembly of the V‐ATPase; localized to the yeast endoplasmic reticulum (ER) NA YKR078W Cytoplasmic protein of unknown function, has similarity to Vps5p; 0.9242 0.0003 potential Cdc28p substrate; contains a Phox homology (PX) domain and specifically binds phosphatidylinositol 3‐phosphate (PtdIns‐3‐P)

MSS2 YDL107W Peripherally bound inner membrane protein of the mitochondrial 0.9220 0.0001 matrix involved in membrane insertion of C‐terminus of Cox2p, interacts genetically and physically with Cox18p

SPC72 YAL047C Component of the cytoplasmic Tub4p (gamma‐tubulin) complex, 0.9199 0.0001 binds spindle pole bodies and links them to microtubules; has roles in astral microtubule formation and stabilization

GET3 YDL100C Guanine nucleotide exchange factor for Gpa1p; amplifies G protein 0.9188 0.0000 signaling; subunit of the GET complex, which is involved in Golgi to ER trafficking and insertion of proteins into the ER membrane; has low‐level ATPase activity NA YDR124W Putative protein of unknown function; non‐essential gene; 0.9173 0.0002 expression is strongly induced by alpha factor NA YDR366C Putative protein of unknown function 0.9171 0.0001 ASF2 YDL197C Anti‐silencing protein that causes derepression of silent loci when 0.9165 0.0001 overexpressed NA YNR075C‐A Identified by gene‐trapping, microarray‐based expression analysis, 0.9165 0.0002 and genome‐wide homology searching ATP16 YDL004W Delta subunit of the central stalk of mitochondrial F1F0 ATP 0.9148 0.0001 synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis; phosphorylated

NA YPR108W‐A Putative protein of unknown function; identified by fungal 0.9125 0.0006 homology and RT‐PCR RVB1 YDR190C Essential protein involved in transcription regulation; component of 0.9094 0.0002 chromatin remodeling complexes; required for assembly and function of the INO80 complex; also referred to as pontin; member of the RUVB‐like protein family CDC1 YDR182W Putative lipid phosphatase of the endoplasmic reticulum; shows 0.9069 0.0000 Mn2+ dependence and may affect Ca2+ signaling; mutants display actin and general growth defects and pleiotropic defects in cell cycle progression and organelle distribution LSM6 YDR378C Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p‐ 0.9065 0.0001 7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA RPT3 YDR394W One of six ATPases of the 19S regulatory particle of the 26S 0.9025 0.0000 proteasome involved in the degradation of ubiquitinated substrates; substrate of N‐acetyltransferase B TAH1 YCR060W HSP90 cofactor; interacts with Hsp82p, Pih1p, Rvb1 and Rvb2, 0.9018 0.0002 contains a single TPR domain with at least two TPR motifs THI13 YDL244W Protein involved in synthesis of the thiamine precursor 0.9012 0.0002 hydroxymethylpyrimidine (HMP); member of a subtelomeric gene family including THI5, THI11, THI12, and THI13

232

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) SSS1 YDR086C Subunit of the Sec61p translocation complex (Sec61p‐Sss1p‐Sbh1p) 0.9007 0.0005 that forms a channel for passage of secretory proteins through the endoplasmic reticulum membrane, and of the Ssh1p complex (Ssh1p‐Sbh2p‐Sss1p); interacts with Ost4p and Wbp1p REF2 YDR195W RNA‐binding protein involved in the cleavage step of mRNA 3'‐end 0.8998 0.0001 formation prior to polyadenylation, and in snoRNA maturation; part of holo‐CPF subcomplex APT, which associates with 3'‐ends of snoRNA‐ and mRNA‐encoding genes UBX3 YDL091C UBX (ubiquitin regulatory X) domain‐containing protein that 0.8993 0.0003 interacts with Cdc48p, green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern

RSM19 YNR037C Mitochondrial ribosomal protein of the small subunit, has similarity 0.8988 0.0004 to E. coli S19 ribosomal protein COA2 YPL189C‐A Cytochrome oxidase assembly factor; null mutation results in 0.8930 0.0007 respiratory deficiency with specific loss of cytochrome oxidase activity; functions downstream of assembly factors Mss51p and Coa1p and interacts with assembly factor Shy1p MTW1 YAL034W‐A Essential component of the MIND kinetochore complex (Mtw1p 0.8921 0.0004 Including Nnf1p‐Nsl1p‐Dsn1p) which joins kinetochore subunits contacting DNA to those contacting microtubules; critical to kinetochore assembly NA YDL121C Putative protein of unknown function; green fluorescent protein 0.8914 0.0003 (GFP)‐fusion protein localizes to the endoplasmic reticulum; YDL121C is not an essential protein YPD1 YDL235C Phosphorelay intermediate protein, phosphorylated by the plasma 0.8907 0.0001 membrane sensor Sln1p in response to osmotic stress and then in turn phosphorylates the response regulators Ssk1p in the cytosol and Skn7p in the nucleus TAF1 YGR274C TFIID subunit (145 kDa), involved in RNA polymerase II transcription 0.8886 0.0004 initiation; possesses in vitro histone acetyltransferase activity but its role in vivo appears to be minor; involved in promoter binding and G1/S progression SRN2 YLR119W Component of the ESCRT‐I complex, which is involved in ubiquitin‐ 0.8881 0.0005 dependent sorting of proteins into the endosome; suppressor of rna1‐1 mutation; may be involved in RNA export from nucleus

DET1 YDR051C Acid phosphatase involved in the non‐vesicular transport of sterols 0.8868 0.0001 in both directions between the endoplasmic reticulum and plasma membrane; deletion confers sensitivity to nickel

NA YDL176W Protein of unknown function, predicted by computational methods 0.8862 0.0002 to be involved in fructose‐1,6‐bisphosphatase (Fbp1p) degradation; interacts with components of the GID complex; YDL176W is not an essential gene NA YDR131C F‐box protein, substrate‐specific adaptor subunit that recruits 0.8859 0.0001 substrates to a core ubiquitination complex ARG82 YDR173C Inositol polyphosphate multikinase (IPMK), sequentially 0.8848 0.0002 phosphorylates Ins(1,4,5)P3 to form Ins(1,3,4,5,6)P5; also has diphosphoinositol polyphosphate synthase activity; regulates arginine‐, phosphate‐, and nitrogen‐responsive genes NA YDL086W Putative protein of unknown function; the authentic, non‐tagged 0.8846 0.0001 protein is detected in highly purified mitochondria in high‐ throughput studies; YDL086W is not an essential gene

233

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) NDT80 YHR124W Meiosis‐specific transcription factor required for exit from 0.8806 0.0003 pachytene and for full meiotic recombination; activates middle sporulation genes; competes with Sum1p for binding to promoters containing middle sporulation elements (MSE) DAP1 YPL170W Heme‐binding protein involved in regulation of cytochrome P450 0.8762 0.0001 protein Erg11p; damage response protein, related to mammalian membrane progesterone receptors; mutations lead to defects in telomeres, mitochondria, and sterol synthesis RLF2 YPR018W Largest subunit (p90) of the Chromatin Assembly Complex (CAF‐1) 0.8760 0.0002 with Cac2p and Msi1p that assembles newly synthesized histones onto recently replicated DNA; involved in the maintenance of transcriptionally silent chromatin CAB5 YDR196C Probable dephospho‐CoA kinase (DPCK) that catalyzes the last step 0.8751 0.0002 in coenzyme A biosynthesis; null mutant lethality is complemented by E. coli coaE (encoding DPCK); detected in purified mitochondria in high‐throughput studies COG8 YML071C Component of the conserved oligomeric Golgi complex (Cog1p 0.8701 0.0001 through Cog8p), a cytosolic tethering complex that functions in protein trafficking to mediate fusion of transport vesicles to Golgi compartments DAL2 YIR029W Allantoicase, converts allantoate to urea and ureidoglycolate in the 0.8698 0.0001 second step of allantoin degradation; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation DUR3 YHL016C Plasma membrane transporter for both urea and polyamines, 0.8693 0.0001 expression is highly sensitive to nitrogen catabolite repression and induced by allophanate, the last intermediate of the allantoin degradative pathway BCS1 YDR375C Mitochondrial protein of the AAA ATPase family; has ATP‐ 0.8677 0.0002 dependent chaperone activity; required for assembly of Rip1p and Qcr10p into cytochrome bc(1) complex; mutations in human homolog BCS1L are linked to neonatal mitochondrial diseases SNA4 YDL123W Protein of unknown function, localized to the vacuolar outer 0.8662 0.0002 membrane; predicted to be palmitoylated MRPL33 YMR286W Mitochondrial ribosomal protein of the large subunit 0.8660 0.0002 YAE1 YJR067C Protein of unknown function, essential for growth under standard 0.8654 0.0002 (aerobic) conditions but not under anaerobic conditions SKP1 YDR328C Evolutionarily conserved kinetochore protein that is part of multiple 0.8642 0.0001 protein complexes, including the SCF ubiquitin ligase complex, the CBF3 complex that binds centromeric DNA, and the RAVE complex that regulates assembly of the V‐ATPase NA YML083C Putative protein of unknown function; strong increase in transcript 0.8642 0.0006 abundance during anaerobic growth compared to aerobic growth; cells deleted for YML083C do not exhibit growth defects in anerobic or anaerobic conditions SIR4 YDR227W Silent information regulator that, together with SIR2 and SIR3, is 0.8635 0.0001 involved in assembly of silent chromatin domains at telomeres and the silent mating‐type loci; potentially phosphorylated by Cdc28p; some alleles of SIR4 prolong lifespan TIM8 YJR135W‐A Mitochondrial intermembrane space protein, forms a complex with 0.8624 0.0004 Tim13p that delivers a subset of hydrophobic proteins to the TIM22 complex for inner membrane insertion; homolog of human TIMM8A, implicated in Mohr‐Tranebjaerg syndrome 234

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) MOG1 YJR074W Conserved nuclear protein that interacts with GTP‐Gsp1p, which is a 0.8607 0.0002 Ran homolog of the Ras GTPase family, and stimulates nucleotide release, involved in nuclear protein import, nucleotide release is inhibited by Yrb1p HDA2 YDR295C Subunit of a possibly tetrameric trichostatin A‐sensitive class II 0.8599 0.0001 histone deacetylase complex containing an Hda1p homodimer and an Hda2p‐Hda3p heterodimer; involved in telomere maintenance

SMC3 YJL074C Subunit of the multiprotein cohesin complex required for sister 0.8591 0.0001 chromatid cohesion in mitotic cells; also required, with Rec8p, for cohesion and recombination during meiosis; phylogenetically conserved SMC chromosomal ATPase family member ZIM17 YNL310C Heat shock protein with a zinc finger motif; essential for protein 0.8583 0.0001 import into mitochondria; may act with Pam18p to facilitate recognition and folding of imported proteins by Ssc1p (mtHSP70) in the mitochondrial matrix PRP28 YDR243C RNA helicase in the DEAD‐box family, involved in RNA isomerization 0.8575 0.0001 at the 5' splice site PEX29 YDR479C Peroxisomal integral membrane peroxin, involved in the regulation 0.8559 0.0004 of peroxisomal size, number and distribution; genetic interactions suggest that Pex28p and Pex29p act at steps upstream of those mediated by Pex30p, Pex31p, and Pex32p GPI8 YDR331W ER membrane glycoprotein subunit of the 0.8556 0.0002 glycosylphosphatidylinositol transamidase complex that adds glycosylphosphatidylinositol (GPI) anchors to newly synthesized proteins; human PIG‐K protein is a functional homolog YRB1 YDR002W Ran GTPase binding protein; involved in nuclear protein import and 0.8546 0.0001 RNA export, ubiquitin‐mediated protein degradation during the cell cycle; shuttles between the nucleus and cytoplasm; is essential; homolog of human RanBP1 TGL2 YDR058C Triacylglycerol lipase that is localized to the mitochondria; has 0.8540 0.0003 lipolytic activity towards triacylglycerols and diacylglycerols when expressed in E. coli RPN6 YDL097C Essential, non‐ATPase regulatory subunit of the 26S proteasome lid 0.8524 0.0001 required for the assembly and activity of the 26S proteasome; the human homolog (S9 protein) partially rescues Rpn6p depletion

EAF6 YJR082C Subunit of the NuA4 acetyltransferase complex that acetylates 0.8514 0.0007 histone H4 and NuA3 acetyltransferase complex that acetylates histone H3 FCF2 YLR051C Essential nucleolar protein involved in the early steps of 35S rRNA 0.8499 0.0007 processing; interacts with Faf1p; member of a transcriptionally co‐ regulated set of genes called the RRB regulon

NA YDR003W‐A Putative protein of unknown function; identified by expression 0.8497 0.0006 profiling and mass spectrometry FRQ1 YDR373W N‐myristoylated calcium‐binding protein that may have a role in 0.8497 0.0001 intracellular signaling through its regulation of the phosphatidylinositol 4‐kinase Pik1p; member of the recoverin/frequenin branch of the EF‐hand superfamily XRS2 YDR369C Protein required for DNA repair; component of the Mre11 complex, 0.8488 0.0002 which is involved in double strand breaks, meiotic recombination, telomere maintenance, and checkpoint signaling

235

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) SNU56 YDR240C Component of U1 snRNP required for mRNA splicing via 0.8478 0.0001 spliceosome; yeast specific, no metazoan counterpart; interacts with mRNA in commitment complex NA NA NA 0.8457 0.0003 NA YIL169C Putative protein of unknown function; serine/threonine rich and 0.8448 0.0003 highly similar to YOL155C, a putative glucan alpha‐1,4‐glucosidase; transcript is induced in both high and low pH environments; YIL169C is a non‐essential gene RBS1 YDL189W Protein of unknown function, identified as a high copy suppressor of 0.8436 0.0001 psk1 psk2 mutations that confer temperature‐sensitivity for galactose utilization; proposed to bind single‐stranded nucleic acids via its R3H domain SIS1 YNL007C Type II HSP40 co‐chaperone that interacts with the HSP70 protein 0.8408 0.0001 Ssa1p; not functionally redundant with Ydj1p due to due to substrate specificity; shares similarity with bacterial DnaJ proteins

RTT107 YHR154W Protein implicated in Mms22‐dependent DNA repair during S phase, 0.8398 0.0008 DNA damage induces phosphorylation by Mec1p at one or more SQ/TQ motifs; interacts with Mms22p and Slx4p; has four BRCT domains; has a role in regulation of Ty1 transposition KIN28 YDL108W Serine/threonine protein kinase, subunit of the transcription factor 0.8393 0.0001 TFIIH; involved in transcription initiation at RNA polymerase II promoters NA YCR102C Putative protein of unknown function, involved in copper 0.8392 0.0003 metabolism; similar to C. carbonum toxD gene; member of the quinone oxidoreductase family NA YMR030W‐ Putative protein of unknown function 0.8378 0.0006 A CDC21 YOR074C Thymidylate synthase, required for de novo biosynthesis of 0.8367 0.0004 pyrimidine deoxyribonucleotides; expression is induced at G1/S

MIM1 YOL026C Mitochondrial outer membrane protein, required for assembly of 0.8354 0.0001 the translocase of the outer membrane (TOM) complex and thereby for mitochondrial protein import; N terminus is exposed to the cytosol: transmembrane segment is highly conserved MRP1 YDR347W Mitochondrial ribosomal protein of the small subunit; MRP1 exhibits 0.8317 0.0002 genetic interactions with PET122, encoding a COX3‐specific translational activator, and with PET123, encoding a small subunit mitochondrial ribosomal protein TAF7 YMR227C TFIID subunit (67 kDa), involved in RNA polymerase II transcription 0.8290 0.0003 initiation IWR1 YDL115C Protein involved in both basal and regulated transcription from RNA 0.8280 0.0001 polymerase II (RNAP II) promoters; interacts with most of the RNAP II subunits; nucleo‐cytoplasmic shuttling protein; deletion causes hypersensitivity to K1 killer toxin YCF1 YDR135C Vacuolar glutathione S‐conjugate transporter of the ATP‐binding 0.8248 0.0002 cassette family, has a role in detoxifying metals such as cadmium, mercury, and arsenite; also transports unconjugated bilirubin; similar to human cystic fibrosis protein CFTR VAM6 YDL077C Vacuolar protein that plays a critical role in the tethering steps of 0.8236 0.0003 vacuolar membrane fusion by facilitating guanine nucleotide exchange on small guanosine triphosphatase Ypt7p

236

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) BUD3 YCL014W Protein involved in bud‐site selection and required for axial budding 0.8235 0.0002 pattern; localizes with septins to bud neck in mitosis and may constitute an axial landmark for next round of budding

BNI5 YNL166C Protein involved in organization of septins at the mother‐bud neck, 0.8230 0.0001 may interact directly with the Cdc11p septin, localizes to bud neck in a septin‐dependent manner CBS2 YDR197W Mitochondrial translational activator of the COB mRNA; interacts 0.8212 0.0001 with translating ribosomes, acts on the COB mRNA 5'‐untranslated leader FPR2 YDR519W Membrane‐bound peptidyl‐prolyl cis‐trans isomerase (PPIase), binds 0.8184 0.0002 to the drugs FK506 and rapamycin; expression pattern suggests possible involvement in ER protein trafficking

NA YDL073W Putative protein of unknown function; YDL073W is not an essential 0.8161 0.0002 gene PAU8 YAL068C Protein of unknown function, member of the seripauperin 0.8158 0.0002 multigene family encoded mainly in subtelomeric regions DIF1 YLR437C Protein that regulates the nuclear localization of ribonucleotide 0.8156 0.0002 reductase Rnr2p and Rnr4p subunits; phosphorylated by Dun1p in response to DNA damage and degraded; N‐terminal half has similarity to S. pombe Spd1 protein RPN9 YDR427W Non‐ATPase regulatory subunit of the 26S proteasome, has 0.8151 0.0002 similarity to putative proteasomal subunits in other species; null mutant is temperature sensitive and exhibits cell cycle and proteasome assembly defects SDH4 YDR178W Membrane anchor subunit of succinate dehydrogenase (Sdh1p, 0.8145 0.0003 Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain CHA1 YCL064C Catabolic L‐serine (L‐threonine) deaminase, catalyzes the 0.8137 0.0003 degradation of both L‐serine and L‐threonine; required to use serine or threonine as the sole nitrogen source, transcriptionally induced by serine and threonine PST1 YDR055W Cell wall protein that contains a putative GPI‐attachment site; 0.8131 0.0008 secreted by regenerating protoplasts; up‐regulated by activation of the cell integrity pathway, as mediated by Rlm1p; upregulated by cell wall damage via disruption of FKS1 SAN1 YDR143C Ubiquitin‐protein ligase, involved in the proteasome‐dependent 0.8129 0.0004 degradation of aberrant nuclear proteins; contains intrinsically disordered regions that contribute to substrate recognition NA YDR319C Putative protein of unknown function, identified as an ortholog of 0.8108 0.0001 the highly conserved FIT family of proteins involved in triglyceride droplet biosynthesis; interacts with Sst2p and Hsp82p in high‐ throughput two‐hybrid screens TBS1 YBR150C Putative protein of unknown function; the authentic, non‐tagged 0.8096 0.0009 protein is detected in highly purified mitochondria in high‐ throughput studies PSF1 YDR013W Subunit of the GINS complex (Sld5p, Psf1p, Psf2p, Psf3p), which is 0.8095 0.0001 localized to DNA replication origins and implicated in assembly of the DNA replication machinery MPP6 YNR024W Nuclear exosome‐associated RNA binding protein; involved in 0.8084 0.0003 surveillance of pre‐rRNAs and pre‐mRNAs, and the degradation of cryptic non‐coding RNAs (ncRNA); copurifies with ribosomes

237

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) CPR7 YJR032W Peptidyl‐prolyl cis‐trans isomerase (cyclophilin), catalyzes the cis‐ 0.8053 0.0003 trans isomerization of peptide bonds N‐terminal to proline residues; binds to Hsp82p and contributes to chaperone activity

ZDS1 YMR273C Protein with a role in regulating Swe1p‐dependent polarized 0.8035 0.0004 growth; interacts with silencing proteins at the telomere; has a role in Bcy1p localization; implicated in mRNA nuclear export; involved in mitotic exit through Cdc14p regulation GIC2 YDR309C Redundant rho‐like GTPase Cdc42p effector; homolog of Gic1p; 0.8020 0.0001 involved in initiation of budding and cellular polarization; interacts with Cdc42p via the Cdc42/Rac‐interactive binding (CRIB) domain and with PI(4,5)P2 via a polybasic region FYV6 YNL133C Protein of unknown function, required for survival upon exposure to 0.8011 0.0002 K1 killer toxin; proposed to regulate double‐strand break repair via non‐homologous end‐joining YKE2 YLR200W Subunit of the heterohexameric Gim/prefoldin protein complex 0.8010 0.0004 involved in the folding of alpha‐tubulin, beta‐tubulin, and actin

SYF1 YDR416W Member of the NineTeen Complex (NTC) that contains Prp19p and 0.7998 0.0002 stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; null mutant has splicing defect and arrests in G2/M; homologs in human and C. elegans IES2 YNL215W Protein that associates with the INO80 chromatin remodeling 0.7976 0.0002 complex under low‐salt conditions; essential for growth under anaerobic conditions GCS1 YDL226C ADP‐ribosylation factor GTPase activating protein (ARF GAP), 0.7975 0.0004 involved in ER‐Golgi transport; shares functional similarity with Glo3p MRPL37 YBR268W Mitochondrial ribosomal protein of the large subunit 0.7958 0.0003 ASP1 YDR321W Cytosolic L‐asparaginase, involved in asparagine catabolism 0.7957 0.0006

PHO2 YDL106C Homeobox transcription factor; regulatory targets include genes 0.7956 0.0006 involved in phosphate metabolism; binds cooperatively with Pho4p to the PHO5 promoter; phosphorylation of Pho2p facilitates interaction with Pho4p NA YOR389W Putative protein of unknown function; expression regulated by 0.7938 0.0005 copper levels NA YDR415C Putative protein of unknown function 0.7904 0.0004 KCS1 YDR017C Inositol hexakisphosphate (IP6) and inositol heptakisphosphate (IP7) 0.7900 0.0006 kinase; generation of high energy inositol pyrophosphates by Kcs1p is required for many processes such as vacuolar biogenesis, stress response and telomere maintenance PFD1 YJL179W Subunit of heterohexameric prefoldin, which binds cytosolic 0.7899 0.0002 chaperonin and transfers target proteins to it; involved in the biogenesis of actin and of alpha‐ and gamma‐tubulin

RNH70 YGR276C 3'‐5' exoribonuclease; required for maturation of 3' ends of 5S rRNA 0.7897 0.0004 and tRNA‐Arg3 from dicistronic transcripts PMS1 YNL082W ATP‐binding protein required for mismatch repair in mitosis and 0.7893 0.0003 meiosis; functions as a heterodimer with Mlh1p, binds double‐ and single‐stranded DNA via its N‐terminal domain, similar to E. coli MutL

238

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) MCM21 YDR318W Protein involved in minichromosome maintenance; component of 0.7881 0.0004 the COMA complex (Ctf19p, Okp1p, Mcm21p, Ame1p) that bridges kinetochore subunits that are in contact with centromeric DNA and the subunits bound to microtubules ARP1 YHR129C Actin‐related protein of the dynactin complex; required for spindle 0.7879 0.0006 orientation and nuclear migration; putative ortholog of mammalian centractin RFA3 YJL173C Subunit of heterotrimeric Replication Protein A (RPA), which is a 0.7878 0.0002 highly conserved single‐stranded DNA binding protein involved in DNA replication, repair, and recombination

CPR5 YDR304C Peptidyl‐prolyl cis‐trans isomerase (cyclophilin) of the endoplasmic 0.7860 0.0001 reticulum, catalyzes the cis‐trans isomerization of peptide bonds N‐ terminal to proline residues; transcriptionally induced in response to unfolded proteins in the ER RAM1 YDL090C Beta subunit of the CAAX farnesyltransferase (FTase) that prenylates 0.7854 0.0002 the a‐factor mating pheromone and Ras proteins; required for the membrane localization of Ras proteins and a‐factor; homolog of the mammalian FTase beta subunit NA NA NA 0.7854 0.0004 OST4 YDL232W Subunit of the oligosaccharyltransferase complex of the ER lumen, 0.7845 0.0001 which catalyzes protein asparagine‐linked glycosylation; type I membrane protein required for incorporation of Ost3p or Ost6p into the OST complex GRX1 YCL035C Hydroperoxide and superoxide‐radical responsive heat‐stable 0.7839 0.0009 glutathione‐dependent disulfide oxidoreductase with active site cysteine pair; protects cells from oxidative damage

HST4 YDR191W Member of the Sir2 family of NAD(+)‐dependent protein 0.7830 0.0003 deacetylases; involved along with Hst3p in silencing at telomeres, cell cycle progression, radiation resistance, genomic stability and short‐chain fatty acid metabolism SNA2 YDR525W‐A Protein of unknown function, has similarity to Pmp3p, which is 0.7827 0.0002 involved in cation transport; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern

NUM1 YDR150W Protein required for nuclear migration, localizes to the mother cell 0.7800 0.0002 cortex and the bud tip; may mediate interactions of dynein and cytoplasmic microtubules with the cell cortex

SLX5 YDL013W Subunit of the Slx5‐Slx8 SUMO‐targeted ubiquitin ligase (STUbL) 0.7800 0.0002 complex, stimulated by SUMO‐modified substrates; contains a RING domain and two SIMs (SUMO‐interacting motifs); forms SUMO‐ dependent nuclear foci, including DNA repair centers SHU2 YDR078C Protein involved in a Rad51p‐, Rad54p‐dependent pathway for 0.7789 0.0002 homologous recombination repair, important for error‐free repair of spontaneous and induced DNA lesions to protect the genome from mutation; associates with Shu1p, Psy3p, and Csm2p UBC13 YDR092W Ubiquitin‐conjugating enzyme involved in the error‐free DNA 0.7785 0.0001 postreplication repair pathway; interacts with Mms2p to assemble ubiquitin chains at the Ub Lys‐63 residue; DNA damage triggers redistribution from the cytoplasm to the nucleus CUS2 YNL286W Protein that binds to U2 snRNA and Prp11p, may be involved in U2 0.7766 0.0003 snRNA folding; contains two RNA recognition motifs (RRMs)

239

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) NA YDR061W Protein with similarity to ATP‐binding cassette (ABC) transporter 0.7763 0.0002 family members; lacks predicted membrane‐spanning regions; transcriptionally activated by Yrm1p along with genes involved in multidrug resistance MTC5 YDR128W Protein of unknown function; mtc5 is synthetically sick with cdc13‐1 0.7763 0.0001

GPI17 YDR434W Transmembrane protein subunit of the glycosylphosphatidylinositol 0.7762 0.0008 transamidase complex that adds GPIs to newly synthesized proteins; human PIG‐Sp homolog

GIM5 YML094W Subunit of the heterohexameric cochaperone prefoldin complex 0.7755 0.0002 which binds specifically to cytosolic chaperonin and transfers target proteins to it SPS1 YDR523C Putative protein serine/threonine kinase expressed at the end of 0.7754 0.0008 meiosis and localized to the prospore membrane, required for correct localization of enzymes involved in spore wall synthesis

FMP10 YER182W Putative protein of unknown function; the authentic, non‐tagged 0.7751 0.0007 protein is detected in highly purified mitochondria in high‐ throughput studies NA YDR026C Protein of unknown function that may interact with ribosomes, 0.7749 0.0002 based on co‐purification experiments; Myb‐like DNA‐binding protein that may bind to the Ter region of rDNA; interacts physically with Fob1p NA YDR444W Putative protein of unknown function 0.7732 0.0007 HIF1 YLL022C Non‐essential component of the HAT‐B histone acetyltransferase 0.7725 0.0003 complex (Hat1p‐Hat2p‐Hif1p), localized to the nucleus; has a role in telomeric silencing UMP1 YBR173C Short‐lived chaperone required for correct maturation of the 20S 0.7723 0.0002 proteasome; may inhibit premature dimerization of proteasome half‐mers; degraded by proteasome upon completion of its assembly SWR1 YDR334W Swi2/Snf2‐related ATPase that is the structural component of the 0.7709 0.0004 SWR1 complex, which exchanges histone variant H2AZ (Htz1p) for chromatin‐bound histone H2A TRM9 YML014W tRNA methyltransferase, catalyzes esterification of modified uridine 0.7693 0.0006 nucleotides in tRNA(Arg3) and tRNA(Glu), likely as part of a complex with Trm112p; deletion confers resistance to zymocin

VTA1 YLR181C Multivesicular body (MVB) protein involved in endosomal protein 0.7691 0.0003 sorting; regulates Vps4p activity by promoting its oligomerization; has an N‐terminal Vps60‐ and Did2‐ binding domain, a linker region, and a C‐terminal Vps4p binding domain SRP14 YDL092W Signal recognition particle (SRP) subunit, interacts with the RNA 0.7685 0.0003 component of SRP to form the Alu domain, which is the region of SRP responsible for arrest of nascent chain elongation during membrane targeting; homolog of mammalian SRP14 MRPL44 YMR225C Mitochondrial ribosomal protein of the large subunit 0.7677 0.0004 NA YDR109C Putative kinase 0.7675 0.0001 PSH1 YOL054W E3 ubiquitin ligase that mediates poyubiquitination and degradation 0.7665 0.0003 of centromere‐binding protein Cse4p and prevents Cse4p from mislocalizing to euchromatin; ubiquitylation of Cse4p may be antagonized by Scm3p NA YLR099W‐A Putative protein of unknown function 0.7665 0.0003

240

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) YSF3 YNL138W‐A Component of the SF3b subcomplex of the U2 snRNP, essential 0.7634 0.0003 protein required for for splicing and for assembly of SF3b

ADK1 YDR226W Adenylate kinase, required for purine metabolism; localized to the 0.7628 0.0001 cytoplasm and the mitochondria; lacks cleavable signal sequence

PCF11 YDR228C mRNA 3' end processing factor, essential component of cleavage 0.7620 0.0001 and polyadenylation factor IA (CF IA), involved in pre‐mRNA 3' end processing and in transcription termination; binds C‐terminal domain of largest subunit of RNA pol II (Rpo21p) PKH3 YDR466W Protein kinase with similarity to mammalian phosphoinositide‐ 0.7617 0.0003 dependent kinase 1 (PDK1) and yeast Pkh1p and Pkh2p, two redundant upstream activators of Pkc1p; identified as a multicopy suppressor of a pkh1 pkh2 double mutant VPS3 YDR495C Component of CORVET tethering complex; cytoplasmic protein 0.7615 0.0006 required for the sorting and processing of soluble vacuolar proteins, acidification of the vacuolar lumen, and assembly of the vacuolar H+‐ATPase PPH22 YDL188C Catalytic subunit of protein phosphatase 2A (PP2A), functionally 0.7611 0.0006 redundant with Pph21p; methylated at C terminus; forms alternate complexes with several regulatory subunits; involved in signal transduction and regulation of mitosis CTF8 YHR191C Subunit of a complex with Ctf18p that shares some subunits with 0.7600 0.0002 Replication Factor C and is required for sister chromatid cohesion

DPM1 YPR183W Dolichol phosphate mannose (Dol‐P‐Man) synthase of the ER 0.7600 0.0002 membrane, catalyzes the formation of Dol‐P‐Man from Dol‐P and GDP‐Man; required for glycosyl phosphatidylinositol membrane anchoring, O mannosylation, and protein glycosylation TIM11 YDR322C‐A Subunit e of mitochondrial F1F0‐ATPase, which is a large, 0.7569 0.0001 evolutionarily conserved enzyme complex required for ATP synthesis; essential for the dimeric and oligomeric state of ATP synthase MSA2 YKR077W Putative transcriptional activator, that interacts with G1‐specific 0.7569 0.0005 transcription factor, MBF and G1‐specific promoters; ortholog of Msa2p, an MBF and SBF activator that regulates G1‐specific transcription and cell cycle initiation YOS1 YER074W‐A Integral membrane protein required for ER to Golgi transport; 0.7552 0.0002 localized to the Golgi, the ER, and COPII vesicles; interacts with Yip1p and Yif1p RSM28 YDR494W Mitochondrial ribosomal protein of the small subunit; genetic 0.7534 0.0002 interactions suggest a possible role in promoting translation initiation NA YPL071C Putative protein of unknown function; green fluorescent protein 0.7522 0.0004 (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus

IPK1 YDR315C Inositol 1,3,4,5,6‐pentakisphosphate 2‐kinase, nuclear protein 0.7518 0.0007 required for synthesis of 1,2,3,4,5,6‐hexakisphosphate (phytate), which is integral to cell function; has 2 motifs conserved in other fungi; ipk1 gle1 double mutant is inviable MFB1 YDR219C Mitochondria‐associated F‐box protein involved in maintenance of 0.7492 0.0004 normal mitochondrial morphology; interacts with Skp1p through the F‐box motif; preferentially localizes to the mother cell during budding 241

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) SRX1 YKL086W Sulfiredoxin, contributes to oxidative stress resistance by reducing 0.7469 0.0004 cysteine‐sulfinic acid groups in the peroxiredoxin Tsa1p, which is formed upon exposure to oxidants; conserved in higher eukaryotes

SPA2 YLL021W Component of the polarisome, which functions in actin cytoskeletal 0.7452 0.0003 organization during polarized growth; acts as a scaffold for Mkk1p and Mpk1p cell wall integrity signaling components; potential Cdc28p substrate RPN5 YDL147W Essential, non‐ATPase regulatory subunit of the 26S proteasome lid, 0.7425 0.0005 similar to mammalian p55 subunit and to another S. cerevisiae regulatory subunit, Rpn7p RPC10 YHR143W‐A RNA polymerase subunit ABC10‐alpha, found in RNA polymerase 0.7423 0.0006 complexes I, II, and III NBP2 YDR162C Protein involved in the HOG (high osmolarity glycerol) pathway, 0.7419 0.0002 negatively regulates Hog1p by recruitment of phosphatase Ptc1p the Pbs2p‐Hog1p complex, found in the nucleus and cytoplasm, contains an SH3 domain that binds Pbs2p ELF1 YKL160W Transcription elongation factor that contains a conserved zinc finger 0.7394 0.0002 domain; implicated in the maintenance of proper chromatin structure in actively transcribed regions; deletion inhibits Brome mosaic virus (BMV) gene expression GNA1 YFL017C Evolutionarily conserved glucosamine‐6‐phosphate 0.7393 0.0001 acetyltransferase required for multiple cell cycle events including passage through START, DNA synthesis, and mitosis; involved in UDP‐N‐acetylglucosamine synthesis, forms GlcNAc6P from AcCoA RAD30 YDR419W DNA polymerase eta, involved in translesion synthesis during post‐ 0.7390 0.0002 replication repair; catalyzes the synthesis of DNA opposite cyclobutane pyrimidine dimers and other lesions; mutations in human pol eta are responsible for XPV NA YDL144C Putative protein of unknown function; green fluorescent protein 0.7381 0.0002 (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YDL144C is not an essential gene. NA YOR385W Putative protein of unknown function; green fluorescent protein 0.7376 0.0002 (GFP)‐fusion protein localizes to the cytoplasm; YOR385W is not an essential gene NA YDR338C Putative protein of unknown function, member of the multi‐drug 0.7371 0.0006 and toxin extrusion (MATE) family of the multidrug/oligosaccharidyl‐ lipid/polysaccharide (MOP) exporter superfamily

AIR2 YDL175C Zinc knuckle protein, involved in nuclear RNA processing and 0.7362 0.0003 degredation as a component of the TRAMP complex; stimulates the poly(A) polymerase activity of Pap2p in vitro; functionally redundant with Air1p CYK3 YDL117W SH3‐domain protein located in the mother‐bud neck and the 0.7350 0.0001 cytokinetic actin ring; mutant phenotype and genetic interactions suggest a role in cytokinesis SPO71 YDR104C Meiosis‐specific protein of unknown function, required for spore 0.7347 0.0001 wall formation during sporulation; dispensable for both nuclear divisions during meiosis NA NA NA 0.7347 0.0007 NA YDR381C‐A Protein of unknown function, localized to the mitochondrial outer 0.7286 0.0003 membrane

242

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) ARF2 YDL137W ADP‐ribosylation factor, GTPase of the Ras superfamily involved in 0.7280 0.0003 regulation of coated formation vesicles in intracellular trafficking within the Golgi; functionally interchangeable with Arf1p

NA YDR179W‐A Putative protein of unknown function 0.7263 0.0005 NA NA NA 0.7245 0.0004 SCW10 YMR305C Cell wall protein with similarity to glucanases; may play a role in 0.7244 0.0001 conjugation during mating based on mutant phenotype and its regulation by Ste12p LEO1 YOR123C Component of the Paf1 complex, which associates with RNA 0.7208 0.0003 polymerase II and is involved in histone methylation; plays a role in regulating Ty1 transposition NA YBL059W Putative protein of unknown function; the authentic, non‐tagged 0.7196 0.0005 protein is detected in highly purified mitochondria in high‐ throughput studies NA NA NA 0.7188 0.0007 NA YIL161W Putative protein of unknown function; green fluorescent protein 0.7183 0.0002 (GFP)‐fusion protein localizes to the cytoplasm; mRNA is enriched in Scp160p‐associated mRNPs; YIL161W is a non‐essential gene

VPS72 YDR485C Htz1p‐binding component of the SWR1 complex, which exchanges 0.7163 0.0003 histone variant H2AZ (Htz1p) for chromatin‐bound histone H2A; required for vacuolar protein sorting DIG2 YDR480W MAP kinase‐responsive inhibitor of the Ste12p transcription factor, 0.7151 0.0004 involved in the regulation of mating‐specific genes and the invasive growth pathway; related regulators Dig1p and Dig2p bind to Ste12p

MRPL11 YDL202W Mitochondrial ribosomal protein of the large subunit 0.7145 0.0002 SRM1 YGL097W Nucleotide exchange factor for Gsp1p, localizes to the nucleus, 0.7129 0.0008 required for nucleocytoplasmic trafficking of macromolecules; suppressor of the pheromone response pathway; potentially phosphorylated by Cdc28p FMC1 YIL098C Mitochondrial matrix protein, required for assembly or stability at 0.7106 0.0001 high temperature of the F1 sector of mitochondrial F1F0 ATP synthase; null mutant temperature sensitive growth on glycerol is suppressed by multicopy expression of Odc1p AAD4 YDL243C Putative aryl‐alcohol dehydrogenase with similarity to P. 0.7101 0.0004 chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin NA YEL073C Putative protein of unknown function; located adjacent to ARS503 0.7079 0.0004 and the telomere on the left arm of chromosome V; regulated by inositol/choline GTB1 YDR221W Glucosidase II beta subunit, forms a complex with alpha subunit 0.7077 0.0004 Rot2p, involved in removal of two glucose residues from N‐linked glycans during glycoprotein biogenesis in the ER

