Page 1 of 230 Diabetes

Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose

intolerance

Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M.

Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3,

Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4,

Mohit Jain1,2, Jerrold M. Olefsky1 *

Affiliations:

1 Division of Endocrinology & Metabolism, Department of Medicine, University of California,

San Diego, La Jolla, California, USA.

2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA.

3 Second Genome, Inc., South San Francisco, California, USA.

4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA,

USA.

* Correspondence to: 858-534-2230, [email protected]

Word Count: 4749

Figures: 6

Supplemental Figures: 11

Supplemental Tables: 5

1

Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230

ABSTRACT

The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor

Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.

Overall, we describe a new mechanism by which the gut microbiota can modulate glucose metabolism, providing a potential approach for treatment of metabolic disease.

2 Page 3 of 230 Diabetes

Chronic inflammation in obesity can induce insulin resistance leading to Type 2 Diabetes

(T2D) (1). The commensal microbiota of the GI tract serve as a key link between diet and

metabolism, producing numerous metabolites that influence host physiology (2; 3). Changes in

gut microbiota, termed dysbiosis, are associated with obesity as well as other disease states.

Interestingly, obesity-associated dysbiosis has been implicated in the development of insulin

resistance and T2D (4). As of yet, most studies that have linked dysbiosis with obesity or T2D

involve associations and correlations without detailed mechanisms. As rates of obesity and T2D

continue to rise across the globe (5), identification of the mechanisms by which gut microbiota

interact with the host to modulate metabolism is necessary before therapeutic interventions can

be developed.

The effects of the microbiome and microbiota-derived byproducts extend beyond the

local intestinal epithelium or gut immune cells. In high-fat diet (HFD) mice, gut dysbiosis

preceded elevations in circulating inflammatory cytokines, suggesting an early role of the

microbiome in the induction of inflammation (6). As well, an ‘obese’ microbiome signature

confers an increased capacity to harvest energy from the diet, which could contribute to the

obese state (7). Obesity is strongly associated with an increased microbiome content of the

Fimicutes phylum and a decreased representation of the Bacteroidetes phylum (8). The

importance of the microbiome was further highlighted in a study where germ-free mice who

received microbiota transplants from an obese human twin gained 10% more fat mass compared

to mice receiving a microbiota transplant from the lean twin (9). However, the mechanisms

connecting microbiome changes and insulin resistance or obesity remain to be elucidated, and

are likely to involve both immune cells and enteroendrine cells (10).

3 Diabetes Page 4 of 230

Incretins are a class of metabolic hormones released from enteroendocrine cells in the gut

(11). After eating, glucagon-like peptide 1 (GLP-1) is released from L cells, which acts on β- cells to potentiate glucose-stimulated insulin secretion (11). Indeed, antagonism of the GLP-1 receptor lowers insulin secretion and increases blood glucose (12). In T2D humans, post-prandial

GLP-1 secretion is generally impaired (13), although the mechanism has not been established

(14). The microbiome, including metabolites and byproducts, may play a role in gut hormone secretion since enteroendocrine cells contain receptors to these products and can be influenced by them (10).

Metabolites and byproducts of the microbiome have been shown to orchestrate a variety of immune responses in the mammalian host. Among these different products, N-formyl peptides are derived from foreign bacteria or destroyed host cells (mitochondria) and activate G protein- coupled N-formyl peptide receptors (FPRs) (15). N-formyl peptides traditionally define a large group of oligopeptides that contain a formyl-containing methionine (16). These motifs are part of a larger group known as pathogen- or danger-associated molecular patterns (PAMPs and

DAMPs) because they stimulate immune responses and inflammation (17). N-formyl peptides can stimulate chemotaxis of FPR-expressing immune cells (18), which leads to a signaling cascade that can cause phagocytosis (19) or apoptosis (20). Intestinal epithelial cells also express the Fpr1 receptor, and in response to an infection, can affect epithelial cell restitution

(21) or migration (22). However, a role for Fpr1 in metabolism remains unexplored (23).

In the current study, we investigated whether fMLF levels are altered in conditions of obesity and the associated dysbiosis, and reveal a mechanism whereby this bacterial product influences glucose metabolism.

4 Page 5 of 230 Diabetes

RESEARCH DESIGN AND METHODS

Animal care and use. Fpr1-KO and Glp1r-KO mice were generated as previously described (24;

25). Only male mice were used in this study, fed ad libitum and maintained on a 12/12-hour

light/dark cycle. At 8 weeks of age, mice were placed on a 60% HFD (Research Diets) or normal

chow diet (13.5% fat, LabDiet) for 8-10 weeks before analyses. For broad-spectrum antibiotic

treatment, mice were subject to daily oral gavage for two weeks with water alone or containing

mixture of antibiotics (Sigma): 0.5 mg/mL vancomycin HCl, 1 mg/mL ampicillin sodium salt, 1

mg/mL neomycin sulfate, 1 mg/mL metronidazole, and 1 mg/mL gentamycin sulfate. Mice were

treated with the Glp1r antagonist Exendin 9-39 (Sigma) or saline vehicle in a 0.2 mg/kg dose 20

minutes before metabolic studies. fMLF (Sigma) was administered at 1 mg/kg in saline via oral

gavage one hour prior to analyses. cFLFLF was provided daily at 0.5 mg/kg by oral gavage for

two weeks prior to analyses. For all drug treatments, body weight and food intake were

monitored prior and during the treatment period. Germfree (GF) C57BL/6 mice maintained in

the UC San Diego Gnotobiotic Mouse Facility. GF mice were fed either autoclaved chow diet

(2019S Teklad Global 19% Protein Extruded Rodent Diet, Harlan Laboratories) or irradiated

sterilized 60% HFD (06414 Teklad) as previously described (26). For fecal transplantation, 8-10-

week-old GF mice were gavaged with fecal suspensions from either WT HFD or Fpr1-KO HFD

animals (50 mg/mL). Animal housing and procedures were performed according to UC San

Diego and Institutional Animal Care and Use Committee-approved protocols, and conformed to

the Guide for Care and Use of Laboratory Animals of the National Institutes of Health.

fMLF detection and analysis. Tissues, feces and plasma were collected, homogenized and

lyophilized, if necessary. Metabolites were extracted by adding phosphate-buffered saline (PBS)

containing 4 nM of isotopically-labeled fMLF [N-formyl-L-methionyl-L-leucyl (13C-6, 15N)-L-

5 Diabetes Page 6 of 230

phenylalanine] as an internal standard (New England Peptide). The mixture was extracted using a Waters Oasis® HLB SPE cartridge (30 mg, 1 mL) then eluted. The eluent was dried in-vacuo using a Thermo Savant vacuum concentrator (Thermo Scientific) with the resulting dried pellet resuspended in MeOH:H2O (40:60, v/v) for LC-MS analysis.

