Mapping Active Site Residues in Glutamate-5-Kinase. the Substrate Glutamate and the Feed-Back Inhibitor Proline Bind at Overlapping Sites

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

FEBS Letters 580 (2006) 6247–6253

Mapping active site residues in glutamate-5-kinase. The substrate glutamate and the feed-back inhibitor proline bind at overlapping sites

Isabel Pe´rez-Arellanoa, Vicente Rubiob, Javier Cerveraa,* a Centro de Investigacio´n Prı´ncipe Felipe, Avda. Autopista del Saler, 16, Valencia 46013, Spain b Instituto de Biomedicina de Valencia (IBV-CSIC), Jaime Roig 11, Valencia 46010, Spain

Received 22 August 2006; revised 10 October 2006; accepted 12 October 2006

Available online 20 October 2006

Edited by Stuart Ferguson

(a domain named after pseudo uridine synthases and archaeo- Abstract Glutamate-5-kinase (G5K) catalyzes the controlling first step of proline biosynthesis. Substrate binding, catalysis sine-specific transglycosylases) domain [10]. AAK domains and feed-back inhibition by proline are functions of the N-termi- bind ATP and a phosphorylatable acidic substrate, and make nal 260-residue domain of G5K. We study here the impact on a phosphoric anhydride [11]. The function of the PUA domain these functions of 14 site-directed mutations affecting 9 residues (a domain characteristically found in some RNA-modifying of Escherichia coli G5K, chosen on the basis of the structure of enzymes) [12] is not known. By deleting the PUA domain of the bisubstrate complex of the homologous enzyme acetylgluta- E. coli G5K we showed [10] that the isolated AAK domain, mate kinase (NAGK). The results support the predicted roles as the complete enzyme, forms tetramers, catalyzes the reac- of K10, K217 and T169 in catalysis and ATP binding and of tion and is feed-back inhibited by proline. We now pursue fur- D150 in orienting the catalytic lysines. They support the implica- ther structure-function correlations in G5K using site-directed tion of D148 and D150 in glutamate binding and of D148 and mutagenesis to map substrate-binding and catalytic residues N149 in proline binding. Proline increases the S0.5 for glutamate and appears to bind at a site overlapping with the site for gluta- within the AAK domain of the E. coli enzyme. The paradig- mate. We conclude that G5K and NAGK closely resemble each matic AAK-family enzyme N-acetyl-L-glutamate kinase other concerning substrate binding and catalysis, but that they (NAGK) was chosen as a model to decide which residues to have different mechanisms of feed-back control. mutate in G5K, because (1) it is homologous to the G5K 2006 Federation of European Biochemical Societies. Published AAK domain (Fig. 1B); (2) it catalyzes the same reaction ex- by Elsevier B.V. All rights reserved. cept for the use of N-acetylated glutamate; and (3) there exist high resolution structures of complexes of NAGK with sub- Keywords: c-glutamyl 5-kinase; Glutamate-5-kinase; Amino strates or substrate analogs which mimic different steps of acid kinase; proB; Site-directed mutagenesis; Allosteric the catalytic cycle [11,13]. We report here the effects of 14 regulation; Phosphoryl group transfer; Proline synthesis mutations affecting 9 residues of the AAK domain of G5K, shedding light on substrate binding and catalysis by G5K, and supporting the overlap of the site for the feed-back inhibitor, proline, with the site for the substrate glutamate.