RDH54 YBR073W DNA‐dependent ATPase, stimulates strand exchange by modifying 0.7068 0.0010 the topology of double‐stranded DNA; involved in recombinational repair of DNA double‐strand breaks during mitosis and meiosis; proposed to be involved in crossover interference SMB1 YER029C Core Sm protein Sm B; part of heteroheptameric complex (with 0.7043 0.0003 Smd1p, Smd2p, Smd3p, Sme1p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm B and Sm B'

243

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) NA YNR029C Putative protein of unknown function, deletion confers reduced 0.7042 0.0006 fitness in saline SNF3 YDL194W Plasma membrane low glucose sensor that regulates glucose 0.7036 0.0003 transport; contains 12 predicted transmembrane segments and a long C‐terminal tail required for induction of hexose transporters; also senses fructose and mannose; similar to Rgt2p SOK1 YDR006C Protein whose overexpression suppresses the growth defect of 0.7025 0.0002 mutants lacking protein kinase A activity; involved in cAMP‐ mediated signaling; localized to the nucleus; similar to the mouse testis‐specific protein PBS13 SAC3 YDR159W Nuclear pore‐associated protein, required for biogenesis of the 0.7015 0.0002 small ribosomal subunit; forms a complex with Thp1p that is involved in transcription and in mRNA export from the nucleus

YPS7 YDR349C Putative GPI‐anchored aspartic protease, member of the yapsin 0.6982 0.0001 family of proteases involved in cell wall growth and maintenance; located in the cytoplasm and endoplasmic reticulum

STP1 YDR463W Transcription factor, undergoes proteolytic processing by SPS 0.6970 0.0003 (Ssy1p‐Ptr3p‐Ssy5p)‐sensor component Ssy5p in response to extracellular amino acids; activates transcription of amino acid permease genes and may have a role in tRNA processing NA YKL018C‐A Putative protein of unknown function; identified by homology; 0.6955 0.0005 green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm NA YMR114C Protein of unknown function; may interact with ribosomes, based 0.6948 0.0009 on co‐purification experiments; green fluorescent protein (GFP)‐ fusion protein localizes to the nucleus and cytoplasm; YMR114C is not an essential gene NA YOL114C Putative protein of unknown function with similarity to human ICT1 0.6945 0.0004 and prokaryotic factors that may function in translation termination; YOL114C is not an essential gene CLB3 YDL155W B‐type cyclin involved in cell cycle progression; activates Cdc28p to 0.6924 0.0002 promote the G2/M transition; may be involved in DNA replication and spindle assembly; accumulates during S phase and G2, then targeted for ubiquitin‐mediated degradation TIF11 YMR260C Translation initiation factor eIF1A, essential protein that forms a 0.6888 0.0006 complex with Sui1p (eIF1) and the 40S ribosomal subunit and scans for the start codon; C‐terminus associates with Fun12p (eIF5B); N terminus interacts with eIF2 and eIF3 SRP101 YDR292C Signal recognition particle (SRP) receptor alpha subunit; contain 0.6882 0.0003 GTPase domains; involved in SRP‐dependent protein targeting; interacts with the beta subunit, Srp102p NA YDR307W Putative protein of unknown function 0.6867 0.0005 CLN2 YPL256C G1 cyclin involved in regulation of the cell cycle; activates Cdc28p 0.6842 0.0003 kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐ Mbp1p) and SBF (Swi6p‐Swi4p) MED11 YMR112C Subunit of the RNA polymerase II mediator complex; associates with 0.6826 0.0005 core polymerase subunits to form the RNA polymerase II holoenzyme; essential protein

244

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) PGA2 YNL149C Essential protein required for maturation of Gas1p and Pho8p; 0.6819 0.0005 involved in protein trafficking; GFP‐fusion protein localizes to the ER and YFP‐fusion protein to the nuclear envelope‐ER network; null mutants have a cell separation defect YSP2 YDR326C Protein involved in programmed cell death; mutant shows 0.6813 0.0006 resistance to cell death induced by amiodarone or intracellular acidification SNT2 YGL131C DNA binding protein with similarity to the S. pombe Snt2 protein; 0.6811 0.0003 computational analysis suggests a role in regulation of expression of genes encoding amine transporters

OCA6 YDR067C Cytoplasmic protein required for replication of Brome mosaic virus 0.6811 0.0002 in S. cerevisiae, which is a model system for studying positive‐strand RNA virus replication; null mutation confers sensitivity to tunicamycin and DTT FPR3 YML074C Nucleolar peptidyl‐prolyl cis‐trans isomerase (PPIase); FK506 binding 0.6804 0.0002 protein; phosphorylated by casein kinase II (Cka1p‐Cka2p‐Ckb1p‐ Ckb2p) and dephosphorylated by Ptp1p

DBF4 YDR052C Regulatory subunit of Cdc7p‐Dbf4p kinase complex, required for 0.6798 0.0006 Cdc7p kinase activity and initiation of DNA replication; phosphorylates the Mcm2‐7 family of proteins; cell cycle regulated

DSK2 YMR276W Nuclear‐enriched ubiquitin‐like polyubiquitin‐binding protein, 0.6792 0.0009 required for spindle pole body (SPB) duplication and for transit through the G2/M phase of the cell cycle, involved in proteolysis, interacts with the proteasome TAF12 YDR145W Subunit (61/68 kDa) of TFIID and SAGA complexes, involved in RNA 0.6775 0.0005 polymerase II transcription initiation and in chromatin modification, similar to histone H2A ACK1 YDL203C Protein that functions upstream of Pkc1p in the cell wall integrity 0.6768 0.0003 pathway; GFP‐fusion protein expression is induced in response to the DNA‐damaging agent MMS; non‐tagged Ack1p is detected in purified mitochondria NA YGR121W‐A Putative protein of unknown function 0.6766 0.0010 TRX3 YCR083W Mitochondrial thioredoxin, highly conserved oxidoreductase 0.6736 0.0003 required to maintain the redox homeostasis of the cell, forms the mitochondrial thioredoxin system with Trr2p, redox state is maintained by both Trr2p and Glr1p MNN10 YDR245W Subunit of a Golgi mannosyltransferase complex also containing 0.6725 0.0002 Anp1p, Mnn9p, Mnn11p, and Hoc1p that mediates elongation of the polysaccharide mannan backbone; membrane protein of the mannosyltransferase family PCL7 YIL050W Pho85p cyclin of the Pho80p subfamily, forms a functional kinase 0.6708 0.0005 complex with Pho85p which phosphorylates Mmr1p and is regulated by Pho81p; involved in glycogen metabolism, expression is cell‐cycle regulated TPM1 YNL079C Major isoform of tropomyosin; binds to and stabilizes actin cables 0.6704 0.0005 and filaments, which direct polarized cell growth and the distribution of several organelles; acetylated by the NatB complex and acetylated form binds actin most efficiently TRM3 YDL112W 2'‐O‐ribose methyltransferase, catalyzes the ribose methylation of 0.6703 0.0005 the guanosine nucleotide at position 18 of tRNAs

245

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) DAD3 YBR233W‐A Essential subunit of the Dam1 complex (aka DASH complex), couples 0.6701 0.0003 kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis IMG2 YCR071C Mitochondrial ribosomal protein of the large subunit 0.6699 0.0006 ERF2 YLR246W Subunit of a palmitoyltransferase, composed of Erf2p and Shr5p, 0.6696 0.0002 that adds a palmitoyl lipid moiety to heterolipidated substrates such as Ras1p and Ras2p through a thioester linkage; mutants partially mislocalize Ras2p to the vacuole NTG2 YOL043C DNA N‐glycosylase and apurinic/apyrimidinic (AP) lyase involved in 0.6687 0.0002 base excision repair, localizes to the nucleus; sumoylated

NA YLR460C Member of the quinone oxidoreductase family, up‐regulated in 0.6678 0.0008 response to the fungicide mancozeb; possibly up‐regulated by iodine PEX5 YDR244W Peroxisomal membrane signal receptor for the C‐terminal tripeptide 0.6657 0.0005 signal sequence (PTS1) of peroxisomal matrix proteins, required for peroxisomal matrix protein import; also proposed to have PTS1‐ receptor independent functions PKR1 YMR123W V‐ATPase assembly factor, functions with other V‐ATPase assembly 0.6642 0.0006 factors in the ER to efficiently assemble the V‐ATPase membrane sector (V0) RAV2 YDR202C Subunit of RAVE (Rav1p, Rav2p, Skp1p), a complex that associates 0.6642 0.0003 with the V1 domain of the vacuolar membrane (H+)‐ATPase (V‐ ATPase) and promotes assembly and reassembly of the holoenzyme NA NA NA 0.6639 0.0007 TMA64 YDR117C Protein of unknown function that associates with ribosomes; has a 0.6615 0.0003 putative RNA binding domain; in mammals the corresponding protein, eIF2D, has been shown to possess translation initiation factor activity MRPL35 YDR322W Mitochondrial ribosomal protein of the large subunit 0.6590 0.0006 SPO13 YHR014W Meiosis‐specific protein, involved in maintaining sister chromatid 0.6582 0.0009 cohesion during meiosis I as well as promoting proper attachment of kinetochores to the spindle during meiosis I and meiosis II

NUP2 YLR335W Nucleoporin involved in nucleocytoplasmic transport, binds to 0.6577 0.0006 either the nucleoplasmic or cytoplasmic faces of the nuclear pore complex depending on Ran‐GTP levels; also has a role in chromatin organization PTR3 YFR029W Component of the SPS plasma membrane amino acid sensor system 0.6571 0.0002 (Ssy1p‐Ptr3p‐Ssy5p), which senses external amino acid concentration and transmits intracellular signals that result in regulation of expression of amino acid permease genes PRP11 YDL043C Subunit of the SF3a splicing factor complex, required for 0.6559 0.0005 spliceosome assembly NOP10 YHR072W‐A Constituent of small nucleolar ribonucleoprotein particles 0.6540 0.0007 containing H/ACA‐type snoRNAs, which are required for pseudouridylation and processing of pre‐18S rRNA SSY1 YDR160W Component of the SPS plasma membrane amino acid sensor system 0.6535 0.0006 (Ssy1p‐Ptr3p‐Ssy5p), which senses external amino acid concentration and transmits intracellular signals that result in regulation of expression of amino acid permease genes

246

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) YPT1 YFL038C Rab family GTPase, involved in the ER‐to‐Golgi step of the secretory 0.6532 0.0002 pathway; complex formation with the Rab escort protein Mrs6p is required for prenylation of Ypt1p by protein geranylgeranyltransferase type II (Bet2p‐Bet4p) DUO1 YGL061C Essential subunit of the Dam1 complex (aka DASH complex), couples 0.6529 0.0003 kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis SNA3 YJL151C Integral membrane protein localized to vacuolar intralumenal 0.6519 0.0002 vesicles, computational analysis of large‐scale protein‐protein interaction data suggests a possible role in either cell wall synthesis or protein‐vacuolar targeting FUN19 YAL034C Non‐essential protein of unknown function; expression induced in 0.6513 0.0002 response to heat stress ECM18 YDR125C Protein of unknown function, similar to Rlp24p 0.6510 0.0003 BRE2 YLR015W Subunit of COMPASS (Set1C) complex, which methylates Lys4 of 0.6506 0.0007 histone H3 and functions in silencing at telomeres; has a C‐terminal Sdc1 Dpy‐30 Interaction (SDI) domain that mediates binding to Sdc1p; similar to trithorax‐group protein ASH2L UBC5 YDR059C Ubiquitin‐conjugating enzyme that mediates selective degradation 0.6492 0.0008 of short‐lived, abnormal, or excess proteins, including histone H3; central component of the cellular stress response; expression is heat inducible SLD2 YKL108W Protein required for DNA replication, phosphorylated in S phase by 0.6456 0.0005 S‐phase cyclin‐dependent kinases (Cdks), phosphorylation is essential for DNA replication and for complex formation with Dpb11p; potential Cdc28p substrate CDC48 YDL126C ATPase involved in ubiquitin‐mediated protein degradation; 0.6447 0.0004 Cdc48p‐Npl4p‐Ufd1p complex participates in ER‐associated degradation (ERAD) while Cdc48p‐Npl4p‐Vms1p complex participates in mitochondria‐associated degradation (MAD) NA YCR076C Putative protein of unknown function; YCR076C is not an essential 0.6415 0.0006 gene CHO1 YER026C Phosphatidylserine synthase, functions in phospholipid biosynthesis; 0.6403 0.0002 catalyzes the reaction CDP‐diaclyglycerol + L‐serine = CMP + L‐1‐ phosphatidylserine, transcriptionally repressed by myo‐inositol and choline CSR1 YLR380W Phosphatidylinositol transfer protein with a potential role in 0.6401 0.0004 regulating lipid and fatty acid metabolism under heme‐depleted conditions; interacts specifically with thioredoxin peroxidase; may have a role in oxidative stress resistance SLC1 YDL052C 1‐acyl‐sn‐glycerol‐3‐phosphate acyltransferase, catalyzes the 0.6386 0.0004 acylation of lysophosphatidic acid to form phosphatidic acid, a key intermediate in lipid metabolism; enzymatic activity detected in lipid particles and microsomes CKS1 YBR135W Cyclin‐dependent protein kinase regulatory subunit and adaptor; 0.6365 0.0005 modulates proteolysis of M‐phase targets through interactions with the proteasome; role in transcriptional regulation, recruiting proteasomal subunits to target gene promoters SIZ1 YDR409W SUMO/Smt3 ligase that promotes the attachment of sumo (Smt3p; 0.6361 0.0002 small ubiquitin‐related modifier) to proteins; binds Ubc9p and may bind septins; specifically required for sumoylation of septins in vivo; localized to the septin ring 247

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) TOM1 YDR457W E3 ubiquitin ligase of the hect‐domain class; has a role in mRNA 0.6355 0.0004 export from the nucleus and may regulate transcriptional coactivators; involved in degradation of excess histones

GPX2 YBR244W Phospholipid hydroperoxide glutathione peroxidase induced by 0.6329 0.0004 glucose starvation that protects cells from phospholipid hydroperoxides and nonphospholipid peroxides during oxidative stress BIO4 YNR057C Dethiobiotin synthetase, catalyzes the third step in the biotin 0.6329 0.0006 biosynthesis pathway; BIO4 is in a cluster of 3 genes (BIO3, BIO4, and BIO5) that mediate biotin synthesis; expression appears to be repressed at low iron levels MVD1 YNR043W Mevalonate pyrophosphate decarboxylase, essential enzyme 0.6312 0.0003 involved in the biosynthesis of isoprenoids and sterols, including ergosterol; acts as a homodimer NA YDR391C Putative protein of unknown function, possibly involved in zinc 0.6311 0.0003 homeostasis; Bdf1p‐dependent transcription induced by salt stress; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus TRR1 YDR353W Cytoplasmic thioredoxin reductase, key regulatory enzyme that 0.6296 0.0003 determines the redox state of the thioredoxin system, which acts as a disulfide reductase system and protects cells against both oxidative and reductive stress HHO1 YPL127C Histone H1, a linker histone required for nucleosome packaging at 0.6288 0.0005 restricted sites; suppresses DNA repair involving homologous recombination; not required for telomeric silencing, basal transcriptional repression, or efficient sporulation IGO1 YNL157W Protein required for initiation of G0 program; prevents degradation 0.6280 0.0004 of nutrient‐regulated mRNAs via the 5'‐3' mRNA decay pathway; phosphorylated by Rim15p; GFP protein localizes to the cytoplasm and nucleus; similar to Igo2p MSS4 YDR208W Phosphatidylinositol‐4‐phosphate 5‐kinase, involved in actin 0.6275 0.0006 cytoskeleton organization and cell morphogenesis; multicopy suppressor of stt4 mutation NTR2 YKR022C Essential protein that forms a dimer with Ntr1p; also forms a trimer, 0.6274 0.0003 with Ntr2p and the DExD/H‐box RNA helicase Prp43p, that is involved in spliceosome disassembly GUK1 YDR454C Guanylate kinase, converts GMP to GDP; required for growth and 0.6263 0.0006 mannose outer chain elongation of cell wall N‐linked glycoproteins

NA YDL119C Putative mitochondrial transport protein; GFP‐fusion protein is 0.6262 0.0003 induced in response to the DNA‐damaging agent MMS; the authentic, non‐tagged protein is detected in purified mitochondria

RMP1 YLR145W Subunit of RNase MRP, which processes pre‐rRNA and has a role in 0.6259 0.0010 cell cycle‐regulated degradation of daughter cell‐specific mRNAs; unlike most subunits, not shared between RNase MRP and nuclear RNase P RPC17 YJL011C RNA polymerase III subunit C17; physically interacts with C31, C11, 0.6258 0.0010 and TFIIIB70; may be involved in the recruitment of pol III by the preinitiation complex

248

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) NBP1 YLR457C Spindle pole body (SPB) component, required for the insertion of 0.6249 0.0003 the duplication plaque into the nuclear membrane during SPB duplication; essential for bipolar spindle formation; component of the Mps2p‐Bbp1p complex PUS5 YLR165C Pseudouridine synthase, catalyzes only the formation of 0.6229 0.0006 pseudouridine (Psi)‐2819 in mitochondrial 21S rRNA; not essential for viability TOS6 YNL300W Glycosylphosphatidylinositol‐dependent cell wall protein, 0.6224 0.0003 expression is periodic and decreases in respone to ergosterol perturbation or upon entry into stationary phase; depletion increases resistance to lactic acid ITR1 YDR497C Myo‐inositol transporter with strong similarity to the minor myo‐ 0.6222 0.0002 inositol transporter Itr2p, member of the sugar transporter superfamily; expression is repressed by inositol and choline via Opi1p and derepressed via Ino2p and Ino4p PAN5 YHR063C 2‐dehydropantoate 2‐reductase, part of the pantothenic acid 0.6221 0.0008 pathway, structurally homologous to E. coli panE SPP2 YOR148C Essential protein that promotes the first step of splicing and is 0.6206 0.0008 required for the final stages of spliceosome maturation; interacts with Prp2p, which may release Spp2p from the spliceosome following the first cleavage reaction DAL3 YIR032C Ureidoglycolate hydrolase, converts ureidoglycolate to glyoxylate 0.6199 0.0009 and urea in the third step of allantoin degradation; expression sensitive to nitrogen catabolite repression

ERG25 YGR060W C‐4 methyl sterol oxidase, catalyzes the first of three steps required 0.6199 0.0007 to remove two C‐4 methyl groups from an intermediate in ergosterol biosynthesis; mutants accumulate the sterol intermediate 4,4‐dimethylzymosterol RDS3 YPR094W Component of the SF3b subcomplex of the U2 snRNP, zinc cluster 0.6197 0.0010 protein involved in pre‐mRNA splicing and cycloheximide resistance

MLC2 YPR188C Regulatory light chain for the type II myosin, Myo1p; binds to an IQ 0.6186 0.0005 motif of Myo1p, localization to the bud neck depends on Myo1p; involved in the disassembly of the Myo1p ring

CCS1 YMR038C Copper chaperone for superoxide dismutase Sod1p, involved in 0.6173 0.0003 oxidative stress protection; Met‐X‐Cys‐X2‐Cys motif within the N‐ terminal portion is involved in insertion of copper into Sod1p under conditions of copper deprivation PEX22 YAL055W Putative peroxisomal membrane protein required for import of 0.6138 0.0009 peroxisomal proteins, functionally complements a Pichia pastoris pex22 mutation NA YGL041C‐B Putative protein of unknown function; identified by fungal 0.6133 0.0009 homology and RT‐PCR NA YAL044W‐A Putative protein of unknown function; similar to S. pombe uvi31 0.6123 0.0003 which is a putative DNA repair protein CCT6 YDR188W Subunit of the cytosolic chaperonin Cct ring complex, related to 0.6099 0.0002 Tcp1p, essential protein that is required for the assembly of actin and tubulins in vivo; contains an ATP‐binding motif

MDJ1 YFL016C Co‐chaperone that stimulates the ATPase activity of the HSP70 0.6067 0.0003 protein Ssc1p; involved in protein folding/refolding in the mitochodrial matrix; required for proteolysis of misfolded proteins; member of the HSP40 (DnaJ) family of chaperones

249

log2(mtr1 Symbols ORF Description 0.Ts/WT.T adj.p.val s) TIP41 YPR040W Protein that interacts physically and genetically with Tap42p, which 0.6055 0.0004 regulates protein phosphatase 2A; component of the TOR (target of rapamycin) signaling pathway

PLP2 YOR281C Essential protein that interacts with the CCT (chaperonin containing 0.6055 0.0005 TCP‐1) complex to stimulate actin folding; has similarity to phosducins; null mutant lethality is complemented by mouse phosducin‐like protein MgcPhLP RGT2 YDL138W Plasma membrane high glucose sensor that regulates glucose 0.6055 0.0004 transport; contains 12 predicted transmembrane segments and a long C‐terminal tail required for induction of hexose transporters; highly similar to Snf3p ATP5 YDR298C Subunit 5 of the stator stalk of mitochondrial F1F0 ATP synthase, 0.6031 0.0007 which is an evolutionarily conserved enzyme complex required for ATP synthesis; homologous to bovine subunit OSCP (oligomycin sensitivity‐conferring protein); phosphorylated NUP53 YMR153W Subunit of the nuclear pore complex (NPC), interacts with 0.6016 0.0010 karyopherin Kap121p or with Nup170p via overlapping regions of Nup53p, involved in activation of the spindle checkpoint mediated by the Mad1p‐Mad2p complex REG1 YDR028C Regulatory subunit of type 1 protein phosphatase Glc7p, involved in 0.6004 0.0007 negative regulation of glucose‐repressible genes

RSM10 YDR041W Mitochondrial ribosomal protein of the small subunit, has similarity 0.6004 0.0006 to E. coli S10 ribosomal protein; essential for viability, unlike most other mitoribosomal proteins

250

APPENDIX K: Summary tables of functional catalogue analysis for affected transcripts in msn5Δ cells in fed or amino acid starvation conditions

This section includes four summary results of functional catalogue (FunCat) analysis of transcriptionally differentially expressed genes (cutoff conditions: log2 FC 0.6 or log2

FC 0.6 and adjusted p-value < 0.05) in msn5Δ cells in fed or amino acid starvation conditions. The FunCat analysis was executed in the website: http://mips.helmholtz- muenchen.de/proj/funcatDB/ (Ruepp et al., 2004)

Table K. 1. FunCat analysis of down-regulated transcripts in msn5Δ cells in fed condition. numbers FUNCTIONAL CATALOGUE of gene p-value matches phospholipid metabolism 4 0.04032 mitotic cell cycle 7 0.037809 RNA synthesis 20 0.016061 mRNA synthesis 20 0.005821 transcriptional control 20 0.000976 transcription activation 3 0.045394 transcription repression 3 0.015685 REGULATION OF METABOLISM AND PROTEIN FUNCTION 10 0.022164 regulation of protein activity 9 0.040119 enzymatic activity regulation / enzyme regulator 8 0.021278 CELLULAR COMMUNICATION/SIGNAL TRANSDUCTION MECHANISM 9 0.034185 G‐protein mediated signal transduction 5 0.009891 small GTPase mediated signal transduction 4 0.024253 251 continued

Table. K. 1. continued numbers FUNCTIONAL CATALOGUE of gene p-value matches transmembrane signal transduction 5 0.001254 non‐enzymatic receptor mediated signalling 2 0.007125 G‐protein coupled receptor signalling pathway 2 0.007125 catalase reaction 1 0.037812 INTERACTION WITH THE ENVIRONMENT 25 1.39E‐06 cellular sensing and response to external stimulus 22 1.27E‐08 chemoperception and response 20 1.86E‐08 pheromone response, mating‐type determination, sex‐specific proteins 16 4.63E‐07 CELL FATE 11 0.014673 cell growth / morphogenesis 11 0.005503 growth regulators / regulation of cell size 3 0.001315 DEVELOPMENT (Systemic) 11 5.48E‐08 fungal/microorganismic development 11 5.48E‐08 mating (fertilization) 11 5.48E‐08 cytoskeleton/structural proteins 9 0.050802 centrosome 1 0.037812 CELL TYPE DIFFERENTIATION 19 0.000824 fungal/microorganismic cell type differentiation 19 0.000824 fungal and other eukaryotic cell type differentiation 19 0.000824 budding, cell polarity and filament formation 14 0.002384 hyphae formation 1 0.037812 UNCLASSIFIED PROTEINS 18 0.982084

Table K. 2. Up-regulated transcripts in msn5Δ cells in fed condition. numbers FUNCTIONAL CATALOGUE of gene p-value matches METABOLISM 64 0.000215 assimilation of ammonia, metabolism of the glutamate group 4 0.043414 metabolism of proline 2 0.015316 metabolism of arginine 3 0.020528 degradation of arginine 3 2.25E‐05 metabolism of urea cycle, creatine and polyamines 4 0.00067 metabolism of urea (urea cycle) 3 0.000422 nitrogen, sulfur and selenium metabolism 9 0.001626 nitrogen metabolism 3 0.000723 catabolism of nitrogenous compounds 3 0.000723 urea catabolism (not urea cycle) 1 0.028385 phosphate metabolism 20 0.014327 C‐compound and carbohydrate metabolism 34 1.33E‐06 252 continued.

Table K. 2. continued. numbers FUNCTIONAL CATALOGUE of gene p-value matches sugar, glucoside, polyol and carboxylate metabolism 9 0.000438 sugar, glucoside, polyol and carboxylate anabolism 5 0.00283 sugar, glucoside, polyol and carboxylate catabolism 8 0.00168 glycogen metabolism 2 0.007572 glycogen anabolism 2 0.007572 regulation of C‐compound and carbohydrate metabolism 8 0.027488 ENERGY 31 2.74E‐08 glycolysis and gluconeogenesis 6 0.006218 regulation of glycolysis and gluconeogenesis 3 0.015587 electron transport and membrane‐associated energy conservation 8 0.000292 respiration 11 0.001774 aerobic respiration 6 0.021576 metabolism of energy reserves (e.g. glycogen, trehalose) 10 3.02E‐06 lysosomal and vacuolar protein degradation 3 0.036207 vacuolar protein degradation 2 0.037236 biotin binding 1 0.028385 transported compounds (substrates) 28 0.003816 anion transport 3 0.036207 phosphate transport 3 0.003135 C‐compound and carbohydrate transport 10 9.11E‐06 20.01.03.01 sugar transport 5 0.001188 20.01.07 amino acid/amino acid derivatives transport 4 0.037865 20.01.15 electron transport 8 0.002307 20.03.02 carrier (electrochemical potential‐driven transport) 6 6.71E‐06 20.03.02.02 symporter 3 8.81E‐05 20.03.02.02.01 proton driven symporter 2 0.002359 20.03.02.02.02 sodium driven symporter 1 0.028385 20.03.02.03 antiporter 3 0.006496 32.01.01 oxidative stress response 5 0.019263 32.07.07 oxygen and radical detoxification 3 0.036207 32.07.07.05 peroxidase reaction 2 0.015316 34.01.03.03 homeostasis of phosphate 2 0.025294 42.25 vacuole or lysosome 5 0.007713 99 UNCLASSIFIED PROTEINS 55 0.003908

253

Table K. 3. FunCat analysis of down-regulated transcripts in msn5Δ cells in amino acid starvation condition. numbers FUNCTIONAL CATALOGUE of gene p-value matches 10.03 cell cycle 43 0.001358 10.03.01 mitotic cell cycle and cell cycle control 28 0.018237 10.03.02 meiosis 13 0.016221 10.03.02.01 meiosis I 3 0.014924 10.03.05 cell cycle dependent cytoskeleton reorganization 6 0.015233 10.03.05.01 spindle pole body/centrosome and microtubule cycle 6 0.007273 18 REGULATION OF METABOLISM AND PROTEIN FUNCTION 19 0.008736 18.02 regulation of protein activity 16 0.042612 18.02.01 enzymatic activity regulation / enzyme regulator 13 0.036475 18.02.05 regulator of G‐protein signalling 3 0.022331 20.01.17 nucleotide/nucleoside/nucleobase transport 4 0.008366 20.01.23 allantoin and allantoate transport 3 0.00341 20.01.27 drug/toxin transport 6 0.005018 20.03 transport facilities 17 0.003107 20.03.25 ABC transporters 7 0.000111 30 CELLULAR COMMUNICATION/SIGNAL TRANSDUCTION MECHANISM 19 0.003804 30.01.05 enzyme mediated signal transduction 11 0.022151 30.01.05.05 G‐protein mediated signal transduction 7 0.023786 30.01.05.05.01 small GTPase mediated signal transduction 6 0.032409 30.05 transmembrane signal transduction 10 7.40E‐06 30.05.02 non‐enzymatic receptor mediated signalling 3 0.002199 30.05.02.24 G‐protein coupled receptor signalling pathway 3 0.002199 34 INTERACTION WITH THE ENVIRONMENT 40 5.59E‐06 34.11 cellular sensing and response to external stimulus 35 4.22E‐09 34.11.03 chemoperception and response 33 7.20E‐10 34.11.03.07 pheromone response, mating‐type determination, sex‐specific proteins 30 1.30E‐10 41 DEVELOPMENT (Systemic) 18 1.97E‐10 41.01 fungal/microorganismic development 18 1.97E‐10 41.01.01 mating (fertilization) 18 1.97E‐10 42.04.05 microtubule cytoskeleton 7 0.002998 43 CELL TYPE DIFFERENTIATION 43 1.64E‐07 43.01 fungal/microorganismic cell type differentiation 43 1.64E‐07 43.01.03 fungal and other eukaryotic cell type differentiation 43 1.64E‐07 43.01.03.05 budding, cell polarity and filament formation 26 0.00052 43.01.03.09 development of asco‐ basidio‐ or zygospore 17 0.00053 99 UNCLASSIFIED PROTEINS 50 0.902999

254

Table K. 4. FunCat analysis of up-regulated transcripts in msn5Δ cells in amino acid starvation condition. numbers FUNCTIONAL CATALOGUE of gene p-value matches degradation of arginine 2 0.002838 degradation of serine 1 0.031158 nitrogen metabolism 2 0.018292 catabolism of nitrogenous compounds 2 0.018292 ENERGY 23 0.000962 electron transport and membrane‐associated energy conservation 6 0.011323 respiration 12 0.001161 aerobic respiration 6 0.032216 protein folding and stabilization 8 0.008134 enzyme inhibitor 5 0.004229 protease inhibitor 2 0.009077 anion transport 3 0.04575 phosphate transport 3 0.004084 C‐compound and carbohydrate transport 5 0.045681 electron transport 6 0.044096 carrier (electrochemical potential‐driven transport) 4 0.001983 symporter 2 0.00556 CELL RESCUE, DEFENSE AND VIRULENCE 25 0.036729 stress response 23 0.012182 oxidative stress response 8 0.000266 oxygen and radical detoxification 4 0.007976 peroxidase reaction 2 0.018292 homeostasis of anions 3 0.010274 homeostasis of phosphate 3 0.002177 vacuole or lysosome 7 0.000368 UNCLASSIFIED PROTEINS 61 0.001865

255

APPENDIX L: Down-regulated genes in msn5Δ cells in fed condition

This section includes the list of transcriptionally differentially expressed genes (cutoff

conditions: log2 FC 0.6 and adjusted p-value < 0.05) in msn5Δ cells in fed condition.

Down-regulated genes in msn5Δ cells in fed condition

log2(msn5 adj.p. Symbols ORF Description .Tf/WT.Tf) val MSN5 YDR335W Karyopherin involved in nuclear import and export of proteins, ‐7.1037 0.0000 including import of replication protein A and export of Swi6p, Far1p, and Pho4p; required for re‐export of mature tRNAs after their retrograde import from the cytoplasm HUG1 YML058W‐A Protein involved in the Mec1p‐mediated checkpoint pathway that ‐2.4244 0.0013 responds to DNA damage or replication arrest, transcription is induced by DNA damage PRM1 YNL279W Pheromone‐regulated multispanning membrane protein involved in ‐2.2513 0.0000 membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p FIG1 YBR040W Integral membrane protein required for efficient mating; may ‐2.2108 0.0085 participate in or regulate the low affinity Ca2+ influx system, which affects intracellular signaling and cell‐cell fusion during mating

DAN1 YJR150C Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and Tir4p; ‐2.1252 0.0041 expressed under anaerobic conditions, completely repressed during aerobic growth PRM6 YML047C Pheromone‐regulated protein, predicted to have 2 transmembrane ‐2.0349 0.0150 segments; regulated by Ste12p during mating

FUS1 YCL027W Membrane protein localized to the shmoo tip, required for cell fusion; ‐1.7866 0.0014 expression regulated by mating pheromone; proposed to coordinate signaling, fusion, and polarization events required for fusion; potential Cdc28p substrate WSC4 YHL028W ER membrane protein involved in the translocation of soluble ‐1.6054 0.0162 secretory proteins and insertion of membrane proteins into the ER membrane; may also have a role in the stress response but has only partial functional overlap with WSC1‐3

256

log2(msn5 adj.p. Symbols ORF Description .Tf/WT.Tf) val IMD1 YAR073W Nonfunctional protein with homology to IMP dehydrogenase; ‐1.5849 0.0096 probable pseudogene, located close to the telomere; is not expressed at detectable levels; YAR073W and YAR075W comprise a continuous reading frame in some strains of S. cerevisiae HO YDL227C Site‐specific endonuclease required for gene conversion at the MAT ‐1.5549 0.0032 locus (homothallic switching) through the generation of a ds DNA break; expression restricted to mother cells in late G1 as controlled by Swi4p‐Swi6p, Swi5p and Ash1p AGA1 YNR044W Anchorage subunit of a‐agglutinin of a‐cells, highly O‐glycosylated ‐1.5162 0.0013 protein with N‐terminal secretion signal and C‐terminal signal for addition of GPI anchor to cell wall, linked to adhesion subunit Aga2p via two disulfide bonds MF(ALPHA YGL089C Mating pheromone alpha‐factor, made by alpha cells; interacts with ‐1.4937 0.0045 )2 mating type a cells to induce cell cycle arrest and other responses leading to mating; also encoded by MF(ALPHA)1, which is more highly expressed than MF(ALPHA)2 NA YAR066W Putative GPI protein ‐1.4805 0.0017 TIR1 YER011W Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐ ‐1.4492 0.0015 rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking NA YIL082W‐A Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as ‐1.3888 0.0005 one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes NA YDR222W Protein of unknown function; green fluorescent protein (GFP)‐fusion ‐1.3702 0.0276 protein localizes to the cytoplasm in a punctate pattern PLB2 YMR006C Phospholipase B (lysophospholipase) involved in phospholipid ‐1.3209 0.0026 metabolism; displays transacylase activity in vitro; overproduction confers resistance to lysophosphatidylcholine NA YLR042C Protein of unknown function; localizes to the cytoplasm; YLL042C is ‐1.3205 0.0015 not an essential gene STR3 YGL184C Peroxisomal cystathionine beta‐lyase, converts cystathionine into ‐1.3066 0.0341 homocysteine; may be redox regulated by Gto1p SRO77 YBL106C Protein with roles in exocytosis and cation homeostasis; functions in ‐1.2967 0.0219 docking and fusion of post‐Golgi vesicles with plasma membrane; homolog of Sro7p and Drosophila lethal giant larvae tumor suppressor; interacts with SNARE protein Sec9p PPM2 YOL141W AdoMet‐dependent tRNA methyltransferase also involved in ‐1.2951 0.0029 methoxycarbonylation; required for the synthesis of wybutosine (yW), a modified guanosine found at the 3'‐position adjacent to the anticodon of phe‐tRNA; similarity to Ppm1p PRM2 YIL037C Pheromone‐regulated protein, predicted to have 4 transmembrane ‐1.2774 0.0231 segments and a coiled coil domain; regulated by Ste12p; required for efficient nuclear fusion SST2 YLR452C GTPase‐activating protein for Gpa1p, regulates desensitization to ‐1.1922 0.0015 alpha factor pheromone; also required to prevent receptor‐ independent signaling of the mating pathway; member of the RGS (regulator of G‐protein signaling) family SFG1 YOR315W Nuclear protein, putative transcription factor required for growth of ‐1.1781 0.0159 superficial pseudohyphae (which do not invade the agar substrate) but not for invasive pseudohyphal growth; may act together with Phd1p; potential Cdc28p substrate

257

log2(msn5 adj.p. Symbols ORF Description .Tf/WT.Tf) val IMD2 YHR216W Inosine monophosphate dehydrogenase, catalyzes the rate‐limiting ‐1.1711 0.0031 step in GTP biosynthesis, expression is induced by mycophenolic acid resulting in resistance to the drug, expression is repressed by nutrient limitatio SAG1 YJR004C Alpha‐agglutinin of alpha‐cells, binds to Aga1p during agglutination, N‐ ‐1.1666 0.0009 terminal half is homologous to the immunoglobulin superfamily and contains binding site for a‐agglutinin, C‐terminal half is highly glycosylated and contains GPI anchor CRR1 YLR213C Putative glycoside hydrolase of the spore wall envelope; required for ‐1.1315 0.0171 normal spore wall assembly, possibly for cross‐linking between the glucan and chitosan layers; expressed during sporulation RIM9 YMR063W Protein of unknown function, involved in the proteolytic activation of ‐1.1261 0.0253 Rim101p in response to alkaline pH; has similarity to A. nidulans PalI; putative membrane protein NA YCR101C Putative protein of unknown function; localizes to the membrane ‐1.1227 0.0171 fraction; YCR101C is not an essential gene PCL1 YNL289W Cyclin, interacts with cyclin‐dependent kinase Pho85p; member of the ‐1.1030 0.0109 Pcl1,2‐like subfamily, involved in the regulation of polarized growth and morphogenesis and progression through the cell cycle; localizes to sites of polarized cell growth NA YHL018W Putative protein of unknown function; green fluorescent protein ‐1.0830 0.0191 (GFP)‐fusion protein localizes to mitochondria and is induced in response to the DNA‐damaging agent MMS SVS1 YPL163C Cell wall and vacuolar protein, required for wild‐type resistance to ‐1.0814 0.0113 vanadate SPS1 YDR523C Putative protein serine/threonine kinase expressed at the end of ‐1.0764 0.0392 meiosis and localized to the prospore membrane, required for correct localization of enzymes involved in spore wall synthesis CLN1 YMR199W G1 cyclin involved in regulation of the cell cycle; activates Cdc28p ‐1.0744 0.0017 kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐ Mbp1p) and SBF (Swi6p‐Swi4p) CLB2 YPR119W B‐type cyclin involved in cell cycle progression; activates Cdc28p to ‐1.0713 0.0109 promote the transition from G2 to M phase; accumulates during G2 and M, then targeted via a destruction box motif for ubiquitin‐ mediated degradation by the proteasome RPI1 YIL119C Putative transcriptional regulator; overexpression suppresses the heat ‐1.0693 0.0489 shock sensitivity of wild‐type RAS2 overexpression and also suppresses the cell lysis defect of an mpk1 mutation SPC24 YMR117C Component of the evolutionarily conserved kinetochore‐associated ‐1.0451 0.0139 Ndc80 complex (Ndc80p‐Nuf2p‐Spc24p‐Spc25p); involved in chromosome segregation, spindle checkpoint activity and kinetochore clustering YHP1 YDR451C One of two homeobox transcriptional repressors (see also Yox1p), that ‐1.0427 0.0077 bind to Mcm1p and to early cell cycle box (ECB) elements of cell cycle regulated genes, thereby restricting ECB‐mediated transcription to the M/G1 interval FAR1 YJL157C Cyclin‐dependent kinase inhibitor that mediates cell cycle arrest in ‐1.0374 0.0013 response to pheromone; also forms a complex with Cdc24p, Ste4p, and Ste18p that may specify the direction of polarized growth during mating; potential Cdc28p substrate