LC-MS analysis was performed on Agilent 1290 Infinity II UPLC system (Agilent

Technologies) coupled to an Agilent 6495 triple quadrupole mass spectrometer equipped with an electrospray ionization (ESI) source. The acquired data was analyzed by Agilent MassHunter workstation software (version B.07.01) and the concentration of fMLF was determined using calibration curves of isotopically-labeled standard spiked into pooled plasma or stool at 1, 2.5, 5,

10, 25 and 50 nM.

Bacterial DNA measurement from feces. The PowerViral DNA/RNA Isolation Kit (MoBio) was used to isolate DNA from feces, followed by qPCR for the bacterial 16S rRNA gene V2 region. Bacterial DNA concentration was estimated using a standard curve of bacterial DNA.

Cell culture and siRNA transfection. Intraperitoneal macrophages were elicited from mice by injection of 3% thioglycollate and harvested in PBS after 3 days. mGLUTag cells were cultured as previously described (27). 48 hours after plating cells, we transfected pooled siRNA libraries against Fpr1 or Fpr2, or a scrambled negative control (ON-TARGETplus SMARTpool, GE

Dharmacon), using GenMute transfection reagent (SignaGen).

In vitro chemotaxis assay. After siRNA transfection, 1x105 cells were placed in the upper chamber of a Transwell plate (Corning, 8 m polycarbonate filter), whereas RPMI containing fMLF (250 nM, Sigma) or MCP-1 (100 ng/mL, Sigma) was placed in the lower chamber, and incubated for 4 hours. Cells that migrated to the other side of the Transwell filter were stained

6 Page 7 of 230 Diabetes

with DAPI, images captured on an Olympus MVX10 Macro-view microscope and cells counted

using ImageJ software (NIH).

Gene expression analysis. RNA was isolated with the DirectZol RNA isolation kit (Zymo

Research), and cDNA synthesized using the High Capacity Reverse Transcription Kit (Applied

Biosystems). Quantitative real-time PCR was performed using iTaq SYBRgreen Supermix

(BioRad) and the StepOnePlus Real-time PCR system (Applied Biosystems). Relative gene

expression was calculated using the Ct method with GAPDH as an internal control. Inferred

expression of intestinal epithelial cell Fpr1 was calculated by subtracting lamina propria gene

expression from the total ileum gene expression. Primer sequences are listed in Table S1.

Intracellular cAMP analysis. Intracellular cAMP levels in intraperitoneal macrophages were

measured using the Bridge-It cAMP Designer Fluorescence Assay Kit (Mediomics).

Metabolic studies. Mice were fasted for 6 hours prior to conducting ITTs and GTTs, which are

described previously (28).

GLP-1 detection. Blood serum was collected from mice fasted for 6 hours, immediately before

(basal) and 10-15 minutes after dextrose gavage, in the presence of DPP-IV inhibitor (EMD

Millipore). Postprandial blood collection was taken at 10 minutes after gavage in NCD mice and

15 minutes after gavage in HFD mice. Analysis of GLP-1 was conducted by High Sensitivity

Active GLP-1 Chemiluminescent ELISA (EMD Millipore).

Glucose-stimulated insulin secretion assay. Primary murine islets were isolated as previously

described (29). Secreted insulin was normalized to the corresponding intracellular insulin levels

in the cell pellet of each sample.

Glucose-stimulated GLP-1 secretion assay. mGLUTag cells were stimulated with 3mM

glucose in the presence or absence of Fpr1 agonists (fMLF) for 4 hours.

7 Diabetes Page 8 of 230

Plasma protein measurements. Fasting insulin, glucagon, total GLP-1 and active GLP-1 levels were measured by ELISA (Alpco, Mercodia, and EMD Millipore, respectively). Other fasting plasma proteins were measured by MILLIPLEX Multiplex assay (EMD Millipore).

Histological analyses. Tissue sections of pancreas, eWAT, small intestine or colon were immunostained with appropriate antibodies listed in Table S1 and analyzed as described previously (30).

RNA Fluorescence in situ Hybridization RNA-FISH was performed on frozen sections of the small intestine and colon using an RNAscope Fluorescent Multiplex Kit with RNAscope probes designed against mouse Fpr1 (catalog # 319251) and mouse Proglucagon (catalog # 400601), according to the manufacturer’s instructions (Advanced Cell Diagnostics, Inc.). Slides were counterstained with DAPI and images captured with an Olympus FV1000 Spectral Confocal

Microscope. For quantification, 15-30 randomly selected Proglucagon + L-cells on each slide were observed for the Fpr1 probe signal, and images were analyzed for Fpr1 probe fluorescence intensity using Image J software.

Immunoblot analysis. Proteins from tissue lysates loaded onto a SDS- PAGE gel then transferred to a PVDF membrane. Membranes were blocked then incubated with antibodies listed in Table S2 and analyzed as previously described (21).

Flow cytometry analysis. Lamina propria leukocytes were isolated from the small intestine and colon as previously described, followed by staining with fluorescence-tagged antibodies to detect cell lineages (See table (31) and Table S2). Data were collected with a BD FACS Canto flow cytometer and analyzed using FloJo software.

8 Page 9 of 230 Diabetes

Fecal albumin analysis. Fecal pellets were collected prior to and 8-10 weeks after placing

animals on HFD and frozen at -80°C. Feces were resuspended at 10 mg/mL in PBS and albumin

concentration determined by ELISA (Bethyl Labs).

In vivo FITC-Dextran assay. Analysis was performed as previously described (32). The

concentration of FITC-Dextran was determined by fluorescence spectroscopy relative to a linear

standard curve of FITC-Dextran prepared in plasma from untreated mice.

Bacterial 16S rRNA gene sample processing and sequencing. Bacterial DNA was isolated

from feces using the PowerFecal DNA Isolation Kit (MoBio), according to the manufacturer’s

guidelines. Pools of PCR amplification using bacterial 16S V4 rDNA fusion primers (515f and

806r) were loaded into an Illumina MiSeq and sequenced for 250 cycles for paired-end

sequencing (33).

Sequencing data analyses. Sequenced paired-end reads were merged, quality filtered, and

dereplicated with USEARCH (34). Representative sequences from the de novo OTUs were

assigned taxonomic classification via mothur’s bayesian classifier at 80% confidence; the

classifier was trained against the Greengenes reference database of 16S rRNA gene sequences

clustered at 99% (35). Alpha- and beta-diversity metrics were calculated as previously described

(36)-(37).