1. Introduction

Proline accumulation in both prokaryotes and eukaryotes is 2. Materials and methods now believed to be related not only to the functions of proline as a protein amino acid and as a source of energy, carbon and 2.1. Site-directed mutagenesis nitrogen, but also as an osmolyte [1–4] and as a potential vir- E. coli proB cloning into pET-22b to yield pGKE, and overexpres- ulence factor [5–7] known to facilitate bacterial growth at ele- sion and purification of G5K have been reported [14]. Site-directed mutagenesis was carried out by the overlapping extension method vated osmolarities [8]. Glutamate is the primary precursor for [15] (Expand High Fidelity PCR System; from Roche), using as tem- proline biosynthesis in bacteria [3] and in osmotically stressed plate pGKE. In the first PCR step, two overlapping fragments of proB plant cells [2,9]. The first and controlling step of the synthesis were independently amplified for each mutation, using the common of proline from glutamate is catalyzed by glutamate-5-kinase forward outside primer 1 (Table 1) and the reverse mutation-specific (G5K) [3]. This enzyme is feed-back inhibited by proline, primer (even-numbered in Table 1), or using the common reverse primer 2 (Table 1) and the forward mutation-specific primer (odd-num- and, in Escherichia coli is a homotetramer of a 367 amino-acid bered in Table 1). After electrophoretic purification of the amplified polypeptide composed of (Fig. 1A) an N-terminal 257-residue fragments, the two overlapping fragments for each mutation were amino acid kinase (AAK) domain and a 110-residue PUA mixed and subjected to another round of PCR amplification including in the PCR mixture both outside primers 1 and 2, which introduce, respectively, an NdeI site at the initiator ATG and a BamHI site down- *Corresponding author. Fax: +34 96 328 97 01. stream of the stop codon of proB. The NdeI and BamHI digested- E-mail address: [email protected] (J. Cervera). amplified fragments were ligated using T4 ligase (Promega) into the NdeI and BamHI sites of plasmid pET-22b (Novagen). The mutant Abbreviations: AAK, amino acid kinase; G5K, glutamate-5-kinase; plasmids, isolated from E. coli DH5a cells (from Clontech) and con- NAGK, N-acetyl-L-glutamate kinase; PUA, a domain named after firmed to carry the desired mutation by complete DNA sequencing, pseudo uridine synthases and archaeosine-specific transglycosylases; were used to transform BL21(DE3) cells (from Novagen) and to drive SDS–PAGE, polyacrylamide gel electrophoresis in the presence of the overexpression of the mutant proteins, which were purified to sodium dodecyl sulphate homogeneity (Fig. 2) by the same procedure as for wild-type G5K [14].

0014-5793/$32.00 2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2006.10.031 6248 I. Pe´rez-Arellano et al. / FEBS Letters 580 (2006) 6247–6253

Fig. 1. (A) Domain organization of E. coli G5K showing the localization in the sequence of the mutations introduced here. (B) Alignment of the amino acid sequences of E. coli NAGK and of the AAK domain of G5K (residues 1–257 are shown), using red lettering for residues conserved in both enzymes, and highlighting in yellow background invariant residues among either G5Ks or among NAGKs. The mutations introduced here are shown below the G5K sequence. Above the NAGK sequence bars denote a helices in the structure of this enzyme, and arrows b strands. The triangles mark the residues that, on the basis of the NAGK structure, interact with the nucleotide (white) or with acetylglutamate (gray triangles). (C) Stereo view ball and stick representation of NAGK residues surrounding bound acetylglutamate and AMPPNP (PDB ﬁle 1gs5).

2.2. Enzyme activity assays without proline and I0.5 is the proline concentration at which G5K activity was assayed at 37 C as described [10], by measuring v = v[Pro] = 0 · 0.5). ADP release in the presence of 20 mM ATP, 0.15 M Na glutamate and 80 mM MgCl2. When ATP was varied, glutamate was kept at 2.3. Circular dichroism 0.15 M, and MgCl2 was in an excess of 60 mM over ATP. When glu- Measurements in the far-UV region (195–250 nm) were performed at tamate was varied, 20 mM ATP and 80 mM MgCl2 were used. One en- 25 C on a Jasco 810 spectropolarimeter, using 1.5–2.8 lM enzyme (ex- zyme unit makes 1 lmol ADP min1. Program GraphPad Prism pressed as the concentration of the enzyme polypeptide) in 0.2 ml of a (GradPad Software, San Diego, California) was used for data fitting solution of 25 mM Tris–HCl pH 7.2 containing 0.5 mM dithiothreitol. H to either hyperbolic kinetics, sigmoidal kinetics (v ¼ V max ½S = The optical path was 0.1 cm and the integration time was 4 s. Ten H H ½Pro¼0 H ðS0:5 þ½S ÞÞ or sigmoidal inhibition (v ¼ v ð1 ð½Pro = scans taken on each sample were averaged and the background spec- H H [Pro] = 0 I0:5 þ½Pro Þ; where H is the Hill coefficient, v is the velocity trum of the buffer was subtracted. I. Pe´rez-Arellano et al. / FEBS Letters 580 (2006) 6247–6253 6249