258

log2(msn5 adj.p. Symbols ORF Description .Tf/WT.Tf) val CSI2 YOL007C Protein of unknown function; green fluorescent protein (GFP)‐ fusion ‐1.0200 0.0026 protein localizes to the mother side of the bud neck and the vacuole; YOL007C is not an essential gene HES1 YOR237W Protein implicated in the regulation of ergosterol biosynthesis; one of ‐1.0063 0.0054 a seven member gene family with a common essential function and non‐essential unique functions; similar to human oxysterol binding protein (OSBP) GPI19 YDR437W Subunit of GPI‐GlcNAc transferase involved in synthesis of N‐ ‐0.9955 0.0034 acetylglucosaminyl phosphatidylinositol (GlcNAc‐PI), which is the first intermediate in glycosylphosphatidylinositol (GPI) anchor synthesis, shares similarity with mammalian PIG‐P PDR15 YDR406W Plasma membrane ATP binding cassette (ABC) transporter, multidrug ‐0.9730 0.0026 transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element NRM1 YNR009W Transcriptional co‐repressor of MBF (MCB binding factor)‐regulated ‐0.9644 0.0032 gene expression; Nrm1p associates stably with promoters via MBF to repress transcription upon exit from G1 phase RTC4 YNL254C Protein of unknown function; null mutation suppresses cdc13‐1 ‐0.9440 0.0029 temperature sensitivity; (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus STE3 YKL178C Receptor for a factor pheromone, couples to MAP kinase cascade to ‐0.9394 0.0013 mediate pheromone response; transcribed in alpha cells and required for mating by alpha cells, ligand bound receptors endocytosed and recycled to the plasma membrane; GPCR AQY1 YPR192W Spore‐specific water channel that mediates the transport of water ‐0.9382 0.0116 across cell membranes, developmentally controlled; may play a role in spore maturation, probably by allowing water outflow, may be involved in freeze tolerance NA YGR035C Putative protein of unknown function, potential Cdc28p substrate; ‐0.9278 0.0130 transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance FRE8 YLR047C Protein with sequence similarity to iron/copper reductases, involved in ‐0.9271 0.0091 iron homeostasis; deletion mutant has iron deficiency/accumulation growth defects; expression increased in the absence of copper‐ responsive transcription factor Mac1p NA YGR109W‐B Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as ‐0.9258 0.0034 one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes PET122 YER153C Mitochondrial translational activator specific for the COX3 mRNA, acts ‐0.9248 0.0159 together with Pet54p and Pet494p; located in the mitochondrial inner membrane NA YAR068W Fungal‐specific protein of unknown function; induced in respiratory‐ ‐0.9239 0.0221 deficient cells LRG1 YDL240W Putative GTPase‐activating protein (GAP) involved in the Pkc1p‐ ‐0.9226 0.0023 mediated signaling pathway that controls cell wall integrity; appears to specifically regulate 1,3‐beta‐glucan synthesis FMP45 YDL222C Integral membrane protein localized to mitochondria (untagged ‐0.9193 0.0109 protein); required for sporulation and maintaining sphingolipid content; has sequence similarity to SUR7 and YNL194C

259

log2(msn5 adj.p. Symbols ORF Description .Tf/WT.Tf) val BTN2 YGR142W v‐SNARE binding protein that facilitates specific protein retrieval from ‐0.9012 0.0050 a late endosome to the Golgi; modulates arginine uptake, possible role in mediating pH homeostasis between the vacuole and plasma membrane H(+)‐ATPase SAE2 YGL175C Endonuclease that processes hairpin DNA structures with the MRX ‐0.8847 0.0096 complex; involved in meiotic and mitotic double‐strand break repair; phosphorylated in response to DNA damage and required for normal resistance to DNA‐damaging agents YOX1 YML027W Homeodomain‐containing transcriptional repressor, binds to Mcm1p ‐0.8839 0.0355 and to early cell cycle boxes (ECBs) in the promoters of cell cycle‐ regulated genes expressed in M/G1 phase; expression is cell cycle‐ regulated; potential Cdc28p substrate CLN2 YPL256C G1 cyclin involved in regulation of the cell cycle; activates Cdc28p ‐0.8757 0.0068 kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐ Mbp1p) and SBF (Swi6p‐Swi4p) NA NA NA ‐0.8703 0.0148 NA NA NA ‐0.8682 0.0170 PTH1 YHR189W One of two (see also PTH2) mitochondrially‐localized peptidyl‐tRNA ‐0.8578 0.0495 hydrolases; dispensable for respiratory growth on rich medium, but required for respiratory growth on minimal medium CLB6 YGR109C B‐type cyclin involved in DNA replication during S phase; activates ‐0.8495 0.0144 Cdc28p to promote initiation of DNA synthesis; functions in formation of mitotic spindles along with Clb3p and Clb4p; most abundant during late G1 NA YDR124W Putative protein of unknown function; non‐essential gene; expression ‐0.8480 0.0187 is strongly induced by alpha factor GIC1 YHR061C Protein of unknown function involved in initiation of budding and ‐0.8437 0.0183 cellular polarization, interacts with Cdc42p via the Cdc42/Rac‐ interactive binding (CRIB) domain OPT1 YJL212C Proton‐coupled oligopeptide transporter of the plasma membrane; ‐0.8396 0.0456 also transports glutathione and phytochelatin; member of the OPT family SFK1 YKL051W Plasma membrane protein that may act together with or upstream of ‐0.8301 0.0308 Stt4p to generate normal levels of the essential phospholipid PI4P, at least partially mediates proper localization of Stt4p to the plasma membrane PLM2 YDR501W Forkhead Associated domain containing protein and putative ‐0.8251 0.0057 transcription factor found associated with chromatin; target of SBF transcription factor; induced in response to DNA damaging agents and deletion of telomerase; similar to TOS4 DCI1 YOR180C Peroxisomal protein; identification as a delta(3,5)‐delta(2,4)‐dienoyl‐ ‐0.8201 0.0242 CoA isomerase involved in fatty acid metabolism is disputed CIN8 YEL061C Kinesin motor protein involved in mitotic spindle assembly and ‐0.8094 0.0143 chromosome segregation YJU2 YKL095W Essential protein required for pre‐mRNA splicing; associates transiently ‐0.7977 0.0162 with the spliceosomal NTC ("nineteen complex") and acts after Prp2p to promote the first catalytic reaction of splicing PMA2 YPL036W Plasma membrane H+‐ATPase, isoform of Pma1p, involved in pumping ‐0.7944 0.0221 protons out of the cell; regulator of cytoplasmic pH and plasma membrane potential DED1 YOR204W ATP‐dependent DEAD (Asp‐Glu‐Ala‐Asp)‐box RNA helicase, required ‐0.7753 0.0126 for translation initiation of all yeast mRNAs; mutations in human DEAD‐box DBY are a frequent cause of male infertility 260

log2(msn5 adj.p. Symbols ORF Description .Tf/WT.Tf) val NA YDL109C Putative lipase; involved in lipid metabolism; YDL109C is not an ‐0.7744 0.0057 essential gene NA YCL021W‐A Putative protein of unknown function ‐0.7739 0.0141 NBL1 YHR199C‐A Subunit of the conserved chromosomal passenger complex (CPC; ‐0.7731 0.0206 Ipl1p‐Sli15p‐Bir1p‐Nbl1p), which regulates mitotic chromosome segregation; not required for the kinase activity of the complex; mediates the interaction of Sli15p and Bir1p STE12 YHR084W Transcription factor that is activated by a MAP kinase signaling ‐0.7682 0.0054 cascade, activates genes involved in mating or pseudohyphal/invasive growth pathways; cooperates with Tec1p transcription factor to regulate genes specific for invasive growth SFL1 YOR140W Transcriptional repressor and activator; involved in repression of ‐0.7648 0.0144 flocculation‐related genes, and activation of stress responsive genes; negatively regulated by cAMP‐dependent protein kinase A subunit Tpk2p NRT1 YOR071C High‐affinity nicotinamide riboside transporter; also transports ‐0.7616 0.0191 thiamine with low affinity; shares sequence similarity with Thi7p and Thi72p; proposed to be involved in 5‐fluorocytosine sensitivity RTG1 YOL067C Transcription factor (bHLH) involved in interorganelle communication ‐0.7588 0.0122 between mitochondria, peroxisomes, and nucleus GEM1 YAL048C Evolutionarily‐conserved tail‐anchored outer mitochondrial membrane ‐0.7553 0.0175 GTPase which regulates mitochondrial morphology; cells lacking Gem1p contain collapsed, globular, or grape‐like mitochondria; not required for pheromone‐induced cell death CTA1 YDR256C Catalase A, breaks down hydrogen peroxide in the peroxisomal matrix ‐0.7546 0.0186 formed by acyl‐CoA oxidase (Pox1p) during fatty acid beta‐oxidation FHL1 YPR104C Regulator of ribosomal protein transcription; has forkhead associated ‐0.7505 0.0054 domain that binds phosphorylated proteins; also has forkhead DNA‐ binding domain but does not bind DNA in vitro; suppresses RNA pol III and splicing factor prp4 mutants WHI5 YOR083W Repressor of G1 transcription that binds to SCB binding factor (SBF) at ‐0.7453 0.0276 SCB target promoters in early G1; phosphorylation of Whi5p by the CDK, Cln3p/Cdc28p relieves repression and promoter binding by Whi5; periodically expressed in G1 NA YCR100C Putative protein of unknown function ‐0.7411 0.0269 TOS2 YGR221C Protein involved in localization of Cdc24p to the site of bud growth; ‐0.7389 0.0033 may act as a membrane anchor; localizes to the bud neck and bud tip; potentially phosphorylated by Cdc28p PRM3 YPL192C Pheromone‐regulated protein required for nuclear envelope fusion ‐0.7386 0.0116 during karyogamy; localizes to the outer face of the nuclear membrane; interacts with Kar5p at the spindle pole body YHK8 YHR048W Presumed antiporter of the DHA1 family of multidrug resistance ‐0.7354 0.0168 transporters; contains 12 predicted transmembrane spans; expression of gene is up‐regulated in cells exhibiting reduced susceptibility to azoles DFG10 YIL049W Protein of unknown function, involved in filamentous growth ‐0.7329 0.0029 NA YNR063W Putative zinc‐cluster protein of unknown function ‐0.7263 0.0316 INO2 YDR123C Component of the heteromeric Ino2p/Ino4p basic helix‐loop‐helix ‐0.7210 0.0308 transcription activator that binds inositol/choline‐responsive elements (ICREs), required for derepression of phospholipid biosynthetic genes in response to inositol depletion NA YOL014W Putative protein of unknown function ‐0.7177 0.0328

261

log2(msn5 adj.p. Symbols ORF Description .Tf/WT.Tf) val PDR11 YIL013C ATP‐binding cassette (ABC) transporter, multidrug transporter ‐0.7172 0.0105 involved in multiple drug resistance; mediates sterol uptake when sterol biosynthesis is compromisedregulated by Pdr1p; required for anaerobic growth YAP7 YOL028C Putative basic leucine zipper (bZIP) transcription factor ‐0.7075 0.0483 MUP1 YGR055W High affinity methionine permease, integral membrane protein with ‐0.7045 0.0339 13 putative membrane‐spanning regions; also involved in cysteine uptake FIG2 YCR089W Cell wall adhesin, expressed specifically during mating; may be ‐0.6983 0.0041 involved in maintenance of cell wall integrity during mating PHO4 YFR034C Basic helix‐loop‐helix (bHLH) transcription factor of the myc‐family; ‐0.6959 0.0171 binds cooperatively with Pho2p to the PHO5 promoter; function is regulated by phosphorylation at multiple sites and by phosphate availability RIM4 YHL024W Putative RNA‐binding protein required for the expression of early and ‐0.6924 0.0452 middle sporulation genes TKL2 YBR117C Transketolase, similar to Tkl1p; catalyzes conversion of xylulose‐5‐ ‐0.6871 0.0044 phosphate and ribose‐5‐phosphate to sedoheptulose‐7‐phosphate and glyceraldehyde‐3‐phosphate in the pentose phosphate pathway; needed for synthesis of aromatic amino acids SRB8 YCR081W Subunit of the RNA polymerase II mediator complex; associates with ‐0.6858 0.0072 core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; involved in glucose repression IZH1 YDR492W Membrane protein involved in zinc ion homeostasis, member of the ‐0.6721 0.0241 four‐protein IZH family; transcription is regulated directly by Zap1p, expression induced by zinc deficiency and fatty acids; deletion increases sensitivity to elevated zinc SCW11 YGL028C Cell wall protein with similarity to glucanases; may play a role in ‐0.6677 0.0241 conjugation during mating based on its regulation by Ste12p AIM20 YIL158W Putative protein of unknown function; overexpression causes a cell ‐0.6643 0.0066 cycle delay or arrest; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole; null mutant displays elevated frequency of mitochondrial genome loss WHI3 YNL197C RNA binding protein that sequesters CLN3 mRNA in cytoplasmic foci; ‐0.6550 0.0356 cytoplasmic retention factor for Cdc28p and associated cyclins; regulates cell fate and dose‐dependently regulates the critical cell size required for passage through Start TOS6 YNL300W Glycosylphosphatidylinositol‐dependent cell wall protein, expression is ‐0.6550 0.0223 periodic and decreases in respone to ergosterol perturbation or upon entry into stationary phase; depletion increases resistance to lactic acid TEC1 YBR083W Transcription factor required for full Ty1 expression, Ty1‐mediated ‐0.6480 0.0051 gene activation, and haploid invasive and diploid pseudohyphal growth; TEA/ATTS DNA‐binding domain family member JJJ2 YJL162C Protein of unknown function, contains a J‐domain, which is a region ‐0.6452 0.0200 with homology to the E. coli DnaJ protein MSB2 YGR014W Mucin family member involved in the Cdc42p‐ and MAP kinase‐ ‐0.6385 0.0123 dependent filamentous growth signaling pathway; also functions as an osmosensor in parallel to the Sho1p‐mediated pathway; potential Cdc28p substrate ATF2 YGR177C Alcohol acetyltransferase, may play a role in steroid detoxification; ‐0.6337 0.0266 forms volatile esters during fermentation, which is important for brewing and winemaking

262

log2(msn5 adj.p. Symbols ORF Description .Tf/WT.Tf) val NDD1 YOR372C Transcriptional activator essential for nuclear division; localized to the ‐0.6298 0.0242 nucleus; essential component of the mechanism that activates the expression of a set of late‐S‐phase‐specific genes HPR1 YDR138W Subunit of THO/TREX complexes that couple transcription elongation ‐0.6239 0.0036 with mitotic recombination and with mRNA metabolism and export, subunit of an RNA Pol II complex; regulates lifespan; involved in telomere maintenance; similar to Top1p FRK1 YPL141C Putative protein kinase; similar to Kin4p; green fluorescent protein ‐0.6223 0.0209 (GFP)‐fusion protein localizes to the cytoplasm; interacts with rRNA transcription and ribosome biogenesis factors and the long chain fatty acyl‐CoA synthetase Faa3 NA YLL066W‐B Putative protein of unknown function; overexpression causes a cell ‐0.6210 0.0065 cycle delay or arrest SFP1 YLR403W Transcription factor that controls expression of ribosome biogenesis ‐0.6205 0.0483 genes in response to nutrients and stress, regulates G2/M transitions during mitotic cell cycle and DNA‐damage response, modulates cell size; regulated by TORC1 and Mrs6p ADH4 YGL256W Alcohol dehydrogenase isoenzyme type IV, dimeric enzyme ‐0.6147 0.0108 demonstrated to be zinc‐dependent despite sequence similarity to iron‐activated alcohol dehydrogenases; transcription is induced in response to zinc deficiency RAX2 YLR084C N‐glycosylated protein involved in the maintenance of bud site ‐0.6133 0.0188 selection during bipolar budding; localization requires Rax1p; RAX2 mRNA stability is regulated by Mpt5p STB5 YHR178W Transcription factor, involved in regulating multidrug resistance and ‐0.6112 0.0089 oxidative stress response; forms a heterodimer with Pdr1p; contains a Zn(II)2Cys6 zinc finger domain that interacts with a pleiotropic drug resistance element in vitro KAR5 YMR065W Protein required for nuclear membrane fusion during karyogamy, ‐0.6068 0.0060 localizes to the membrane with a soluble portion in the endoplasmic reticulum lumen, may form a complex with Jem1p and Kar2p; expression of the gene is regulated by pheromone VBA2 YBR293W Permease of basic amino acids in the vacuolar membrane ‐0.6052 0.0231 NA YJL107C Putative protein of unknown function; expression is induced by ‐0.6049 0.0171 activation of the HOG1 mitogen‐activated signaling pathway and this induction is Hog1p/Pbs2p dependent; YJL107C and adjacent ORF, YJL108C are merged in related fungi

263

APPENDIX M: Up-regulated genes in msn5Δ cells in fed condition

This section includes the list of transcriptionally differentially expressed genes (cutoff conditions: log2 FC 0.6 and adjusted p-value < 0.05) in msn5Δ cells in fed condition.

Up-regulated genes in msn5Δ cells in fed condition

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al PHO84 YML123C High‐affinity inorganic phosphate (Pi) transporter and low‐affinity 6.5678 0.0000 manganese transporter; regulated by Pho4p and Spt7p; mutation confers resistance to arsenate; exit from the ER during maturation requires Pho86p SPL2 YHR136C Protein with similarity to cyclin‐dependent kinase inhibitors; 5.1812 0.0000 downregulates low‐affinity phosphate transport during phosphate limitation; overproduction suppresses a plc1 null mutation; GFP‐ fusion protein localizes to the cytoplasm PHO89 YBR296C Na+/Pi cotransporter, active in early growth phase; similar to 2.7683 0.0065 phosphate transporters of Neurospora crassa; transcription regulated by inorganic phosphate concentrations and Pho4p PHO11 YAR071W One of three repressible acid phosphatases, a glycoprotein that is 2.5966 0.0026 transported to the cell surface by the secretory pathway; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2

PHM6 YDR281C Protein of unknown function, expression is regulated by phosphate 2.3875 0.0109 levels PHO5 YBR093C Repressible acid phosphatase (1 of 3) that also mediates extracellular 2.3445 0.0014 nucleotide‐derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2 VTC3 YPL019C Subunit of the vacuolar transporter chaperone (VTC) complex 2.3172 0.0005 involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion

CYC7 YEL039C Cytochrome c isoform 2, expressed under hypoxic conditions; 1.8015 0.0071 electron carrier of the mitochondrial intermembrane space that transfers electrons from ubiquinone‐cytochrome c oxidoreductase to cytochrome c oxidase during cellular respiration NA YLR312C Putative protein of unknown function 1.7179 0.0028 MTH1 YDR277C Negative regulator of the glucose‐sensing signal transduction 1.6946 0.0015 pathway, required for repression of transcription by Rgt1p; interacts with Rgt1p and the Snf3p and Rgt2p glucose sensors; phosphorylated by Yck1p, triggering Mth1p degradation

264

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al CYB2 YML054C Cytochrome b2 (L‐lactate cytochrome‐c oxidoreductase), component 1.5974 0.0004 of the mitochondrial intermembrane space, required for lactate utilization; expression is repressed by glucose and anaerobic conditions NA YFR017C Putative protein of unknown function; green fluorescent protein 1.5519 0.0005 (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS; YFR017C is not an essential gene NA YGL262W Putative protein of unknown function; null mutant displays elevated 1.5464 0.0219 sensitivity to expression of a mutant huntingtin fragment or of alpha‐ synuclein; YGL262W is not an essential gene

SOL4 YGR248W 6‐phosphogluconolactonase with similarity to Sol3p 1.5294 0.0170 NA YHR214C‐E Putative protein of unknown function; identified by gene‐trapping, 1.4988 0.0110 microarray‐based expression analysis, and genome‐wide homology searching CRC1 YOR100C Mitochondrial inner membrane carnitine transporter, required for 1.4600 0.0016 carnitine‐dependent transport of acetyl‐CoA from peroxisomes to mitochondria during fatty acid beta‐oxidation

DCS2 YOR173W Non‐essential, stress induced regulatory protein; modulates m7G‐ 1.4014 0.0026 oligoribonucleotide metabolism; inhibits Dcs1p; regulated by Msn2p, Msn4p, and the Ras‐cAMP‐cAPK signaling pathway; mutant has increased aneuploidy tolerance GPM2 YDL021W Homolog of Gpm1p phosphoglycerate mutase, which converts 3‐ 1.4000 0.0002 phosphoglycerate to 2‐phosphoglycerate in glycolysis; may be non‐ functional derivative of a gene duplication event

NA YMR090W Putative protein of unknown function with similarity to DTDP‐glucose 1.3741 0.0022 4,6‐dehydratases; GFP‐fusion protein localizes to the cytoplasm; up‐ regulated in response to the fungicide mancozeb; not essential for viability NA YDR018C Probable membrane protein with three predicted transmembrane 1.3658 0.0013 domains; homologous to Ybr042cp, similar to C. elegans F55A11.5 and maize 1‐acyl‐glycerol‐3‐phosphate acyltransferase

AIM17 YHL021C Putative protein of unknown function; the authentic, non‐tagged 1.3625 0.0073 protein is detected in highly purified mitochondria in high‐ throughput studies; null mutant displays reduced frequency of mitochondrial genome loss GDH3 YAL062W NADP(+)‐dependent glutamate dehydrogenase, synthesizes 1.3458 0.0091 glutamate from ammonia and alpha‐ketoglutarate; rate of alpha‐ ketoglutarate utilization differs from Gdh1p; expression regulated by nitrogen and carbon sources STF2 YGR008C Protein involved in regulation of the mitochondrial F1F0‐ATP 1.3182 0.0109 synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein YPT53 YNL093W Rab family GTPase, similar to Ypt51p and Ypt52p and to mammalian 1.3130 0.0042 rab5; required for vacuolar protein sorting and endocytosis HXT4 YHR092C High‐affinity glucose transporter of the major facilitator superfamily, 1.2365 0.0308 expression is induced by low levels of glucose and repressed by high levels of glucose COS12 YGL263W Protein of unknown function, member of the DUP380 subfamily of 1.2307 0.0269 conserved, often subtelomerically‐encoded proteins

265

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al YPC1 YBR183W Alkaline ceramidase that also has reverse (CoA‐independent) 1.1755 0.0109 ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance GCY1 YOR120W Putative NADP(+) coupled glycerol dehydrogenase, proposed to be 1.1738 0.0015 involved in an alternative pathway for glycerol catabolism; also has mRNA binding activity; member of the aldo‐keto reductase (AKR) family HBN1 YCL026C‐B Putative protein of unknown function; similar to bacterial 1.1731 0.0065 nitroreductases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; protein becomes insoluble upon intracellular iron depletion PHO8 YDR481C Repressible alkaline phosphatase, a glycoprotein localized to the 1.1708 0.0005 vacuole; regulated by levels of inorganic phosphate and by a system consisting of Pho4p, Pho9p, Pho80p, Pho81p and Pho85p; dephosphorylates phosphotyrosyl peptides ARO9 YHR137W Aromatic aminotransferase II, catalyzes the first step of tryptophan, 1.1616 0.0464 phenylalanine, and tyrosine catabolism BOP2 YLR267W Protein of unknown function 1.1607 0.0398 DUR1,2 YBR208C Urea amidolyase, contains both urea carboxylase and allophanate 1.1596 0.0070 hydrolase activities, degrades urea to CO2 and NH3; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation

PRX1 YBL064C Mitochondrial peroxiredoxin (1‐Cys Prx) with thioredoxin peroxidase 1.1478 0.0014 activity, has a role in reduction of hydroperoxides; reactivation requires Trr2p and glutathione; induced during respiratory growth and oxidative stress; phosphorylated NA YKL107W Putative protein of unknown function; proposed to be a 1.1472 0.0096 palmitoylated membrane protein MAL31 YBR298C Maltose permease, high‐affinity maltose transporter (alpha‐glucoside 1.1389 0.0016 transporter); encoded in the MAL3 complex locus; member of the 12 transmembrane domain superfamily of sugar transporters; functional in genomic reference strain S288C USV1 YPL230W Putative transcription factor containing a C2H2 zinc finger; mutation 1.1211 0.0088 affects transcriptional regulation of genes involved in growth on non‐ fermentable carbon sources, response to salt stress and cell wall biosynthesis MAL32 YBR299W Maltase (alpha‐D‐glucosidase), inducible protein involved in maltose 1.1189 0.0147 catabolism; encoded in the MAL3 complex locus; functional in genomic reference strain S288C; hydrolyzes the disaccharides maltose, turanose, maltotriose, and sucrose DAL1 YIR027C Allantoinase, converts allantoin to allantoate in the first step of 1.1186 0.0032 allantoin degradation; expression sensitive to nitrogen catabolite repression REG2 YBR050C Regulatory subunit of the Glc7p type‐1 protein phosphatase; 1.0843 0.0047 involved with Reg1p, Glc7p, and Snf1p in regulation of glucose‐ repressible genes, also involved in glucose‐induced proteolysis of maltose permease NA YHL048C‐A Putative protein of unknown function; identified by expression 1.0822 0.0022 profiling and mass spectrometry MOH1 YBL049W Protein of unknown function, has homology to kinase Snf7p; not 1.0763 0.0080 required for growth on nonfermentable carbon sources; essential for survival in stationary phase

266

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al ATO2 YNR002C Putative transmembrane protein involved in export of ammonia, a 1.0748 0.0186 starvation signal that promotes cell death in aging colonies; phosphorylated in mitochondria; member of the TC 9.B.33 YaaH family; homolog of Ady2p and Y. lipolytica Gpr1p NA YFL054C Putative channel‐like protein; similar to Fps1p; mediates passive 1.0654 0.0014 diffusion of glycerol in the presence of ethanol VTC4 YJL012C Vacuolar membrane polyphosphate polymerase; subunit of the 1.0636 0.0023 vacuolar transporter chaperone (VTC) complex involved in synthesis and transfer of polyP to the vacuole; regulates membrane trafficking; role in non‐autophagic vacuolar fusion PYK2 YOR347C Pyruvate kinase that appears to be modulated by phosphorylation; 1.0456 0.0060 PYK2 transcription is repressed by glucose, and Pyk2p may be active under low glycolytic flux MCH2 YKL221W Protein with similarity to mammalian monocarboxylate permeases, 1.0449 0.0066 which are involved in transport of monocarboxylic acids across the plasma membrane; mutant is not deficient in monocarboxylate transport NA YOR289W Putative protein of unknown function; transcription induced by the 1.0422 0.0036 unfolded protein response; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus

NA YDR391C Putative protein of unknown function, possibly involved in zinc 1.0397 0.0026 homeostasis; Bdf1p‐dependent transcription induced by salt stress; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus YPS6 YIR039C Putative GPI‐anchored aspartic protease, member of the yapsin 1.0321 0.0029 family of proteases involved in cell wall growth and maintenance PHO81 YGR233C Cyclin‐dependent kinase (CDK) inhibitor, regulates Pho80p‐Pho85p 1.0245 0.0045 and Pcl7p‐Pho85p cyclin‐CDK complexes in response to phosphate levels; inhibitory activity for Pho80p‐Pho85p requires myo‐D‐inositol heptakisphosphate (IP7) generated by Vip1p FMP33 YJL161W Putative protein of unknown function; the authentic, non‐tagged 1.0212 0.0047 protein is detected in highly purified mitochondria in high‐ throughput studies PET10 YKR046C Protein of unknown function that co‐purifies with lipid particles; 1.0203 0.0052 expression pattern suggests a role in respiratory growth; computational analysis of large‐scale protein‐protein interaction data suggests a role in ATP/ADP exchange NA YBL086C Protein of unknown function; green fluorescent protein (GFP)‐fusion 1.0196 0.0026 protein localizes to the cell periphery CLD1 YGR110W Mitochondrial cardiolipin‐specific phospholipase; functions upstream 1.0169 0.0186 of Taz1p to generate monolyso‐cardiolipin; transcription increases upon genotoxic stress; involved in restricting Ty1 transposition; has homology to mammalian CGI‐58 GAP1 YKR039W General amino acid permease; localization to the plasma membrane 1.0123 0.0109 is regulated by nitrogen source NA YEL073C Putative protein of unknown function; located adjacent to ARS503 1.0117 0.0070 and the telomere on the left arm of chromosome V; regulated by inositol/choline KIN82 YCR091W Putative serine/threonine protein kinase implicated in the regulation 1.0036 0.0148 of phospholipid asymmetry through the activation of phospholipid translocases (flippases) Lem3p‐Dnf1p/Dnf2p; similar to Fpk1p

267

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al GLC3 YEL011W Glycogen branching enzyme, involved in glycogen accumulation; 0.9895 0.0047 green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern PIC2 YER053C Mitochondrial phosphate carrier, imports inorganic phosphate into 0.9859 0.0142 mitochondria; functionally redundant with Mir1p but less abundant than Mir1p under normal conditions; expression is induced at high temperature NA YKL151C Putative protein of unknown function; YKL151C promoter contains 0.9750 0.0028 STREs (stress response elements) and expression is induced by heat shock or methyl methanesulfonate; green fluorescent protein (GFP)‐ fusion protein localizes to the cytoplasm SUE1 YPR151C Mitochondrial protein required for degradation of unstable forms of 0.9655 0.0089 cytochrome c NA NA NA 0.9614 0.0411 LAP4 YKL103C Vacuolar aminopeptidase yscI; zinc metalloproteinase that belongs to 0.9590 0.0036 the peptidase family M18; often used as a marker protein in studies of autophagy and cytosol to vacuole targeting (CVT) pathway TSL1 YML100W Large subunit of trehalose 6‐phosphate synthase 0.9533 0.0204 (Tps1p)/phosphatase (Tps2p) complex, which converts uridine‐5'‐ diphosphoglucose and glucose 6‐phosphate to trehalose, similar to Tps3p and may share function; mutant has aneuploidy tolerance NTH1 YDR001C Neutral trehalase, degrades trehalose; required for thermotolerance 0.9406 0.0022 and may mediate resistance to other cellular stresses; may be phosphorylated by Cdc28p DCS1 YLR270W Non‐essential hydrolase involved in mRNA decapping, may function 0.9212 0.0077 in a feedback mechanism to regulate deadenylation, contains pyrophosphatase activity and a HIT (histidine triad) motif; interacts with neutral trehalase Nth1p STF1 YDL130W‐A Protein involved in regulation of the mitochondrial F1F0‐ATP 0.9205 0.0109 synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein DAL3 YIR032C Ureidoglycolate hydrolase, converts ureidoglycolate to glyoxylate 0.9195 0.0266 and urea in the third step of allantoin degradation; expression sensitive to nitrogen catabolite repression

NA YMR206W Putative protein of unknown function; YMR206W is not an essential 0.9149 0.0098 gene BNA2 YJR078W Putative tryptophan 2,3‐dioxygenase or indoleamine 2,3‐ 0.9143 0.0091 dioxygenase, required for de novo biosynthesis of NAD from tryptophan via kynurenine; interacts genetically with telomere capping gene CDC13; regulated by Hst1p and Aftp GSY1 YFR015C Glycogen synthase with similarity to Gsy2p, the more highly 0.9140 0.0091 expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary phase NA NA NA 0.9093 0.0102 NA YER079W Putative protein of unknown function 0.9050 0.0132 NA YMR262W Protein of unknown function; interacts weakly with Knr4p; 0.9024 0.0046 YMR262W is not an essential gene NA YHL044W Putative integral membrane protein, member of DUP240 gene 0.8932 0.0014 family; green fluorescent protein (GFP)‐fusion protein localizes to the plasma membrane in a punctate pattern HXT9 YJL219W Putative hexose transporter that is nearly identical to Hxt11p, has 0.8838 0.0153 similarity to major facilitator superfamily (MFS) transporters, expression of HXT9 is regulated by transcription factors Pdr1p and Pdr3p 268

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al REC8 YPR007C Meiosis‐specific component of sister chromatid cohesion complex; 0.8821 0.0135 maintains cohesion between sister chromatids during meiosis I; maintains cohesion between centromeres of sister chromatids until meiosis II; homolog of S. pombe Rec8p NA YLR281C Putative protein of unknown function; green fluorescent protein 0.8820 0.0021 (GFP)‐fusion protein localizes to mitochondria; YLR281C is not an essential gene UBP11 YKR098C Ubiquitin‐specific protease that cleaves ubiquitin from ubiquitinated 0.8811 0.0092 proteins NA YNR034W‐A Putative protein of unknown function; expression is regulated by 0.8799 0.0185 Msn2p/Msn4p HXK1 YFR053C Hexokinase isoenzyme 1, a cytosolic protein that catalyzes 0.8792 0.0206 phosphorylation of glucose during glucose metabolism; expression is highest during growth on non‐glucose carbon sources; glucose‐ induced repression involves the hexokinase Hxk2p EMI2 YDR516C Non‐essential protein of unknown function required for 0.8772 0.0114 transcriptional induction of the early meiotic‐specific transcription factor IME1; required for sporulation; expression is regulated by glucose‐repression transcription factors Mig1/2p ROM1 YGR070W GDP/GTP exchange protein (GEP) for Rho1p; mutations are 0.8720 0.0141 synthetically lethal with mutations in rom2, which also encodes a GEP NA YNL200C Putative protein of unknown function; the authentic, non‐tagged 0.8719 0.0025 protein is detected in highly purified mitochondria in high‐ throughput studies FMP46 YKR049C Putative redox protein containing a thioredoxin fold; the authentic, 0.8706 0.0031 non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies NA YHR138C Putative protein of unknown function; has similarity to Pbi2p; double 0.8657 0.0047 null mutant lacking Pbi2p and Yhr138p exhibits highly fragmented vacuoles CAR1 YPL111W Arginase, responsible for arginine degradation, expression responds 0.8615 0.0081 to both induction by arginine and nitrogen catabolite repression; disruption enhances freeze tolerance AMS1 YGL156W Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) 0.8532 0.0206 degradation; delivered to the vacuole in a novel pathway separate from the secretory pathway JID1 YPR061C Probable Hsp40p co‐chaperone, has a DnaJ‐like domain and appears 0.8513 0.0015 to be involved in ER‐associated degradation of misfolded proteins containing a tightly folded cytoplasmic domain; inhibits replication of Brome mosaic virus in S. cerevisiae THI13 YDL244W Protein involved in synthesis of the thiamine precursor 0.8493 0.0041 hydroxymethylpyrimidine (HMP); member of a subtelomeric gene family including THI5, THI11, THI12, and THI13 GDB1 YPR184W Glycogen debranching enzyme containing glucanotranferase and 0.8449 0.0189 alpha‐1,6‐amyloglucosidase activities, required for glycogen degradation; phosphorylated in mitochondria DGR2 YKL121W Protein of unknown function; null mutant is resistant to 2‐deoxy‐D‐ 0.8397 0.0091 glucose and displays abnormally elongated buds ISF1 YMR081C Serine‐rich, hydrophilic protein with similarity to Mbr1p; 0.8299 0.0487 overexpression suppresses growth defects of hap2, hap3, and hap4 mutants; expression is under glucose control; cotranscribed with NAM7 in a cyp1 mutant COX20 YDR231C Mitochondrial inner membrane protein, required for proteolytic 0.8294 0.0024 processing of Cox2p and its assembly into cytochrome c oxidase 269

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al ECM8 YBR076W Non‐essential protein of unknown function 0.8267 0.0071 GOR1 YNL274C Glyoxylate reductase; null mutation results in increased biomass 0.8265 0.0171 after diauxic shift; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies XKS1 YGR194C Xylulokinase, converts D‐xylulose and ATP to xylulose 5‐phosphate 0.8165 0.0131 and ADP; rate limiting step in fermentation of xylulose; required for xylose fermentation by recombinant S. cerevisiae strains TPK1 YJL164C cAMP‐dependent protein kinase catalytic subunit; promotes 0.8118 0.0142 vegetative growth in response to nutrients via the Ras‐cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p GLK1 YCL040W Glucokinase, catalyzes the phosphorylation of glucose at C6 in the 0.8064 0.0054 first irreversible step of glucose metabolism; one of three glucose phosphorylating enzymes; expression regulated by non‐fermentable carbon sources PIG2 YIL045W Putative type‐1 protein phosphatase targeting subunit that tethers 0.7987 0.0210 Glc7p type‐1 protein phosphatase to Gsy2p glycogen synthase YAK1 YJL141C Serine‐threonine protein kinase that is part of a glucose‐sensing 0.7940 0.0070 system involved in growth control in response to glucose availability; translocates from the cytoplasm to the nucleus and phosphorylates Pop2p in response to a glucose signal GSP2 YOR185C GTP binding protein (mammalian Ranp homolog) involved in the 0.7909 0.0144 maintenance of nuclear organization, RNA processing and transport; interacts with Kap121p, Kap123p and Pdr6p (karyophilin betas); Gsp1p homolog that is not required for viability RTC2 YBR147W Protein of unknown function; identified in a screen for mutants with 0.7881 0.0105 decreased levels of rDNA transcription; detected in highly purified mitochondria; null mutant suppresses cdc13‐1; similar to a G‐protein coupled receptor from S. pombe NA YLR345W Similar to 6‐phosphofructo‐2‐kinase/fructose‐2,6‐bisphosphatase 0.7815 0.0065 enzymes responsible for the metabolism of fructoso‐2,6‐ bisphosphate; mRNA expression is repressed by the Rfx1p‐Tup1p‐ Ssn6p repressor complex; YLR345W is not an essential gene GSY2 YLR258W Glycogen synthase, similar to Gsy1p; expression induced by glucose 0.7814 0.0337 limitation, nitrogen starvation, heat shock, and stationary phase; activity regulated by cAMP‐dependent, Snf1p and Pho85p kinases as well as by the Gac1p‐Glc7p phosphatase NA YBR056W Putative cytoplasmic protein of unknown function 0.7795 0.0091 NA YGR174W‐A Putative protein of unknown function; predicted to have a role in cell 0.7790 0.0419 budding based on computational "guilt by association" analysis CMC4 YMR194C‐B Protein that localizes to the mitochondrial intermembrane space via 0.7790 0.0090 the Mia40p‐Erv1p system; contains twin cysteine‐x(9)‐cysteine motifs NA YJR008W Putative protein of unknown function; expression repressed by 0.7728 0.0227 inosine and choline in an Opi1p‐dependent manner; expression induced by mild heat‐stress on a non‐fermentable carbon source. NA YAL016C‐B Dubious open reading frame unlikely to encode a protein, based on 0.7654 0.0224 available experimental and comparative sequence data VID24 YBR105C Peripheral membrane protein located at Vid (vacuole import and 0.7647 0.0065 degradation) vesicles; regulates fructose‐1,6‐bisphosphatase (FBPase) targeting to the vacuole; promotes proteasome‐dependent catabolite degradation of FBPase PTK2 YJR059W Putative serine/threonine protein kinase involved in regulation of ion 0.7631 0.0096 transport across plasma membrane; enhances spermine uptake