Inference of Metagenomes. Metagenome prediction was conducted from 16S rRNA sequencing

data using the Piphillin algorithm, utilizing the reference genome databases KEGG 70.1 and

BioCyc 18.0 (38).

Synthesis and purification of cFLFLF. The synthetic peptide cinnamoyl-phenylalanyl-

(D)leucine-phenylalanyl-(D)leucine-phenylalanine (cFLFLF) was synthesized using a standard

9 Diabetes Page 10 of 230

solid phase Wang-resin supported Fmoc peptide synthesis protocol using an auto synthesizer (CS

Bio Company), similar to previous publications (39).

Significance testing. Sample sizes necessary for animal studies were estimated using Russ

Lenth’s power calculator (University of Iowa): http://homepage.divms.uiowa.edu/~rlenth/Power/. Whole microbiome significance testing was

performed by Permutational Analysis of Variance (PERMANOVA, version 3.2.2, www.r-

project.com) (40). Taxon significance, or the univariate differential abundance of OTUs, was

tested using the DESeq2 package and q-values were calculated with the Benjamini-Hochberg

procedure to correct p-values, controlling for false discovery rates (41; 42). All other data was

analyzed for significance testing using GraphPad Prism software.

10 Page 11 of 230 Diabetes

RESULTS

fMLF is increased in HFD/obese mice and requires Fpr1 to induce chemotaxis

To determine whether levels of N-formyl peptides are altered by HFD-induced obesity,

we conducted mass spectrometry analysis of blood plasma and GI tissues from wild-type (WT)

mice fed either a normal chow diet (NCD) or a 60% HFD. We found that blood levels of the N-

formyl peptide fMLF are several fold higher in obese/HFD compared to lean/NCD animals, and

increase over time on HFD (Fig. 1A-B). GI levels of fMLF across all gut regions are even more

dramatically increased on HFD, and are in a much higher range compared to those found in the

circulation (Fig. 1C-E). These elevated fMLF levels are particularly dramatic considering the

reduction in total bacterial load that occurs over time on HFD (Fig. 1F). Consistent with a

microbiota-derived origin, treatment of NCD or HFD mice with broad-spectrum antibiotics for

two weeks led to ~80-100% reduction in blood and intestinal fMLF levels (Fig. 1G-H).

Additionally, germfree animals also had barely detectable intestinal and blood levels of fMLF on

NCD (Fig. S1A-B). One of the receptors for fMLF is the N-formyl receptor, Fpr1, which we

found expressed in all parts of the intestine and is increased in the ileum and colon under HFD

feeding (Fig. 1I). Intestinal lamia propria showed the highest expression of Fpr1 (Fig. S1C).

However, Fpr1 expression was ~50% reduced in the small intestinal lamina propria of HFD

animals; therefore, the increased Fpr1 expression in the total intestinal tissue in these mice

resides in the epithelial compartment (Fig. S1D). Although mammals have several FPRs, in vitro

macrophage chemotaxis experiments revealed that fMLF acts through the Gi-coupled Fpr1,

rather than Fpr2, and also reduces forskolin-induced cAMP (Fig. 1J-L, Fig. S1E-F) (43). In

addition, qPCR expression analyses confirmed that Fpr1 is expressed throughout the intestine,

where fMLF levels are highest, and is increased in HFD compared to NCD animals (Fig. S1G-

11 Diabetes Page 12 of 230

H). These findings, together with the marked differences between blood and intestinal fMLF levels, lead us to suggest that Fpr1 is stimulated by fMLF present in the intestinal lumen, consistent with reports that Fpr1 is expressed on the apical surface of intestinal epithelial cells

(44).

Loss of Fpr1 in HFD/obese mice improves glucose tolerance and is GLP-1-dependent

To assess the metabolic effects of Fpr1, we placed WT and Fpr1-KO littermates on HFD for 10 weeks and measured glucose and insulin tolerance. Oral glucose tolerance tests (OG-

GTTs) revealed a significant improvement in glucose tolerance in Fpr1-KO versus WT mice, with no change in body weight, organ weight or overall food intake (Fig. 2A-B, Fig. S2A-I). In addition, Fpr1-KO mice displayed increased plasma insulin levels in both the basal state and in response to glucose (Fig. 2C), while insulin tolerance tests revealed no improvement in insulin sensitivity (Fig. 2D-E). In contrast, loss of Fpr1 did not lead to a significant improvement in glucose or insulin tolerance on NCD (Fig. S3). Overall, this is consistent with the idea that elevated fMLF levels in the HFD state activates Fpr1 leading to glucose intolerance.

To examine how loss of Fpr1 leads to increased insulin levels, we measured ex vivo glucose stimulated-insulin secretion using pancreatic islets isolated from HFD WT and Fpr1-KO mice. Surprisingly, we found no change in insulin secretion (Fig. 2F). In addition, islet size and total mass in Fpr1-KO mice was unchanged (Fig. S2J-K), although intracellular levels of insulin were elevated (Fig. 2G). This suggests that Fpr1 deficiency increases insulin levels through an extrinsic, or islet-nonautonomous, manner. This is also consistent with findings that Fpr1 is expressed only at very low levels in WT pancreatic islets, and reduced further in HFD conditions

(Fig. S1D). Interestingly, circulating GLP-1 levels were higher in HFD Fpr1-KO mice compared to WT mice (Fig. 2H). No significant changes were detected in levels of other circulating gastric

12 Page 13 of 230 Diabetes

hormones or glucagon (Fig. S4), suggesting that GLP-1 may drive the increased insulin secretion

in Fpr1-KO animals. We also found that antibiotic-treated HFD mice displayed improved

glucose tolerance and increased GLP-1 levels, consistent with a connection between the gut

microbiota and GLP-1 modulation (Fig. S5). To determine whether the glucose-tolerant

phenotype of HFD Fpr1-KO mice is dependent upon GLP-1, we pre-treated WT and Fpr1-KO

HFD mice with the GLP-1 receptor (Glp1r) antagonist exendin 9-39 (45). This antagonist

prevented the improved glucose tolerance in Fpr1-KO mice compared to vehicle-treated

littermates (Fig. 2I-J). Similarly, the elevated insulin levels in Fpr1-KO animals were suppressed

by Glp1r inhibition (Fig. 2K). Thus, the beneficial effects of Fpr1 deficiency are dependent upon

GLP-1 signaling.