Table 1 Synthetic oligonucleotides used Primer number Mutation Direction Sequence 1a Used with all mutations Forward 50CAGAGACATATGAGTGACAGCC30 2b Used with all mutations Reverse 50TTGTTCCAGGATCCGCCTGCTCC30 3 K10A Forward 50CTGGTGGTAGCACTCGGCAC30 4 K10A Reverse 50GTGCCGAGTGCTACCACCAG30 5 G51A Forward 50TGTGACGTCGGCCGCGATCG30 6 G51A Reverse 50CGATCGCGGCCGACGTCACA30 7 D148A Forward 50AAGGTCGGCGCTAACGATA30 8 D148A Reverse 50TATCGTTAGCGCCGACCTT30 9 D148N Forward 50AAGGTCGGCAATAACGATA30 10 D148N Reverse 50TATCGTTATTGCCGACCTT30 11 N149A Forward 50GGCGATGCCGATAACCTTT30 12 N149A Reverse 50AAGGTTATCGGCATCGCC30 13 D150A Forward 50GATAACGCTAACCTTTCTGC30 14 D150A Reverse 50GCAGAAAGGTTAGCGTTATC30 15 D150N Forward 50GATAACAATAACCTTTCTGC30 16 D150N Reverse 50GCAGAAAGGTTATTGTTATC30 17 T169A Forward 50TTGCTGCTGGCCGATCAAA30 18 T169A Reverse 50TTTGATCGGCCAGCAGCAA30 19 T169S Forward 50TTGCTGCTGTCCGATCAAA30 20 T169S Reverse 50TTTGATCGGACAGCAGCAA30 21 D170A Forward 50TGCTGACCGCTCAAAAAGG30 22 D170A Reverse 50CCTTTTTGAGCGGTCAGCA30 23 D170N Forward 50TGCTGACCAATCAAAAAGG30 24 D170N Reverse 50CCTTTTTGATTGGTCAGCA30 25 M214A Forward 50CTGGCGGCGCGAGTACCAA30 26 M214A Reverse 50TTGGTACTCGCGCCGCCAG30 27 K217A Forward 50CATGAGTACCGCATTGCAG30 28 K217A Reverse 50CTGCAATGCGGTACTCATG30 29 K217R Forward 50CATGAGTACCAGATTGCAG30 30 K217R Reverse 50CTGCAATCTGGTACTCATG30 aNdeI site (underlined) at initiator ATG. bBamHI site (underlined) downstream of the stop codon.

St T169S N149A D150A D170N M214A K217R D150N T169A D170A K217A WT D148N K10A D148A G51A kDa 116

66.2

Fig. 2. Coomassie-stained SDS–PAGE (10% polyacrylamide) of the puriﬁed wild-type (WT) and mutant forms of E. coli G5K. St, molecular mass protein markers with the masses, in kDa, indicated at the side.

3. Results and discussion proline triggers much smaller Vmax changes (Fig. 3B), G5K ap- proaches a perfect K allosteric system (in the terminology of 3.1. Effects of proline on G5K activity Monod et al. [16]). When the glutamate concentration was de- G5K activity depends hyperbolically on the concentrations creased from 0.15 to 0.05 M, the proline concentrations needed of both ATP and glutamate, but the dependency on glutamate for inhibition were decreased, as expected for competition be- becomes sigmoidal in the presence of proline (Fig. 3A), with a tween glutamate and proline, and the dependency of the activ- hyperbolic increase in the Hill coefficient with proline ity on proline concentration became less sigmoidal than at concentration, from a value of 1.1 without proline, to 3.6 at higher glutamate (Fig. 3C). Glu infinite proline (Fig. 3B). The S0:5 increases linearly with proline concentration (Fig. 3B), as expected for competition 3.2. Preparation of the mutant enzyme forms between proline and glutamate. From the slope of the straight The mutations introduced here (shown below the G5K Pro line a Ki ¼ 89 3 lM, is estimated, a value 1000-fold lower sequence; Fig. 1B) affect residues that are either invariant or Glu than the Km in the absence of proline (82 mM, Table 2). Since conservatively replaced in both G5Ks and NAGKs 6250 I. Pe´rez-Arellano et al. / FEBS Letters 580 (2006) 6247–6253