270

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al NA YDR379C‐A Protein involved in the assembly of the mitochondrial succinate 0.7585 0.0467 dehydrogenase complex; mutations in human ortholog SDHAF1 are associated with infantile leukoencephalopathy MAL11 YGR289C Inducible high‐affinity maltose transporter (alpha‐glucoside 0.7576 0.0115 transporter); encoded in the MAL1 complex locus; broad substrate specificity that includes maltotriose; required for isomaltose utilization YTP1 YNL237W Probable type‐III integral membrane protein of unknown function, 0.7569 0.0416 has regions of similarity to mitochondrial electron transport proteins ECM4 YKR076W Omega class glutathione transferase; not essential; similar to 0.7496 0.0110 Ygr154cp; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm SOM1 YEL059C‐A Subunit of the mitochondrial inner membrane peptidase, which is 0.7431 0.0097 required for maturation of mitochondrial proteins of the intermembrane space; Som1p facilitates cleavage of a subset of substrates; contains twin cysteine‐x9‐cysteine motifs HUB1 YNR032C‐A Ubiquitin‐like protein modifier, may function in modification of 0.7430 0.0068 Sph1p and Hbt1p, functionally complemented by the human or S. pombe ortholog; mechanism of Hub1p adduct formation not yet clear FMP40 YPL222W Putative protein of unknown function; proposed to be involved in 0.7410 0.0051 responding to environmental stresses; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐ throughput studies NA YFR012W‐A Putative protein of unknown function; identified by homology 0.7370 0.0054 TRX3 YCR083W Mitochondrial thioredoxin, highly conserved oxidoreductase required 0.7367 0.0034 to maintain the redox homeostasis of the cell, forms the mitochondrial thioredoxin system with Trr2p, redox state is maintained by both Trr2p and Glr1p ALD3 YMR169C Cytoplasmic aldehyde dehydrogenase, involved in beta‐alanine 0.7357 0.0400 synthesis; uses NAD+ as the preferred coenzyme; very similar to Ald2p; expression is induced by stress and repressed by glucose BNA1 YJR025C 3‐hydroxyanthranilic acid dioxygenase, required for the de novo 0.7334 0.0034 biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p NA YNL217W Putative protein of unknown function; weak sequence similarity to 0.7263 0.0091 bis (5'‐nucleotidyl)‐tetraphosphatases; (GFP)‐fusion protein localizes to the vacuole; null mutant is highly sensitive to azaserine and resistant to sodium‐O‐vandate TPS3 YMR261C Regulatory subunit of trehalose‐6‐phosphate synthase/phosphatase 0.7217 0.0060 complex, which synthesizes the storage carbohydrate trehalose; expression is induced by stress conditions and repressed by the Ras‐ cAMP pathway EMP46 YLR080W Integral membrane component of endoplasmic reticulum‐derived 0.7217 0.0292 COPII‐coated vesicles, which function in ER to Golgi transport NA YGL185C Putative protein with sequence similarity to hydroxyacid 0.7171 0.0093 dehydrogenases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm DOG2 YHR043C 2‐deoxyglucose‐6‐phosphate phosphatase, member of a family of 0.7164 0.0134 low molecular weight phosphatases, similar to Dog1p, induced by oxidative and osmotic stress, confers 2‐deoxyglucose resistance when overexpressed AGP1 YCL025C Low‐affinity amino acid permease with broad substrate range, 0.7129 0.0085 involved in uptake of asparagine, glutamine, and other amino acids; expression is regulated by the SPS plasma membrane amino acid sensor system (Ssy1p‐Ptr3p‐Ssy5p) 271

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al CAR2 YLR438W L‐ornithine transaminase (OTAse), catalyzes the second step of 0.7105 0.0246 arginine degradation, expression is dually‐regulated by allophanate induction and a specific arginine induction process; not nitrogen catabolite repression sensitive UPS3 YDR185C Mitochondrial protein of unknown function; similar to Ups1p and 0.7060 0.0111 Ups2p which are involved in regulation of mitochondrial cardiolipin and phosphatidylethanolamine levels; null is viable but interacts synthetically with ups1 and ups2 mutations CMK2 YOL016C Calmodulin‐dependent protein kinase; may play a role in stress 0.7045 0.0138 response, many CA++/calmodulan dependent phosphorylation substrates demonstrated in vitro, amino acid sequence similar to Cmk1p and mammalian Cam Kinase II OYE3 YPL171C Conserved NADPH oxidoreductase containing flavin mononucleotide 0.7035 0.0308 (FMN), homologous to Oye2p with different ligand binding and catalytic properties; has potential roles in oxidative stress response and programmed cell death VTC1 YER072W Subunit of the vacuolar transporter chaperone (VTC) complex 0.7030 0.0060 involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion; also has mRNA binding activity UGX2 YDL169C Protein of unknown function, transcript accumulates in response to 0.6974 0.0285 any combination of stress conditions PNC1 YGL037C Nicotinamidase that converts nicotinamide to nicotinic acid as part of 0.6966 0.0181 the NAD(+) salvage pathway, required for life span extension by calorie restriction; PNC1 expression responds to all known stimuli that extend replicative life span NGL3 YML118W Putative endonuclease, has a domain similar to a magnesium‐ 0.6952 0.0328 dependent endonuclease motif in mRNA deadenylase Ccr4p; similar to Ngl1p and Ngl2p NA YBR230W‐A Putative protein of unknown function 0.6950 0.0242 NA YPL247C Putative protein of unknown function; green fluorescent protein 0.6893 0.0170 (GFP)‐fusion protein localizes to the cytoplasm and nucleus; similar to the petunia WD repeat protein an11; overexpression causes a cell cycle delay or arrest GAL3 YDR009W Transcriptional regulator involved in activation of the GAL genes in 0.6848 0.0225 response to galactose; forms a complex with Gal80p to relieve Gal80p inhibition of Gal4p; binds galactose and ATP but does not have galactokinase activity MIC14 YDR031W Mitochondrial intermembrane space protein, required for normal 0.6802 0.0104 oxygen consumption; contains twin cysteine‐x9‐cysteine motifs UBP9 YER098W Ubiquitin carboxyl‐terminal hydrolase, ubiquitin‐specific protease 0.6722 0.0109 that cleaves ubiquitin‐protein fusions TMA17 YDL110C Protein of unknown function that associates with ribosomes; 0.6718 0.0292 heterozygous deletion demonstrated increases in chromosome instability in a rad9 deletion background; protein abundance is decreased upon intracellular iron depletion VPS73 YGL104C Mitochondrial protein; mutation affects vacuolar protein sorting; 0.6713 0.0190 putative transporter; member of the sugar porter family VTC2 YFL004W Subunit of the vacuolar transporter chaperone (VTC) complex 0.6706 0.0292 involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion

NA YMR105W‐ Putative protein of unknown function 0.6697 0.0476 A

272

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al NA YJL133C‐A Putative protein of unknown function; the authentic, non‐tagged 0.6671 0.0091 protein is detected in highly purified mitochondria in high‐ throughput studies HOR2 YER062C One of two redundant DL‐glycerol‐3‐phosphatases (RHR2/GPP1 0.6665 0.0041 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition GPX1 YKL026C Phospholipid hydroperoxide glutathione peroxidase induced by 0.6663 0.0079 glucose starvation that protects cells from phospholipid hydroperoxides and nonphospholipid peroxides during oxidative stress NTH2 YBR001C Putative neutral trehalase, required for thermotolerance and may 0.6662 0.0054 mediate resistance to other cellular stresses NA YGR226C Dubious open reading frame, unlikely to encode a protein; not 0.6654 0.0104 conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W UBC12 YLR306W Enzyme that mediates the conjugation of Rub1p, a ubiquitin‐like 0.6566 0.0086 protein, to other proteins; related to E2 ubiquitin‐conjugating enzymes SDH4 YDR178W Membrane anchor subunit of succinate dehydrogenase (Sdh1p, 0.6563 0.0090 Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain GRX1 YCL035C Hydroperoxide and superoxide‐radical responsive heat‐stable 0.6534 0.0171 glutathione‐dependent disulfide oxidoreductase with active site cysteine pair; protects cells from oxidative damage

DAN4 YJR151C Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and 0.6460 0.0091 Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth YSC84 YHR016C Actin‐binding protein involved in bundling of actin filaments and 0.6443 0.0109 endocytosis of actin cortical patches; activity stimulated by Las17p; contains SH3 domain similar to Rvs167p NA YBR085C‐A Putative protein of unknown function; green fluorescent protein 0.6425 0.0165 (GFP)‐fusion protein localizes to the cytoplasm and to the nucleus PUT1 YLR142W Proline oxidase, nuclear‐encoded mitochondrial protein involved in 0.6412 0.0090 utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source ATG34 YOL083W Receptor protein involved in selective autophagy during starvation; 0.6396 0.0253 specifically involved in the transport of cargo protein alpha‐ mannosidase (Ams1p); Atg19p paralog NA YNR014W Putative protein of unknown function; expression is cell‐cycle 0.6388 0.0292 regulated, Azf1p‐dependent, and heat‐inducible PMC1 YGL006W Vacuolar Ca2+ ATPase involved in depleting cytosol of Ca2+ ions; 0.6367 0.0170 prevents growth inhibition by activation of calcineurin in the presence of elevated concentrations of calcium; similar to mammalian PMCA1a ICY1 YMR195W Protein of unknown function, required for viability in rich media of 0.6366 0.0073 cells lacking mitochondrial DNA; mutants have an invasive growth defect with elongated morphology; induced by amino acid starvation SFC1 YJR095W Mitochondrial succinate‐fumarate transporter, transports succinate 0.6324 0.0403 into and fumarate out of the mitochondrion; required for ethanol and acetate utilization

273

log2(msn5 adj.p.v Symbols ORF Description .Tf/WT.Tf) al NA YBR287W Protein of unknown function; green fluorescent protein (GFP)‐fusion 0.6307 0.0091 protein localizes to the ER; YBR287W is not an essential gene QCR8 YJL166W Subunit 8 of ubiquinol cytochrome‐c reductase complex, which is a 0.6294 0.0081 component of the mitochondrial inner membrane electron transport chain; oriented facing the intermembrane space; expression is regulated by Abf1p and Cpf1p NA YMR291W Putative kinase of unknown function; green fluorescent protein 0.6287 0.0045 (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YMR291W is not an essential gene VID30 YGL227W Protein involved in proteasome‐dependent catabolite degradation of 0.6285 0.0150 fructose‐1,6‐bisphosphatase (FBPase); binds FBPase; shifts the balance of nitrogen metabolism toward glutamate production; localizes to the nucleus and the cytoplasm ZTA1 YBR046C NADPH‐dependent quinone reductase, GFP‐tagged protein localizes 0.6240 0.0104 to the cytoplasm and nucleus; has similarity to E. coli quinone oxidoreductase and to human zeta‐crystallin REE1 YJL217W Cytoplasmic protein involved in the regulation of enolase (ENO1); 0.6214 0.0400 mRNA expression is induced by calcium shortage, copper deficiency (via Mac1p) and the presence of galactose (via Gal4p); mRNA expression is also regulated by the cell cycle OSH2 YDL019C Member of an oxysterol‐binding protein family with seven members 0.6211 0.0113 in S. cerevisiae; family members have overlapping, redundant functions in sterol metabolism and collectively perform a function essential for viability COX5B YIL111W Subunit Vb of cytochrome c oxidase, which is the terminal member 0.6204 0.0337 of the mitochondrial inner membrane electron transport chain; predominantly expressed during anaerobic growth while its isoform Va (Cox5Ap) is expressed during aerobic growth DCG1 YIR030C Protein of unknown function, expression is sensitive to nitrogen 0.6182 0.0166 catabolite repression and regulated by Dal80p; contains transmembrane domain NA YLR177W Putative protein of unknown function; phosphorylated by Dbf2p‐ 0.6074 0.0127 Mob1p in vitro; some strains contain microsatellite polymophisms at this locus; YLR177W is not an essential gene

ODC1 YPL134C Mitochondrial inner membrane transporter, exports 2‐oxoadipate 0.6048 0.0144 and 2‐oxoglutarate from the mitochondrial matrix to the cytosol for lysine and glutamate biosynthesis and lysine catabolism; suppresses, in multicopy, an fmc1 null mutation NA YJL213W Protein of unknown function that may interact with ribosomes; 0.6020 0.0253 periodically expressed during the yeast metabolic cycle; phosphorylated in vitro by the mitotic exit network (MEN) kinase complex, Dbf2p/Mob1p ALG14 YBR070C Component of UDP‐GlcNAc transferase required for the second step 0.6006 0.0080 of dolichyl‐linked oligosaccharide synthesis; anchors the catalytic subunit Alg13p to the ER membrane; similar to bacterial and human glycosyltransferases

274

APPENDIX N: Down-regulated genes in msn5Δ cells in amino acid starvation condition

This section includes the list of transcriptionally differentially expressed genes (cutoff conditions: log2 FC 0.6 and adjusted p-value < 0.05) in msn5Δ cells in amino acid starvation condition.

Down-regulated genes in msn5Δ cells in amino acid starvation condition

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al MSN5 YDR335W Karyopherin involved in nuclear import and export of proteins, ‐7.9130 0.0000 including import of replication protein A and export of Swi6p, Far1p, and Pho4p; required for re‐export of mature tRNAs after their retrograde import from the cytoplasm MF(ALPHA) YGL089C Mating pheromone alpha‐factor, made by alpha cells; interacts with ‐4.6487 0.0000 2 mating type a cells to induce cell cycle arrest and other responses leading to mating; also encoded by MF(ALPHA)1, which is more highly expressed than MF(ALPHA)2 PCL1 YNL289W Cyclin, interacts with cyclin‐dependent kinase Pho85p; member of ‐3.2756 0.0002 the Pcl1,2‐like subfamily, involved in the regulation of polarized growth and morphogenesis and progression through the cell cycle; localizes to sites of polarized cell growth PRM1 YNL279W Pheromone‐regulated multispanning membrane protein involved in ‐2.9190 0.0000 membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p YOX1 YML027W Homeodomain‐containing transcriptional repressor, binds to Mcm1p ‐2.7175 0.0007 and to early cell cycle boxes (ECBs) in the promoters of cell cycle‐ regulated genes expressed in M/G1 phase; expression is cell cycle‐ regulated; potential Cdc28p substrate BAR1 YIL015W Aspartyl protease secreted into the periplasmic space of mating type ‐2.3923 0.0004 a cells, helps cells find mating partners, cleaves and inactivates alpha factor allowing cells to recover from alpha‐factor‐induced cell cycle arrest FUS1 YCL027W Membrane protein localized to the shmoo tip, required for cell ‐2.1300 0.0004 fusion; expression regulated by mating pheromone; proposed to coordinate signaling, fusion, and polarization events required for fusion; potential Cdc28p substrate IMD1 YAR073W Nonfunctional protein with homology to IMP dehydrogenase; ‐2.1086 0.0025 probable pseudogene, located close to the telomere; is not 275

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al expressed at detectable levels; YAR073W and YAR075W comprise a continuous reading frame in some strains of S. cerevisiae FIG1 YBR040W Integral membrane protein required for efficient mating; may ‐1.9293 0.0075 participate in or regulate the low affinity Ca2+ influx system, which affects intracellular signaling and cell‐cell fusion during mating YHP1 YDR451C One of two homeobox transcriptional repressors (see also Yox1p), ‐1.9256 0.0007 that bind to Mcm1p and to early cell cycle box (ECB) elements of cell cycle regulated genes, thereby restricting ECB‐mediated transcription to the M/G1 interval SAG1 YJR004C Alpha‐agglutinin of alpha‐cells, binds to Aga1p during agglutination, ‐1.9071 0.0001 N‐terminal half is homologous to the immunoglobulin superfamily and contains binding site for a‐agglutinin, C‐terminal half is highly glycosylated and contains GPI anchor ANS1 YHR126C Putative protein of unknown function; transcription dependent upon ‐1.8395 0.0039 Azf1p AGA1 YNR044W Anchorage subunit of a‐agglutinin of a‐cells, highly O‐glycosylated ‐1.8349 0.0004 protein with N‐terminal secretion signal and C‐terminal signal for addition of GPI anchor to cell wall, linked to adhesion subunit Aga2p via two disulfide bonds WSC4 YHL028W ER membrane protein involved in the translocation of soluble ‐1.7878 0.0072 secretory proteins and insertion of membrane proteins into the ER membrane; may also have a role in the stress response but has only partial functional overlap with WSC1‐3 AGA2 YGL032C Adhesion subunit of a‐agglutinin of a‐cells, C‐terminal sequence acts ‐1.7575 0.0034 as a ligand for alpha‐agglutinin (Sag1p) during agglutination, modified with O‐linked oligomannosyl chains, linked to anchorage subunit Aga1p via two disulfide bonds ASG7 YJL170C Protein that regulates signaling from a G protein beta subunit Ste4p ‐1.7416 0.0021 and its relocalization within the cell; specific to a‐cells and induced by alpha‐factor NA YER085C Putative protein of unknown function ‐1.7129 0.0013 IMD2 YHR216W Inosine monophosphate dehydrogenase, catalyzes the rate‐limiting ‐1.7000 0.0007 step in GTP biosynthesis, expression is induced by mycophenolic acid resulting in resistance to the drug, expression is repressed by nutrient limitatio CSI2 YOL007C Protein of unknown function; green fluorescent protein (GFP)‐ fusion ‐1.6657 0.0003 protein localizes to the mother side of the bud neck and the vacuole; YOL007C is not an essential gene TOS6 YNL300W Glycosylphosphatidylinositol‐dependent cell wall protein, expression ‐1.6583 0.0009 is periodic and decreases in respone to ergosterol perturbation or upon entry into stationary phase; depletion increases resistance to lactic acid PRM6 YML047C Pheromone‐regulated protein, predicted to have 2 transmembrane ‐1.6562 0.0183 segments; regulated by Ste12p during mating PHM7 YOL084W Protein of unknown function, expression is regulated by phosphate ‐1.6327 0.0200 levels; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery and vacuole HO YDL227C Site‐specific endonuclease required for gene conversion at the MAT ‐1.6270 0.0019 locus (homothallic switching) through the generation of a ds DNA break; expression restricted to mother cells in late G1 as controlled by Swi4p‐Swi6p, Swi5p and Ash1p DAN1 YJR150C Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and ‐1.6217 0.0061 Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth NA YAR066W Putative GPI protein ‐1.6055 0.0009 RIM9 YMR063W Protein of unknown function, involved in the proteolytic activation of ‐1.5709 0.0062 Rim101p in response to alkaline pH; has similarity to A. nidulans PalI; putative membrane protein SFG1 YOR315W Nuclear protein, putative transcription factor required for growth of ‐1.5696 0.0042 276

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al superficial pseudohyphae (which do not invade the agar substrate) but not for invasive pseudohyphal growth; may act together with Phd1p; potential Cdc28p substrate SCW10 YMR305C Cell wall protein with similarity to glucanases; may play a role in ‐1.5512 0.0004 conjugation during mating based on mutant phenotype and its regulation by Ste12p PLM2 YDR501W Forkhead Associated domain containing protein and putative ‐1.5402 0.0004 transcription factor found associated with chromatin; target of SBF transcription factor; induced in response to DNA damaging agents and deletion of telomerase; similar to TOS4 HUG1 YML058W‐A Protein involved in the Mec1p‐mediated checkpoint pathway that ‐1.5216 0.0030 responds to DNA damage or replication arrest, transcription is induced by DNA damage RPI1 YIL119C Putative transcriptional regulator; overexpression suppresses the ‐1.5166 0.0111 heat shock sensitivity of wild‐type RAS2 overexpression and also suppresses the cell lysis defect of an mpk1 mutation MFA1 YDR461W Mating pheromone a‐factor, made by a cells; interacts with alpha ‐1.5020 0.0019 cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C‐terminal modification, N‐terminal proteolysis, and export; also encoded by MFA2 STE3 YKL178C Receptor for a factor pheromone, couples to MAP kinase cascade to ‐1.4891 0.0001 mediate pheromone response; transcribed in alpha cells and required for mating by alpha cells, ligand bound receptors endocytosed and recycled to the plasma membrane; GPCR CWP1 YKL096W Cell wall mannoprotein that localizes specifically to birth scars of ‐1.4830 0.0210 daughter cells, linked to a beta‐1,3‐ and beta‐1,6‐glucan heteropolymer through a phosphodiester bond; required for propionic acid resistance ADH2 YMR303C Glucose‐repressible alcohol dehydrogenase II, catalyzes the ‐1.4705 0.0020 conversion of ethanol to acetaldehyde; involved in the production of certain carboxylate esters; regulated by ADR1 SST2 YLR452C GTPase‐activating protein for Gpa1p, regulates desensitization to ‐1.4700 0.0004 alpha factor pheromone; also required to prevent receptor‐ independent signaling of the mating pathway; member of the RGS (regulator of G‐protein signaling) family FAR1 YJL157C Cyclin‐dependent kinase inhibitor that mediates cell cycle arrest in ‐1.4390 0.0002 response to pheromone; also forms a complex with Cdc24p, Ste4p, and Ste18p that may specify the direction of polarized growth during mating; potential Cdc28p substrate NA YIL082W‐A Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated ‐1.4350 0.0003 as one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes DTR1 YBR180W Putative dityrosine transporter, required for spore wall synthesis; ‐1.4312 0.0001 expressed during sporulation; member of the major facilitator superfamily (DHA1 family) of multidrug resistance transporters NA YAL018C Putative protein of unknown function ‐1.4045 0.0031 NA YOR214C Putative protein of unknown function; YOR214C is not an essential ‐1.3955 0.0182 gene SPC24 YMR117C Component of the evolutionarily conserved kinetochore‐associated ‐1.3870 0.0035 Ndc80 complex (Ndc80p‐Nuf2p‐Spc24p‐Spc25p); involved in chromosome segregation, spindle checkpoint activity and kinetochore clustering CRR1 YLR213C Putative glycoside hydrolase of the spore wall envelope; required for ‐1.3782 0.0062 normal spore wall assembly, possibly for cross‐linking between the glucan and chitosan layers; expressed during sporulation ALP1 YNL270C Arginine transporter; expression is normally very low and it is unclear ‐1.3741 0.0062 what conditions would induce significant expression CLB2 YPR119W B‐type cyclin involved in cell cycle progression; activates Cdc28p to ‐1.3465 0.0033

277

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al promote the transition from G2 to M phase; accumulates during G2 and M, then targeted via a destruction box motif for ubiquitin‐ mediated degradation by the proteasome ECM11 YDR446W Non‐essential protein apparently involved in meiosis, GFP fusion ‐1.3128 0.0051 protein is present in discrete clusters in the nucleus throughout mitosis; may be involved in maintaining chromatin structure SVS1 YPL163C Cell wall and vacuolar protein, required for wild‐type resistance to ‐1.3010 0.0040 vanadate PTH1 YHR189W One of two (see also PTH2) mitochondrially‐localized peptidyl‐tRNA ‐1.2941 0.0095 hydrolases; dispensable for respiratory growth on rich medium, but required for respiratory growth on minimal medium PMA2 YPL036W Plasma membrane H+‐ATPase, isoform of Pma1p, involved in ‐1.2830 0.0032 pumping protons out of the cell; regulator of cytoplasmic pH and plasma membrane potential STE12 YHR084W Transcription factor that is activated by a MAP kinase signaling ‐1.2510 0.0007 cascade, activates genes involved in mating or pseudohyphal/invasive growth pathways; cooperates with Tec1p transcription factor to regulate genes specific for invasive growth NA YHL018W Putative protein of unknown function; green fluorescent protein ‐1.2395 0.0083 (GFP)‐fusion protein localizes to mitochondria and is induced in response to the DNA‐damaging agent MMS KAR4 YCL055W Transcription factor required for gene regulation in response to ‐1.2261 0.0007 pheromones; also required during meiosis; exists in two forms, a slower‐migrating form more abundant during vegetative growth and a faster‐migrating form induced by pheromone HES1 YOR237W Protein implicated in the regulation of ergosterol biosynthesis; one of ‐1.2197 0.0019 a seven member gene family with a common essential function and non‐essential unique functions; similar to human oxysterol binding protein (OSBP) RSB1 YOR049C Suppressor of sphingoid long chain base (LCB) sensitivity of an LCB‐ ‐1.1971 0.0182 lyase mutation; putative integral membrane transporter or flippase that may transport LCBs from the cytoplasmic side toward the extracytoplasmic side of the membrane NA YMR084W Putative protein of unknown function; YMR084W and adjacent ORF ‐1.1706 0.0117 YMR085W are merged in related strains CDC6 YJL194W Essential ATP‐binding protein required for DNA replication, ‐1.1641 0.0062 component of the pre‐replicative complex (pre‐RC) which requires ORC to associate with chromatin and is in turn required for Mcm2‐7p DNA association; homologous to S. pombe Cdc18p MSB2 YGR014W Mucin family member involved in the Cdc42p‐ and MAP kinase‐ ‐1.1203 0.0015 dependent filamentous growth signaling pathway; also functions as an osmosensor in parallel to the Sho1p‐mediated pathway; potential Cdc28p substrate FRE8 YLR047C Protein with sequence similarity to iron/copper reductases, involved ‐1.1190 0.0030 in iron homeostasis; deletion mutant has iron deficiency/accumulation growth defects; expression increased in the absence of copper‐responsive transcription factor Mac1p SMA1 YPL027W Protein of unknown function involved in the assembly of the ‐1.1130 0.0102 prospore membrane during sporulation; interacts with Spo14p NA YLR042C Protein of unknown function; localizes to the cytoplasm; YLL042C is ‐1.1123 0.0016 not an essential gene PCL2 YDL127W Cyclin, interacts with cyclin‐dependent kinase Pho85p; member of ‐1.0947 0.0016 the Pcl1,2‐like subfamily, involved in the regulation of polarized growth and morphogenesis and progression through the cell cycle; localizes to sites of polarized cell growth NRM1 YNR009W Transcriptional co‐repressor of MBF (MCB binding factor)‐regulated ‐1.0944 0.0015 gene expression; Nrm1p associates stably with promoters via MBF to repress transcription upon exit from G1 phase NA YCL021W‐A Putative protein of unknown function ‐1.0911 0.0030

278

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al AQY1 YPR192W Spore‐specific water channel that mediates the transport of water ‐1.0892 0.0048 across cell membranes, developmentally controlled; may play a role in spore maturation, probably by allowing water outflow, may be involved in freeze tolerance NA YOR316C‐A Putative protein of unknown function; identified by fungal homology ‐1.0829 0.0109 and RT‐PCR RTG1 YOL067C Transcription factor (bHLH) involved in interorganelle communication ‐1.0808 0.0025 between mitochondria, peroxisomes, and nucleus NFT1 YKR103W Putative transporter of the multidrug resistance‐associated protein ‐1.0804 0.0130 (MRP) subfamily; adjacent ORFs YKR103W and YKR104W are merged in different strain backgrounds. CLN1 YMR199W G1 cyclin involved in regulation of the cell cycle; activates Cdc28p ‐1.0786 0.0012 kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐ Mbp1p) and SBF (Swi6p‐Swi4p) TIR1 YER011W Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐ ‐1.0773 0.0025 rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking DFG10 YIL049W Protein of unknown function, involved in filamentous growth ‐1.0770 0.0005 FRM2 YCL026C‐A Protein of unknown function, involved in the integration of lipid ‐1.0733 0.0062 signaling pathways with cellular homeostasis; expression induced in cells treated with the mycotoxin patulin; has similarity to bacterial nitroreductases BSC5 YNR069C Protein of unknown function, ORF exhibits genomic organization ‐1.0651 0.0110 compatible with a translational readthrough‐dependent mode of expression PPM2 YOL141W AdoMet‐dependent tRNA methyltransferase also involved in ‐1.0581 0.0034 methoxycarbonylation; required for the synthesis of wybutosine (yW), a modified guanosine found at the 3'‐position adjacent to the anticodon of phe‐tRNA; similarity to Ppm1p PLB2 YMR006C Phospholipase B (lysophospholipase) involved in phospholipid ‐1.0523 0.0034 metabolism; displays transacylase activity in vitro; overproduction confers resistance to lysophosphatidylcholine GPI19 YDR437W Subunit of GPI‐GlcNAc transferase involved in synthesis of N‐ ‐1.0492 0.0019 acetylglucosaminyl phosphatidylinositol (GlcNAc‐PI), which is the first intermediate in glycosylphosphatidylinositol (GPI) anchor synthesis, shares similarity with mammalian PIG‐P NA YMR279C Putative paralog of ATR1, but not required for boron tolerance; ‐1.0426 0.0015 identified as a heat‐induced gene in a high‐throughout screen; YMR279C is not an essential gene NA YOL014W Putative protein of unknown function ‐1.0419 0.0070 FUS2 YMR232W Cytoplasmic protein localized to the shmoo tip; required for the ‐1.0404 0.0033 alignment of parental nuclei before nuclear fusion during mating PRM2 YIL037C Pheromone‐regulated protein, predicted to have 4 transmembrane ‐1.0365 0.0287 segments and a coiled coil domain; regulated by Ste12p; required for efficient nuclear fusion CLN2 YPL256C G1 cyclin involved in regulation of the cell cycle; activates Cdc28p ‐1.0334 0.0025 kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐ Mbp1p) and SBF (Swi6p‐Swi4p) WHI5 YOR083W Repressor of G1 transcription that binds to SCB binding factor (SBF) ‐1.0283 0.0069 at SCB target promoters in early G1; phosphorylation of Whi5p by the CDK, Cln3p/Cdc28p relieves repression and promoter binding by Whi5; periodically expressed in G1 SLI15 YBR156C Subunit of the conserved chromosomal passenger complex (CPC; ‐1.0253 0.0009 Ipl1p‐Sli15p‐Bir1p‐Nbl1p), which regulates kinetochore‐microtubule attachments, activation of the spindle tension checkpoint, and mitotic spindle disassembly 279

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al SPO23 YBR250W Protein of unknown function; associates with meiosis‐specific protein ‐1.0248 0.0070 Spo1p NA NA NA ‐1.0171 0.0069 EXG2 YDR261C Exo‐1,3‐beta‐glucanase, involved in cell wall beta‐glucan assembly; ‐1.0140 0.0035 may be anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor STE2 YFL026W Receptor for alpha‐factor pheromone; seven transmembrane‐ ‐1.0118 0.0016 domain GPCR that interacts with both pheromone and a heterotrimeric G protein to initiate the signaling response that leads to mating between haploid a and alpha cells PRY2 YKR013W Protein of unknown function ‐1.0117 0.0014 LRG1 YDL240W Putative GTPase‐activating protein (GAP) involved in the Pkc1p‐ ‐1.0074 0.0012 mediated signaling pathway that controls cell wall integrity; appears to specifically regulate 1,3‐beta‐glucan synthesis GEM1 YAL048C Evolutionarily‐conserved tail‐anchored outer mitochondrial ‐1.0037 0.0049 membrane GTPase which regulates mitochondrial morphology; cells lacking Gem1p contain collapsed, globular, or grape‐like mitochondria; not required for pheromone‐induced cell death SAE2 YGL175C Endonuclease that processes hairpin DNA structures with the MRX ‐1.0015 0.0040 complex; involved in meiotic and mitotic double‐strand break repair; phosphorylated in response to DNA damage and required for normal resistance to DNA‐damaging agents NA YDL114W Putative protein of unknown function with similarity to acyl‐carrier‐ ‐0.9974 0.0080 protein reductases; YDL114W is not an essential gene SMK1 YPR054W Middle sporulation‐specific mitogen‐activated protein kinase (MAPK) ‐0.9917 0.0040 required for production of the outer spore wall layers; negatively regulates activity of the glucan synthase subunit Gsc2p YPT35 YHR105W Endosomal protein of unknown function that contains a phox (PX) ‐0.9895 0.0090 homology domain and binds to both phosphatidylinositol‐3‐ phosphate (PtdIns(3)P) and proteins involved in ER‐Golgi or vesicular transport ENT4 YLL038C Protein of unknown function, contains an N‐terminal epsin‐like ‐0.9841 0.0152 domain; proposed to be involved in the trafficking of Arn1p in the absence of ferrichrome AUS1 YOR011W Transporter of the ATP‐binding cassette family, involved in uptake of ‐0.9791 0.0055 sterols and anaerobic growth KAR5 YMR065W Protein required for nuclear membrane fusion during karyogamy, ‐0.9719 0.0009 localizes to the membrane with a soluble portion in the endoplasmic reticulum lumen, may form a complex with Jem1p and Kar2p; expression of the gene is regulated by pheromone UTR2 YEL040W Chitin transglycosylase that functions in the transfer of chitin to ‐0.9691 0.0019 beta(1‐6) and beta(1‐3) glucans in the cell wall; similar to and functionally redundant with Crh1; glycosylphosphatidylinositol (GPI)‐ anchored protein localized to bud neck IZH4 YOL101C Membrane protein involved in zinc ion homeostasis, member of the ‐0.9617 0.0241 four‐protein IZH family, expression induced by fatty acids and altered zinc levels; deletion reduces sensitivity to excess zinc; possible role in sterol metabolism RIM4 YHL024W Putative RNA‐binding protein required for the expression of early ‐0.9562 0.0109 and middle sporulation genes NA YMR147W Putative protein of unknown function ‐0.9502 0.0040 GIC1 YHR061C Protein of unknown function involved in initiation of budding and ‐0.9414 0.0086 cellular polarization, interacts with Cdc42p via the Cdc42/Rac‐ interactive binding (CRIB) domain DCI1 YOR180C Peroxisomal protein; identification as a delta(3,5)‐delta(2,4)‐dienoyl‐ ‐0.9355 0.0108 CoA isomerase involved in fatty acid metabolism is disputed NA YJL118W Putative protein of unknown function; may interact with ribosomes, ‐0.9331 0.0207 based on co‐purification experiments; YJL18W is a non‐essential gene; deletion enhances the toxicity of heterologously expressed 280

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al human alpha‐synuclein HEM13 YDR044W Coproporphyrinogen III oxidase, an oxygen requiring enzyme that ‐0.9268 0.0048 catalyzes the sixth step in the heme biosynthetic pathway; transcription is repressed by oxygen and heme (via Rox1p and Hap1p) YHB1 YGR234W Nitric oxide oxidoreductase, flavohemoglobin involved in nitric oxide ‐0.9247 0.0103 detoxification; plays a role in the oxidative and nitrosative stress responses PET122 YER153C Mitochondrial translational activator specific for the COX3 mRNA, ‐0.9217 0.0102 acts together with Pet54p and Pet494p; located in the mitochondrial inner membrane NA YCR101C Putative protein of unknown function; localizes to the membrane ‐0.9206 0.0209 fraction; YCR101C is not an essential gene NA YGR109W‐B Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated ‐0.9171 0.0023 as one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes TPO1 YLL028W Polyamine transporter that recognizes spermine, putrescine, and ‐0.9144 0.0071 spermidine; catalyzes uptake of polyamines at alkaline pH and excretion at acidic pH; phosphorylation enhances activity and sorting to the plasma membrane SPS1 YDR523C Putative protein serine/threonine kinase expressed at the end of ‐0.9102 0.0439 meiosis and localized to the prospore membrane, required for correct localization of enzymes involved in spore wall synthesis CLB4 YLR210W B‐type cyclin involved in cell cycle progression; activates Cdc28p to ‐0.9096 0.0020 promote the G2/M transition; may be involved in DNA replication and spindle assembly; accumulates during S phase and G2, then targeted for ubiquitin‐mediated degradation HMLALPHA YCL066W Silenced copy of ALPHA1 at HML, encoding a transcriptional ‐0.9033 0.0030 1 coactivator involved in the regulation of mating‐type alpha‐specific gene expression GAL7 YBR018C Galactose‐1‐phosphate uridyl transferase, synthesizes glucose‐1‐ ‐0.9031 0.0035 phosphate and UDP‐galactose from UDP‐D‐glucose and alpha‐D‐ galactose‐1‐phosphate in the second step of galactose catabolism SRL1 YOR247W Mannoprotein that exhibits a tight association with the cell wall, ‐0.8986 0.0012 required for cell wall stability in the absence of GPI‐anchored mannoproteins; has a high serine‐threonine content; expression is induced in cell wall mutants MAM1 YER106W Monopolin, kinetochore associated protein involved in chromosome ‐0.8973 0.0197 attachment to meiotic spindle MFA2 YNL145W Mating pheromone a‐factor, made by a cells; interacts with alpha ‐0.8942 0.0056 cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C‐terminal modification, N‐terminal proteolysis, and export; also encoded by MFA1 PDR18 YNR070W Putative transporter of the ATP‐binding cassette (ABC) family, ‐0.8933 0.0065 implicated in pleiotropic drug resistance; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐ throughput studies FCY22 YER060W‐A Putative purine‐cytosine permease, very similar to Fcy2p but cannot ‐0.8926 0.0215 substitute for its function HMS1 YOR032C Basic helix‐loop‐helix (bHLH) protein with similarity to myc‐family ‐0.8865 0.0025 transcription factors; overexpression confers hyperfilamentous growth and suppresses the pseudohyphal filamentation defect of a diploid mep1 mep2 homozygous null mutant KAR9 YPL269W Karyogamy protein required for correct positioning of the mitotic ‐0.8691 0.0020 spindle and for orienting cytoplasmic microtubules, localizes at the shmoo tip in mating cells and at the tip of the growing bud in small‐ budded cells through anaphase PRM8 YGL053W Pheromone‐regulated protein with 2 predicted transmembrane ‐0.8682 0.0012