GLP-1 secretion is dependent on Fpr-1 expression

Consistent with elevated GLP-1 levels in HFD Fpr1-KO mice, immunofluorescence

analysis revealed increased GLP-1 expression in enteroendocrine L-cells of the ileum and colon

in these mice compared to reduced levels observed in WT HFD mice (Fig. 3A-B, Fig. S6A).

mRNA transcript levels of proglucagon, the precursor of GLP-1, were also increased in Fpr1-

KO mice relative to WT on HFD (Fig. 3C, Fig. S6B-C), indicating a potential transcriptional

basis for increased GLP-1 levels. We also demonstrate Fpr1 expression in L-cells through RNA-

fluorescence in situ hybridization and immunofluorescence analyses (Fig. 3D, Fig. S6D-E).

Interestingly, whereas Fpr1 expression was quite low and difficult to detect in NCD L-cells, we

found increased Fpr1 expression in HFD L-cells. In addition, Fpr1 expression was increased in

the colon of HFD mice as measured by qPCR and western blot analyses (Fig. 1I, Fig. S1G-G

and Fig. 6D-G). This provides a reasonable explanation for the more dramatic phenotypic

difference in Fpr1-KO mice on HFD. GLP-1 can also be produced in pancreatic α-cells, but our

13 Diabetes Page 14 of 230

studies show Fpr1 expression to be very low in isolated murine islets, with even lower expression in HFD (Fig. S1C-D). This suggests that the actions of Fpr1 to modulate GLP-1 levels are primarily through L-cells in the intestine.

Given these results, we postulated that fMLF acts upon L-cells to suppress glucose- stimulated GLP-1 secretion. To test this, we measured glucose-stimulated GLP-1 secretion in murine mGLUTag L-cells, treated with or without fMLF. Treatment with fMLF suppressed

GLP-1 secretion in a dose-dependent fashion (Fig. 3E). Furthermore, siRNA-mediated Fpr1 knockdown abrogated the effect of fMLF to reduce GLP-1 secretion at any of the concentrations tested (Fig. 3F, Fig. S6F). Whereas Fpr1 was well expressed, we could not detect the low affinity Fpr2 in these cells (data not shown). Treatment of mGLUTag cells with palmitate to mimic HFD conditions also led to increased expression of Fpr1, similar to that observed in vivo

(Fig. S6E). Overall, we conclude that fMLF can signal through FPR1 in L-cells to inhibit GLP-1 secretion.

Flow cytometric analysis of the small intestinal lamina propria confirmed previously reported immune cell population differences in HFD versus NCD animals, including reduced eosinophil and increased macrophage numbers (Fig. S7A-H) (32). However, loss of Fpr1 did not change immune cell composition in either diet condition. qPCR analysis of these cells revealed little change in pro-inflammatory gene expression, although anti-inflammatory IL-10 expression was increased in Fpr1-KO HFD mice (Fig. S7I-J). Similarly, elevated IL-10 levels were detected in the blood of these mice (Fig. S7K). Analysis of inflammation in epidydimal white adipose tissue also showed no significant change in macrophage numbers and only a modest improvement in inflammatory gene expression (Fig. S8).

Pharmacological control of Fpr1 activity modulates GLP-1 levels and glucose tolerance

14 Page 15 of 230 Diabetes

To confirm that the Fpr agonist fMLF detrimentally impacts glucose metabolism in vivo,

we acutely treated WT HFD mice with fMLF. Treatment reduced glucose tolerance (Fig. 4A-C)

and GLP-1 levels (Fig. 4D). In contrast, fMLF had no significant effect in NCD mice, likely due

to the low expression of GI L-cell Fpr1 in these animals compared to HFD (Fig S9A). In

addition, we determined whether pharmacological inhibition of Fpr1 could provide similar

benefits as seen in Fpr1-KO mice. In contrast to agonist administration, treatment of WT HFD

mice with the Fpr1 antagonist, cFLFLF (Fig. S9B), improved glucose tolerance (Fig. 4E-F), and

increased plasma insulin and GLP-1 levels, without changing body weight or food intake (Fig.

4G-H, Fig. S9C-H). The improved glucose tolerance induced by the Fpr1 antagonist is

dependent upon the GLP-1 receptor, as treatment had no effect in HFD Glp1r-KO littermates

(Fig. 4E-F). These results suggest that GLP-1 dependency is the dominant mechanism for the

Fpr1-KO phenotype.

Loss of Fpr1 alters intestinal microbiome composition in HFD/obese mice

We next assessed the effects of diet and genotype on the microbiome. Levels of fMLF in

the blood and intestine of HFD Fpr1-KO mice were reduced compared to WT (Fig. 5A-B).

Measurement of gastrointestinal permeability as assessed by fecal albumin content and analysis

of blood levels of orally administered FITC-dextran confirmed increased permeability in HFD

animals, consistent with the increased plasma fMLF levels (Fig. S10A-B) (32). However, we

found no change in GI permeability in Fpr1-KO mice compared to WT, suggesting that the

microbiota composition in the Fpr1-KO mice might be responsible for decreased fMLF. To

investigate this, we conducted fecal 16S rRNA gene sequencing of WT and Fpr1-KO littermates

fed NCD or HFD. Sequences were clustered based on similarity into Operational Taxonomic

Units (OTUs) and compared against a reference 16S rRNA database to identify their bacterial

15 Diabetes Page 16 of 230

classifications (Fig. S10C) (35). There was a modest change in alpha diversity between lean/NCD and HFD animals as measured by either the Shannon diversity index or OTU richness

(Fig. 5C), while loss of Fpr1 led to a marked increase in diversity compared to WT on HFD, although not on NCD (Fig. 5C and Fig. S10D-E). We next examined compositional differences between samples, termed beta diversity, based on dissimilarity of whole microbiome abundance profiles, utilizing Bray-Curtis and principal component analyses. Diet was the strongest determinant of differences, with HFD and NCD samples highly dissimilar regardless of genotype

(Fig. 5D). Interestingly, the Fpr1-KO significantly affected microbiome composition, but only in

HFD animals, revealing that HFD interacts with the Fpr1-KO genotype to uncover an otherwise masked phenotype.

Comparison between Fpr1-KO and WT microbiome abundances on HFD revealed differences in over 360 OTUs (Fig. 5E, Table S3). The mean relative abundances of several obesity-associated families within these phyla were altered by diet and genotype, including

Lachnospiraceae and Rikenellaceae (Fig. S10F-H) (46). To illuminate what functional bacterial pathways and enzymes might be altered, we performed Piphillin inferred metagenomic content analysis, which predicts metagenomes from 16S rRNA sequencing data by comparison with reference genome databases (47). This analysis predicted numerous pathways and enzymes altered by diet or genotype (Figs. 5F, S10I, Tables S4-S5).