[Proline] (mM) estimated visually by SDS–PAGE (sodium dodecyl sulphate– A 150 polyacrylamide gel electrophoresis)), they were purified simi- 125 0 larly to wild-type G5K (Fig. 2), and their CD spectra were indistinguishable from the spectrum of wild-type G5K (data 100 0.15 not shown), indicating that they are well folded and reason- 0.3 ably stable. 75 0.6 1 50 3.3. Mutations having large effects on catalysis (Table 2) velocity (U/mg) velocity 25 Except the D150A mutant, all the mutants were active, although the activity was 61% of that of wild-type G5K for 0 the mutations affecting K10, N149, D150, D170 and K217. As- 0 250 500 750 1000 1250 says at varying substrate concentrations proved mutations at [Glutamate] (mM) these residues to decrease very importantly Vmax, and thus to hamper catalysis. Judged from the NAGK crystal structure, B this effect was to be expected for mutations affecting K10, 12 Glu S0.5 K217 and D150, since the corresponding K8 and K217 of NAGK were proposed to catalyze phosphoryl transfer by 10 shielding negative charges in the pentavalent phosphorus transition state and in the ADP b-phosphate, respectively, and elative) 8 D162 of NAGK orients the catalytic amino groups of these lysines by interacting with them through its carboxylate group [11,13]. K8R and D162E mutations were previously shown 6 to decrease Vmax P 100-fold in NAGK [17]. Since the K217R mutation preserves the positive charge on the mutant 4 residue, the exact location of this charge appears crucial, given HGlu the mutation large effect in G5K. Similarly the negative charge on D150 appears crucial, as expected for interaction with the Kinetic parameter (r 2 VGlu positively charged catalytic lysines. Of the other two mutations causing large decreases in Vmax, 0 N149A may trigger its effect indirectly, by altering the position 0.0 0.5 1.0 of the crucial adjacent residue D150, but it is unclear how do [Proline] (mM) D170 mutations interfere with catalysis, since the corresponding NAGK residue, D181, merely makes one hydrogen bond C 1.00 with the ribose of ATP [11].

0.75 [Glu] (mM) 3.4. Mutations hampering glutamate binding (Fig. 4A and Table 2) Glu 0.50 D148N and D148A dramatically increased Km , preventing 150 saturation even at 1.2 M glutamate, although the activity of the D148N mutant was at this concentration 40% of wild- 0.25 velocity (relative) velocity 50 type, indicating that the Vmax was little or not affected by this Glu mutation. Assuming normal Vmax, Km would be increased 0.00 22- and 2000-fold by the D148N and D148A mutations, 0.0 0.1 0.2 0.3 0.4 0.5 respectively, indicating that the side chain of D148 is crucial [Proline] (mM) and that the negative charge on this side chain is important for glutamate binding. The corresponding NAGK residue, Fig. 3. Influence of proline on the dependency of the velocity on the N160, is involved in the binding of the acetamido group of ace- concentration of glutamate (A) and on the kinetic parameters for glutamate (B), and influence of decreasing the glutamate concentration tylglutamate [11] and thus the side-chain of D148 is likely to from 150 to 50 mM on the inhibition by proline (C). VGlu is the interact with the amino group of glutamate, contributing to velocity extrapolated at infinite glutamate concentration, HGlu is the neutralize this group. The carboxylate on D150 may also con- Glu Hill coefficient for glutamate (see Section 2) and S0:5 is the concen- Glu tribute to such neutralization, since the D150N mutation, in tration of glutamate giving a velocity of 0.5 · V . In (B) and (C) Glu values are expressed relative to the value of the corresponding addition to reducing Vmax, increased 13-fold the Km . parameter in the absence of proline. 3.5. Effects of other mutations (Table 2) ATP T169A and T169S increased Km 9- and 3-fold and de- (Fig. 1B). Only the invariant G5K residue N149 is not con- creased V max20- and 5-fold, respectively, pointing to a substan- served in NAGK, where it is replaced by the invariant (among tial role of the T169 hydroxyl in ATP binding and catalysis, as NAGKs) A161. The NAGK counterparts to the residues expected if this residue forms, as its counterpart in NAGK mutated here surround the bound substrates (Fig. 1C). The (S180) [11], a donor hydrogen bond with the ATP b-phos- mutant G5Ks were abundantly expressed in soluble form phate. The changes triggered by G51A are too small for the (10–20% of the soluble protein in the crude E. coli extracts, intended elimination of a donor hydrogen bond with the I. Pe´rez-Arellano et al. / FEBS Letters 580 (2006) 6247–6253 6251