281

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al segments and an FF sequence, a motif involved in COPII binding; forms a complex with Prp9p in the ER; member of DUP240 gene family AAR2 YBL074C Component of the U5 snRNP, required for splicing of U3 precursors; ‐0.8681 0.0062 originally described as a splicing factor specifically required for splicing pre‐mRNA of the MATa1 cistron NRT1 YOR071C High‐affinity nicotinamide riboside transporter; also transports ‐0.8665 0.0086 thiamine with low affinity; shares sequence similarity with Thi7p and Thi72p; proposed to be involved in 5‐fluorocytosine sensitivity MMS21 YEL019C SUMO ligase involved in chromosomal organization and DNA repair; ‐0.8660 0.0133 essential subunit of the Mms21‐Smc5‐Smc6 complex; mutants are sensitive to methyl methanesulfonate and show increased spontaneous mutation and mitotic recombination GAL10 YBR019C UDP‐glucose‐4‐epimerase, catalyzes the interconversion of UDP‐ ‐0.8647 0.0048 galactose and UDP‐D‐glucose in galactose metabolism; also catalyzes the conversion of alpha‐D‐glucose or alpha‐D‐galactose to their beta‐ anomers FDH1 YOR388C NAD(+)‐dependent formate dehydrogenase, may protect cells from ‐0.8565 0.0076 exogenous formate STE14 YDR410C Farnesyl cysteine‐carboxyl methyltransferase, mediates the carboxyl ‐0.8546 0.0020 methylation step during C‐terminal CAAX motif processing of a‐factor and RAS proteins in the endoplasmic reticulum, localizes to the ER membrane PDR15 YDR406W Plasma membrane ATP binding cassette (ABC) transporter, multidrug ‐0.8530 0.0025 transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element CDA1 YLR307W Chitin deacetylase, together with Cda2p involved in the biosynthesis ‐0.8521 0.0103 ascospore wall component, chitosan; required for proper rigidity of the ascospore wall NA YCR100C Putative protein of unknown function ‐0.8420 0.0122 RAX2 YLR084C N‐glycosylated protein involved in the maintenance of bud site ‐0.8415 0.0048 selection during bipolar budding; localization requires Rax1p; RAX2 mRNA stability is regulated by Mpt5p RPL13A YDL082W Protein component of the large (60S) ribosomal subunit, nearly ‐0.8407 0.0371 identical to Rpl13Bp; not essential for viability; has similarity to rat L13 ribosomal protein MSN4 YKL062W Transcriptional activator related to Msn2p; activated in stress ‐0.8400 0.0208 conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression YJU2 YKL095W Essential protein required for pre‐mRNA splicing; associates ‐0.8361 0.0088 transiently with the spliceosomal NTC ("nineteen complex") and acts after Prp2p to promote the first catalytic reaction of splicing RTC4 YNL254C Protein of unknown function; null mutation suppresses cdc13‐1 ‐0.8320 0.0028 temperature sensitivity; (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus NA NA NA ‐0.8311 0.0029 NA YDL109C Putative lipase; involved in lipid metabolism; YDL109C is not an ‐0.8304 0.0028 essential gene ATP10 YLR393W Mitochondrial inner membrane protein required for assembly of the ‐0.8282 0.0062 F0 sector of mitochondrial F1F0 ATP synthase, interacts genetically with ATP6 FMP45 YDL222C Integral membrane protein localized to mitochondria (untagged ‐0.8273 0.0095 protein); required for sporulation and maintaining sphingolipid content; has sequence similarity to SUR7 and YNL194C NA YJR154W Putative protein of unknown function; green fluorescent protein ‐0.8261 0.0282 (GFP)‐fusion protein localizes to the cytoplasm NIS1 YNL078W Protein localized in the bud neck at G2/M phase; physically interacts ‐0.8216 0.0034 282

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al with septins; possibly involved in a mitotic signaling network TEC1 YBR083W Transcription factor required for full Ty1 expression, Ty1‐mediated ‐0.8197 0.0016 gene activation, and haploid invasive and diploid pseudohyphal growth; TEA/ATTS DNA‐binding domain family member SIM1 YIL123W Protein of the SUN family (Sim1p, Uth1p, Nca3p, Sun4p) that may ‐0.8182 0.0056 participate in DNA replication, promoter contains SCB regulation box at ‐300 bp indicating that expression may be cell cycle‐regulated SCW11 YGL028C Cell wall protein with similarity to glucanases; may play a role in ‐0.8108 0.0088 conjugation during mating based on its regulation by Ste12p SRB8 YCR081W Subunit of the RNA polymerase II mediator complex; associates with ‐0.8099 0.0025 core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; involved in glucose repression MEI4 YER044C‐A Meiosis‐specific protein involved in double‐strand break formation ‐0.8094 0.0077 during meiotic recombination; required for chromosome synapsis and production of viable spores IRC15 YPL017C Microtubule associated protein; regulates microtubule dynamics; ‐0.8088 0.0055 required for accurate meiotic chromosome segregation; null mutant displays large budded cells due to delayed mitotic progression, increased levels of spontaneous Rad52 foci NA YJL107C Putative protein of unknown function; expression is induced by ‐0.8087 0.0048 activation of the HOG1 mitogen‐activated signaling pathway and this induction is Hog1p/Pbs2p dependent; YJL107C and adjacent ORF, YJL108C are merged in related fungi BNA4 YBL098W Kynurenine 3‐mono oxygenase, required for the de novo ‐0.8074 0.0017 biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p; putative therapeutic target for Huntington disease NA YDR042C Putative protein of unknown function; expression is increased in ‐0.8053 0.0091 ssu72‐ts69 mutant MUC1 YIR019C GPI‐anchored cell surface glycoprotein (flocculin) required for ‐0.8024 0.0200 pseudohyphal formation, invasive growth, flocculation, and biofilms; transcriptionally regulated by the MAPK pathway (via Ste12p and Tec1p) and the cAMP pathway (via Flo8p) NUT2 YPR168W Subunit of the RNA polymerase II mediator complex; associates with ‐0.7998 0.0324 core polymerase subunits to form the RNA polymerase II holoenzyme; required for transcriptional activation and has a role in basal transcription NA YKR104W Putative transporter of the multidrug resistance‐associated protein ‐0.7994 0.0187 (MRP) subfamily; contains a stop codon in S288C; adjacent ORFs YKR103W and YKR104W are merged in different strain backgrounds NA YGL101W Putative protein of unknown function; non‐essential gene with ‐0.7988 0.0075 similarity to YBR242W; interacts with the DNA helicase Hpr5p IRC7 YFR055W Putative cystathionine beta‐lyase; involved in copper ion ‐0.7980 0.0043 homeostasis and sulfur metabolism; null mutant displays increased levels of spontaneous Rad52p foci; expression induced by nitrogen limitation in a GLN3, GAT1‐dependent manner DED1 YOR204W ATP‐dependent DEAD (Asp‐Glu‐Ala‐Asp)‐box RNA helicase, required ‐0.7979 0.0070 for translation initiation of all yeast mRNAs; mutations in human DEAD‐box DBY are a frequent cause of male infertility BBP1 YPL255W Protein required for the spindle pole body (SPB) duplication, localized ‐0.7966 0.0028 at the central plaque periphery; forms a complex with a nuclear envelope protein Mps2p and SPB components Spc29p and Kar1p; required for mitotic functions of Cdc5p SCC2 YDR180W Subunit of cohesin loading factor (Scc2p‐Scc4p), a complex required ‐0.7923 0.0176 for loading of cohesin complexes onto chromosomes; involved in establishing sister chromatid cohesion during DSB repair via histone H2AX; evolutionarily‐conserved adherin NDJ1 YOL104C Meiosis‐specific telomere protein, required for bouquet formation, ‐0.7823 0.0043

283

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al effective homolog pairing, ordered cross‐over distribution, sister chromatid cohesion at meiotic telomeres, chromosomal segregation and telomere‐led rapid prophase movement TAT1 YBR069C Amino acid transport protein for valine, leucine, isoleucine, and ‐0.7816 0.0016 tyrosine, low‐affinity tryptophan and histidine transporter; overexpression confers FK506 and FTY720 resistance SFK1 YKL051W Plasma membrane protein that may act together with or upstream of ‐0.7796 0.0249 Stt4p to generate normal levels of the essential phospholipid PI4P, at least partially mediates proper localization of Stt4p to the plasma membrane NA YGR035C Putative protein of unknown function, potential Cdc28p substrate; ‐0.7784 0.0136 transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance VBA2 YBR293W Permease of basic amino acids in the vacuolar membrane ‐0.7779 0.0070 THI7 YLR237W Plasma membrane transporter responsible for the uptake of ‐0.7771 0.0021 thiamine, member of the major facilitator superfamily of transporters; mutation of human ortholog causes thiamine‐ responsive megaloblastic anemia SPC42 YKL042W Central plaque component of spindle pole body (SPB); involved in ‐0.7767 0.0034 SPB duplication, may facilitate attachment of the SPB to the nuclear membrane HBT1 YDL223C Substrate of the Hub1p ubiquitin‐like protein that localizes to the ‐0.7758 0.0102 shmoo tip (mating projection); mutants are defective for mating projection formation, thereby implicating Hbt1p in polarized cell morphogenesis KSS1 YGR040W Mitogen‐activated protein kinase (MAPK) involved in signal ‐0.7749 0.0056 transduction pathways that control filamentous growth and pheromone response; the KSS1 gene is nonfunctional in S288C strains and functional in W303 strains PHD1 YKL043W Transcriptional activator that enhances pseudohyphal growth; ‐0.7748 0.0232 regulates expression of FLO11, an adhesin required for pseudohyphal filament formation; similar to StuA, an A. nidulans developmental regulator; potential Cdc28p substrate NA YPR071W Putative membrane protein; YPR071W is not an essential gene ‐0.7731 0.0022 NA YNR062C Putative membrane protein of unknown function ‐0.7713 0.0039 ERD1 YDR414C Predicted membrane protein required for the retention of lumenal ‐0.7569 0.0095 endoplasmic reticulum proteins; mutants secrete the endogenous ER protein, BiP (Kar2p) NA YLR012C Putative protein of unknown function; YLR012C is not an essential ‐0.7569 0.0234 gene POP3 YNL282W Subunit of both RNase MRP, which cleaves pre‐rRNA, and nuclear ‐0.7522 0.0198 RNase P, which cleaves tRNA precursors to generate mature 5' ends ATG15 YCR068W Lipase required for intravacuolar lysis of autophagic bodies and Cvt ‐0.7504 0.0072 bodies; targeted to intravacuolar vesicles during autophagy via the multivesicular body (MVB) pathway UME6 YDR207C Key transcriptional regulator of early meiotic genes, binds URS1 ‐0.7464 0.0070 upstream regulatory sequence, couples metabolic responses to nutritional cues with initiation and progression of meiosis, forms complex with Ime1p, and also with Sin3p‐Rpd3p NA YHR140W Putative integral membrane protein of unknown function ‐0.7434 0.0210 STB5 YHR178W Transcription factor, involved in regulating multidrug resistance and ‐0.7386 0.0028 oxidative stress response; forms a heterodimer with Pdr1p; contains a Zn(II)2Cys6 zinc finger domain that interacts with a pleiotropic drug resistance element in vitro YPT11 YNL304W Rab family GTPase that interacts with the C‐terminal tail domain of ‐0.7380 0.0059 Myo2p; mediates distribution of mitochondria and endoplasmic reticuli to daughter cells NA YOL019W Protein of unknown function; green fluorescent protein (GFP)‐fusion ‐0.7335 0.0070 protein localizes to the cell periphery and vacuole 284

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al NA NA NA ‐0.7333 0.0158 RPL18B YNL301C Protein component of the large (60S) ribosomal subunit, identical to ‐0.7313 0.0187 Rpl18Ap and has similarity to rat L18 ribosomal protein NA YOL163W Putative protein of unknown function; member of the Dal5p ‐0.7266 0.0479 subfamily of the major facilitator family MPS2 YGL075C Essential membrane protein localized at the nuclear envelope and ‐0.7252 0.0044 spindle pole body (SPB), required for insertion of the newly duplicated SPB into the nuclear envelope; potentially phosphorylated by Cdc28p GAS3 YMR215W Low abundance, possibly inactive member of the GAS family of GPI‐ ‐0.7239 0.0031 containing proteins; putative 1,3‐beta‐glucanosyltransferase with similarity to other GAS family members; localizes to the cell wall; mRNA induced during sporulation NA YJR124C Putative protein of unknown function; expression induced under ‐0.7204 0.0282 calcium shortage PDR12 YPL058C Plasma membrane ATP‐binding cassette (ABC) transporter, weak‐ ‐0.7192 0.0051 acid‐inducible multidrug transporter required for weak organic acid resistance; induced by sorbate and benzoate and regulated by War1p; mutants exhibit sorbate hypersensitivity FIG2 YCR089W Cell wall adhesin, expressed specifically during mating; may be ‐0.7180 0.0024 involved in maintenance of cell wall integrity during mating IRC4 YDR540C Putative protein of unknown function; null mutant displays increased ‐0.7167 0.0230 levels of spontaneous Rad52p foci; green fluorescent protein (GFP)‐ fusion protein localizes to the cytoplasm and nucleus HXT5 YHR096C Hexose transporter with moderate affinity for glucose, induced in the ‐0.7130 0.0334 presence of non‐fermentable carbon sources, induced by a decrease in growth rate, contains an extended N‐terminal domain relative to other HXTs BUB3 YOR026W Kinetochore checkpoint WD40 repeat protein that localizes to ‐0.7124 0.0165 kinetochores during prophase and metaphase, delays anaphase in the presence of unattached kinetochores; forms complexes with Mad1p‐Bub1p and with Cdc20p, binds Mad2p and Mad3p MF(ALPHA) YPL187W Mating pheromone alpha‐factor, made by alpha cells; interacts with ‐0.7113 0.0016 1 mating type a cells to induce cell cycle arrest and other responses leading to mating; also encoded by MF(ALPHA)2, although MF(ALPHA)1 produces most alpha‐factor MCD4 YKL165C Protein involved in glycosylphosphatidylinositol (GPI) anchor ‐0.7080 0.0049 synthesis; multimembrane‐spanning protein that localizes to the endoplasmic reticulum; highly conserved among eukaryotes CIS3 YJL158C Mannose‐containing glycoprotein constituent of the cell wall; ‐0.7077 0.0016 member of the PIR (proteins with internal repeats) family NA YOR186W Putative protein of unknown function; proper regulation of ‐0.7077 0.0154 expression during heat stress is sphingolipid‐dependent SMP1 YBR182C Putative transcription factor involved in regulating the response to ‐0.7069 0.0277 osmotic stress; member of the MADS‐box family of transcription factors FHN1 YGR131W Protein of unknown function; induced by ketoconazole; promoter ‐0.7053 0.0145 region contains sterol regulatory element motif, which has been identified as a Upc2p‐binding site; overexpression complements function of Nce102p in NCE102 deletion strain HUA2 YOR284W Cytoplasmic protein of unknown function; computational analysis of ‐0.7041 0.0152 large‐scale protein‐protein interaction data suggests a possible role in actin patch assembly PUN1 YLR414C Putative protein of unknown function; localizes to bud and ‐0.7038 0.0073 cytoplasm; co‐localizes with Sur7p in punctate patches in the plasma membrane; null mutant displays decreased thermotolerance; transcription induced on cell wall damage NA YAR068W Fungal‐specific protein of unknown function; induced in respiratory‐ ‐0.7036 0.0335 deficient cells

285

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al NA YNR061C Putative protein of unknown function ‐0.7011 0.0025 NA YJL147C Mitochondrial protein of unknown function; homozygous diploid ‐0.6997 0.0043 deletion strain has a sporulation defect characterized by elevated dityrosine in the soluble fraction; expression induced by calcium shortage; YJL147W is a non‐essential gene NA YNL034W Putative protein of unknown function; YNL034W is not an essential ‐0.6963 0.0080 gene CAR2 YLR438W L‐ornithine transaminase (OTAse), catalyzes the second step of ‐0.6951 0.0180 arginine degradation, expression is dually‐regulated by allophanate induction and a specific arginine induction process; not nitrogen catabolite repression sensitive WHI3 YNL197C RNA binding protein that sequesters CLN3 mRNA in cytoplasmic foci; ‐0.6947 0.0201 cytoplasmic retention factor for Cdc28p and associated cyclins; regulates cell fate and dose‐dependently regulates the critical cell size required for passage through Start NA YLR040C Putative protein of unknown function; localizes to the cell wall; ‐0.6903 0.0019 predicted to be a GPI‐attached protein; upregulated by Mcm1p‐ Alpha1p transcription factor; partially overlaps the dubious ORF YLR041W; YLR040C is not essential PRP39 YML046W U1 snRNP protein involved in splicing, contains multiple ‐0.6869 0.0017 tetriatricopeptide repeats TOS2 YGR221C Protein involved in localization of Cdc24p to the site of bud growth; ‐0.6843 0.0027 may act as a membrane anchor; localizes to the bud neck and bud tip; potentially phosphorylated by Cdc28p NA YDR124W Putative protein of unknown function; non‐essential gene; ‐0.6827 0.0241 expression is strongly induced by alpha factor AAD6 YFL056C Putative aryl‐alcohol dehydrogenase with similarity to P. ‐0.6815 0.0292 chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin PDR11 YIL013C ATP‐binding cassette (ABC) transporter, multidrug transporter ‐0.6740 0.0077 involved in multiple drug resistance; mediates sterol uptake when sterol biosynthesis is compromisedregulated by Pdr1p; required for anaerobic growth NA YJL160C Putative protein of unknown function; member of the PIR (proteins ‐0.6737 0.0182 with internal repeats) family of cell wall proteins; non‐essential gene that is required for sporulation; mRNA is weakly cell cycle regulated, peaking in mitosis TCA17 YEL048C Protein that interacts with subunits of the TRAPP complex and may ‐0.6699 0.0411 play a role its assembly or stability; mutation is synthetically lethal with gcs1 deletion; Sedlin_N family member; human Sedlin mutations cause the skeletal disorder SEDT NA YPL152W‐A Identified by gene‐trapping, microarray‐based expression analysis, ‐0.6694 0.0048 and genome‐wide homology searching NA YLR415C Putative protein of unknown function; YLR415C is not an essential ‐0.6694 0.0051 gene PST1 YDR055W Cell wall protein that contains a putative GPI‐attachment site; ‐0.6671 0.0152 secreted by regenerating protoplasts; up‐regulated by activation of the cell integrity pathway, as mediated by Rlm1p; upregulated by cell wall damage via disruption of FKS1 NA YIL166C Putative protein with similarity to the allantoate permease (Dal5p) ‐0.6659 0.0155 subfamily of the major facilitator superfamily; mRNA expression is elevated by sulfur limitation; YIL166C is a non‐essential gene SDS3 YIL084C Component of the Rpd3p/Sin3p deacetylase complex required for its ‐0.6653 0.0243 structural integrity and catalytic activity, involved in transcriptional silencing and required for sporulation; cells defective in SDS3 display pleiotropic phenotypes MCM3 YEL032W Protein involved in DNA replication; component of the Mcm2‐7 ‐0.6633 0.0019 hexameric complex that binds chromatin as a part of the pre‐

286

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al replicative complex NA YPL272C Putative protein of unknown function; gene expression induced in ‐0.6627 0.0131 response to ketoconazole; YPL272C is not an essential gene PIP2 YOR363C Autoregulatory oleate‐specific transcriptional activator of ‐0.6605 0.0055 peroxisome proliferation, contains Zn(2)‐Cys(6) cluster domain, forms heterodimer with Oaf1p, binds oleate response elements (OREs), activates beta‐oxidation genes COG1 YGL223C Essential component of the conserved oligomeric Golgi complex ‐0.6579 0.0056 (Cog1p through Cog8p), a cytosolic tethering complex that functions in protein trafficking to mediate fusion of transport vesicles to Golgi compartments RNR1 YER070W Major isoform of the large subunit of ribonucleotide‐diphosphate ‐0.6579 0.0384 reductase; the RNR complex catalyzes rate‐limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits NA YMR144W Putative protein of unknown function; localized to the nucleus; ‐0.6562 0.0086 YMR144W is not an essential gene YHK8 YHR048W Presumed antiporter of the DHA1 family of multidrug resistance ‐0.6523 0.0153 transporters; contains 12 predicted transmembrane spans; expression of gene is up‐regulated in cells exhibiting reduced susceptibility to azoles NA YJR149W Putative protein of unknown function; green fluorescent protein ‐0.6496 0.0117 (GFP)‐fusion protein localizes to the cytoplasm FEN2 YCR028C Plasma membrane H+‐pantothenate symporter; confers sensitivity to ‐0.6495 0.0065 the antifungal agent fenpropimorph HST3 YOR025W Member of the Sir2 family of NAD(+)‐dependent protein ‐0.6470 0.0345 deacetylases; involved along with Hst4p in telomeric silencing, cell cycle progression, radiation resistance, genomic stability and short‐ chain fatty acid metabolism SPR1 YOR190W Sporulation‐specific exo‐1,3‐beta‐glucanase; contributes to ‐0.6467 0.0283 ascospore thermoresistance ASE1 YOR058C Mitotic spindle midzone localized microtubule‐associated protein ‐0.6467 0.0144 (MAP) family member; required for spindle elongation and stabilization; undergoes cell cycle‐regulated degradation by anaphase promoting complex; potential Cdc28p substrate SPC29 YPL124W Inner plaque spindle pole body (SPB) component, links the central ‐0.6440 0.0043 plaque component Spc42p to the inner plaque component Spc110p; required for SPB duplication SMA2 YML066C Meiosis‐specific prospore membrane protein; required to produce ‐0.6404 0.0239 bending force necessary for proper assembly of the prospore membrane during sporulation RNR3 YIL066C Minor isoform of the large subunit of ribonucleotide‐diphosphate ‐0.6382 0.0157 reductase; the RNR complex catalyzes rate‐limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits CDC5 YMR001C Polo‐like kinase with multiple functions in mitosis and cytokinesis ‐0.6375 0.0104 through substrate phosphorylation, also functions in adaptation to DNA damage during meiosis; has similarity to Xenopus Plx1 and S. pombe Plo1p; possible Cdc28p substrate AXL2 YIL140W Integral plasma membrane protein required for axial budding in ‐0.6372 0.0043 haploid cells, localizes to the incipient bud site and bud neck; glycosylated by Pmt4p; potential Cdc28p substrate ECM25 YJL201W Non‐essential protein of unknown function; promoter contains a ‐0.6367 0.0056 consensus binding sequence for factor Abf1p ECI1 YLR284C Peroxisomal delta3,delta2‐enoyl‐CoA isomerase, hexameric protein ‐0.6365 0.0025 that converts 3‐hexenoyl‐CoA to trans‐2‐hexenoyl‐CoA, essential for the beta‐oxidation of unsaturated fatty acids, oleate‐induced ATG29 YPL166W Autophagy‐specific protein that is required for recruitment of other ‐0.6347 0.0208 ATG proteins to the pre‐autophagosomal structure (PAS); interacts

287

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al with Atg17p and localizas to the PAS in a manner interdependent with Atg17p and Cis1p; not conserved PCL9 YDL179W Cyclin, forms a functional kinase complex with Pho85p cyclin‐ ‐0.6312 0.0064 dependent kinase (Cdk), expressed in late M/early G1 phase, activated by Swi5p THI72 YOR192C Transporter of thiamine or related compound; shares sequence ‐0.6296 0.0345 similarity with Thi7p MSG5 YNL053W Dual‐specificity protein phosphatase; exists in 2 isoforms; required ‐0.6290 0.0141 for maintenance of a low level of signaling through the cell integrity pathway, adaptive response to pheromone; regulates and is regulated by Slt2p; dephosphorylates Fus3p HOF1 YMR032W Bud neck‐localized, SH3 domain‐containing protein required for ‐0.6275 0.0096 cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins, Bni1p and Bnr1p, and with Cyk3p, Vrp1p, and Bni5p MSN2 YMR037C Transcriptional activator related to Msn4p; activated in stress ‐0.6271 0.0069 conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression CAF120 YNL278W Part of the evolutionarily‐conserved CCR4‐NOT transcriptional ‐0.6264 0.0362 regulatory complex involved in controlling mRNA initiation, elongation, and degradation FUS3 YBL016W Mitogen‐activated serine/threonine protein kinase involved in ‐0.6248 0.0062 mating; phosphoactivated by Ste7p; substrates include Ste12p, Far1p, Bni1p, Sst2p; inhibits invasive growth during mating by phosphorylating Tec1p, promoting its degradation HPR1 YDR138W Subunit of THO/TREX complexes that couple transcription elongation ‐0.6167 0.0025 with mitotic recombination and with mRNA metabolism and export, subunit of an RNA Pol II complex; regulates lifespan; involved in telomere maintenance; similar to Top1p HCM1 YCR065W Forkhead transcription factor that drives S‐phase specific expression ‐0.6155 0.0206 of genes involved in chromosome segregation, spindle dynamics, and budding; suppressor of calmodulin mutants with specific SPB assembly defects; telomere maintenance role KIP1 YBL063W Kinesin‐related motor protein required for mitotic spindle assembly, ‐0.6143 0.0208 chromosome segregation, and 2 micron plasmid partitioning; functionally redundant with Cin8p for chromosomal but not plasmid functions NA YPL067C Putative protein of unknown function; green fluorescent protein ‐0.6141 0.0023 (GFP)‐fusion protein localizes to the cytoplasm; YPL067C is not an essential gene MUM3 YOR298W Protein of unknown function involved in the organization of the ‐0.6135 0.0366 outer spore wall layers; has similarity to the tafazzins superfamily of acyltransferases MPD2 YOL088C Member of the protein disulfide isomerase (PDI) family, exhibits ‐0.6114 0.0034 chaperone activity; overexpression suppresses the lethality of a pdi1 deletion but does not complement all Pdi1p functions; undergoes oxidation by Ero1p SFL1 YOR140W Transcriptional repressor and activator; involved in repression of ‐0.6109 0.0182 flocculation‐related genes, and activation of stress responsive genes; negatively regulated by cAMP‐dependent protein kinase A subunit Tpk2p RAX1 YOR301W Protein involved in bud site selection during bipolar budding; ‐0.6097 0.0061 localization requires Rax2p; has similarity to members of the insulin‐ related peptide superfamily NA YPL041C Protein of unknown function involved in maintenance of proper ‐0.6090 0.0104 telomere length NA YGL015C Putative protein of unknown function; null mutants accumulate ‐0.6085 0.0101 cargo in the Golgi

288

log2(msn5 adj.p.v Symbols ORF Description .Ts/WT.Ts) al GAS1 YMR307W Beta‐1,3‐glucanosyltransferase, required for cell wall assembly and ‐0.6079 0.0049 also has a role in transcriptional silencing; localizes to the cell surface via a glycosylphosphatidylinositol (GPI) anchor; also found at the nuclear periphery RGD2 YFL047W GTPase‐activating protein (RhoGAP) for Cdc42p and Rho5p ‐0.6060 0.0039 NA YOR390W Putative protein of unknown function ‐0.6034 0.0034 PRM3 YPL192C Pheromone‐regulated protein required for nuclear envelope fusion ‐0.6013 0.0138 during karyogamy; localizes to the outer face of the nuclear membrane; interacts with Kar5p at the spindle pole body

289

APPENDIX O: Up-regulated genes in msn5Δ cells in amino acid starvation condition

This section includes the list of transcriptionally differentially expressed genes (cutoff

conditions: log2 FC 0.6 and adjusted p-value < 0.05) in msn5Δ cells in fed condition.

Up-regulated genes in msn5Δ cells in amino acid starvation condition

log2(msn5 Symbols ORF Description adj.p.val .Ts/WT.Ts) PHO84 YML123C High‐affinity inorganic phosphate (Pi) transporter and low‐affinity 6.0173 0.0000 manganese transporter; regulated by Pho4p and Spt7p; mutation confers resistance to arsenate; exit from the ER during maturation requires Pho86p SPL2 YHR136C Protein with similarity to cyclin‐dependent kinase inhibitors; 4.4287 0.0001 downregulates low‐affinity phosphate transport during phosphate limitation; overproduction suppresses a plc1 null mutation; GFP‐ fusion protein localizes to the cytoplasm PHO89 YBR296C Na+/Pi cotransporter, active in early growth phase; similar to 4.0506 0.0013 phosphate transporters of Neurospora crassa; transcription regulated by inorganic phosphate concentrations and Pho4p

PHM6 YDR281C Protein of unknown function, expression is regulated by phosphate 2.4826 0.0062 levels PHO11 YAR071W One of three repressible acid phosphatases, a glycoprotein that is 2.2526 0.0026 transported to the cell surface by the secretory pathway; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2

NA YHR214C‐E Putative protein of unknown function; identified by gene‐trapping, 2.1899 0.0021 microarray‐based expression analysis, and genome‐wide homology searching NA YGL262W Putative protein of unknown function; null mutant displays elevated 1.9801 0.0066 sensitivity to expression of a mutant huntingtin fragment or of alpha‐ synuclein; YGL262W is not an essential gene

VTC3 YPL019C Subunit of the vacuolar transporter chaperone (VTC) complex 1.8455 0.0009 involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion

MTH1 YDR277C Negative regulator of the glucose‐sensing signal transduction 1.6631 0.0012 pathway, required for repression of transcription by Rgt1p; interacts with Rgt1p and the Snf3p and Rgt2p glucose sensors; phosphorylated by Yck1p, triggering Mth1p degradation 290

COS12 YGL263W Protein of unknown function, member of the DUP380 subfamily of 1.5196 0.0095 conserved, often subtelomerically‐encoded proteins

NA YLR053C Putative protein of unknown function 1.4665 0.0069 NA YHR214C‐ Putative protein of unknown function; identified by gene‐trapping, 1.4197 0.0173 D microarray‐based expression analysis, and genome‐wide homology searching SOL4 YGR248W 6‐phosphogluconolactonase with similarity to Sol3p 1.3921 0.0147 REG2 YBR050C Regulatory subunit of the Glc7p type‐1 protein phosphatase; involved 1.3834 0.0015 with Reg1p, Glc7p, and Snf1p in regulation of glucose‐repressible genes, also involved in glucose‐induced proteolysis of maltose permease GDH3 YAL062W NADP(+)‐dependent glutamate dehydrogenase, synthesizes 1.3764 0.0053 glutamate from ammonia and alpha‐ketoglutarate; rate of alpha‐ ketoglutarate utilization differs from Gdh1p; expression regulated by nitrogen and carbon sources MOH1 YBL049W Protein of unknown function, has homology to kinase Snf7p; not 1.3625 0.0023 required for growth on nonfermentable carbon sources; essential for survival in stationary phase RGI1 YER067W Protein of unknown function involved in energy metabolism under 1.3593 0.0093 respiratory conditions; protein abundance is increased upon intracellular iron depletion SSA1 YAL005C ATPase involved in protein folding and nuclear localization signal 1.3518 0.0026 (NLS)‐directed nuclear transport; member of heat shock protein 70 (HSP70) family; forms a chaperone complex with Ydj1p; localized to the nucleus, cytoplasm, and cell wall DGR2 YKL121W Protein of unknown function; null mutant is resistant to 2‐deoxy‐D‐ 1.3377 0.0015 glucose and displays abnormally elongated buds NA YNL144C Putative protein of unknown function; the authentic, non‐tagged 1.3179 0.0210 protein is detected in highly purified mitochondria in high‐throughput studies; YNL144C is not an essential gene

NA YBL055C 3'‐‐>5' exonuclease and endonuclease with a possible role in 1.2901 0.0016 apoptosis; has similarity to mammalian and C. elegans apoptotic nucleases PHO81 YGR233C Cyclin‐dependent kinase (CDK) inhibitor, regulates Pho80p‐Pho85p 1.2787 0.0015 and Pcl7p‐Pho85p cyclin‐CDK complexes in response to phosphate levels; inhibitory activity for Pho80p‐Pho85p requires myo‐D‐inositol heptakisphosphate (IP7) generated by Vip1p CYB2 YML054C Cytochrome b2 (L‐lactate cytochrome‐c oxidoreductase), component 1.2371 0.0007 of the mitochondrial intermembrane space, required for lactate utilization; expression is repressed by glucose and anaerobic conditions PHO5 YBR093C Repressible acid phosphatase (1 of 3) that also mediates extracellular 1.2277 0.0066 nucleotide‐derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2 YPT53 YNL093W Rab family GTPase, similar to Ypt51p and Ypt52p and to mammalian 1.2200 0.0033 rab5; required for vacuolar protein sorting and endocytosis

TRX3 YCR083W Mitochondrial thioredoxin, highly conserved oxidoreductase required 1.2171 0.0004 to maintain the redox homeostasis of the cell, forms the mitochondrial thioredoxin system with Trr2p, redox state is maintained by both Trr2p and Glr1p

291

NA YOR289W Putative protein of unknown function; transcription induced by the 1.1988 0.0016 unfolded protein response; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus

HUB1 YNR032C‐ Ubiquitin‐like protein modifier, may function in modification of Sph1p 1.1861 0.0010 A and Hbt1p, functionally complemented by the human or S. pombe ortholog; mechanism of Hub1p adduct formation not yet clear

NA YKL151C Putative protein of unknown function; YKL151C promoter contains 1.1577 0.0012 STREs (stress response elements) and expression is induced by heat shock or methyl methanesulfonate; green fluorescent protein (GFP)‐ fusion protein localizes to the cytoplasm CSR2 YPR030W Nuclear protein proposed to regulate utilization of nonfermentable 1.1536 0.0022 carbon sources and endocytosis of plasma membrane proteins; overproduction suppresses chs5 spa2 lethality at high temp; ubiquitinated by Rsp5p, deubiquitinated by Ubp2p HXT4 YHR092C High‐affinity glucose transporter of the major facilitator superfamily, 1.1515 0.0259 expression is induced by low levels of glucose and repressed by high levels of glucose NA YLR312C Putative protein of unknown function 1.1370 0.0065 DCS2 YOR173W Non‐essential, stress induced regulatory protein; modulates m7G‐ 1.1227 0.0034 oligoribonucleotide metabolism; inhibits Dcs1p; regulated by Msn2p, Msn4p, and the Ras‐cAMP‐cAPK signaling pathway; mutant has increased aneuploidy tolerance NA NA NA 1.1215 0.0032 ISF1 YMR081C Serine‐rich, hydrophilic protein with similarity to Mbr1p; 1.1158 0.0131 overexpression suppresses growth defects of hap2, hap3, and hap4 mutants; expression is under glucose control; cotranscribed with NAM7 in a cyp1 mutant NA YGR174W‐ Putative protein of unknown function; predicted to have a role in cell 1.0900 0.0101 A budding based on computational "guilt by association" analysis CTF19 YPL018W Outer kinetochore protein, required for accurate mitotic 1.0857 0.0195 chromosome segregation; component of the kinetochore sub‐ complex COMA (Ctf19p, Okp1p, Mcm21p, Ame1p) that functions as a platform for kinetochore assembly RAD28 YDR030C Protein involved in DNA repair, related to the human CSA protein that 1.0854 0.0009 is involved in transcription‐coupled repair nucleotide excision repair

NA YNR034W‐ Putative protein of unknown function; expression is regulated by 1.0818 0.0065 A Msn2p/Msn4p TMA23 YMR269W Nucleolar protein of unknown function implicated in ribosome 1.0680 0.0154 biogenesis; TMA23 may be a fungal‐specific gene as no homologs have been yet identified in higher eukaryotes

VTC4 YJL012C Vacuolar membrane polyphosphate polymerase; subunit of the 1.0654 0.0016 vacuolar transporter chaperone (VTC) complex involved in synthesis and transfer of polyP to the vacuole; regulates membrane trafficking; role in non‐autophagic vacuolar fusion HXK1 YFR053C Hexokinase isoenzyme 1, a cytosolic protein that catalyzes 1.0552 0.0076 phosphorylation of glucose during glucose metabolism; expression is highest during growth on non‐glucose carbon sources; glucose‐ induced repression involves the hexokinase Hxk2p RTC3 YHR087W Protein of unknown function involved in RNA metabolism; has 1.0531 0.0485 structural similarity to SBDS, the human protein mutated in Shwachman‐Diamond Syndrome (the yeast SBDS ortholog = SDO1); null mutation suppresses cdc13‐1 temperature sensitivity

292

NA YDR018C Probable membrane protein with three predicted transmembrane 1.0382 0.0018 domains; homologous to Ybr042cp, similar to C. elegans F55A11.5 and maize 1‐acyl‐glycerol‐3‐phosphate acyltransferase

BCD1 YHR040W Essential protein required for the accumulation of box C/D snoRNA 1.0303 0.0152

VTC1 YER072W Subunit of the vacuolar transporter chaperone (VTC) complex 1.0297 0.0012 involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion; also has mRNA binding activity NA YBL086C Protein of unknown function; green fluorescent protein (GFP)‐fusion 1.0109 0.0018 protein localizes to the cell periphery CYC7 YEL039C Cytochrome c isoform 2, expressed under hypoxic conditions; 1.0009 0.0260 electron carrier of the mitochondrial intermembrane space that transfers electrons from ubiquinone‐cytochrome c oxidoreductase to cytochrome c oxidase during cellular respiration FUN19 YAL034C Non‐essential protein of unknown function; expression induced in 0.9980 0.0007 response to heat stress TSA2 YDR453C Stress inducible cytoplasmic thioredoxin peroxidase; cooperates with 0.9953 0.0104 Tsa1p in the removal of reactive oxygen, nitrogen and sulfur species using thioredoxin as hydrogen donor; deletion enhances the mutator phenotype of tsa1 mutants NA YGR102C Subunit of the trimeric GatFAB AmidoTransferase(AdT) complex; 0.9890 0.0025 involved in the formation of Q‐tRNAQ; transposon insertion mutant is salt sensitive and null mutant has growth defects; non‐tagged protein is detected in purified mitochondria CHA1 YCL064C Catabolic L‐serine (L‐threonine) deaminase, catalyzes the degradation 0.9776 0.0192 of both L‐serine and L‐threonine; required to use serine or threonine as the sole nitrogen source, transcriptionally induced by serine and threonine UGX2 YDL169C Protein of unknown function, transcript accumulates in response to 0.9618 0.0071 any combination of stress conditions PUT1 YLR142W Proline oxidase, nuclear‐encoded mitochondrial protein involved in 0.9616 0.0016 utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source USV1 YPL230W Putative transcription factor containing a C2H2 zinc finger; mutation 0.9583 0.0083 affects transcriptional regulation of genes involved in growth on non‐ fermentable carbon sources, response to salt stress and cell wall biosynthesis HSP78 YDR258C Oligomeric mitochondrial matrix chaperone that cooperates with 0.9579 0.0012 Ssc1p in mitochondrial thermotolerance after heat shock; able to prevent the aggregation of misfolded proteins as well as resolubilize protein aggregates COX17 YLL009C Copper metallochaperone that transfers copper to Sco1p and Cox11p 0.9496 0.0028 for eventual delivery to cytochrome c oxidase; contains twin cysteine‐ x9‐cysteine motifs STF2 YGR008C Protein involved in regulation of the mitochondrial F1F0‐ATP 0.9492 0.0189 synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein FMP46 YKR049C Putative redox protein containing a thioredoxin fold; the authentic, 0.9400 0.0016 non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies

293

PHO87 YCR037C Low‐affinity inorganic phosphate (Pi) transporter, involved in 0.9287 0.0025 activation of PHO pathway; expression is independent of Pi concentration and Pho4p activity; contains 12 membrane‐spanning segments HSP104 YLL026W Heat shock protein that cooperates with Ydj1p (Hsp40) and Ssa1p 0.9260 0.0042 (Hsp70) to refold and reactivate previously denatured, aggregated proteins; responsive to stresses including: heat, ethanol, and sodium arsenite; involved in [PSI+] propagation YPS6 YIR039C Putative GPI‐anchored aspartic protease, member of the yapsin 0.9259 0.0026 family of proteases involved in cell wall growth and maintenance NA YCL073C Protein of unconfirmed function; displays a topology characteristic of 0.9120 0.0039 the Major Facilitators Superfamily of membrane proteins; coding sequence 98% identical to that of YKR106W

NA YGR226C Dubious open reading frame, unlikely to encode a protein; not 0.9005 0.0025 conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W NA YER137C Putative protein of unknown function 0.9003 0.0207 NA YMR090W Putative protein of unknown function with similarity to DTDP‐glucose 0.8945 0.0055 4,6‐dehydratases; GFP‐fusion protein localizes to the cytoplasm; up‐ regulated in response to the fungicide mancozeb; not essential for viability NA YFR017C Putative protein of unknown function; green fluorescent protein 0.8890 0.0020 (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS; YFR017C is not an essential gene MAL31 YBR298C Maltose permease, high‐affinity maltose transporter (alpha‐glucoside 0.8863 0.0024 transporter); encoded in the MAL3 complex locus; member of the 12 transmembrane domain superfamily of sugar transporters; functional in genomic reference strain S288C UBC12 YLR306W Enzyme that mediates the conjugation of Rub1p, a ubiquitin‐like 0.8802 0.0020 protein, to other proteins; related to E2 ubiquitin‐conjugating enzymes MRPS16 YPL013C Mitochondrial ribosomal protein of the small subunit 0.8708 0.0044 AMS1 YGL156W Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) 0.8658 0.0131 degradation; delivered to the vacuole in a novel pathway separate from the secretory pathway

NA YJL077W‐B Putative protein of unknown function; identified by gene‐trapping, 0.8633 0.0102 microarray‐based expression analysis, and genome‐wide homology searching MIC14 YDR031W Mitochondrial intermembrane space protein, required for normal 0.8615 0.0030 oxygen consumption; contains twin cysteine‐x9‐cysteine motifs

ALG14 YBR070C Component of UDP‐GlcNAc transferase required for the second step 0.8593 0.0016 of dolichyl‐linked oligosaccharide synthesis; anchors the catalytic subunit Alg13p to the ER membrane; similar to bacterial and human glycosyltransferases GIS3 YLR094C Protein of unknown function 0.8541 0.0272 NA YMR105W Putative protein of unknown function 0.8520 0.0149 ‐A MCH2 YKL221W Protein with similarity to mammalian monocarboxylate permeases, 0.8483 0.0075 which are involved in transport of monocarboxylic acids across the plasma membrane; mutant is not deficient in monocarboxylate transport

294

SYF2 YGR129W Member of the NineTeen Complex (NTC) that contains Prp19p and 0.8396 0.0384 stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; isy1 syf2 cells have defective spindles activiating cell cycle arrest DAL1 YIR027C Allantoinase, converts allantoin to allantoate in the first step of 0.8333 0.0054 allantoin degradation; expression sensitive to nitrogen catabolite repression OM45 YIL136W Protein of unknown function, major constituent of the mitochondrial 0.8269 0.0260 outer membrane; located on the outer (cytosolic) face of the outer membrane GAC1 YOR178C Regulatory subunit for Glc7p type‐1 protein phosphatase (PP1), 0.8158 0.0493 tethers Glc7p to Gsy2p glycogen synthase, binds Hsf1p heat shock transcription factor, required for induction of some HSF‐regulated genes under heat shock COA2 YPL189C‐A Cytochrome oxidase assembly factor; null mutation results in 0.8143 0.0051 respiratory deficiency with specific loss of cytochrome oxidase activity; functions downstream of assembly factors Mss51p and Coa1p and interacts with assembly factor Shy1p SFC1 YJR095W Mitochondrial succinate‐fumarate transporter, transports succinate 0.8136 0.0123 into and fumarate out of the mitochondrion; required for ethanol and acetate utilization VTC2 YFL004W Subunit of the vacuolar transporter chaperone (VTC) complex 0.8104 0.0109 involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion

MTC3 YGL226W Protein of unknown function; green fluorescent protein (GFP)‐fusion 0.8094 0.0061 protein localizes to the mitochondrion; mtc3 is synthetically sick with cdc13‐1 DAD4 YDR320C‐ Essential subunit of the Dam1 complex (aka DASH complex), couples 0.8058 0.0020 A kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis NA YPR159C‐A Identified by gene‐trapping, microarray‐based expression analysis, 0.8050 0.0075 and genome‐wide homology searching UBP9 YER098W Ubiquitin carboxyl‐terminal hydrolase, ubiquitin‐specific protease 0.8030 0.0040 that cleaves ubiquitin‐protein fusions HSP42 YDR171W Small heat shock protein (sHSP) with chaperone activity; forms barrel‐ 0.7986 0.0235 shaped oligomers that suppress unfolded protein aggregation; involved in cytoskeleton reorganization after heat shock

CBP4 YGR174C Mitochondrial protein required for assembly of ubiquinol 0.7978 0.0019 cytochrome‐c reductase complex (cytochrome bc1 complex); interacts with Cbp3p and function is partially redundant with that of Cbp3p DIA3 YDL024C Protein of unknown function, involved in invasive and pseudohyphal 0.7901 0.0019 growth BUD27 YFL023W Unconventional prefoldin protein involved in translation initiation; 0.7900 0.0313 mutants have inappropriate expression of nutrient sensitive genes due to translational derepression of Gcn4p transcription factor; diploid mutants show random budding FIS1 YIL065C Protein involved in mitochondrial membrane fission and peroxisome 0.7878 0.0025 abundance; required for localization of Dnm1p and Mdv1p during mitochondrial division; mediates ethanol‐induced apoptosis and ethanol‐induced mitochondrial fragmentation YAE1 YJR067C Protein of unknown function, essential for growth under standard 0.7848 0.0035 (aerobic) conditions but not under anaerobic conditions

295

NA YNL200C Putative protein of unknown function; the authentic, non‐tagged 0.7817 0.0022 protein is detected in highly purified mitochondria in high‐throughput studies VPS62 YGR141W Vacuolar protein sorting (VPS) protein required for cytoplasm to 0.7755 0.0040 vacuole targeting of proteins YPC1 YBR183W Alkaline ceramidase that also has reverse (CoA‐independent) 0.7734 0.0250 ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance

SRX1 YKL086W Sulfiredoxin, contributes to oxidative stress resistance by reducing 0.7716 0.0061 cysteine‐sulfinic acid groups in the peroxiredoxin Tsa1p, which is formed upon exposure to oxidants; conserved in higher eukaryotes

NA YAR064W Putative protein of unknown function 0.7701 0.0234 GPX1 YKL026C Phospholipid hydroperoxide glutathione peroxidase induced by 0.7660 0.0030 glucose starvation that protects cells from phospholipid hydroperoxides and nonphospholipid peroxides during oxidative stress GDB1 YPR184W Glycogen debranching enzyme containing glucanotranferase and 0.7653 0.0174 alpha‐1,6‐amyloglucosidase activities, required for glycogen degradation; phosphorylated in mitochondria

NA YPL247C Putative protein of unknown function; green fluorescent protein 0.7629 0.0080 (GFP)‐fusion protein localizes to the cytoplasm and nucleus; similar to the petunia WD repeat protein an11; overexpression causes a cell cycle delay or arrest HSP82 YPL240C Hsp90 chaperone required for pheromone signaling and negative 0.7489 0.0109 regulation of Hsf1p; docks with Tom70p for mitochondrial preprotein delivery; promotes telomerase DNA binding and nucleotide addition; interacts with Cns1p, Cpr6p, Cpr7p, Sti1p PGM3 YMR278W Phosphoglucomutase, catalyzes interconversion of glucose‐1‐ 0.7485 0.0249 phosphate and glucose‐6‐phospate; transcription induced in response to stress; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; non‐essential RRP17 YDR412W Component of the pre‐60S pre‐ribosomal particle; required for cell 0.7468 0.0112 viability under standard (aerobic) conditions but not under anaerobic conditions; exonuclease required for 5′ end processing of pre‐ 60S ribosomal RNA IES2 YNL215W Protein that associates with the INO80 chromatin remodeling 0.7451 0.0048 complex under low‐salt conditions; essential for growth under anaerobic conditions RGM1 YMR182C Putative transcriptional repressor with proline‐rich zinc fingers; 0.7449 0.0444 overproduction impairs cell growth GIT1 YCR098C Plasma membrane permease, mediates uptake of 0.7445 0.0029 glycerophosphoinositol and glycerophosphocholine as sources of the nutrients inositol and phosphate; expression and transport rate are regulated by phosphate and inositol availability NA YIL014C‐A Putative protein of unknown function 0.7402 0.0138 BUD20 YLR074C Protein involved in bud‐site selection; diploid mutants display a 0.7397 0.0466 random budding pattern instead of the wild‐type bipolar pattern

NA YBR230W‐ Putative protein of unknown function 0.7382 0.0133 A UIP4 YPL186C Protein that interacts with Ulp1p, a Ubl (ubiquitin‐like protein)‐ 0.7308 0.0027 specific protease for Smt3p protein conjugates; detected in a phosphorylated state in the mitochondrial outer membrane; also detected in ER and nuclear envelope

296

DAL3 YIR032C Ureidoglycolate hydrolase, converts ureidoglycolate to glyoxylate and 0.7308 0.0362 urea in the third step of allantoin degradation; expression sensitive to nitrogen catabolite repression

NA YMR244C‐ Putative protein of unknown function; green fluorescent protein 0.7252 0.0061 A (GFP)‐fusion protein localizes to both the cytoplasm and nucleus and is induced in response to the DNA‐damaging agent MMS; YMR244C‐A is not an essential gene MRPL51 YPR100W Mitochondrial ribosomal protein of the large subunit 0.7213 0.0048 RIO1 YOR119C Essential serine kinase involved in cell cycle progression and 0.7196 0.0069 processing of the 20S pre‐rRNA into mature 18S rRNA HIT1 YJR055W Protein of unknown function, required for growth at high 0.7192 0.0131 temperature TRM13 YOL125W 2'‐O‐methyltransferase responsible for modification of tRNA at 0.7142 0.0388 position 4; C‐terminal domain has similarity to Rossmann‐fold (RFM) superfamily of RNA methyltransferases

NA YOR032W‐ Identified by gene‐trapping, microarray‐based expression analysis, 0.7141 0.0449 A and genome‐wide homology searching NA YLR156W Putative protein of unknown function; exhibits a two‐hybrid 0.7139 0.0112 interaction with Jsn1p in a large‐scale analysis NA YOL114C Putative protein of unknown function with similarity to human ICT1 0.7136 0.0225 and prokaryotic factors that may function in translation termination; YOL114C is not an essential gene NA YFL054C Putative channel‐like protein; similar to Fps1p; mediates passive 0.7120 0.0030 diffusion of glycerol in the presence of ethanol AUA1 YFL010W‐ Protein required for the negative regulation by ammonia of Gap1p, 0.7116 0.0020 A which is a general amino acid permease KIN82 YCR091W Putative serine/threonine protein kinase implicated in the regulation 0.7107 0.0268 of phospholipid asymmetry through the activation of phospholipid translocases (flippases) Lem3p‐Dnf1p/Dnf2p; similar to Fpk1p

CUS2 YNL286W Protein that binds to U2 snRNA and Prp11p, may be involved in U2 0.7092 0.0019 snRNA folding; contains two RNA recognition motifs (RRMs)

URM1 YIL008W Ubiquitin‐like protein involved in thiolation of cytoplasmic tRNAs; 0.7054 0.0234 receives sulfur from the E1‐like enzyme Uba4p and transfers it to tRNA; also functions as a protein tag with roles in nutrient sensing and oxidative stress response MBR1 YKL093W Protein involved in mitochondrial functions and stress response; 0.7043 0.0056 overexpression suppresses growth defects of hap2, hap3, and hap4 mutants GLC3 YEL011W Glycogen branching enzyme, involved in glycogen accumulation; 0.7022 0.0085 green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern NA YGR169C‐ Putative protein of unknown function 0.6998 0.0071 A PBI2 YNL015W Cytosolic inhibitor of vacuolar proteinase B (PRB1), required for 0.6981 0.0215 efficient vacuole inheritance; with thioredoxin forms protein complex LMA1, which assists in priming SNARE molecules and promotes vacuole fusion PYK2 YOR347C Pyruvate kinase that appears to be modulated by phosphorylation; 0.6923 0.0131 PYK2 transcription is repressed by glucose, and Pyk2p may be active under low glycolytic flux EMI1 YDR512C Non‐essential protein required for transcriptional induction of the 0.6824 0.0025 early meiotic‐specific transcription factor IME1, also required for sporulation; contains twin cysteine‐x9‐cysteine motifs

297

NGL3 YML118W Putative endonuclease, has a domain similar to a magnesium‐ 0.6799 0.0235 dependent endonuclease motif in mRNA deadenylase Ccr4p; similar to Ngl1p and Ngl2p NA YHR138C Putative protein of unknown function; has similarity to Pbi2p; double 0.6765 0.0063 null mutant lacking Pbi2p and Yhr138p exhibits highly fragmented vacuoles GCY1 YOR120W Putative NADP(+) coupled glycerol dehydrogenase, proposed to be 0.6754 0.0056 involved in an alternative pathway for glycerol catabolism; also has mRNA binding activity; member of the aldo‐keto reductase (AKR) family COX13 YGL191W Subunit VIa of cytochrome c oxidase, which is the terminal member 0.6743 0.0040 of the mitochondrial inner membrane electron transport chain; not essential for cytochrome c oxidase activity but may modulate activity in response to ATP ERR3 YMR323W Protein of unknown function, has similarity to enolases 0.6742 0.0349 NA YAR029W Member of DUP240 gene family but contains no transmembrane 0.6719 0.0230 domains; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern

PRX1 YBL064C Mitochondrial peroxiredoxin (1‐Cys Prx) with thioredoxin peroxidase 0.6701 0.0049 activity, has a role in reduction of hydroperoxides; reactivation requires Trr2p and glutathione; induced during respiratory growth and oxidative stress; phosphorylated COS4 YFL062W Protein of unknown function, member of the DUP380 subfamily of 0.6699 0.0131 conserved, often subtelomerically‐encoded proteins

HBN1 YCL026C‐B Putative protein of unknown function; similar to bacterial 0.6678 0.0221 nitroreductases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; protein becomes insoluble upon intracellular iron depletion NA YFL041W‐ Putative protein of unknown function; identified by fungal homology 0.6676 0.0050 A and RT‐PCR CRS5 YOR031W Copper‐binding metallothionein, required for wild‐type copper 0.6672 0.0120 resistance CAT8 YMR280C Zinc cluster transcriptional activator necessary for derepression of a 0.6671 0.0092 variety of genes under non‐fermentative growth conditions, active after diauxic shift, binds carbon source responsive elements

NA YKL107W Putative protein of unknown function; proposed to be a 0.6645 0.0319 palmitoylated membrane protein CAR1 YPL111W Arginase, responsible for arginine degradation, expression responds 0.6645 0.0109 to both induction by arginine and nitrogen catabolite repression; disruption enhances freeze tolerance

NA YKL018C‐A Putative protein of unknown function; identified by homology; green 0.6631 0.0059 fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm

MND2 YIR025W Subunit of the anaphase‐promoting complex (APC); necessary for 0.6627 0.0039 maintaining sister chromatid cohesion in prophase I of meiosis by inhibiting premature ubiquitination and subsequent degradation of substrates by the APC(Ama1) ubiquitin ligase FMP10 YER182W Putative protein of unknown function; the authentic, non‐tagged 0.6600 0.0078 protein is detected in highly purified mitochondria in high‐throughput studies DAN4 YJR151C Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and 0.6591 0.0054 Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth

298

CGR1 YGL029W Protein involved in nucleolar integrity and processing of the pre‐rRNA 0.6578 0.0430 for the 60S ribosome subunit; transcript is induced in response to cytotoxic stress but not genotoxic stress

ATS1 YAL020C Protein required, with Elongator complex, Kti11p, and Kti12p, for 0.6567 0.0078 modification of wobble nucleosides in tRNA; has a potential role in regulatory interactions between microtubules and the cell cycle

NA YDL160C‐A Putative protein of unknown function; mutant in a srs2 mutant 0.6555 0.0208 background displays MMS hypersensitivity; ortholog of human MHF2, a component of the Fanconi anemia (FA) complex that is involved in maintaining genome stability SNF3 YDL194W Plasma membrane low glucose sensor that regulates glucose 0.6539 0.0074 transport; contains 12 predicted transmembrane segments and a long C‐terminal tail required for induction of hexose transporters; also senses fructose and mannose; similar to Rgt2p REX3 YLR107W RNA exonuclease; required for maturation of the RNA component of 0.6536 0.0069 RNase MRP; functions redundantly with Rnh70p and Rex2p in processing of U5 snRNA and RNase P RNA; member of RNase D family of exonucleases NA YOL164W‐ Putative protein of unknown function; identified by fungal homology 0.6530 0.0359 A and RT‐PCR COS2 YBR302C Protein of unknown function, member of the DUP380 subfamily of 0.6524 0.0073 conserved, often subtelomerically‐encoded proteins

TOA1 YOR194C TFIIA large subunit; involved in transcriptional activation, acts as 0.6522 0.0227 antirepressor or as coactivator; homologous to largest and second largest subunits of human and Drosophila TFIIA

ASR1 YPR093C Ubiquitin ligase that modifies and regulates RNA Pol II; involved in a 0.6490 0.0094 putative alcohol‐responsive signaling pathway; accumulates in the nucleus under alcohol stress; contains a Ring/PHD finger domain similar to the mammalian rA9 protein GRX1 YCL035C Hydroperoxide and superoxide‐radical responsive heat‐stable 0.6475 0.0115 glutathione‐dependent disulfide oxidoreductase with active site cysteine pair; protects cells from oxidative damage

CRP1 YHR146W Protein that binds to cruciform DNA structures 0.6469 0.0028 CPD1 YGR247W Cyclic nucleotide phosphodiesterase, hydrolyzes ADP‐ribose 1'', 2''‐ 0.6466 0.0032 cyclic phosphate to ADP‐ribose 1''‐phosphate; may have a role in tRNA splicing; no detectable phenotype is conferred by null mutation or by overexpression SSA2 YLL024C ATP binding protein involved in protein folding and vacuolar import of 0.6461 0.0107 proteins; member of heat shock protein 70 (HSP70) family; associated with the chaperonin‐containing T‐complex; present in the cytoplasm, vacuolar membrane and cell wall TOP3 YLR234W DNA Topoisomerase III, conserved protein that functions in a complex 0.6445 0.0146 with Sgs1p and Rmi1p to relax single‐stranded negatively‐supercoiled DNA preferentially, involved in telomere stability and regulation of mitotic recombination CUE4 YML101C Protein of unknown function; has a CUE domain that binds ubiquitin, 0.6434 0.0031 which may facilitate intramolecular monoubiquitination

MOG1 YJR074W Conserved nuclear protein that interacts with GTP‐Gsp1p, which is a 0.6417 0.0048 Ran homolog of the Ras GTPase family, and stimulates nucleotide release, involved in nuclear protein import, nucleotide release is inhibited by Yrb1p

299

TPC1 YGR096W Mitochondrial membrane transporter that mediates uptake of the 0.6399 0.0075 essential cofactor thiamine pyrophosphate (ThPP) into mitochondria; expression appears to be regulated by carbon source; member of the mitochondrial carrier family STI1 YOR027W Hsp90 cochaperone, interacts with the Ssa group of the cytosolic 0.6373 0.0052 Hsp70 chaperones and activates Ssa1p ATPase activity; interacts with Hsp90 chaperones and inhibits their ATPase activity; homolog of mammalian Hop NA YIR018C‐A Putative protein of unknown function; identified by expression 0.6368 0.0481 profiling and mass spectrometry NA YMR182W Putative protein of unknown function 0.6356 0.0109 ‐A VIP1 YLR410W Inositol hexakisphosphate (IP6) and inositol heptakisphosphate (IP7) 0.6332 0.0059 kinase; IP7 production is important for phosphate signaling; involved in cortical actin cytoskeleton function, and invasive pseudohyphal growth analogous to S. pombe asp1 NQM1 YGR043C Transaldolase of unknown function; transcription is repressed by 0.6321 0.0167 Mot1p and induced by alpha‐factor and during diauxic shift BRE2 YLR015W Subunit of COMPASS (Set1C) complex, which methylates Lys4 of 0.6310 0.0059 histone H3 and functions in silencing at telomeres; has a C‐terminal Sdc1 Dpy‐30 Interaction (SDI) domain that mediates binding to Sdc1p; similar to trithorax‐group protein ASH2L MOD5 YOR274W Delta 2‐isopentenyl pyrophosphate:tRNA isopentenyl transferase, 0.6248 0.0356 required for biosynthesis of the modified base isopentenyladenosine in mitochondrial and cytoplasmic tRNAs; gene is nuclear and encodes two isozymic forms MER1 YNL210W Protein with RNA‐binding motifs required for meiosis‐specific mRNA 0.6239 0.0354 splicing; required for chromosome pairing and meiotic recombination

ECM4 YKR076W Omega class glutathione transferase; not essential; similar to 0.6174 0.0127 Ygr154cp; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm SDH4 YDR178W Membrane anchor subunit of succinate dehydrogenase (Sdh1p, 0.6155 0.0065 Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain NA YDR391C Putative protein of unknown function, possibly involved in zinc 0.6152 0.0081 homeostasis; Bdf1p‐dependent transcription induced by salt stress; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus TEN1 YLR010C Protein that regulates telomeric length; protects telomeric ends in a 0.6147 0.0051 complex with Cdc13p and Stn1p EMP46 YLR080W Integral membrane component of endoplasmic reticulum‐derived 0.6143 0.0323 COPII‐coated vesicles, which function in ER to Golgi transport NA YPL039W Putative protein of unknown function; YPL039W is not an essential 0.6138 0.0062 gene NCE101 YJL205C Protein of unknown function, involved in secretion of proteins that 0.6120 0.0030 lack classical secretory signal sequences NVJ1 YHR195W Nuclear envelope protein, anchored to the nuclear inner membrane, 0.6113 0.0120 that interacts with the vacuolar membrane protein Vac8p to promote formation of nucleus‐vacuole junctions during piecemeal microautophagy of the nucleus (PMN) RAD2 YGR258C Single‐stranded DNA endonuclease, cleaves single‐stranded DNA 0.6112 0.0065 during nucleotide excision repair to excise damaged DNA; subunit of Nucleotide Excision Repair Factor 3 (NEF3); homolog of human XPG protein

300

QCR8 YJL166W Subunit 8 of ubiquinol cytochrome‐c reductase complex, which is a 0.6105 0.0055 component of the mitochondrial inner membrane electron transport chain; oriented facing the intermembrane space; expression is regulated by Abf1p and Cpf1p LAP4 YKL103C Vacuolar aminopeptidase yscI; zinc metalloproteinase that belongs to 0.6101 0.0097 the peptidase family M18; often used as a marker protein in studies of autophagy and cytosol to vacuole targeting (CVT) pathway

SEM1 YDR363W‐ Component of the lid subcomplex of the regulatory subunit of the 26S 0.6080 0.0187 A proteasome; involved in mRNA export mediated by the TREX‐2 complex (Sac3p‐Thp1p); ortholog of human DSS1

FMP33 YJL161W Putative protein of unknown function; the authentic, non‐tagged 0.6077 0.0144 protein is detected in highly purified mitochondria in high‐throughput studies MXR2 YCL033C Methionine‐R‐sulfoxide reductase, involved in the response to 0.6049 0.0025 oxidative stress; protects iron‐sulfur clusters from oxidative inactivation along with MXR1; involved in the regulation of lifespan

PRP2 YNR011C RNA‐dependent ATPase in the DEAH‐box family, required for 0.6044 0.0062 activation of the spliceosome before the first transesterification step in RNA splicing; orthologous to human protein DHX16

NA YPR015C Putative protein of unknown function; overexpression causes a cell 0.6044 0.0100 cycle delay or arrest YCT1 YLL055W High‐affinity cysteine‐specific transporter with similarity to the Dal5p 0.6023 0.0209 family of transporters; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YCT1 is not an essential gene

NHA1 YLR138W Na+/H+ antiporter involved in sodium and potassium efflux through 0.6001 0.0073 the plasma membrane; required for alkali cation tolerance at acidic pH

301

APPENDIX P: R codes for microarray data analysis

This section includes the R codes for microarray data analysis to generate the differential expressed genes in this project.

## download packages required for microarray analysis >source("http://bioconductor.org/biocLite.R") >biocLite("affyPLM")

## check working environment >sessionInfo()

R version 2.13.0 (2011-04-13) Platform: i386-pc-mingw32/i386 (32-bit) locale: [1] LC_COLLATE=English_United States.1252 [2] LC_CTYPE=English_United States.1252 [3] LC_MONETARY=English_United States.1252 [4] LC_NUMERIC=C [5] LC_TIME=English_United States.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] affycoretools_1.24.0 KEGG.db_2.5.0 GO.db_2.5.0 [4] yeast2.db_2.5.0 org.Sc.sgd.db_2.5.0 RSQLite_0.9-4 [7] DBI_0.2-5 annotate_1.30.0 genefilter_1.34.0 [10] yeast2probe_2.8.0 yeast2cdf_2.8.0 AnnotationDbi_1.14.1 [13] limma_3.8.2 affy_1.30.0 Biobase_2.12.1 loaded via a namespace (and not attached): [1] affyio_1.20.0 annaffy_1.24.0 biomaRt_2.8.1 [4] Biostrings_2.20.4 Category_2.18.0 gcrma_2.24.1 [7] GOstats_2.18.0 graph_1.30.0 GSEABase_1.14.0 [10] IRanges_1.10.6 preprocessCore_1.14.0 RBGL_1.28.0 [13] RCurl_1.6-10.1 splines_2.13.0 survival_2.36-5 [16] tools_2.13.0 XML_3.4-2.2 xtable_1.5-6

302

########### importing cel files ########### ########### follow online manual -- limma ########### ########### ########### setwd("F://2007- Data in Hopper Lab//Microarray data analysis//R wd//wt_mtr10_msn5") library("affy") library("limma") targets <- readTargets("targets_all.txt") aaa <- ReadAffy(filenames = targets $ filename) pData(aaa) setwd("F://2007- Data in Hopper Lab//Microarray data analysis//R_Output//WT_mtr10_msn5_output") pdf("Box plot-Raw data.pdf", width=5, height=5) par(mar=c(10,4,2,1)) boxplot(aaa, las=3, cex.axis=0.7, ylab="log2 intensity", main="Raw data");dev.off()

########### ######### ########### Remove S.p. probes ######### ########### #########

##### from BioC list--Jenny Jenny Drnevich, Ph.D. ##### Functional Genomics Bioinformatics Specialist ##### W.M. Keck Center for Comparative and Functional Genomics ##### Roy J. Carver Biotechnology Center, University of #####Illinois,Urbana-Champaign library("yeast2probe")

### The first part is just creating two ojects (ResetEnvir and ### RemoveProbes) originally ### written by Ariel Chernomoretz and modified by Jenny Drnevich to ### remove individual probes and/or entire probesets. Just highlight ### everything from here until ### you see STOP and paste it to R all at once

ResetEnvir <- function(cleancdf){ cdfpackagename <- paste(cleancdf,"cdf",sep="") probepackagename <- paste(cleancdf,"probe",sep="") ll<-search() cdfpackagepos <- grep(cdfpackagename,ll) if(length(cdfpackagepos)>0) detach(pos=cdfpackagepos) ll<-search() probepackagepos <- grep(probepackagename,ll) if(length(probepackagepos)>0) detach(pos=probepackagepos) require(cdfpackagename,character.only=T) require(probepackagename,character.only=T) 303

require(affy) }

RemoveProbes <- function(listOutProbes=NULL, listOutProbeSets=NULL, cleancdf,destructive=TRUE) {

#default probe dataset values cdfpackagename <- paste(cleancdf,"cdf",sep="") probepackagename <- paste(cleancdf,"probe",sep="") require(cdfpackagename,character.only = TRUE) require(probepackagename,character.only = TRUE) probe.env.orig <- get(probepackagename)

if(!is.null(listOutProbes)){ # taking probes out from CDF env probes<- unlist(lapply(listOutProbes,function(x){ a<-strsplit(x,"at") aux1<-paste(a[[1]][1],"at",sep="") aux2<-as.integer(a[[1]][2]) c(aux1,aux2) })) n1<-as.character(probes[seq(1,(length(probes)/2))*2-1]) n2<-as.integer(probes[seq(1,(length(probes)/2))*2]) probes<-data.frame(I(n1),n2) probes[,1]<-as.character(probes[,1]) probes[,2]<-as.integer(probes[,2]) pset<-unique(probes[,1]) for(i in seq(along=pset)){ ii <-grep(pset[i],probes[,1]) iout<-probes[ii,2] a<-get(pset[i],env=get(cdfpackagename)) a<-a[-iout,] assign(pset[i],a,env=get(cdfpackagename)) } }

# taking probesets out from CDF env if(!is.null(listOutProbeSets)){ rm(list=listOutProbeSets,envir=get(cdfpackagename)) }

# setting the PROBE env accordingly (idea from gcrma compute.affinities.R) tmp <- get("xy2indices",paste("package:",cdfpackagename,sep="")) newAB <- new("AffyBatch",cdfName=cleancdf) pmIndex <- unlist(indexProbes(newAB,"pm")) subIndex<- match(tmp(probe.env.orig$x,probe.env.orig$y,cdf=cdfpackagename),pmIndex ) rm(newAB) 304

iNA <- which(is.na(subIndex))

if(length(iNA)>0){ ipos<-grep(probepackagename,search()) assign(probepackagename,probe.env.orig[-iNA,],pos=ipos) } }

### STOP HERE!!!! PASTE THE ABOVE INTO R AND CHECK TO SEE YOU HAVE ### THE TWO OBJECTS (ResetEnvir and RemoveProbes) WORKSPACE WITH ls()

## All you need now is your affybatch object, and a character vector ## of probe set names ## and/or another vector of individual probes that you want to remove. ## If your affybatch object is called 'rawdata' and the vector of probesets ## is 'maskedprobes', all you need to do is:

## here after: rawdata = aaa, maskedprobes <- scan("sp_IDs.txt", what="") maskedprobes[1] maskedprobes <- as.vector(maskedprobes)

## cleancdf <- cleancdfname(rawdata at cdfName,addcdf=FALSE) cleancdf <- cleancdfname(aaa @cdfName,addcdf=FALSE)

# Make sure starting with the original cdf with all the # probes and probesets.

ResetEnvir(cleancdf)

# Double-check to make sure all probesets are present in your # affybatch by typing in # the name of your affybatch and looking at the output.

# rawdata aaa

# To remove some probe sets (but not individual probes in this #example), use:

RemoveProbes(listOutProbes=NULL, listOutProbeSets=maskedprobes, cleancdf)

# The cdf file will be temporarily modified to mask the indicated # probesets & probes, which you can check by typing in the name of # your affybatch again and seeing that the number of probesets # have decreased. The masking can be undone by using ResetEnvir # as above, or by quitting the session. However, any Expression Set # objects created when the cdf is modified will have the masked # probesets removed permanently because they do not refer to the # cdf like an affybatch object does. 305

aaa ## check id numbers to see if it decreases

## normalize with 5900 probesets library("affy") eset <- rma(aaa) dim(exprs(eset))

### Box plot setwd("F://2007- Data in Hopper Lab//Microarray data analysis//R_Output//WT_mtr10_msn5_output") pdf("Box plot-after removingProbes and RMA normalized.pdf", width=5, height=5) par(mar=c(10,4,2,1)) boxplot(eset, main="After Remove probes and RMA normalized", ylab="log2 intensity", las=2, cex.axis=0.7) ; dev.off()

##### ##### ##### follow online manual(M. Bioconductor exercise) ##### ##### & add annotation info. #####

### Generate RMA expression data, MAS5 P/M/A calls setwd("F://2007- Data in Hopper Lab//Microarray data analysis//R_Output//WT_mtr10_msn5_output") eset.pm <- mas5calls(aaa) # Generates MAS 5.0 P/M/A calls, not working in one cdf env? frame1 <- data.frame(exprs(eset), exprs(eset.pm)) # Combine RMA intensities, P/M/A calls in one data frame frame2 <- frame1[, sort(names(frame1))] # Sorts columns by cel file name.

#write.table(frame1, file="All_expression value and PA calls.txt", sep="\t") #write.table(frame2, file="All_expression value and PA calls_sortbyname.txt", sep="\t")

############# ############# ############# Pre-processing ############# ############# #############

#### #### step 1. filter -- to get rid of low/no singals #### (by log2intensities, no hypothesis tested) #### library("genefilter")

306 f1 <- anyNA f2 <- pOverA(0.50, 6) ff <- filterfun(f1, f2) selected <- genefilter(exprs(eset), ff) ; sum(selected) esetsub <- eset[selected,] ## esetsub is a filtered matrix ef <- exprs(esetsub) ; ef[1:5, 1:3]; dim(ef) write.table(ef, file="All_RMA_expression value_filtered.txt",quote=FALSE, sep='\t') frame2.esetsub <- frame2[selected,]; dim(frame2.esetsub) write.table(frame2.esetsub, file="All_RMA_expression value_filtered plusPAcall.txt",quote=FALSE, sep='\t')

####### ####### ####### add and export annotation info. ####### for all probesets ####### ####### library("annotate") ; ls("package:annotate") library("yeast2.db") ; ls("package:yeast2.db") annotation(eset) <- "yeast2.db" annotation(esetsub) <- "yeast2.db"

## get information for esetsub probeIDs <- featureNames(esetsub) # get affyIDs from esetsub length(probeIDs) ; probeIDs[5] # check # Retrieves gene descriptions symbols <- as.vector(unlist(mget(probeIDs,yeast2GENENAME))) symbols[5] ; length(symbols) # check orf <- as.vector(unlist(mget(probeIDs,yeast2ORF))) ; orf[1:5] ;length(orf) # Retrieves ORF desrp <- as.vector(unlist(mget(probeIDs, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, orf, desrp, sep=".")) ; sym.orf.des[1:3] sym.des <- as.vector(paste(symbols, desrp, sep="."))