As changes in host metabolism can influence gut microbiota composition (4), we tested whether the differences in microbiota observed in HFD Fpr1-KO mice might be the result or a cause of improved glucose tolerance. Given the coprophagic nature of mice, one would predict that a microbiota-dependent effect would be transferrable through co-housing. We found that even when co-housed, differences in glucose tolerance were readily observed between

16 Page 17 of 230 Diabetes

genotypes, arguing against microbiome-transferable effects (Fig. 5G). Analysis of whole

microbiome abundance profiles from multiple cohorts containing co-housed or separated mice

showed that, whereas WT and Fpr1-KO mice raised in separate cages display differences in

microbiota composition, those that are co-housed are more similar or the same (Fig. S10J).

Fecal microbiota transfer from Fpr1-KO HFD donor mice to germfree recipient mice does

not alter glucose tolerance compared to controls.

To further elucidate the role of the microbiome, we performed fecal microbiota transfer

experiments, in which we transferred microbiota by gavage from either WT or Fpr1-KO HFD

donor mice to germfree recipient animals. After 8 weeks on HFD, no differences in glucose

tolerance were found between animals receiving microbiota from WT or Fpr1-KO mice (Fig.

6A). Insulin and GLP-1 levels were also unchanged, suggesting that the altered microbiome of

Fpr1-KO mice does not transfer the improved metabolic phenotype (Fig. 6B-C). Rather, the

enhanced glucose tolerance in Fpr1-KO mice appears to be genotype related. Body weight,

epididymal fat and liver weight were also unchanged between mice that received WT or Fpr1-

KO HFD microbiome transplants (Fig. 6D-F).

17 Diabetes Page 18 of 230

DISCUSSION

In these studies, we identify a bacterial product and host receptor signaling mechanism that modulates GLP-1 to influence metabolism in diet-induced obesity. As such, fMLF is among the first identified microbiota-produced compounds increased in obesity, which can directly impair glucose homeostasis. These data support a model whereby lean animals have a healthy microbiota producing lower levels of fMLF, which, together with low Fpr1 expression in L-cells, allows for abundant postprandial GLP-1 secretion. In contrast, obesity-induced dysbiosis leads to elevated fMLF and increased Fpr1 expression, culminating in suppressed GLP-1 secretion and reduced glucose tolerance (Fig. S11).

Incretins are important hormones that stimulate β-cell glucose-stimulated insulin secretion (11). In particular, gastrointestinal L-cells produce GLP-1 under the influence of dietary glucose as well as other regulatory inputs. Recent studies have also demonstrated that glucagon-producing -cells in the pancreatic islets also produce GLP-1 and this may play an important role in stimulating insulin secretion in neighboring -cells (48). In addition, with respect to α-cells versus L-cells, our studies found low expression of Fpr1 in α-cells compared to robust expression in L-cells, along with high local levels of fMLF in the gastrointestinal tract

(Fig. S1C-S1D). This suggests that the major physiologic effects of fMLF are on gastrointestinal

L-cells. It is also well-known that GLP-1 has robust effects to improve glucose homeostasis in an insulin-independent manner (49). Thus, GLP-1 causes decreased α-cell glucagon secretion, delayed gastric emptying and neuronal signaling from the gut to the brain that may contribute to modulation of metabolic homeostasis (50). With this paradigm, the effects of GLP-1 from either

-cells or L-cells to stimulate insulin secretion would represent only one arm of GLP-1 regulation of glucose homeostasis.

18 Page 19 of 230 Diabetes

Our studies show that feeding mice HFD had a strong effect to cause microbiome

changes, commonly termed dysbiosis. In addition to the diet-induced dysbiosis, we found that

Fpr1 KO also led to alterations in the composition of the microbiota. Interestingly, predicted

levels of methionyl-tRNA formyltransferase (MTFMT), the enzyme that produces

formylmethionine, were increased in WT HFD versus NCD, consistent with increased fMLF

production (51). Furthermore, in Fpr1-KO versus WT on HFD, predicted levels of purine

production enzymes were elevated, potentially decreasing substrate availability for MTFMT and

contributing to the reduced fMLF levels observed in Fpr1-KO animals (52). Interestingly, in the

current study, while Fpr1-KO mice demonstrated an altered microbiome, when we did fecal

transplant studies from Fpr1-KO mice into germ free WT animals, we found that the microbiome

transplant did not confer any changes in metabolic status. These data suggest that the

microbiome alterations we observed in the Fpr1-KOs are secondary to their improved metabolic

status.

Another important finding from this study is that HFD mice display elevated fMLF levels

and this is associated with glucose intolerance and reduced GLP-1 secretion. This increased

fMLF level is likely derived from the microbiome, as antibiotic treatment of mice abolished

blood levels of fMLF and germfree animals also displayed barely detectable intestinal and blood

fMLF levels (Fig. 1G-H, Fig. S1A-B). Although these data suggest that most of the fMLF

present in HFD appears to be microbiome-derived, there may be a small contribution from host

mitochondria which remains to be determined. Since treatment of WT and Fpr1-KO mice with

the GLP1 antagonist (9-39) blocked the effects of FPR1 KO to improve glucose tolerance, this

suggests that the major aspects of the metabolic phenotype in the KO animals can be traced back

to GLP-1/GLP1R interactions. Furthermore, treating mice with exogenous fMLF by oral gavage

19 Diabetes Page 20 of 230

led to worsening of glucose tolerance, whereas, treatment of these mice with the Fpr1 antagonist, cFLFLF, markedly improved glucose tolerance with enhanced insulin secretion. GPCRs have been established as important regulators of L-cell GLP-1 secretion through elevation of intracellular cyclic AMP levels leading to a rise in intracellular Ca2+ with membrane depolarization (53). Since Fpr1 is a Gαi coupled GPCR, our data are consistent with the proposal that fMLF signaling through Fpr1 can lower intracellular cAMP levels by activating Gαi (Fig.

S1F). These lowered levels of cAMP would impair membrane depolarization and reduce GLP-1 secretion. This raises the possibility that Fpr1 antagonists could eventually be used in the context of anti-diabetic therapy.

In summary, our findings illustrate a mechanism whereby the gut microbiota influences metabolism in obesity (Fig. S11). We demonstrate that fMLF levels are significantly increased in

HFD mice and that Fpr1-KO improves glucose tolerance and promotes GLP-1 and insulin secretion. GLP-1 antagonism reverses the beneficial metabolic effects of Fpr1-KO, indicating a primary role of incretins in the phenotype. We also found that treatment of HFD mice with fMLF can exacerbate glucose intolerance, while antagonizing fMLF with cFLFLF significantly improves glucose tolerance. Finally, microbiome changes occur with HFD and Fpr1-KO that highlight a dynamic host-microbiome relationship. The anti-diabetic effects of fMLF antagonism should be further explored in order to maximize the incretin effect in patients that have uncontrolled hyperglycemia.