Table 2 Kinetic parameters for wild-type and mutant G5Ks Mutation Kinetic parameters for ATP Glutamate Proline [ATP] = 1 [Glu] = 1 V (U/mg) Km (mM) V (U/mg) S0.5 (mM) H I0.5 (mM) H WT 127 ± 1 2.0 ± 0.1 163 ± 3 82 ± 4 1.13 ± 0.04 0.15 ± 0.01 2.1 ± 0.1 K10A 0.51 ± 0.02 6.1 ± 0.6 0.57 ± 0.01 91 ± 8 1.00 ± 0.03 0.26 ± 0.06 1.0 ± 0.1 G51A 38 ± 1 4.3 ± 0.3 95 ± 3 199 ± 8 2.32 ± 0.14 0.51 ± 0.04 2.3 ± 0.2 D148N 17.6 ± 0.5 2.3 ± 0.3 163a 1,797 ± 98 0.96 ± 0.04 5.9 ± 0.3 0.99 ± 0.04 D148A 0.13 ± 0.01 6.5 ± 0.6 163a 168,000 ± 48,000 1.13± 0.06 21.0± 1.3 1.00 ± 0.05 N149A 1.20 ± 0.02 4.5 ± 0.2 1.83 ± 0.1 135 ± 13 1.00 ± 0.07 2.16 ± 0.21 1.00 ± 0.09 D150N 0.13 ± 0.01 4.2 ± 0.5 0.535 ± 0.087 1,003 ± 279 1.0b 0.176 ± 0.017 0.99 ± 0.09 D150A <0.1(DL) ND <0.1 (DL) ND ND ND ND T169S 37 ± 1 6.1 ± 0.7 34.4 ± 0.8 82 ± 4 2.1 ± 0.2 0.021 ± 0.001 1.5 ± 0.1 T169A 6.6 ± 0.3 18.4 ± 1.6 5.0 ± 0.1 126 ± 5 1.70 ± 0.1 0.011 ± 0.001 1.04 ± 0.08 D170N 0.59 ± 0.01 1.8 ± 0.1 0.83 ± 0.04 64 ± 9 1.00 ± 0.10 0.22 ± 0.01 1.8 ± 0.1 D170A 1.17 ± 0.02 3.4 ± 0.2 1.24 ± 0.04 56 ± 5 1.199 ± 0.100 0.17 ± 0.02 1.8 ± 0.4 M214A 64 ± 2 6.4 ± 0.5 52.7 ± 0.6 39 ± 1 1.31 ± 0.04 0.165 ± 0.003 1.83 ± 0.03 K217A 0.75 ± 0.03 24.6 ± 2.9 0.74 ± 0.01 188 ± 8 1.9 ± 0.1 0.016 ± 0.001 1.4 ± 0.1 K217R 0.76 ± 0.03 17.6 ± 1.6 0.86 ± 0.01 162 ± 4 2.0 ± 0.1 0.020 ± 0.001 1.16 ± 0.09 Values for ATP, glutamate and proline were obtained from concentration-activity plots fitted to hyperbolae, sigmoidal substrate kinetics and sigmoidal inhibition kinetics (see Materials and methods). Standard errors are given. DL, detection limit. ND, undetectable activity. aThe V[Glu] = 1was given a fixed value of 163 (the value of the V[Glu] = 1 for the wild-type enzyme). bA fixed value of 1 was given to H.

mation of the hydrogen bond was not prevented by the struc- A WT tural disturbance introduced by the mutation, or that G51 150 does not make such hydrogen bond in G5K. This mutation