# build data frame df <- as.data.frame(exprs(esetsub)) ; dim(df)

# Generates data frame with above annotation data. Annot <- data.frame(probeIDs, orf, symbols, desrp, sym.des, df, row.names=NULL) ; dim(Annot) write.table(Annot, file="annot_filtered_dataset_no PA.txt", sep="\t",quote=FALSE)

307

############# ############# ############# To generate DEG ############# ############# #############

##### ##### 1. Build dataframe ##### wt.pm.f <- exprs(esetsub[, 1:2])- exprs(esetsub[, 3:4]) ; dim(wt.pm.f) wt.pm.f.avg <- rowMeans(wt.pm.f) wt.pm.s <- exprs(esetsub[, 5:6])- exprs(esetsub[, 7:8]) ; dim(wt.pm.s) wt.pm.s.avg <- rowMeans(wt.pm.s) wt.pm.sf <- wt.pm.s - wt.pm.f ; dim(wt.pm.sf) wt.pm.sf.avg <- rowMeans(wt.pm.sf) msn5.pm.f <- exprs(esetsub[, 9:10]) - exprs(esetsub[, 11:12]) msn5.pm.f.avg <- rowMeans(msn5.pm.f) msn5.pm.s <- exprs(esetsub[, 13:14])- exprs(esetsub[, 15:16]) msn5.pm.s.avg <- rowMeans(msn5.pm.s) msn5.pm.sf <- msn5.pm.s - msn5.pm.f msn5.pm.sf.avg <- rowMeans(msn5.pm.sf) mtr10.pm.f <- exprs(esetsub[, 17:18]) - exprs(esetsub[, 19:20]) mtr10.pm.f.avg <- rowMeans(mtr10.pm.f) mtr10.pm.s <- exprs(esetsub[, 21:22])- exprs(esetsub[, 23:24]) mtr10.pm.s.avg <- rowMeans(mtr10.pm.s) mtr10.pm.sf <- mtr10.pm.s - mtr10.pm.f mtr10.pm.sf.avg <- rowMeans(mtr10.pm.sf) wt.pt.f <- exprs(esetsub[, 1:2])- exprs(esetsub[, 25:26]) ; dim(wt.pt.f) wt.pt.f.avg <- rowMeans(wt.pt.f) wt.pt.s <- exprs(esetsub[, 5:6])- exprs(esetsub[, 27:28]) ; dim(wt.pt.s) wt.pt.s.avg <- rowMeans(wt.pt.s) wt.pt.sf <- wt.pt.s - wt.pt.f ; dim(wt.pt.sf) wt.pt.sf.avg <- rowMeans(wt.pt.sf) msn5.pt.f <- exprs(esetsub[, 9:10])- exprs(esetsub[, 29:30]) ; dim(msn5.pt.f) msn5.pt.f.avg <- rowMeans(msn5.pt.f) msn5.pt.s <- exprs(esetsub[, 13:14])-exprs(esetsub[, 31:32]) msn5.pt.s.avg <- rowMeans(msn5.pt.s) msn5.pt.sf <- msn5.pt.s - msn5.pt.f msn5.pt.sf.avg <- rowMeans(msn5.pt.sf) mtr10.pt.f <- exprs(esetsub[, 17:18])- exprs(esetsub[, 33:34]) ; dim(mtr10.pt.f) mtr10.pt.f.avg <- rowMeans(mtr10.pt.f) mtr10.pt.s <- exprs(esetsub[, 21:22])-exprs(esetsub[, 35:36]) mtr10.pt.s.avg <- rowMeans(mtr10.pt.s) mtr10.pt.sf <- mtr10.pt.s - mtr10.pt.f mtr10.pt.sf.avg <- rowMeans(mtr10.pt.sf)

308

### TXN wt.t.f <- exprs(esetsub[, 25:26]) ; dim(wt.t.f) wt.t.s <- exprs(esetsub[, 27:28]) wt.t.f.avg <- rowMeans (wt.t.f) wt.t.s.avg <- rowMeans (wt.t.s) msn5.t.f <- exprs(esetsub[, 29:30]) msn5.t.s <- exprs(esetsub[, 31:32]) msn5.t.f.avg <- rowMeans (msn5.t.f) msn5.t.s.avg <- rowMeans (msn5.t.s) mtr10.t.f <- exprs(esetsub[, 33:34]) mtr10.t.s <- exprs(esetsub[, 35:36]) mtr10.t.f.avg <- rowMeans (mtr10.t.f) mtr10.t.s.avg <- rowMeans (mtr10.t.s)

setwd("F:/2007- Data in Hopper Lab/Microarray data analysis/R_Output/WT_mtr10_msn5_output") pm.mtr10.and.wt <- cbind(wt.pm.f , mtr10.pm.f, wt.pm.s , mtr10.pm.s) ; dim(pm.mtr10.and.wt) pm.msn5.and.wt <- cbind(wt.pm.f , msn5.pm.f, wt.pm.s , msn5.pm.s) ; dim(pm.msn5.and.wt) txn.mtr10.and.wt <- cbind(wt.t.f , mtr10.t.f, wt.t.s , mtr10.t.s) ; dim(txn.mtr10.and.wt) txn.msn5.and.wt <- cbind(wt.t.f , msn5.t.f, wt.t.s , msn5.t.s) ; dim(txn.msn5.and.wt) pt.mtr10.and.wt <- cbind(wt.pt.f , mtr10.pt.f, wt.pt.s , mtr10.pt.s) ; dim(pt.mtr10.and.wt)

###### ###### Step 2. statistical analysis -- limma ######

##### Step 2.1 Model-fit ##### ##### compare P/M values library("limma") dim(pm.mtr10.and.wt) dim(pm.msn5.and.wt)

### (Pf/Mf) or (Ps/Ms) ### mtr10 pm.mtr10.and.wt.exprs <- new("ExpressionSet", exprs=as.matrix(pm.mtr10.and.wt)) ; dim(pm.mtr10.and.wt.exprs) mtr10.design <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4))) colnames(mtr10.design) <- c("wt.f", "mtr10.f", "wt.s", "mtr10.s") ; mtr10.design 309 mtr10.fit <- lmFit(exprs(pm.mtr10.and.wt.exprs), mtr10.design) contrast.matrix.mtr10 <- makeContrasts("Pf/Mf-mtr10/wt" = mtr10.f-wt.f, "Ps/Ms-mtr10/wt" = mtr10.s-wt.s, levels=mtr10.design) contrast.matrix.mtr10 fit2.mtr10 <- contrasts.fit(mtr10.fit, contrast.matrix.mtr10) fit3.mtr10 <- eBayes(fit2.mtr10)

### msn5 pm.msn5.and.wt.exprs <- new("ExpressionSet", exprs=as.matrix(pm.msn5.and.wt)) ; dim(pm.msn5.and.wt.exprs) msn5.design <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4))) colnames(msn5.design) <- c("wt.f", "msn5.f", "wt.s", "msn5.s") ; msn5.design msn5.fit <- lmFit(exprs(pm.msn5.and.wt.exprs), msn5.design) contrast.matrix.msn5 <- makeContrasts("Pf/Mf-msn5/wt" = msn5.f-wt.f, "Ps/Ms-msn5/wt" = msn5.s-wt.s, levels=msn5.design) contrast.matrix.msn5 fit2.msn5 <- contrasts.fit(msn5.fit, contrast.matrix.msn5) fit3.msn5 <- eBayes(fit2.msn5)

##### ##### Model-fit – compare P/T values ##### library("limma") dim(pt.mtr10.and.wt)

### (Pf/Tf) or (Ps/Ts) ### mtr10 pt.mtr10.and.wt.exprs <- new("ExpressionSet", exprs=as.matrix(pt.mtr10.and.wt)) ; dim(pt.mtr10.and.wt.exprs) pt.design <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4))) colnames(pt.design) <- c("wt.f", "mtr10.f", "wt.s", "mtr10.s") ; pt.design pt.fit <- lmFit(exprs(pt.mtr10.and.wt.exprs), pt.design) pt.contrast.matrix <- makeContrasts("Pf/Tf-mtr10/wt" = mtr10.f-wt.f, "Ps/Ts-mtr10/wt" = mtr10.s-wt.s, levels=pt.design) pt.contrast.matrix pt.fit2 <- contrasts.fit(pt.fit, pt.contrast.matrix) pt.fit3 <- eBayes(pt.fit2)

310

##### ##### Model-fit – compare Txn (T) values ##### library("limma") dim(txn.mtr10.and.wt)

### Tf or Ts ### mtr10 txn.mtr10.and.wt.exprs <- new("ExpressionSet", exprs=as.matrix(txn.mtr10.and.wt)) ; dim(txn.mtr10.and.wt.exprs) design.txn.mtr10 <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4))) colnames(design.txn.mtr10) <- c("wt.Tf", "mtr10.Tf", "wt.Ts", "mtr10.Ts") ; design.txn.mtr10 fit.txn.mtr10 <- lmFit(exprs(txn.mtr10.and.wt.exprs), design.txn.mtr10) contrast.matrix.txn.mtr10 <- makeContrasts("Tf-mtr10/wt" = mtr10.Tf- wt.Tf, "Ts-mtr10/wt" = mtr10.Ts-wt.Ts, levels=design.txn.mtr10) contrast.matrix.txn.mtr10 fit2.txn.mtr10 <- contrasts.fit(fit.txn.mtr10, contrast.matrix.txn.mtr10) fit3.txn.mtr10 <- eBayes(fit2.txn.mtr10)

### msn5 txn.msn5.and.wt.exprs <- new("ExpressionSet", exprs=as.matrix(txn.msn5.and.wt)) ; dim(txn.msn5.and.wt.exprs) design.txn.msn5 <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4))) colnames(design.txn.msn5) <- c("wt.Tf", "msn5.Tf", "wt.Ts", "msn5.Ts") ; design.txn.msn5 fit.txn.msn5 <- lmFit(exprs(txn.msn5.and.wt.exprs), design.txn.msn5) contrast.matrix.txn.msn5 <- makeContrasts("Tf-msn5/wt" = msn5.Tf-wt.Tf, "Ts-msn5/wt" = msn5.Ts-wt.Ts, levels=design.txn.msn5) contrast.matrix.txn.msn5 fit2.txn.msn5 <- contrasts.fit(fit.txn.msn5, contrast.matrix.txn.msn5) fit3.txn.msn5 <- eBayes(fit2.txn.msn5)

##### ##### Step 2.2 Select Deferential-expressed genes (DEG) ##### ##### P/M values

### Pf/Mf or Ps/Ms results.mtr10 <- decideTests(fit3.mtr10, method="separate", adjust.method="BH", p.value=0.05) ; summary(results.mtr10) results.msn5 <- decideTests(fit3.msn5, method="separate", adjust.method="BH", p.value=0.05) ; summary(results.msn5)

pdf("Venn Diagram- PM values_mtr10 vs wt.pdf") 311 vennDiagram(results.mtr10, include=c("up","down"), cex=1.2, lwd=2, counts.col=c("red", "green4"), circle.col=c("burlywood4"), main= "P/M value_p value cutoff 0.05") ; dev.off() pdf("Venn Diagram- PM values_msn5 vs wt.pdf") vennDiagram(results.msn5, include=c("up","down"), cex=1.2, lwd=2, counts.col=c("red", "green4"), circle.col=c("burlywood4"), main= "P/M value_p value cutoff 0.05") ; dev.off()

top.pm.f.mtr10 <- topTable(fit3.mtr10, coef=1, adjust="BH", sort.by="P", number=6000) top.pm.f.mtr10 <- top.pm.f.mtr10[top.pm.f.mtr10$adj.P.Val <0.05,] ; dim(top.pm.f.mtr10) top.pm.f.up.mtr10 <- top.pm.f.mtr10[top.pm.f.mtr10$adj.P.Val <0.05 &(top.pm.f.mtr10 $logFC > 0.6 ),] ; dim(top.pm.f.up.mtr10) top.pm.f.down.mtr10 <- top.pm.f.mtr10[top.pm.f.mtr10$adj.P.Val <0.05 &(top.pm.f.mtr10 $logFC < -0.6 ),] ; dim(top.pm.f.down.mtr10) top.pm.s.mtr10 <- topTable(fit3.mtr10, coef=2, adjust="BH", sort.by="P", number=6000) top.pm.s.mtr10 <- top.pm.s.mtr10[top.pm.s.mtr10$adj.P.Val <0.05,] ; dim(top.pm.s.mtr10) top.pm.s.up.mtr10 <- top.pm.s.mtr10[top.pm.s.mtr10$adj.P.Val <0.05 &(top.pm.s.mtr10 $logFC > 0.6 ),] ; dim(top.pm.s.up.mtr10) top.pm.s.down.mtr10 <- top.pm.s.mtr10[top.pm.s.mtr10$adj.P.Val <0.05 &(top.pm.s.mtr10 $logFC < -0.6 ),] ; dim(top.pm.s.down.mtr10) top.pm.f.msn5 <- topTable(fit3.msn5, coef=1, adjust="BH", sort.by="P", number=6000) top.pm.f.msn5 <- top.pm.f.msn5[top.pm.f.msn5$adj.P.Val <0.05,] ; dim(top.pm.f.msn5) top.pm.f.up.msn5 <- top.pm.f.msn5[top.pm.f.msn5$adj.P.Val <0.05 &(top.pm.f.msn5 $logFC > 0 ),] ; dim(top.pm.f.up.msn5) top.pm.f.down.msn5 <- top.pm.f.msn5[top.pm.f.msn5$adj.P.Val <0.05 &(top.pm.f.msn5 $logFC < 0 ),] ; dim(top.pm.f.down.msn5) top.pm.s.msn5 <- topTable(fit3.msn5, coef=2, adjust="BH", sort.by="P", number=6000) top.pm.s.msn5 <- top.pm.s.msn5[top.pm.s.msn5$adj.P.Val <0.05,] ; dim(top.pm.s.msn5) top.pm.s.up.msn5 <- top.pm.s.msn5[top.pm.s.msn5$adj.P.Val <0.05 &(top.pm.s.msn5 $logFC > 0 ),] ; dim(top.pm.s.up.msn5) top.pm.s.down.msn5 <- top.pm.s.msn5[top.pm.s.msn5$adj.P.Val <0.05 &(top.pm.s.msn5 $logFC < 0 ),] ; dim(top.pm.s.down.msn5)

nn <- intersect (top.pm.f.down.mtr10$ID, top.pm.f.down.msn5$ID);length(nn) # number is 7

312

##### ##### Select DEG -- P/T values #####

### Pf/Tf or Ps/Ts## use adj.p value 0.01 for DEG selection results.pt.mtr10 <- decideTests(pt.fit3, method="separate", adjust.method="BH", p.value=0.01, lfc=0.6); summary(results.pt.mtr10) pdf("Venn Diagram- PT values_mtr10 vs wt.pdf") vennDiagram(results.pt.mtr10, include=c("up","down"), cex=1.2, lwd=2, counts.col=c("red", "green4"), circle.col=c("burlywood4"), main= "P/T value_p value cutoff 0.01 and lfc=0.6") ; dev.off()

top.pt.f.mtr10 <- topTable(pt.fit3, coef=1, adjust="BH", sort.by="P", number=6000) top.pt.f.mtr10 <- top.pt.f.mtr10[top.pt.f.mtr10$adj.P.Val <0.01,] ; dim(top.pt.f.mtr10) top.pt.f.mtr10.up <- top.pt.f.mtr10[top.pt.f.mtr10$adj.P.Val <0.01 &(top.pt.f.mtr10 $logFC > 0.6 ),] ; dim(top.pt.f.mtr10.up) top.pt.f.mtr10.down <- top.pt.f.mtr10[top.pt.f.mtr10$adj.P.Val <0.01 &(top.pt.f.mtr10 $logFC < -0.6 ),] ; dim(top.pt.f.mtr10.down) top.pt.s.mtr10 <- topTable(pt.fit3, coef=2, adjust="BH", sort.by="P", number=6000) top.pt.s.mtr10 <- top.pt.s.mtr10[top.pt.s.mtr10$adj.P.Val <0.01,] ; dim(top.pt.s.mtr10) top.pt.s.mtr10.up <- top.pt.s.mtr10[top.pt.s.mtr10$adj.P.Val <0.01 &(top.pt.s.mtr10 $logFC > 0.6 ),] ; dim(top.pt.s.mtr10.up) top.pt.s.mtr10.down <- top.pt.s.mtr10[top.pt.s.mtr10$adj.P.Val <0.01 &(top.pt.s.mtr10 $logFC < -0.6 ),] ; dim(top.pt.s.mtr10.down)

##### ##### Select DEG -- Txn values #####

#### Tf or Ts results.txn.mtr10 <- decideTests(fit3.txn.mtr10, method="separate", adjust.method="BH", p.value=0.001, lfc=0.6) ; summary(results.txn.mtr10) results.txn.msn5 <- decideTests(fit3.txn.msn5, method="separate", adjust.method="BH", p.value=0.05, lfc=0.6) ; summary(results.txn.msn5) pdf("Venn Diagram- Txn values_mtr10 vs wt.pdf") vennDiagram(results.txn.mtr10, include=c("up","down"), cex=1.2, lwd=3, counts.col=c("red2", "green4"), circle.col=c("burlywood4"), main= "Txn_p value cutoff 0.001 and lfc=0.6") ; dev.off() 313

pdf("Venn Diagram- Txn values_msn5 vs wt.pdf") vennDiagram(results.txn.msn5, include=c("up","down"), cex=1.2, lwd=3, counts.col=c("red2", "green4"), circle.col=c("burlywood4"), main= "Txn_p value cutoff 0.05 and lfc=0.6") ; dev.off()

top.Tf.mtr10 <- topTable(fit3.txn.mtr10, coef=1, adjust="BH", sort.by="P", number=6000) top.Tf.mtr10 <- top.Tf.mtr10[top.Tf.mtr10$adj.P.Val <0.001,] ; dim(top.Tf.mtr10) top.Tf.up.mtr10 <- top.Tf.mtr10[top.Tf.mtr10$adj.P.Val <0.001 & (top.Tf.mtr10 $logFC > 0.6 ),]; dim(top.Tf.up.mtr10) top.Tf.down.mtr10 <- top.Tf.mtr10[top.Tf.mtr10$adj.P.Val <0.001 & (top.Tf.mtr10 $logFC < -0.6 ),]; dim(top.Tf.down.mtr10) top.Ts.mtr10 <- topTable(fit3.txn.mtr10, coef=2, adjust="BH", sort.by="P", number=6000) top.Ts.mtr10 <- top.Ts.mtr10 [top.Ts.mtr10 $adj.P.Val <0.001,] ; dim(top.Ts.mtr10 ) top.Ts.up.mtr10 <- top.Ts.mtr10 [top.Ts.mtr10 $adj.P.Val <0.001 & (top.Ts.mtr10 $logFC > 0.6 ),]; dim(top.Ts.up.mtr10 ) top.Ts.down.mtr10 <- top.Ts.mtr10 [top.Ts.mtr10 $adj.P.Val <0.001 & (top.Ts.mtr10 $logFC < -0.6 ),]; dim(top.Ts.down.mtr10 ) top.Tf.msn5 <- topTable(fit3.txn.msn5, coef=1, adjust="BH", sort.by="P", number=6000) top.Tf.msn5 <- top.Tf.msn5[top.Tf.msn5$adj.P.Val <0.05,] ; dim(top.Tf.msn5) top.Tf.up.msn5 <- top.Tf.msn5[top.Tf.msn5$adj.P.Val <0.05 & (top.Tf.msn5 $logFC > 0.6 ),]; dim(top.Tf.up.msn5) top.Tf.down.msn5 <- top.Tf.msn5[top.Tf.msn5$adj.P.Val <0.05 & (top.Tf.msn5 $logFC < -0.6 ),]; dim(top.Tf.down.msn5) top.Ts.msn5 <- topTable(fit3.txn.msn5, coef=2, adjust="BH", sort.by="P", number=6000) top.Ts.msn5 <- top.Ts.msn5 [top.Ts.msn5 $adj.P.Val <0.05,] ; dim(top.Ts.msn5 ) top.Ts.up.msn5 <- top.Ts.msn5 [top.Ts.msn5 $adj.P.Val <0.05 & (top.Ts.msn5 $logFC > 0.6 ),]; dim(top.Ts.up.msn5 ) top.Ts.down.msn5 <- top.Ts.msn5 [top.Ts.msn5 $adj.P.Val <0.05 & (top.Ts.msn5 $logFC < -0.6 ),]; dim(top.Ts.down.msn5 ) rr.up <- intersect(top.Tf.up.msn5$ID , top.Tf.up.mtr10$ID) ;length(rr.up) rr.down <- intersect(top.Tf.down.msn5$ID , top.Tf.down.mtr10$ID) ;length(rr.down) yy.up <- intersect(top.Ts.up.msn5$ID, top.Ts.up.mtr10$ID) ;length(yy.up) yy.down <- intersect(top.Ts.down.msn5$ID, top.Ts.down.mtr10$ID) ;length(yy.down)

314

##### Step 2.3 Build annotation tables with expression values ##### ##### P/M values

##### mtr10 ##### Generate mtr10 annotation table with P/M up-regulated genes top.pm.f.up.mtr10.id <- as.vector(top.pm.f.up.mtr10$ID) ;length(top.f.up.mtr10.id)

# Retrieves gene descriptions symbols <- as.vector(unlist(mget(top.pm.f.up.mtr10.id, yeast2GENENAME)))

# Retrieves ORF ORF <- as.vector(unlist(mget(top.pm.f.up.mtr10.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pm.f.up.mtr10.id, yeast2DESCRIPTION)))

# Build together sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.pm.f.up.df.mtr10 <- data.frame(probeIDs=top.pm.f.up.mtr10.id, symbols, ORF, des, sym.orf.des);dim(top.pm.f.up.df.mtr10)

# Retrieves expression value pm.f.up.mtr10.2 <- data.frame(exprs(pm.mtr10.and.wt.exprs)[top.pm.f.up.mtr10.id, ])

# Merges everything with above expression data. output.pm.f.up.mtr10 <- merge(top.pm.f.up.df.mtr10 ,pm.f.up.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.pm.f.up.mtr10) output.pm.f.up.mtr10.2 <- cbind(output.pm.f.up.mtr10, top.pm.f.up.mtr10) ;dim(output.pm.f.up.mtr10.2)

# Export dataframe write.table(output.pm.f.up.mtr10.2, file="annot_limma_P0.05_pm.f.up.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

##### Generate mtr10 annotation table with P/M down-regulated genes top.pm.f.down.mtr10.id <- as.vector(top.pm.f.down.mtr10$ID) ;length(top.pm.f.down.mtr10.id) symbols <- as.vector(unlist(mget(top.pm.f.down.mtr10.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.pm.f.down.mtr10.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pm.f.down.mtr10.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.pm.f.down.df.mtr10 <- data.frame(probeIDs=top.pm.f.down.mtr10.id, symbols, ORF, des, sym.orf.des);dim(top.pm.f.down.df.mtr10) pm.f.down.mtr10.2 <- data.frame(exprs(pm.mtr10.and.wt.exprs)[top.pm.f.down.mtr10.id, ])

315 output.pm.f.down.mtr10 <- merge(top.pm.f.down.df.mtr10 ,pm.f.down.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.pm.f.down.mtr10) output.pm.f.down.mtr10.2 <- cbind(output.pm.f.down.mtr10, top.pm.f.down.mtr10) ;dim(output.pm.f.down.mtr10.2) write.table(output.pm.f.down.mtr10.2, file="annot_limma_P0.05_pm.f.down.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate mtr10 annotation table with P/M.starved up-regulated ###genes top.pm.s.up.mtr10.id <- as.vector(top.pm.s.up.mtr10$ID) ;length(top.pm.s.up.mtr10.id) symbols <- as.vector(unlist(mget(top.pm.s.up.mtr10.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.pm.s.up.mtr10.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pm.s.up.mtr10.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.pm.s.up.df.mtr10 <- data.frame(probeIDs=top.pm.s.up.mtr10.id, symbols, ORF, des, sym.orf.des);dim(top.pm.s.up.df.mtr10) pm.s.up.mtr10.2 <- data.frame(exprs(pm.mtr10.and.wt.exprs)[top.pm.s.up.mtr10.id, ]) output.pm.s.up.mtr10 <- merge(top.pm.s.up.df.mtr10 ,pm.s.up.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.pm.s.up.mtr10) output.pm.s.up.mtr10.2 <- cbind(output.pm.s.up.mtr10, top.pm.s.up.mtr10) ;dim(output.pm.s.up.mtr10.2) write.table(output.pm.s.up.mtr10.2, file="annot_limma_P0.05_pm.s.up.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate mtr10 annotation table with P/M.starved down-regulated ###genes top.pm.s.down.mtr10.id <- as.vector(top.pm.s.down.mtr10$ID) ;length(top.pm.s.down.mtr10.id) symbols <- as.vector(unlist(mget(top.pm.s.down.mtr10.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.pm.s.down.mtr10.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pm.s.down.mtr10.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.pm.s.down.df.mtr10 <- data.frame(probeIDs=top.pm.s.down.mtr10.id, symbols, ORF, des, sym.orf.des);dim(top.pm.s.down.df.mtr10) pm.s.down.mtr10.2 <- data.frame(exprs(pm.mtr10.and.wt.exprs)[top.pm.s.down.mtr10.id, ]) output.pm.s.down.mtr10 <- merge(top.pm.s.down.df.mtr10 ,pm.s.down.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.pm.s.down.mtr10) output.pm.s.down.mtr10.2 <- cbind(output.pm.s.down.mtr10, top.pm.s.down.mtr10) ;dim(output.pm.s.down.mtr10.2) write.table(output.pm.s.down.mtr10.2, file="annot_limma_P0.05_pm.s.down.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

316

### msn5 ### P/M values dim(pm.msn5.and.wt.exprs)

### Generate msn5 annotation table with P/M.fed down-regulated genes top.pm.f.down.msn5.id <- as.vector(top.pm.f.down.msn5$ID) ;length(top.pm.f.down.msn5.id) symbols <- as.vector(unlist(mget(top.pm.f.down.msn5.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.pm.f.down.msn5.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pm.f.down.msn5.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.pm.f.down.df.msn5 <- data.frame(probeIDs=top.pm.f.down.msn5.id, symbols, ORF, des, sym.orf.des);dim(top.pm.f.down.df.msn5) pm.f.down.msn5.2 <- data.frame(exprs(pm.msn5.and.wt.exprs)[top.pm.f.down.msn5.id, ]) output.pm.f.down.msn5 <- merge(top.pm.f.down.df.msn5 ,pm.f.down.msn5.2, by.x="probeIDs", by.y=0, all=T);dim(output.pm.f.down.msn5) output.pm.f.down.msn5.2 <- cbind(output.pm.f.down.msn5, top.pm.f.down.msn5) ;dim(output.pm.f.down.msn5.2) write.table(output.pm.f.down.msn5.2, file="annot_limma_P0.05_pm.f.down.msn5_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

## P/T values ## mtr10 only dim(pt.mtr10.and.wt.exprs)

### Generate mtr10 annotation table with P/T.fed up-regulated genes top.pt.f.mtr10.up.id <- as.vector(top.pt.f.mtr10.up$ID) ;length(top.pt.f.mtr10.up.id ) symbols <- as.vector(unlist(mget(top.pt.f.mtr10.up.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.pt.f.mtr10.up.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pt.f.mtr10.up.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.pt.f.up.df.mtr10 <- data.frame(probeIDs=top.pt.f.mtr10.up.id, symbols, ORF, des, sym.orf.des);dim(top.pt.f.up.df.mtr10) pt.f.up.mtr10.2 <- data.frame(exprs(pt.mtr10.and.wt.exprs)[top.pt.f.mtr10.up.id, ]) output.pt.f.up.mtr10 <- merge(top.pt.f.up.df.mtr10 ,pt.f.up.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.pt.f.up.mtr10) output.pt.f.up.mtr10.2 <- cbind(output.pt.f.up.mtr10, top.pt.f.mtr10.up) ;dim(output.pt.f.up.mtr10.2) write.table(output.pt.f.up.mtr10.2, file="annot_limma_P0.01_pt.f.up.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

317

### Generate mtr10 annotation table with P/T.fed down-regulated genes top.pt.f.mtr10.down.id <- as.vector(top.pt.f.mtr10.down$ID) ;length(top.pt.f.mtr10.down.id ) symbols <- as.vector(unlist(mget(top.pt.f.mtr10.down.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.pt.f.mtr10.down.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pt.f.mtr10.down.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.pt.f.down.df.mtr10 <- data.frame(probeIDs=top.pt.f.mtr10.down.id, symbols, ORF, des, sym.orf.des);dim(top.pt.f.down.df.mtr10) pt.f.down.mtr10.2 <- data.frame(exprs(pt.mtr10.and.wt.exprs)[top.pt.f.mtr10.down.id, ]) output.pt.f.down.mtr10 <- merge(top.pt.f.down.df.mtr10 ,pt.f.down.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.pt.f.down.mtr10) output.pt.f.down.mtr10.2 <- cbind(output.pt.f.down.mtr10, top.pt.f.mtr10.down) ;dim(output.pt.f.down.mtr10.2) write.table(output.pt.f.down.mtr10.2, file="annot_limma_P0.01_pt.f.down.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate mtr10 annotation table with P/T.starved up-regulated genes top.pt.s.mtr10.up.id <- as.vector(top.pt.s.mtr10.up$ID) ;length(top.pt.s.mtr10.up.id ) symbols <- as.vector(unlist(mget(top.pt.s.mtr10.up.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.pt.s.mtr10.up.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pt.s.mtr10.up.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.pt.s.up.df.mtr10 <- data.frame(probeIDs=top.pt.s.mtr10.up.id, symbols, ORF, des, sym.orf.des);dim(top.pt.s.up.df.mtr10) pt.s.up.mtr10.2 <- data.frame(exprs(pt.mtr10.and.wt.exprs)[top.pt.s.mtr10.up.id, ]) output.pt.s.up.mtr10 <- merge(top.pt.s.up.df.mtr10 ,pt.s.up.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.pt.s.up.mtr10) output.pt.s.up.mtr10.2 <- cbind(output.pt.s.up.mtr10, top.pt.s.mtr10.up) ;dim(output.pt.s.up.mtr10.2) write.table(output.pt.s.up.mtr10.2, file="annot_limma_P0.01_pt.s.up.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate mtr10 annotation table with P/T.starved down-regulated ###genes top.pt.s.mtr10.down.id <- as.vector(top.pt.s.mtr10.down$ID) ;length(top.pt.s.mtr10.down.id ) symbols <- as.vector(unlist(mget(top.pt.s.mtr10.down.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.pt.s.mtr10.down.id, yeast2ORF))) des <- as.vector(unlist(mget(top.pt.s.mtr10.down.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))

318 top.pt.s.down.df.mtr10 <- data.frame(probeIDs=top.pt.s.mtr10.down.id, symbols, ORF, des, sym.orf.des);dim(top.pt.s.down.df.mtr10) pt.s.down.mtr10.2 <- data.frame(exprs(pt.mtr10.and.wt.exprs)[top.pt.s.mtr10.down.id, ]) output.pt.s.down.mtr10 <- merge(top.pt.s.down.df.mtr10 ,pt.s.down.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.pt.s.down.mtr10) output.pt.s.down.mtr10.2 <- cbind(output.pt.s.down.mtr10, top.pt.s.mtr10.down) ;dim(output.pt.s.down.mtr10.2) write.table(output.pt.s.down.mtr10.2, file="annot_limma_P0.01_pt.s.down.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

## Txn values ## mtr10 dim(txn.mtr10.and.wt.exprs)

### Generate mtr10 annotation table with Total.fed up-regulated ###genes top.Tf.up.mtr10.id <- as.vector(top.Tf.up.mtr10$ID) ;length(top.Tf.up.mtr10.id) symbols <- as.vector(unlist(mget(top.Tf.up.mtr10.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.Tf.up.mtr10.id, yeast2ORF))) des <- as.vector(unlist(mget(top.Tf.up.mtr10.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.Tf.up.df.mtr10 <- data.frame(probeIDs=top.Tf.up.mtr10.id, symbols, ORF, des, sym.orf.des);dim(top.Tf.up.df.mtr10) Tf.up.mtr10.2 <- data.frame(exprs(pm.mtr10.and.wt.exprs)[top.Tf.up.mtr10.id, ]) output.Tf.up.mtr10 <- merge(top.Tf.up.df.mtr10 ,Tf.up.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.Tf.up.mtr10) output.Tf.up.mtr10.2 <- cbind(output.Tf.up.mtr10, top.Tf.up.mtr10) ;dim(output.Tf.up.mtr10.2) write.table(output.Tf.up.mtr10.2, file="annot_limma_P0.05_Tf.up.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate mtr10 annotation table with Total.fed down-regulated ###genes top.Tf.down.mtr10.id <- as.vector(top.Tf.down.mtr10$ID) ;length(top.Tf.down.mtr10.id) symbols <- as.vector(unlist(mget(top.Tf.down.mtr10.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.Tf.down.mtr10.id, yeast2ORF))) des <- as.vector(unlist(mget(top.Tf.down.mtr10.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.Tf.down.df.mtr10 <- data.frame(probeIDs=top.Tf.down.mtr10.id, symbols, ORF, des, sym.orf.des);dim(top.Tf.down.df.mtr10) 319

Tf.down.mtr10.2 <- data.frame(exprs(pm.mtr10.and.wt.exprs)[top.Tf.down.mtr10.id, ]) output.Tf.down.mtr10 <- merge(top.Tf.down.df.mtr10 ,Tf.down.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.Tf.down.mtr10) output.Tf.down.mtr10.2 <- cbind(output.Tf.down.mtr10, top.Tf.down.mtr10) ;dim(output.Tf.down.mtr10.2) write.table(output.Tf.down.mtr10.2, file="annot_limma_P0.05_Tf.down.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate mtr10 annotation table with Total.starved up-regulated ###genes top.Ts.up.mtr10.id <- as.vector(top.Ts.up.mtr10$ID) ;length(top.Ts.up.mtr10.id) symbols <- as.vector(unlist(mget(top.Ts.up.mtr10.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.Ts.up.mtr10.id, yeast2ORF))) des <- as.vector(unlist(mget(top.Ts.up.mtr10.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.Ts.up.df.mtr10 <- data.frame(probeIDs=top.Ts.up.mtr10.id, symbols, ORF, des, sym.orf.des);dim(top.Ts.up.df.mtr10) Ts.up.mtr10.2 <- data.frame(exprs(pm.mtr10.and.wt.exprs)[top.Ts.up.mtr10.id, ]) output.Ts.up.mtr10 <- merge(top.Ts.up.df.mtr10 ,Ts.up.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.Ts.up.mtr10) output.Ts.up.mtr10.2 <- cbind(output.Ts.up.mtr10, top.Ts.up.mtr10) ;dim(output.Ts.up.mtr10.2) write.table(output.Ts.up.mtr10.2, file="annot_limma_P0.05_Ts.up.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate mtr10 annotation table with Total.starved down-regulated ###genes top.Ts.down.mtr10.id <- as.vector(top.Ts.down.mtr10$ID) ;length(top.Ts.down.mtr10.id) symbols <- as.vector(unlist(mget(top.Ts.down.mtr10.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.Ts.down.mtr10.id, yeast2ORF))) des <- as.vector(unlist(mget(top.Ts.down.mtr10.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.Ts.down.df.mtr10 <- data.frame(probeIDs=top.Ts.down.mtr10.id, symbols, ORF, des, sym.orf.des);dim(top.Ts.down.df.mtr10) Ts.down.mtr10.2 <- data.frame(exprs(pm.mtr10.and.wt.exprs)[top.Ts.down.mtr10.id, ]) output.Ts.down.mtr10 <- merge(top.Ts.down.df.mtr10 ,Ts.down.mtr10.2, by.x="probeIDs", by.y=0, all=T);dim(output.Ts.down.mtr10) output.Ts.down.mtr10.2 <- cbind(output.Ts.down.mtr10, top.Ts.down.mtr10) ;dim(output.Ts.down.mtr10.2) write.table(output.Ts.down.mtr10.2, file="annot_limma_P0.05_Ts.down.mtr10_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

320

## Txn values ## msn5 dim(txn.msn5.and.wt.exprs)

### Generate msn5 annotation table with Total.fed up-regulated genes top.Tf.up.msn5.id <- as.vector(top.Tf.up.msn5$ID) ;length(top.Tf.up.msn5.id) symbols <- as.vector(unlist(mget(top.Tf.up.msn5.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.Tf.up.msn5.id, yeast2ORF))) des <- as.vector(unlist(mget(top.Tf.up.msn5.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.Tf.up.df.msn5 <- data.frame(probeIDs=top.Tf.up.msn5.id, symbols, ORF, des, sym.orf.des);dim(top.Tf.up.df.msn5) Tf.up.msn5.2 <- data.frame(exprs(pm.msn5.and.wt.exprs)[top.Tf.up.msn5.id, ]) output.Tf.up.msn5 <- merge(top.Tf.up.df.msn5 ,Tf.up.msn5.2, by.x="probeIDs", by.y=0, all=T);dim(output.Tf.up.msn5) output.Tf.up.msn5.2 <- cbind(output.Tf.up.msn5, top.Tf.up.msn5) ;dim(output.Tf.up.msn5.2) write.table(output.Tf.up.msn5.2, file="annot_limma_P0.05_Tf.up.msn5_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate msn5 annotation table with Total.fed down-regulated genes top.Tf.down.msn5.id <- as.vector(top.Tf.down.msn5$ID) ;length(top.Tf.down.msn5.id) symbols <- as.vector(unlist(mget(top.Tf.down.msn5.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.Tf.down.msn5.id, yeast2ORF))) des <- as.vector(unlist(mget(top.Tf.down.msn5.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.Tf.down.df.msn5 <- data.frame(probeIDs=top.Tf.down.msn5.id, symbols, ORF, des, sym.orf.des);dim(top.Tf.down.df.msn5) Tf.down.msn5.2 <- data.frame(exprs(pm.msn5.and.wt.exprs)[top.Tf.down.msn5.id, ]) output.Tf.down.msn5 <- merge(top.Tf.down.df.msn5 ,Tf.down.msn5.2, by.x="probeIDs", by.y=0, all=T);dim(output.Tf.down.msn5) output.Tf.down.msn5.2 <- cbind(output.Tf.down.msn5, top.Tf.down.msn5) ;dim(output.Tf.down.msn5.2) write.table(output.Tf.down.msn5.2, file="annot_limma_P0.05_Tf.down.msn5_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate msn5 annotation table with Total.starved up-regulated ###genes top.Ts.up.msn5.id <- as.vector(top.Ts.up.msn5$ID) ;length(top.Ts.up.msn5.id) symbols <- as.vector(unlist(mget(top.Ts.up.msn5.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.Ts.up.msn5.id, yeast2ORF)))

321 des <- as.vector(unlist(mget(top.Ts.up.msn5.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.Ts.up.df.msn5 <- data.frame(probeIDs=top.Ts.up.msn5.id, symbols, ORF, des, sym.orf.des);dim(top.Ts.up.df.msn5) Ts.up.msn5.2 <- data.frame(exprs(pm.msn5.and.wt.exprs)[top.Ts.up.msn5.id, ]) output.Ts.up.msn5 <- merge(top.Ts.up.df.msn5 ,Ts.up.msn5.2, by.x="probeIDs", by.y=0, all=T);dim(output.Ts.up.msn5) output.Ts.up.msn5.2 <- cbind(output.Ts.up.msn5, top.Ts.up.msn5) ;dim(output.Ts.up.msn5.2) write.table(output.Ts.up.msn5.2, file="annot_limma_P0.05_Ts.up.msn5_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

### Generate msn5 annotation table with Total.starved down-regulated ###genes top.Ts.down.msn5.id <- as.vector(top.Ts.down.msn5$ID) ;length(top.Ts.down.msn5.id) symbols <- as.vector(unlist(mget(top.Ts.down.msn5.id, yeast2GENENAME))) ORF <- as.vector(unlist(mget(top.Ts.down.msn5.id, yeast2ORF))) des <- as.vector(unlist(mget(top.Ts.down.msn5.id, yeast2DESCRIPTION))) sym.orf.des <- as.vector(paste(symbols, ORF, des, sep=".")) top.Ts.down.df.msn5 <- data.frame(probeIDs=top.Ts.down.msn5.id, symbols, ORF, des, sym.orf.des);dim(top.Ts.down.df.msn5) Ts.down.msn5.2 <- data.frame(exprs(pm.msn5.and.wt.exprs)[top.Ts.down.msn5.id, ]) output.Ts.down.msn5 <- merge(top.Ts.down.df.msn5 ,Ts.down.msn5.2, by.x="probeIDs", by.y=0, all=T);dim(output.Ts.down.msn5) output.Ts.down.msn5.2 <- cbind(output.Ts.down.msn5, top.Ts.down.msn5) ;dim(output.Ts.down.msn5.2) write.table(output.Ts.down.msn5.2, file="annot_limma_P0.05_Ts.down.msn5_vs_WT_usesmall dataset.txt", sep="\t",quote=FALSE)

##### Step 3 ##### Generate graphs of DEGs #####

### ### Volcano plot ###

## Step 3.1 ## average PM values wt.pm.f <- exprs(esetsub[, 1:2])- exprs(esetsub[, 3:4]) ; dim(wt.pm.f) wt.pm.f.avg <- rowMeans(wt.pm.f) wt.pm.s <- exprs(esetsub[, 5:6])- exprs(esetsub[, 7:8]) ; dim(wt.pm.s) wt.pm.s.avg <- rowMeans(wt.pm.s) wt.pm.sf <- wt.pm.s - wt.pm.f ; dim(wt.pm.sf) 322 wt.pm.sf.avg <- rowMeans(wt.pm.sf) msn5.pm.f <- exprs(esetsub[, 9:10]) - exprs(esetsub[, 11:12]) msn5.pm.f.avg <- rowMeans(msn5.pm.f) msn5.pm.s <- exprs(esetsub[, 13:14])- exprs(esetsub[, 15:16]) msn5.pm.s.avg <- rowMeans(msn5.pm.s) msn5.pm.sf <- msn5.pm.s - msn5.pm.f msn5.pm.sf.avg <- rowMeans(msn5.pm.sf) mtr10.pm.f <- exprs(esetsub[, 17:18]) - exprs(esetsub[, 19:20]) mtr10.pm.f.avg <- rowMeans(mtr10.pm.f) mtr10.pm.s <- exprs(esetsub[, 21:22])- exprs(esetsub[, 23:24]) mtr10.pm.s.avg <- rowMeans(mtr10.pm.s) mtr10.pm.sf <- mtr10.pm.s - mtr10.pm.f mtr10.pm.sf.avg <- rowMeans(mtr10.pm.sf)