20 Page 21 of 230 Diabetes

ACKNOWLEDGEMENTS

We would like to thank Dr. Ji Wang and Dr. Phillip Murphy at the National Institutes of Health

(NIH) for providing Fpr1-KO mice, Dr. Daniel Drucker at the University of Toronto for

providing Glp1r-KO mice, Dr. Patricia McDonald at Scripps Research Institute of Florida for

providing the mGLUTag cell line, and Dr. Lars Eckmann and Dr. Yukiko Miyamoto at the UC

San Diego Gnotobiotic Mouse Facility for providing germfree mice and fecal transplantation.

We also thank Angela Tyler for administrative support. This study was funded in part by grants

from the NIH (F32 DK105686, T32 DK007494, DK033651, DK063491, DK074868, and

DK101395), Merck and Johnson & Johnson (UCSD 2016-1729). Imaging was conducted at the

UCSD Neuroscience Microscopy Facility (NIH P30 NS047101). Synthesis of cFLFLF was

supported by a private donation to D.P. (147807-101-DR02793-41200).

Author Contributions

J.W., M.R., Y.J.X., A.F.M.J., J.O., W.Y., D.E., Y.S.L and J.D.W. performed in vivo and in vitro

studies, and analyzed data together with M.J. and J.M.O. L.S.C., A.W.H., C.N.R and N.A.M.

conducted and analyzed 16S rRNA sequencing. M.D.C. and D.P. synthesized and purified

cFLFLF. J.W. and J.M.O. designed the studies and wrote the manuscript with input from all

other authors. J.W. and J.M.O. are the guarantors of this work and, as such, had full access to all

the data in the study and takes responsibility for the integrity of the data and the accuracy of the

data analysis.

Duality of Interest

The authors declare no competing interests.

21 Diabetes Page 22 of 230

REFERENCES

1. Esser N, Legrand-Poels S, Piette J, Scheen AJ, Paquot N: Inflammation as a link between obesity, metabolic syndrome and type 2 diabetes. Diabetes research and clinical practice 2014;105:141-150 2. Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI: Obesity alters gut microbial ecology. Proceedings of the National Academy of Sciences of the United States of America 2005;102:11070-11075 3. Turnbaugh PJ, Hamady M, Yatsunenko T, Cantarel BL, Duncan A, Ley RE, Sogin ML, Jones WJ, Roe BA, Affourtit JP, Egholm M, Henrissat B, Heath AC, Knight R, Gordon JI: A core gut microbiome in obese and lean twins. Nature 2009;457:480-484 4. Johnson AM, Olefsky JM: The origins and drivers of insulin resistance. Cell 2013;152:673- 684 5. Shamseddeen H, Getty JZ, Hamdallah IN, Ali MR: Epidemiology and economic impact of obesity and type 2 diabetes. The Surgical clinics of North America 2011;91:1163-1172, vii 6. Guo X, Li J, Tang R, Zhang G, Zeng H, Wood RJ, Liu Z: High Fat Diet Alters Gut Microbiota and the Expression of Paneth Cell-Antimicrobial Peptides Preceding Changes of Circulating Inflammatory Cytokines. Mediators of inflammation 2017;2017:9474896 7. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI: An obesity- associated gut microbiome with increased capacity for energy harvest. Nature 2006;444:1027- 1031 8. Castaner O, Goday A, Park YM, Lee SH, Magkos F, Shiow STE, Schroder H: The Gut Microbiome Profile in Obesity: A Systematic Review. International journal of endocrinology 2018;2018:4095789 9. Ridaura VK, Faith JJ, Rey FE, Cheng J, Duncan AE, Kau AL, Griffin NW, Lombard V, Henrissat B, Bain JR, Muehlbauer MJ, Ilkayeva O, Semenkovich CF, Funai K, Hayashi DK, Lyle BJ, Martini MC, Ursell LK, Clemente JC, Van Treuren W, Walters WA, Knight R, Newgard CB, Heath AC, Gordon JI: Gut microbiota from twins discordant for obesity modulate metabolism in mice. Science 2013;341:1241214 10. Lu VB, Gribble FM, Reimann F: Free Fatty Acid Receptors in Enteroendocrine Cells. Endocrinology 2018;159:2826-2835 11. Drucker DJ, Nauck MA: The incretin system: glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors in type 2 diabetes. Lancet 2006;368:1696-1705 12. Miyawaki K, Yamada Y, Yano H, Niwa H, Ban N, Ihara Y, Kubota A, Fujimoto S, Kajikawa M, Kuroe A, Tsuda K, Hashimoto H, Yamashita T, Jomori T, Tashiro F, Miyazaki J, Seino Y: Glucose intolerance caused by a defect in the entero-insular axis: a study in gastric inhibitory polypeptide receptor knockout mice. Proceedings of the National Academy of Sciences of the United States of America 1999;96:14843-14847 13. Toft-Nielsen MB, Damholt MB, Madsbad S, Hilsted LM, Hughes TE, Michelsen BK, Holst JJ: Determinants of the impaired secretion of glucagon-like peptide-1 in type 2 diabetic patients. J Clin Endocrinol Metab 2001;86:3717-3723 14. Larsen MP, Torekov SS: Glucagon-Like Peptide 1: A Predictor of Type 2 Diabetes? Journal of diabetes research 2017;2017:7583506 15. Roberts EC, Hobson CH, Anderson RP, Chadwick VS: Radio-immunoassay for formyl methionyl leucyl phenylalanine. II. Demonstration of an enterohepatic circulation of