0.6 v (U/mg) D148A mimics the eﬀects of a low proline concentration, increasing D150N 0.4 the SGlu and rendering sigmoidal the glutamate saturation 100 0:5 0.2 kinetics. M214A also triggered less important changes than G51A [G lutamate] (mM) 0.0 0 250 500 750 1000 anticipated for the stacking of the side chain with the adenine

v (U/mg) ring of ATP [11], as observed in NAGK, suggesting that the 50 D148N role of M214 is either different in G5K, or that other contacts are able to replace the lost contacts in the mutant. 0 0 250 500 750 1000 1250 3.6. Effects of the mutations on the kinetic parameters for proline [Glutamate] (mM) (Fig. 4B and Table 2) None of the mutations abolished inhibition by proline, but B 1.0 mutations D148N and D148A increased 40- and 150-fold, respectively, the proline requirement. Since these mutations 1.0 also increase much KGlu, D148 appears involved in the binding 0.8 0.8 m 0.6 D148A of both glutamate and proline, and its negative charge is 0.6 0.4 important for the binding of both ligands. Another mutation, v (relative) WT 0.2 D148N G51A, also increased concomitantly, although much more M214A 0. 0 N149A Glu Pro 0.4 D170A 0 25 50 75 100 modestly, both the S0:5 and the I0:5 . These findings, together [Proline] (mM) v (relative) with the competition between proline and glutamate (see 0.2 T169S,A G51A above), strongly suggest that the sites for substrate and inhib- K217A,R itor overlap. The negative charge on D148 may be involved in 0.0 neutralizing the amino group of glutamate and the imino 0.00 0.25 0.50 0.75 1.00 1.25 group of proline. As expected for different ligands, the overlap Pro [Proline] mM is incomplete, since N149A increased 14-fold the I0:5 but did Glu not affect substantially the S0:5 , and the opposite was true for Fig. 4. Influence of some of the mutations on the concentration D150N. dependency of the activity for glutamate (A), and proline (B). The insets detail sets of data of difficult representation in the main panels. Mutations T169S, T169A, K217R and K217A decreased one Pro The values for the kinetic constants for each mutant are those given in order of magnitude the I0:5 , but these mutations caused up to Table 2. In (B) velocities are given as a fractions of the velocity for the ATP 15-fold increases in the Km , and therefore the decreased same mutant in the absence of proline, and the curves shown in the IPro may result from increased sigmoidicity of the glutamate main figure are those for the wild-type and for the mutants G51A and 0:5 T169S. dependency of the activity at partial saturation by ATP.