## mtr10 mtr10.pm.f.dif <- mtr10.pm.f.avg-wt.pm.f.avg; length(mtr10.pm.f.dif) mtr10.pm.s.dif <- mtr10.pm.s.avg-wt.pm.s.avg; length(mtr10.pm.s.dif) logp.mtr10.pm.f <- -log10(fit3.mtr10$p.value[,1]) ### NOT adj.p.val logp.mtr10.pm.s <- -log10(fit3.mtr10$p.value[,2])

## msn5 msn5.pm.f.dif <- msn5.pm.f.avg-wt.pm.f.avg msn5.pm.s.dif <- msn5.pm.s.avg-wt.pm.s.avg logp.msn5.pm.f <- -log10(fit3.msn5$p.value[,1]) ### NOT adj.p.val logp.msn5.pm.s <- -log10(fit3.msn5$p.value[,2])

## PT values ## mtr10 mtr10.pt.f.dif <- mtr10.pt.f.avg-wt.pt.f.avg; length(mtr10.pt.f.dif) mtr10.pt.s.dif <- mtr10.pt.s.avg-wt.pt.s.avg; length(mtr10.pt.s.dif) logp.mtr10.pt.f <- -log10(pt.fit3$p.value[,1]) ### NOT adj.p.val logp.mtr10.pt.s <- -log10(pt.fit3$p.value[,2])

## Txn values ## mtr10 mtr10.Tf.dif <- mtr10.t.f.avg - wt.t.f.avg mtr10.Ts.dif <- mtr10.t.s.avg - wt.t.s.avg logp.mtr10.Tf <- -log10(fit3.txn.mtr10$p.value[,1]) ### NOT adj.p.val logp.mtr10.Ts <- -log10(fit3.txn.mtr10$p.value[,2])

## msn5 msn5.Tf.dif <- msn5.t.f.avg - wt.t.f.avg msn5.Ts.dif <- msn5.t.s.avg - wt.t.s.avg

323 logp.msn5.Tf <- -log10(fit3.txn.msn5$p.value[,1]) ### NOT adj.p.val logp.msn5.Ts <- -log10(fit3.txn.msn5$p.value[,2])

## Step 3.2 ## Making plots pdf("Volcano plot of limma_PM values_mtr10 vs wt.pdf") plot(mtr10.pm.f.dif, -log10(fit3.mtr10$p.value[,1]), xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0", main = "Volcano plot of limma -- Pf/Mf_mtr10 vs wt") points(mtr10.pm.f.dif[top.pm.f.down.mtr10$ID], logp.mtr10.pm.f[top.pm.f.down.mtr10$ID], pch = 20, col= "blue3") points(mtr10.pm.f.dif[top.pm.f.up.mtr10$ID], logp.mtr10.pm.f[top.pm.f.up.mtr10$ID], pch = 20, col= "red3") abline(h =2.7, col="darkolivegreen4", lty=2) ## h value is smallest of -log10(p.value) abline(v = 0.6, col="darkolivegreen4", lty=2) abline(v = -0.6, col="darkolivegreen4", lty=2) plot(mtr10.pm.s.dif, -log10(fit3.mtr10$p.value[,2]), xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0", main = "Volcano plot of limma -- Ps/Ms_mtr10 vs wt") points(mtr10.pm.s.dif[top.pm.s.down.mtr10$ID], logp.mtr10.pm.s[top.pm.s.down.mtr10$ID], pch = 20, col= "blue3") points(mtr10.pm.s.dif[top.pm.s.up.mtr10$ID], logp.mtr10.pm.s[top.pm.s.up.mtr10$ID], pch = 20, col= "red3") abline(h =4.2, col="darkolivegreen4", lty=2) abline(v = 0.6, col="darkolivegreen4", lty=2) abline(v = -0.6, col="darkolivegreen4", lty=2);dev.off() pdf("Volcano plot of limma_PT values_mtr10 vs wt.pdf") plot(mtr10.pt.f.dif, -log10(pt.fit3$p.value[,1]), xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0", main = "Volcano plot of limma -- Pf/Tf_mtr10 vs wt") points(mtr10.pt.f.dif[top.pt.f.mtr10.down$ID], logp.pt.f[top.pt.f.mtr10.down$ID], pch = 20, col= "blue3") points(mtr10.pt.f.dif[top.pt.f.mtr10.up$ID], logp.pt.f[top.pt.f.mtr10.up$ID], pch = 20, col= "red3") abline(v = 0.6, col="darkolivegreen4", lty=2) abline(v = -0.6, col="darkolivegreen4", lty=2) plot(mtr10.pt.s.dif, -log10(pt.fit3$p.value[,2]), xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0", main = "Volcano plot of limma -- Pf/Tf_mtr10 vs wt") points(mtr10.pt.s.dif[top.pt.s.mtr10.down$ID], logp.pt.s[top.pt.s.mtr10.down$ID], pch = 20, col= "blue3") points(mtr10.pt.s.dif[top.pt.s.mtr10.up$ID], logp.pt.s[top.pt.s.mtr10.up$ID], pch = 20, col= "red3") abline(h = 3.1, col="darkolivegreen4", lty=2) abline(v = 0.6, col="darkolivegreen4", lty=2) abline(v = -0.6, col="darkolivegreen4", lty=2);dev.off()

324

## plots of Txn values pdf("Volcano plot of limma_Txn values_mtr10 vs wt.pdf") plot(mtr10.Tf.dif, -log10(fit3.txn.mtr10$p.value[,1]), xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0", main = "Volcano plot of limma -- Tf_mtr10 vs wt") points(mtr10.Tf.dif[top.Tf.down.mtr10 $ID], logp.mtr10.Tf[top.Tf.down.mtr10 $ID], pch = 20, col= "blue3") points(mtr10.Tf.dif[top.Tf.up.mtr10 $ID], logp.mtr10.Tf[top.Tf.up.mtr10$ID], pch = 20, col= "red3") abline(h = 4, col="darkolivegreen4", lty=2) abline(v = 0.6, col="darkolivegreen4", lty=2) abline(v = -0.6, col="darkolivegreen4", lty=2) plot(mtr10.Ts.dif, -log10(fit3.txn.mtr10$p.value[,2]), xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0", main = "Volcano plot of limma -- Ts_mtr10 vs wt") points(mtr10.Ts.dif[top.Ts.down.mtr10 $ID], logp.mtr10.Ts[top.Ts.down.mtr10 $ID], pch = 20, col= "blue3") points(mtr10.Ts.dif[top.Ts.up.mtr10 $ID], logp.mtr10.Ts[top.Ts.up.mtr10$ID], pch = 20, col= "red3") abline(h = 3.63, col="darkolivegreen4", lty=2) abline(v = 0.6, col="darkolivegreen4", lty=2) abline(v = -0.6, col="darkolivegreen4", lty=2);dev.off()

pdf("Volcano plot of limma_Txn values_msn5 vs wt.pdf") plot(msn5.Tf.dif, -log10(fit3.txn.msn5$p.value[,1]), xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0", main = "Volcano plot of limma -- Tf_msn5 vs wt") points(msn5.Tf.dif[top.Tf.down.msn5 $ID], logp.msn5.Tf[top.Tf.down.msn5 $ID], pch = 20, col= "blue3") points(msn5.Tf.dif[top.Tf.up.msn5 $ID], logp.msn5.Tf[top.Tf.up.msn5$ID], pch = 20, col= "red3") abline(h = 2.1, col="darkolivegreen4", lty=2) abline(v = 0.6, col="darkolivegreen4", lty=2) abline(v = -0.6, col="darkolivegreen4", lty=2) plot(msn5.Ts.dif, -log10(fit3.txn.msn5$p.value[,2]), xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0", main = "Volcano plot of limma -- Ts_msn5 vs wt") points(msn5.Ts.dif[top.Ts.down.msn5 $ID], logp.msn5.Ts[top.Ts.down.msn5 $ID], pch = 20, col= "blue3") points(msn5.Ts.dif[top.Ts.up.msn5 $ID], logp.msn5.Ts[top.Ts.up.msn5$ID], pch = 20, col= "red3") abline(h = 1.95, col="darkolivegreen4", lty=2) abline(v = 0.6, col="darkolivegreen4", lty=2) abline(v = -0.6, col="darkolivegreen4", lty=2);dev.off()

325

References

Abelson, J., Trotta, C.R., and Li, H. (1998). tRNA Splicing. Journal of Biological Chemistry 273, 12685-12688.

Aitchison, J.D., and Rout, M.P. (2012). The Yeast Nuclear Pore Complex and Transport Through It. Genetics 190, 855-883.

Alexandrov, A., Chernyakov, I., Gu, W., Hiley, S.L., Hughes, T.R., Grayhack, E.J., and Phizicky, E.M. (2006). Rapid tRNA decay can result from lack of nonessential modifications. Mol Cell 21, 87-96.

Andrew, E. (1998). MEC1-Dependent Phosphorylation of Rad9p in Response to DNA Damage. Molecular Cell 2, 183-189.

Arava, Y., Wang, Y., Storey, J.D., Liu, C.L., Brown, P.O., and Herschlag, D. (2003). Genome-wide analysis of mRNA translation profiles in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 100, 3889-3894.

Arts, G.J., Fornerod, M., and Mattaj, I.W. (1998a). Identification of a nuclear export receptor for tRNA. Curr Biol 8, 305-314.

Arts, G.J., Kuersten, S., Romby, P., Ehresmann, B., and Mattaj, I.W. (1998b). The role of exportin-t in selective nuclear export of mature tRNAs. EMBO J 17, 7430-7441.

Ashe, M.P., De Long, S.K., and Sachs, A.B. (2000). Glucose depletion rapidly inhibits translation initiation in yeast. Mol Biol Cell 11, 833-848.

Bakhrat, A., Baranes-Bachar, K., Reshef, D., Voloshin, O., Krichevsky, O., and Raveh, D. (2008). Nuclear export of Ho endonuclease of yeast via Msn5. Curr Genet 54, 271- 281.

Barhoom, S., Kaur, J., Cooperman, B.S., Smorodinsky, N.I., Smilansky, Z., Ehrlich, M., and Elroy-Stein, O. (2011). Quantitative single cell monitoring of protein synthesis at subcellular resolution using fluorescently labeled tRNA. Nucleic Acids Res 39, e129.

326

Baroni, M., Livian, S., Martegani, E., and Alberghina, L. (1986). Molecular cloning and regulation of the expression of the MET2 gene of Saccharomyces cerevisiae. Gene 46, 71-78.

Begley, U., Dyavaiah, M., Patil, A., Rooney, J.P., DiRenzo, D., Young, C.M., Conklin, D.S., Zitomer, R.S., and Begley, T.J. (2007). Trm9-catalyzed tRNA modifications link translation to the DNA damage response. Molecular Cell 28, 860-870.

Blais, J.D., Filipenko, V., Bi, M., Harding, H.P., Ron, D., Koumenis, C., Wouters, B.G., and Bell, J.C. (2004). Activating Transcription Factor 4 Is Translationally Regulated by Hypoxic Stress. Molecular and Cellular Biology 24, 7469-7482.

Blondel, M., Alepuz, P.M., Huang, L.S., Shaham, S., Ammerer, G., and Peter, M. (1999). Nuclear export of Far1p in response to pheromones requires the export receptor Msn5p/Ste21p. Genes Dev 13, 2284-2300.

Bohnsack, M.T., Czaplinski, K., and Gorlich, D. (2004). Exportin 5 is a RanGTP- dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 10, 185-191.

Bollman, K.M., Aukerman, M.J., Park, M.Y., Hunter, C., Berardini, T.Z., and Poethig, R.S. (2003). HASTY, the Arabidopsis ortholog of exportin 5/MSN5, regulates phase change and morphogenesis. Development 130, 1493-1504.

Bolstad, B.M., Irizarry, R.A., Astrand, M., and Speed, T.P. (2003). A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19, 185-193.

Cantara, W.A., Crain, P.F., Rozenski, J., McCloskey, J.A., Harris, K.A., Zhang, X., Vendeix, F.A., Fabris, D., and Agris, P.F. (2011). The RNA Modification Database, RNAMDB: 2011 update. Nucleic Acids Res 39, D195-201.

Castelli, L.M., Lui, J., Campbell, S.G., Rowe, W., Zeef, L.A., Holmes, L.E., Hoyle, N.P., Bone, J., Selley, J.N., Sims, P.F., et al. (2011). Glucose depletion inhibits translation initiation via eIF4A loss and subsequent 48S preinitiation complex accumulation, while the pentose phosphate pathway is coordinately up-regulated. Mol Biol Cell 22, 3379- 3393.

Chen, D.-C., Yang, B.-C., and Kuo, T.-T. (1992a). One-step transformation of yeast in stationary phase. Current Genetics 21, 83-84.

Chen, J.Y., Joyce, P.B., Wolfe, C.L., Steffen, M.C., and Martin, N.C. (1992b). Cytoplasmic and mitochondrial tRNA nucleotidyltransferase activities are derived from the same gene in the yeast Saccharomyces cerevisiae. Journal of Biological Chemistry 267, 14879-14883.

327

Cherest, H., Surdin-Kerjan, Y., Antoniewski, J., and De Robichon-Szulmajster, H. (1973). S-Adenosyl Methionine-Mediated Repression of Methionine Biosynthetic Enzymes in Saccharomyces cerevisiae. Journal of Bacteriology 114, 928-933.

Chernyakov, I., Whipple, J.M., Kotelawala, L., Grayhack, E.J., and Phizicky, E.M. (2008). Degradation of several hypomodified mature tRNA species in Saccharomyces cerevisiae is mediated by Met22 and the 5'-3' exonucleases Rat1 and Xrn1. Genes Dev 22, 1369-1380.

Chook, Y.M., and Süel, K.E. (2011). Nuclear import by karyopherin-βs: Recognition and inhibition. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1813, 1593- 1606.

Ciesla, M., and Boguta, M. (2008). Regulation of RNA polymerase III transcription by Maf1 protein. Acta Biochim Pol 55, 215-225.

Coller, J., and Parker, R. (2005). General translational repression by activators of mRNA decapping. Cell 122, 875-886.

Cook, A.G., Fukuhara, N., Jinek, M., and Conti, E. (2009). Structures of the tRNA export factor in the nuclear and cytosolic states. Nature 461, 60-65.

Dahlberg, J., and Lund, E. (2012). Nuclear translation or nuclear peptidyl transferase? Nucleus 3.

David, A., Dolan, B.P., Hickman, H.D., Knowlton, J.J., Clavarino, G., Pierre, P., Bennink, J.R., and Yewdell, J.W. (2012). Nuclear translation visualized by ribosome- bound nascent chain puromycylation. The Journal of Cell Biology 197, 45-57.

Day, D.A., and Tuite, M.F. (1998). Post-transcriptional gene regulatory mechanisms in eukaryotes: an overview. J Endocrinol 157, 361-371.

DeVit, M.J., and Johnston, M. (1999). The nuclear exportin Msn5 is required for nuclear export of the Mig1 glucose repressor of Saccharomyces cerevisiae. Curr Biol 9, 1231- 1241.

Dhungel, N., and Hopper, A.K. (2012). Beyond tRNA cleavage: novel essential function for yeast tRNA splicing endonuclease unrelated to tRNA processing. Genes & Development 26, 503-514.

Dichtl, B., Stevens, A., and Tollervey, D. (1997). Lithium toxicity in yeast is due to the inhibition of RNA processing enzymes. EMBO J 16, 7184-7195.

Dieci, G., Fiorino, G., Castelnuovo, M., Teichmann, M., and Pagano, A. (2007). The expanding RNA polymerase III transcriptome. Trends Genet 23, 614-622.

328

Esakova, O., and Krasilnikov, A.S. (2010). Of proteins and RNA: The RNase P/MRP family. RNA 16, 1725-1747.

Feng, W., and Hopper, A.K. (2002). A Los1p-independent pathway for nuclear export of intronless tRNAs in Saccharomycescerevisiae. Proc Natl Acad Sci U S A 99, 5412-5417.

Ferrezuelo, F., Steiner, B., Aldea, M., and Futcher, B. (2002). Biogenesis of yeast telomerase depends on the importin mtr10. Mol Cell Biol 22, 6046-6055.

Fodor, S.P., Read, J.L., Pirrung, M.C., Stryer, L., Lu, A.T., and Solas, D. (1991). Light- directed, spatially addressable parallel chemical synthesis. Science 251, 767-773.

Forlani, N., Martegani, E., and Alberghina, L. (1991). Posttranscriptional regulation of the expression of MET2 gene of Saccharomyces cerevisiae. Biochim Biophys Acta 1089, 47-53.

Gallardo, F., Olivier, C., Dandjinou, A.T., Wellinger, R.J., and Chartrand, P. (2008). TLC1 RNA nucleo-cytoplasmic trafficking links telomerase biogenesis to its recruitment to telomeres. EMBO J 27, 748-757.

Gasch, A.P., Spellman, P.T., Kao, C.M., Carmel-Harel, O., Eisen, M.B., Storz, G., Botstein, D., and Brown, P.O. (2000). Genomic expression programs in the response of yeast cells to environmental changes. Mol Biol Cell 11, 4241-4257.

Gasch, A.P., and Werner-Washburne, M. (2002). The genomics of yeast responses to environmental stress and starvation. Funct Integr Genomics 2, 181-192.

Gentleman, R.C., Carey, V.J., Bates, D.M., Bolstad, B., Dettling, M., Dudoit, S., Ellis, B., Gautier, L., Ge, Y., Gentry, J., et al. (2004). Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 5, R80.

Ghavidel, A., Kislinger, T., Pogoutse, O., Sopko, R., Jurisica, I., and Emili, A. (2007). Impaired tRNA nuclear export links DNA damage and cell-cycle checkpoint. Cell 131, 915-926.

Goldstein, A.L., and McCusker, J.H. (1999). Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15, 1541-1553.

Greenbaum, D., Jansen, R., and Gerstein, M. (2002). Analysis of mRNA expression and protein abundance data: an approach for the comparison of the enrichment of features in the cellular population of proteins and transcripts. Bioinformatics 18, 585-596.

Gueldener, U., Heinisch, J., Koehler, Voss, D., and Hegemann (2002). A second set of loxP markercassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Research 30, e23-e23.

329

Gustavsson, M., and Ronne, H. (2008). Evidence that tRNA modifying enzymes are important in vivo targets for 5-fluorouracil in yeast. RNA 14, 666-674.

Gustilo, E.M., Vendeix, F.A., and Agris, P.F. (2008). tRNA's modifications bring order to gene expression. Curr Opin Microbiol 11, 134-140.

Gwizdek, C., Ossareh-Nazari, B., Brownawell, A.M., Doglio, A., Bertrand, E., Macara, I.G., and Dargemont, C. (2003). Exportin-5 mediates nuclear export of minihelix- containing RNAs. J Biol Chem 278, 5505-5508.

Hackmann, A., Gross, T., Baierlein, C., and Krebber, H. (2011). The mRNA export factor Npl3 mediates the nuclear export of large ribosomal subunits. EMBO Rep 12, 1024-1031.

Hani, J., and Feldmann, H. (1998). tRNA genes and retroelements in the yeast genome. Nucleic Acids Research 26, 689-696.

Hinnebusch, A.G. (1988). Mechanisms of gene regulation in the general control of amino acid biosynthesis in Saccharomyces cerevisiae. Microbiol Rev 52, 248-273.

Hinnebusch, A.G. (1997). Translational regulation of yeast GCN4. A window on factors that control initiator-trna binding to the ribosome. J Biol Chem 272, 21661-21664.

Hinnebusch, A.G. (2005). TRANSLATIONAL REGULATION OF GCN4 AND THE GENERAL AMINO ACID CONTROL OF YEAST*. Annual Review of Microbiology 59, 407-450.

Holmes, L.E., Campbell, S.G., De Long, S.K., Sachs, A.B., and Ashe, M.P. (2004). Loss of translational control in yeast compromised for the major mRNA decay pathway. Mol Cell Biol 24, 2998-3010.

Hopper, A.K. (2006). Cellular dynamics of small RNAs. Crit Rev Biochem Mol Biol 41, 3-19.

Hopper, A.K., Pai, D.A., and Engelke, D.R. (2010). Cellular dynamics of tRNAs and their genes. FEBS Lett 584, 310-317.

Hopper, A.K., and Phizicky, E.M. (2003). tRNA transfers to the limelight. Genes Dev 17, 162-180.

Hopper, A.K., and Shaheen, H.H. (2008). A decade of surprises for tRNA nuclear- cytoplasmic dynamics. Trends Cell Biol 18, 98-104.

Hurt, D.J., Wang, S.S., Lin, Y.H., and Hopper, A.K. (1987). Cloning and characterization of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing. Mol Cell Biol 7, 1208-1216. 330

Hurto, R.L., and Hopper, A.K. (2011). P-body components, Dhh1 and Pat1, are involved in tRNA nuclear-cytoplasmic dynamics. RNA 17, 912-924.

Hurto, R.L., Tong, A.H., Boone, C., and Hopper, A.K. (2007). Inorganic phosphate deprivation causes tRNA nuclear accumulation via retrograde transport in Saccharomyces cerevisiae. Genetics 176, 841-852.

Irizarry, R.A., Bolstad, B.M., Collin, F., Cope, L.M., Hobbs, B., and Speed, T.P. (2003). Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res 31, e15.

Jones, G.M., Stalker, J., Humphray, S., West, A., Cox, T., Rogers, J., Dunham, I., and Prelich, G. (2008). A systematic library for comprehensive overexpression screens in Saccharomyces cerevisiae. Nat Methods 5, 239-241.

Kadaba, S., Krueger, A., Trice, T., Krecic, A.M., Hinnebusch, A.G., and Anderson, J. (2004). Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S. cerevisiae. Genes Dev 18, 1227-1240.

Kadaba, S., Wang, X., and Anderson, J.T. (2006). Nuclear RNA surveillance in Saccharomyces cerevisiae: Trf4p-dependent polyadenylation of nascent hypomethylated tRNA and an aberrant form of 5S rRNA. RNA 12, 508-521.

Kadowaki, T., Chen, S., Hitomi, M., Jacobs, E., Kumagai, C., Liang, S., Schneiter, R., Singleton, D., Wisniewska, J., and Tartakoff, A.M. (1994). Isolation and characterization of Saccharomyces cerevisiae mRNA transport-defective (mtr) mutants. J Cell Biol 126, 649-659.

Kaffman, A., Rank, N.M., O'Neill, E.M., Huang, L.S., and O'Shea, E.K. (1998). The receptor Msn5 exports the phosphorylated transcription factor Pho4 out of the nucleus. Nature 396, 482-486.

Kalhor, H.R., Penjwini, M., and Clarke, S. (2005). A novel methyltransferase required for the formation of the hypermodified nucleoside wybutosine in eucaryotic tRNA. Biochem Biophys Res Commun 334, 433-440.

Kim, J.H., Brachet, V., Moriya, H., and Johnston, M. (2006). Integration of transcriptional and posttranslational regulation in a glucose signal transduction pathway in Saccharomyces cerevisiae. Eukaryot Cell 5, 167-173.

Kim, T., Yoon, J., Cho, H., Lee, W.B., Kim, J., Song, Y.H., Kim, S.N., Yoon, J.H., Kim- Ha, J., and Kim, Y.J. (2005). Downregulation of lipopolysaccharide response in Drosophila by negative crosstalk between the AP1 and NF-kappaB signaling modules. Nat Immunol 6, 211-218.

331

Kornitzer, D., Raboy, B., Kulka, R.G., and Fink, G.R. (1994). Regulated degradation of the transcription factor Gcn4. EMBO J 13, 6021-6030.

Kuersten, S., Ohno, M., and Mattaj, I.W. (2001). Nucleocytoplasmic transport: Ran, beta and beyond. Trends Cell Biol 11, 497-503.

Kuhn, K.M., DeRisi, J.L., Brown, P.O., and Sarnow, P. (2001). Global and specific translational regulation in the genomic response of Saccharomyces cerevisiae to a rapid transfer from a fermentable to a nonfermentable carbon source. Mol Cell Biol 21, 916- 927.

Kutay, U., Lipowsky, G., Izaurralde, E., Bischoff, F.R., Schwarzmaier, P., Hartmann, E., and Gorlich, D. (1998). Identification of a tRNA-specific nuclear export receptor. Mol Cell 1, 359-369.

LaCava, J., Houseley, J., Saveanu, C., Petfalski, E., Thompson, E., Jacquier, A., and Tollervey, D. (2005). RNA degradation by the exosome is promoted by a nuclear polyadenylation complex. Cell 121, 713-724.

Lawless, C., Pearson, R.D., Selley, J.N., Smirnova, J.B., Grant, C.M., Ashe, M.P., Pavitt, G.D., and Hubbard, S.J. (2009). Upstream sequence elements direct post-transcriptional regulation of gene expression under stress conditions in yeast. BMC Genomics 10, 7.

Lee, M.S., Henry, M., and Silver, P.A. (1996). A protein that shuttles between the nucleus and the cytoplasm is an important mediator of RNA export. Genes & Development 10, 1233-1246.

Letzring, D.P., Dean, K.M., and Grayhack, E.J. (2010). Control of translation efficiency in yeast by codon–anticodon interactions. RNA 16, 2516-2528.

Lipowsky, G., Bischoff, F.R., Izaurralde, E., Kutay, U., Schafer, S., Gross, H.J., Beier, H., and Gorlich, D. (1999). Coordination of tRNA nuclear export with processing of tRNA. RNA 5, 539-549.

Longtine, M.S., McKenzie, A., 3rd, Demarini, D.J., Shah, N.G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J.R. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953- 961.

Lund, E., and Dahlberg, J.E. (1998). Proofreading and aminoacylation of tRNAs before export from the nucleus. Science 282, 2082-2085.

Lund, E., Guttinger, S., Calado, A., Dahlberg, J.E., and Kutay, U. (2004). Nuclear export of microRNA precursors. Science 303, 95-98.

332

Lundin, C., North, M., Erixon, K., Walters, K., Jenssen, D., Goldman, A.S.H., and Helleday, T. (2005). Methyl methanesulfonate (MMS) produces heat-labile DNA damage but no detectable in vivo DNA double-strand breaks. Nucleic Acids Research 33, 3799- 3811.

McCarthy, J.E.G. (1998). Posttranscriptional Control of Gene Expression in Yeast. Microbiology and Molecular Biology Reviews 62, 1492-1553.

Mori, S., Kajita, T., Endo, T., and Yoshihisa, T. (2011). The intron of tRNA-TrpCCA is dispensable for growth and translation of Saccharomyces cerevisiae. RNA 17, 1760- 1769.

Murthi, A., Shaheen, H.H., Huang, H.Y., Preston, M.A., Lai, T.P., Phizicky, E.M., and Hopper, A.K. (2010). Regulation of tRNA bidirectional nuclear-cytoplasmic trafficking in Saccharomyces cerevisiae. Mol Biol Cell 21, 639-649.

Nakanishi, K., and Nureki, O. (2005). Recent progress of structural biology of tRNA processing and modification. Mol Cells 19, 157-166.

Nakielny, S., and Dreyfuss, G. (1999). Transport of proteins and RNAs in and out of the nucleus. Cell 99, 677-690.

Natarajan, K., Meyer, M.R., Jackson, B.M., Slade, D., Roberts, C., Hinnebusch, A.G., and Marton, M.J. (2001). Transcriptional profiling shows that Gcn4p is a master regulator of gene expression during amino acid starvation in yeast. Mol Cell Biol 21, 4347-4368.

Noma, A., Kirino, Y., Ikeuchi, Y., and Suzuki, T. (2006). Biosynthesis of wybutosine, a hyper-modified nucleoside in eukaryotic phenylalanine tRNA. EMBO J 25, 2142-2154.

Ogawa, N., DeRisi, J., and Brown, P.O. (2000). New components of a system for phosphate accumulation and polyphosphate metabolism in Saccharomyces cerevisiae revealed by genomic expression analysis. Mol Biol Cell 11, 4309-4321.

Ohira, T., and Suzuki, T. (2011). Retrograde nuclear import of tRNA precursors is required for modified base biogenesis in yeast. Proc Natl Acad Sci U S A 108, 10502- 10507.

Paushkin, S.V., Patel, M., Furia, B.S., Peltz, S.W., and Trotta, C.R. (2004). Identification of a human endonuclease complex reveals a link between tRNA splicing and pre-mRNA 3' end formation. Cell 117, 311-321.

Pemberton, L.F., Rosenblum, J.S., and Blobel, G. (1997). A distinct and parallel pathway for the nuclear import of an mRNA-binding protein. J Cell Biol 139, 1645-1653.

Phizicky, E.M., and Hopper, A.K. (2010). tRNA biology charges to the front. Genes Dev 24, 1832-1860. 333

Qiu, H., Hu, C., Anderson, J., Bjork, G.R., Sarkar, S., Hopper, A.K., and Hinnebusch, A.G. (2000). Defects in tRNA processing and nuclear export induce GCN4 translation independently of phosphorylation of the alpha subunit of eukaryotic translation initiation factor 2. Mol Cell Biol 20, 2505-2516.

R development Core Team (2011). R: A language and environment for statistical computing.

Reich, M., Liefeld, T., Gould, J., Lerner, J., Tamayo, P., and Mesirov, J.P. (2006). GenePattern 2.0. Nat Genet 38, 500-501.

Reid, D.W., and Nicchitta, C.V. (2012). The enduring enigma of nuclear translation. The Journal of Cell Biology 197, 7-9.

Rhee, S.Y., Wood, V., Dolinski, K., and Draghici, S. (2008). Use and misuse of the gene ontology annotations. Nat Rev Genet 9, 509-515.

Ribbeck, K., Lipowsky, G., Kent, H.M., Stewart, M., and Gorlich, D. (1998). NTF2 mediates nuclear import of Ran. EMBO J 17, 6587-6598.

Rodriguez, M.S., Dargemont, C., and Stutz, F. (2004). Nuclear export of RNA. Biol Cell 96, 639-655.

Rouse, J., and Jackson, S.P. (2000). LCD1: an essential gene involved in checkpoint control and regulation of the MEC1 signalling pathway in Saccharomyces cerevisiae. EMBO J 19, 5801-5812.

Ruepp, A., Zollner, A., Maier, D., Albermann, K., Hani, J., Mokrejs, M., Tetko, I., Guldener, U., Mannhaupt, G., Munsterkotter, M., et al. (2004). The FunCat, a functional annotation scheme for systematic classification of proteins from whole genomes. Nucleic Acids Res 32, 5539-5545.

Santangelo, G.M. (2006). Glucose signaling in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 70, 253-282.

Sarkar, S., Azad, A.K., and Hopper, A.K. (1999). Nuclear tRNA aminoacylation and its role in nuclear export of endogenous tRNAs in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 96, 14366-14371.

Sarkar, S., and Hopper, A.K. (1998). tRNA nuclear export in saccharomyces cerevisiae: in situ hybridization analysis. Mol Biol Cell 9, 3041-3055.

Schena, M., Shalon, D., Davis, R.W., and Brown, P.O. (1995). Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270, 467- 470.

334

Seiple, L., Jaruga, P., Dizdaroglu, M., and Stivers, J.T. (2006). Linking uracil base excision repair and 5-fluorouracil toxicity in yeast. Nucleic Acids Research 34, 140-151.

Senger, B., Simos, G., Bischoff, F.R., Podtelejnikov, A., Mann, M., and Hurt, E. (1998). Mtr10p functions as a nuclear import receptor for the mRNA-binding protein Npl3p. EMBO J 17, 2196-2207.

Shaheen, H.H., and Hopper, A.K. (2005). Retrograde movement of tRNAs from the cytoplasm to the nucleus in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 102, 11290-11295.

Shaheen, H.H., Horetsky, R.L., Kimball, S.R., Murthi, A., Jefferson, L.S., and Hopper, A.K. (2007). Retrograde nuclear accumulation of cytoplasmic tRNA in rat hepatoma cells in response to amino acid deprivation. Proc Natl Acad Sci U S A 104, 8845-8850.

Shemer, R., Meimoun, A., Holtzman, T., and Kornitzer, D. (2002). Regulation of the Transcription Factor Gcn4 by Pho85 Cyclin Pcl5. Molecular and Cellular Biology 22, 5395-5404.

Shenton, D., Smirnova, J.B., Selley, J.N., Carroll, K., Hubbard, S.J., Pavitt, G.D., Ashe, M.P., and Grant, C.M. (2006). Global translational responses to oxidative stress impact upon multiple levels of protein synthesis. J Biol Chem 281, 29011-29021.

Sherlock, G. (2000). Analysis of large-scale gene expression data. Curr Opin Immunol 12, 201-205.

Shimada, Y., Gulli, M.P., and Peter, M. (2000). Nuclear sequestration of the exchange factor Cdc24 by Far1 regulates cell polarity during yeast mating. Nat Cell Biol 2, 117- 124.

Smirnova, J.B., Selley, J.N., Sanchez-Cabo, F., Carroll, K., Eddy, A.A., McCarthy, J.E., Hubbard, S.J., Pavitt, G.D., Grant, C.M., and Ashe, M.P. (2005). Global gene expression profiling reveals widespread yet distinctive translational responses to different eukaryotic translation initiation factor 2B-targeting stress pathways. Mol Cell Biol 25, 9340-9349.

Smyth, G.K. (2004). Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 3, Article3.

Springer, M., Wykoff, D.D., Miller, N., and O'Shea, E.K. (2003). Partially phosphorylated Pho4 activates transcription of a subset of phosphate-responsive genes. PLoS Biol 1, E28.

Stage-Zimmermann, T., Schmidt, U., and Silver, P.A. (2000). Factors affecting nuclear export of the 60S ribosomal subunit in vivo. Mol Biol Cell 11, 3777-3789.

335

Starck, S.R., Jiang, V., Pavon-Eternod, M., Prasad, S., McCarthy, B., Pan, T., and Shastri, N. (2012). Leucine-tRNA Initiates at CUG Start Codons for Protein Synthesis and Presentation by MHC Class I. Science 336, 1719-1723.

Stewart, M. (2003). Structural biology. Nuclear trafficking. Science 302, 1513-1514.

Takano, A., Endo, T., and Yoshihisa, T. (2005). tRNA actively shuttles between the nucleus and cytosol in yeast. Science 309, 140-142.

Teixeira, M.T., Forstemann, K., Gasser, S.M., and Lingner, J. (2002). Intracellular trafficking of yeast telomerase components. EMBO Rep 3, 652-659.

Thomas-Chollier, M., Defrance, M., Medina-Rivera, A., Sand, O., Herrmann, C., Thieffry, D., and van Helden, J. (2011). RSAT 2011: regulatory sequence analysis tools. Nucleic Acids Research 39, W86-W91.

Thomas-Chollier, M., Sand, O., Turatsinze, J.V., Janky, R., Defrance, M., Vervisch, E., Brohee, S., and van Helden, J. (2008). RSAT: regulatory sequence analysis tools. Nucleic Acids Res 36, W119-127.

Thomas, D., and Surdin-Kerjan, Y. (1997). Metabolism of sulfur amino acids in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 61, 503-532.

Thompson, D.M., and Parker, R. (2009). Stressing out over tRNA cleavage. Cell 138, 215-219.

Thompson, M., Haeusler, R.A., Good, P.D., and Engelke, D.R. (2003). Nucleolar Clustering of Dispersed tRNA Genes. Science 302, 1399-1401.

Tuller, T., Kupiec, M., and Ruppin, E. (2007). Determinants of protein abundance and translation efficiency in S. cerevisiae. PLoS Comput Biol 3, e248.

Tuller, T., Ruppin, E., and Kupiec, M. (2009). Properties of untranslated regions of the S. cerevisiae genome. BMC Genomics 10, 391.

Tusher, V.G., Tibshirani, R., and Chu, G. (2001). Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98, 5116-5121.

van Helden, J. (2003). Regulatory Sequence Analysis Tools. Nucleic Acids Research 31, 3593-3596.

Vanacova, S., Wolf, J., Martin, G., Blank, D., Dettwiler, S., Friedlein, A., Langen, H., Keith, G., and Keller, W. (2005). A new yeast poly(A) polymerase complex involved in RNA quality control. PLoS Biol 3, e189.

336

Vyas, K., Chaudhuri, S., Leaman, D.W., Komar, A.A., Musiyenko, A., Barik, S., and Mazumder, B. (2009). Genome-wide polysome profiling reveals an inflammation- responsive posttranscriptional operon in gamma interferon-activated monocytes. Mol Cell Biol 29, 458-470.

Walker, S.C., and Engelke, D.R. (2006). Ribonuclease P: the evolution of an ancient RNA enzyme. Crit Rev Biochem Mol Biol 41, 77-102.

Whitney, M.L., Hurto, R.L., Shaheen, H.H., and Hopper, A.K. (2007). Rapid and reversible nuclear accumulation of cytoplasmic tRNA in response to nutrient availability. Mol Biol Cell 18, 2678-2686.

Willis, I.M., and Moir, R.D. (2007). Integration of nutritional and stress signaling pathways by Maf1. Trends Biochem Sci 32, 51-53.

Wilson, W.A., and Roach, P.J. (2002). Nutrient-regulated protein kinases in budding yeast. Cell 111, 155-158.

Windgassen, M., Sturm, D., Cajigas, I.J., Gonzalez, C.I., Seedorf, M., Bastians, H., and Krebber, H. (2004). Yeast shuttling SR proteins Npl3p, Gbp2p, and Hrb1p are part of the translating mRNPs, and Npl3p can function as a translational repressor. Mol Cell Biol 24, 10479-10491.

Winzeler, E.A., Lee, B., McCusker, J.H., and Davis, R.W. (1999). Whole genome genetic-typing in yeast using high-density oligonucleotide arrays. Parasitology 118, 73- 80.

Wolfe, C.L., Lou, Y.C., Hopper, A.K., and Martin, N.C. (1994). Interplay of heterogeneous transcriptional start sites and translational selection of AUGs dictate the production of mitochondrial and cytosolic/nuclear tRNA nucleotidyltransferase from the same gene in yeast. Journal of Biological Chemistry 269, 13361-13366.

Yi, R., Qin, Y., Macara, I.G., and Cullen, B.R. (2003). Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 17, 3011-3016.

Yoshihisa, T., Yunoki-Esaki, K., Ohshima, C., Tanaka, N., and Endo, T. (2003). Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease mainly localizes on the mitochondria. Mol Biol Cell 14, 3266-3279.

Zaitseva, L., Myers, R., and Fassati, A. (2006). tRNAs promote nuclear import of HIV-1 intracellular reverse transcription complexes. PLoS Biol 4, e332.

337