22 Page 23 of 230 Diabetes

immunoreactive bacterial chemotactic peptides in man. Journal of gastroenterology and hepatology 1990;5:38-43 16. Prevete N, Liotti F, Marone G, Melillo RM, de Paulis A: Formyl peptide receptors at the interface of inflammation, angiogenesis and tumor growth. Pharmacol Res 2015;102:184-191 17. Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K, Itagaki K, Hauser CJ: Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature 2010;464:104-107 18. Prossnitz ER, Ye RD: The N-formyl peptide receptor: a model for the study of chemoattractant receptor structure and function. Pharmacol Ther 1997;74:73-102 19. Huang J, Chen K, Chen J, Gong W, Dunlop NM, Howard OM, Gao Y, Bian XW, Wang JM: The G-protein-coupled formylpeptide receptor FPR confers a more invasive phenotype on human glioblastoma cells. Br J Cancer 2010;102:1052-1060 20. Wagener BM, Marjon NA, Prossnitz ER: Regulation of N-Formyl Peptide Receptor Signaling and Trafficking by Arrestin-Src Kinase Interaction. PloS one 2016;11:e0147442 21. Babbin BA, Jesaitis AJ, Ivanov AI, Kelly D, Laukoetter M, Nava P, Parkos CA, Nusrat A: Formyl peptide receptor-1 activation enhances intestinal epithelial cell restitution through phosphatidylinositol 3-kinase-dependent activation of Rac1 and Cdc42. J Immunol 2007;179:8112-8121 22. Leoni G, Alam A, Neumann PA, Lambeth JD, Cheng G, McCoy J, Hilgarth RS, Kundu K, Murthy N, Kusters D, Reutelingsperger C, Perretti M, Parkos CA, Neish AS, Nusrat A: Annexin A1, formyl peptide receptor, and NOX1 orchestrate epithelial repair. J Clin Invest 2013;123:443- 454 23. Molloy MJ, Grainger JR, Bouladoux N, Hand TW, Koo LY, Naik S, Quinones M, Dzutsev AK, Gao JL, Trinchieri G, Murphy PM, Belkaid Y: Intraluminal containment of commensal outgrowth in the gut during infection-induced dysbiosis. Cell host & microbe 2013;14:318-328 24. Gao JL, Lee EJ, Murphy PM: Impaired antibacterial host defense in mice lacking the N- formylpeptide receptor. The Journal of experimental medicine 1999;189:657-662 25. Scrocchi LA, Brown TJ, MaClusky N, Brubaker PL, Auerbach AB, Joyner AL, Drucker DJ: Glucose intolerance but normal satiety in mice with a null mutation in the glucagon-like peptide 1 receptor gene. Nature medicine 1996;2:1254-1258 26. Chen P, Miyamoto Y, Mazagova M, Lee KC, Eckmann L, Schnabl B: Microbiota Protects Mice Against Acute Alcohol-Induced Liver Injury. Alcoholism, clinical and experimental research 2015;39:2313-2323 27. Drucker DJ, Jin T, Asa SL, Young TA, Brubaker PL: Activation of proglucagon gene transcription by protein kinase-A in a novel mouse enteroendocrine cell line. Mol Endocrinol 1994;8:1646-1655 28. Riopel M, Seo JB, Bandyopadhyay GK, Li P, Wollam J, Chung H, Jung SR, Murphy A, Wilson M, de Jong R, Patel S, Balakrishna D, Bilakovics J, Fanjul A, Plonowski A, Koh DS, Larson CJ, Olefsky JM, Lee YS: Chronic fractalkine administration improves glucose tolerance and pancreatic endocrine function. J Clin Invest 2018; 29. Lee YS, Morinaga H, Kim JJ, Lagakos W, Taylor S, Keshwani M, Perkins G, Dong H, Kayali AG, Sweet IR, Olefsky J: The fractalkine/CX3CR1 system regulates beta cell function and insulin secretion. Cell 2013;153:413-425 30. Cinti S, Mitchell G, Barbatelli G, Murano I, Ceresi E, Faloia E, Wang S, Fortier M, Greenberg AS, Obin MS: Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. Journal of lipid research 2005;46:2347-2355

23 Diabetes Page 24 of 230

31. Goodyear AW, Kumar A, Dow S, Ryan EP: Optimization of murine small intestine leukocyte isolation for global immune phenotype analysis. Journal of immunological methods 2014;405:97-108 32. Johnson AM, Costanzo A, Gareau MG, Armando AM, Quehenberger O, Jameson JM, Olefsky JM: High fat diet causes depletion of intestinal eosinophils associated with intestinal permeability. PloS one 2015;10:e0122195 33. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, Owens SM, Betley J, Fraser L, Bauer M, Gormley N, Gilbert JA, Smith G, Knight R: Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal 2012;6:1621-1624 34. Edgar RC: UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature methods 2013;10:996-998 35. McDonald D, Price MN, Goodrich J, Nawrocki EP, DeSantis TZ, Probst A, Andersen GL, Knight R, Hugenholtz P: An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME journal 2012;6:610-618 36. Shannon CE: A Mathematical Theory of Communication. Bell System Technical Journal 1948;27:623-656 37. Bray JR, Curtis JT: An Ordination of the Upland Forest Communities of Southern Wisconsin. Ecological Monographs 1957;27:326-349 38. Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K: KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic acids research 2017;45:D353-D361 39. Zhang Y, Kundu B, Zhong M, Huang T, Li J, Chordia MD, Chen MH, Pan D, He J, Shi W: PET imaging detection of macrophages with a formyl peptide receptor antagonist. Nuclear medicine and biology 2015;42:381-386 40. Anderson MJ: A new method for non-parametric multivariate analysis of variance. Austral Ecology 2001;26:32-46 41. Love MI, Huber W, Anders S: Moderated estimation of fold change and dispersion for RNA- seq data with DESeq2. Genome biology 2014;15:550 42. McMurdie PJ, Holmes S: phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PloS one 2013;8:e61217 43. Ye RD, Boulay F, Wang JM, Dahlgren C, Gerard C, Parmentier M, Serhan CN, Murphy PM: International Union of Basic and Clinical Pharmacology. LXXIII. Nomenclature for the formyl peptide receptor (FPR) family. Pharmacological reviews 2009;61:119-161 44. Wentworth CC, Jones RM, Kwon YM, Nusrat A, Neish AS: Commensal-epithelial signaling mediated via formyl peptide receptors. The American journal of pathology 2010;177:2782-2790 45. Edwards CM, Todd JF, Mahmoudi M, Wang Z, Wang RM, Ghatei MA, Bloom SR: Glucagon-like peptide 1 has a physiological role in the control of postprandial glucose in humans: studies with the antagonist exendin 9-39. Diabetes 1999;48:86-93 46. Goodrich JK, Waters JL, Poole AC, Sutter JL, Koren O, Blekhman R, Beaumont M, Van Treuren W, Knight R, Bell JT, Spector TD, Clark AG, Ley RE: Human genetics shape the gut microbiome. Cell 2014;159:789-799 47. Iwai S, Weinmaier T, Schmidt BL, Albertson DG, Poloso NJ, Dabbagh K, DeSantis TZ: Piphillin: Improved Prediction of Metagenomic Content by Direct Inference from Human Microbiomes. PloS one 2016;11:e0166104 48. Fava GE, Dong EW, Wu H: Intra-islet glucagon-like peptide 1. Journal of diabetes and its complications 2016;30:1651-1658