3.7. General discussion c-phosphoryl group of ATP (an interaction observed with the The present results support the quality of the alignment of corresponding G44 of NAGK, [13]), indicating that either for- E. coli G5K and NAGK (Fig. 1) and the similarity of substrate 6252 I. Pe´rez-Arellano et al. / FEBS Letters 580 (2006) 6247–6253 sites and catalytic mechanisms for both enzymes, as illustrated to determine the 3-D structure of the complex of G5K with best by the large effects on the Vmax of G5K and NAGK of proline, a goal that is being actively pursued in our laborato- mutations affecting K10/8 (G5K/NAGK numbering) or ries. While the present paper was under review two structures D150/162. Our results provide the first direct experimental evi- of G5K, from E. coli, have been deposited in the Protein Data- dence for the catalytic and ATP binding roles of K217/K217 bank (2J5T, 2J5V). When the coordinates are released it will be and T169/S180, and they highlight the important roles in glu- of great interest to assess the E. coli variant enzymes reported tamate binding of D148 and D150 of G5K. Nevertheless, the here in this new structural context. Km values for ATP and glutamate of E. coli G5K are 6-fold higher and 400-fold higher, respectively, than the Km values Acknowledgements: This work was supported by grants from the Span- of E. coli NAGK for the corresponding substrates [17], and, ish Ministerios de Educacioń y Ciencia (BFU2004-04472, BFU2004- 05159/BMC) and de Sanidad y Consumo-Instituto de Salud Carlos therefore, there must be important although perhaps subtle III-FISS (RCMN C03/08; REDEMETH G03/54; FISS PI 052838), differences between the substrate sites of both enzymes to jus- and by the Generalitat Valenciana (ACOMP06/123). We thank Drs. tify these differences in apparent affinities. The much higher M. Puig Mora and David Pantoja-Uceda (CIPF) for help with circular Glu AcGlu dichroism assays and with Fig. 1, respectively. Km of G5K relative to the Km of NAGK appears well adapted to the larger concentrations of glutamate than of acetylglutamate expected to be present in E. coli cells. At the mM range of glutamate concentrations expected to prevail in E. coli References [18], proline synthesis ‘‘in vivo’’ should be directly propor- tional to glutamate concentration, and should be nearly abol- [1] Csonka, L.N. and Hanson, A.D. (1991) Prokaryotic osmoregu- lation: genetics and physiology. Annu. Rev. Microbiol. 45, 569– ished by concentrations of proline as low as 0.1 mM. No such 606. potent proline inhibition can occur in plants if these have to [2] Kavi Kishor, P.B., Hong, Z., Miao, G., Hu, C. and Verma, D.P.S. synthesize high concentrations of proline under stress condi- (1995) Overexpression of D1-pyrroline-5-carboxylate synthetase tions [2,9]. Bifunctional G5Ks from plants (incorporating in increases proline overproduction and confers osmotolerance in transgenic plants. Plant Physiol. 108, 1387–1394. the same polypeptide G5K and glutamate-5-phosphate reduc- [3] Leisinger, T. (1996) Biosynthesis of proline in: Escherichia coli tase) appear to require higher proline concentrations for inhi- and Salmonella: Cellular and Molecular Biology (Neidhardt, bition than bacterial G5Ks [2,9], but regulatory mechanisms F.C., Ed.), pp. 434–441, ASM Press, Washington, DC. may also exist to increase the threshold for proline inhibition, [4] Aral, B. and Kamoun, P. (1997) The proline biosynthesis in living similarly to what has been recently found for arginine inhibi- organisms. Amino Acids 13, 189–217. [5] Bayer, A.S., Coulter, S.N., Stover, C.K. and Schwan, W.R. (1999) tion of the NAGK of photosynthetic organisms [19]. Impact of the high-affinity proline permease gene (putP) on the The conclusion of the present work that the sites for the sub- virulence of Staphylococcus aureus in experimental endocarditis. strate glutamate and for the inhibitor proline overlap, explains Infect. Immun. 67, 740–744. why the mutations previously found to decrease the sensitivity [6] Culham, D.E., Dalgado, C., Gyles, C.L., Mamelak, D., MacLe- llan, S. and Wood, J.M. (1998) Osmoregulatory transporter ProP of G5K to proline [9] map exclusively in the N-terminal do- influences colonization of the urinary tract by Escherichia coli. main of G5K, the domain that hosts the site for glutamate, Microbiology 144, 91–102. with clustering of many of these mutations in the vicinity of [7] Schwan, W.R., Coulter, S.N., Ng, E.Y., Langhorne, M.H., D148, the residue found here to be crucially involved in bind- Ritchie, H.D., Brody, L.L., Westbrock-Wadman, S., Bayer, ing both glutamate and proline, and it also accounts for the A.S., Folger, K.R. and Stover, C.K. (1998) Identification and characterization of the PutP proline permease that contributes to observation of impaired enzyme activity associated with some in vivo survival of Staphylococcus aureus in animal models. Infect. of the proline-desensitizing mutations [9]. Since in many Immun. 66, 567–572. organisms NAGK is feed-back inhibited by arginine [20,21], [8] Csonka, L.N. (1981) Proline over-production results in enhanced proline inhibition of G5K might resemble arginine inhibition osmotolerance in Salmonella typhimurium. Mol. Gen. Genet. 182, 82–86. of NAGK. In fact, arginine increases the Km for acetylgluta- [9] Fujita, T., Maggio, A., Garcia-Rios, M., Stauffacher, C., Bressan, mate of arginine-sensitive NAGK [20], similarly to the effect R.A. and Csonka, L.N. (2003) Identification of regions of the of proline on the S0.5 for glutamate in G5K. However, in tomato c-glutamyl kinase that are involved in allosteric regulation NAGK arginine binds in the C-terminal domain, far from by proline. J. Biol. Chem. 278, 14203–14210. the acetylglutamate site, next to an N-terminal kinked a-helix [10] Perez-Arellano, I., Rubio, V. and Cervera, J. (2005) Dissection of Escherichia coli glutamate 5-kinase: functional impact of the which is crucial for inhibition and which is missing in G5K deletion of the PUA domain. FEBS Lett. 579, 6903–6908. (judged from sequence comparisons), and the competition be- [11] Ramoń-Maiques, S., Marina, A., Gil-Ortiz, F., Fita, I. and tween arginine and acetylglutamate results from the favoring Rubio, V. (2002) Structure of acetylglutamate kinase, a key by these ligands of alternative enzyme conformations which enzyme for arginine biosynthesis and a prototype for the amino acid kinase enzyme family, during catalysis. Structure 10, 329– are, respectively, inactive and active [21]. The inhibition of 342. G5K by proline may resemble more the feed-back inhibition [12] Aravind, L. and Koonin, E.V. (1999) Novel predicted RNA- by UTP of another AAK family enzyme, bacterial UMP binding domains associated with the translation machinery. J. kinase, in which UTP was found to bind to the UMP site (cor- Mol. Evol. 48, 291–302. responding to the glutamate site of G5K) [22]. Nevertheless, [13] Gil-Ortiz, F., Ramoń-Maiques, S., Fita, I. and Rubio, V. (2003) The course of phosphorus in the reaction of N-acetyl-L-glutamate UTP and UMP are much more similar than glutamate and kinase, determined from the structures of crystalline complexes, proline, and therefore it is unclear if in G5K proline simply sits including a complex with an AlF4 transition state mimic. J. Mol. on the glutamate site or whether it inhibits in a more complex Biol. 331, 231–244. way such as by triggering an alternative conformation of the [14] Pe´rez-Arellano, I., Gil-Ortiz, F., Cervera, J. and Rubio, V. (2004) Glutamate-5-kinase from Escherichia coli: gene cloning, overex- substrate binding site. To clarify these issues and to analyze pression, purification and crystallization of the recombinant in more detail the potential relatedness of feed-back regulation enzyme and preliminary X-ray studies. Acta Crystallogr. D 60, in the different enzymes of the AAK family, it appears essential 2091–2094. I. Pe´rez-Arellano et al. / FEBS Letters 580 (2006) 6247–6253 6253

[15] Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K. and Pease, protein on N-acetyl-L-glutamate kinase from Synechococcus L.R. (1989) Site-directed mutagenesis by overlap extension using elongatus strain PCC 7942. J. Biol. Chem. 279, 55202–55210. the polymerase chain reaction. Gene 77, 51–59. [20] Fernańdez-Murga, M.L., Gil-Ortiz, F., Llaćer, J.L. and Rubio, V. [16] Monod, J., Wyman, J. and Chageux, J.P. (1965) On the nature of (2004) Arginine biosynthesis in Thermotoga maritima. Character- allosteric transitions: a plausible model. J. Mol. Biol. 12, 88–118. ization of the arginine-sensitive N-acetyl-L-glutamate kinase. J. [17] Marco-Marıń, C., Ramoń-Maiques, S., Tava´rez, S. and Rubio, V. Bacteriol. 186, 6142–6249. (2003) Site-directed mutagenesis of Escherichia coli acetylgluta- [21] Ramon-Maiques, S., Fernandez-Murga, M.L., Gil-Ortiz, F., mate kinase and aspartokinase III probes the catalytic and Vagin, A., Fita, I. and Rubio, V. (2006) Structural bases of substrate-binding mechanisms of these amino acid kinase family feed-back control of arginine biosynthesis, revealed by the enzymes and allows three-dimensional modelling of aspartokin- structures of two hexameric N-acetylglutamate kinases, from ase. J. Mol. Biol. 334, 459–476. Thermotoga maritima and Pseudomonas aeruginosa. J. Mol. Biol. [18] Neidhardt, F.C. and Umbarger, H.E. (1996) Chemical composi- 356, 695–713. tion of Escherichia coli in: Escherichia coli and Salmonella: [22] Briozzo, P., Evrin, C., Meyer, P., Assairi, L., Joly, N., Barzu, O. Cellular and Molecular Biology (Neidhardt, F.C., Ed.), pp. 13–16, and Gilles, A.M. (2005) Structure of Escherichia coli UMP kinase ASM Press, Washington, DC. differs from that of other nucleoside monophosphate kinases and [19] Maheswaran, M., Urbanke, C. and Forchhammer, K. (2004) sheds new light on enzyme regulation. J. Biol. Chem. 280, 25533– Complex formation and catalytic activation by the PII signaling 25540.