24 Page 25 of 230 Diabetes

49. Chambers AP, Sorrell JE, Haller A, Roelofs K, Hutch CR, Kim KS, Gutierrez-Aguilar R, Li B, Drucker DJ, D'Alessio DA, Seeley RJ, Sandoval DA: The Role of Pancreatic Preproglucagon in Glucose Homeostasis in Mice. Cell metabolism 2017;25:927-934 e923 50. Shah M, Vella A: Effects of GLP-1 on appetite and weight. Rev Endocr Metab Disord 2014;15:181-187 51. Meinnel T, Mechulam Y, Blanquet S: Methionine as translation start signal: a review of the enzymes of the pathway in Escherichia coli. Biochimie 1993;75:1061-1075 52. Nagy PL, Marolewski A, Benkovic SJ, Zalkin H: Formyltetrahydrofolate hydrolase, a regulatory enzyme that functions to balance pools of tetrahydrofolate and one-carbon tetrahydrofolate adducts in Escherichia coli. Journal of bacteriology 1995;177:1292-1298 53. Simpson AK, Ward PS, Wong KY, Collord GJ, Habib AM, Reimann F, Gribble FM: Cyclic AMP triggers glucagon-like peptide-1 secretion from the GLUTag enteroendocrine cell line. Diabetologia 2007;50:2181-2189

25 Diabetes Page 26 of 230

FIGURE LEGENDS

Figure 1. fMLF is increased in HFD/obese mice and requires Fpr1 for chemotaxis.

(A) Blood plasma fMLF levels in lean/NCD versus obese/HFD mice after 16 weeks on HFD (n

= 8-12 per group). (B) Timecourse of fMLF levels after placement on HFD (n = 6-8 mice per timepoint). (C) fMLF levels in various intestinal tissues in WT NCD and HFD animals after 8 weeks on diet (n = 8 mice per group). Ileum (D) and colon (E) fMLF levels after 8 and 20 weeks of HFD or NCD (n = 6-8 mice per group). (F) Bacterial DNA levels in colon fecal samples, determined by 16S rRNA gene expression and presented as a measure of bacterial load (n = 8 mice per group).(G) Blood plasma fMLF levels in NCD and HFD mice (after 8 weeks on diet) treated ± antibiotics (n = 6-8 mice per group). (H) Ileum fMLF levels in HFD antibiotic-treated animals, after 8 weeks on diet (n = 4 mice per group). (I) Relative Fpr1 transcript levels in various intestinal tissues of NCD and HFD WT animals after 8 weeks on diet (n = 8 mice per group). (J) Chemotaxis assays of thioglycollate-ellicited intraperitoneal macrophages (IP-Macs) in response to fMLF treatment (250 nM), and after siRNA knockdown of Fpr1 or Fpr2 (n = 3).

(K) Chemotaxis assays in response to MCP-1 treatment (100 ng ml-1) demonstrate that knockdown of Fpr1 does not inhibit macrophage activation by other chemokines. (L) mRNA transcript levels of Fpr1 and Fpr2 in IP-Macs after siRNA knockdown. # = below detection limit.

Data = mean ± SEM. *P<0.05, **P<0.001, ***P<0.0001 by One-way ANOVA with

Bonferroni’s post-test (D-G) or two-tailed t test comparing the indicated groups. In (D-F), statistical significance is indicated comparing groups at each respective time point.

Figure 2. Loss of Fpr1 in HFD/obese mice improves glucose tolerance and is GLP-1- dependent. (A and B) Oral gavage-glucose tolerance test (OG-GTT) after 10 weeks on HFD, and area under the curve (AUC) (n = 7-10 mice per group). (C) Plasma insulin levels during OG-

26 Page 27 of 230 Diabetes

GTT. (D and E) Intraperitoneal-insulin tolerance test after 12 weeks on HFD, and AUC (n = 7-

10 mice per group). (F and G) Glucose-stimulated insulin secretion and intracellular insulin

levels in pancreatic islets from HFD WT and Fpr1-KO mice (n = 4 mice per group, 20 islets per

incubation). (H) Active GLP-1 levels during the OG-GTT in (A) (n = 24-25 mice per group). (I

and J) OG-GTT and corresponding AUC of WT and Fpr1-KO HFD mice after 10 weeks on

HFD and treatment ± the Glp1r antagonist Exendin 9-39 (n = 10 – 11 mice per group). (K)

Plasma insulin levels during the OG-GTT in (I). (n = 10 – 11 mice per group). Error bars =

s.e.m. ns = not significant. *P<0.05, **P<0.001, ***P<0.0001 by Two-way ANOVA and

Bonferroni’s post-test (A and I), One-way ANOVA and Bonferroni’s post-test (J) or two-tailed t

test. Statistical significance is indicated comparing groups at each respective time point. In (I

and K), significance is indicated for WT versus Fpr1-KO animals treated with vehicle.

Figure 3. GLP-1 secretion is dependent on Fpr-1 expression. (A) Immunofluorescence

labeling of GLP-1 in L-cells of WT and Fpr1-KO HFD colon sections (representative images,

scale bars = 50 µm, 16 weeks on HFD). (B) Quantification of (A), including NCD controls (n =

14 – 20 per group). (C) Proglucagon mRNA levels in the ileum of WT and Fpr1-KO mice,

relative to WT NCD (n = 8, 16 weeks on HFD). (D) RNA-fluorescence in situ hybridization of

proglucagon and fpr1 in colonic L-cells (representative images, scale bars = 10 µm) (n = 6 per

group). (E-F) Glucose-stimulated GLP-1 secretion in mGLUTag cells treated with scrambled

control siRNA (E) or fpr1 siRNA (F) and different concentrations of fMLF (n = 5). Error bars =

s.e.m. ns = not significant. *P<0.05, **P<0.001, ***P<0.0001 by One-way ANOVA and

Bonferroni’s post-test, comparing the indicated groups.

Figure 4. Pharmacological control of Fpr1 activity modulates GLP-1 levels and glucose

tolerance. (A) OG-GTT of WT HFD mice after acute oral gavage with the Fpr1 agonist fMLF (1

27 Diabetes Page 28 of 230

mg/kg) (n = 6 mice per group, 10 weeks on HFD). (B-D) AUC, insulin levels, and active GLP-1 levels measured during the OG-GTT. Legend of (A) also applies to (C-D). (E) OG-GTT of WT and Glp1r-KO mice after 10 weeks HFD and daily oral gavage of the Fpr1 antagonist cFLFLF for 2 weeks (0.5 g/kg) (n = 8 mice per group,). (F-H) AUC, insulin levels, and active GLP-1 levels measured during the OG-GTT. Legend of (E) applies to (G and H). Data = Mean ± SEM. ns = not significant. *P<0.05, **P<0.001 by Two-way ANOVA and Bonferroni’s post-test (A and E), One-way ANOVA and Bonferroni’s post-test (F) or two-tailed t test. Statistical significance is indicated comparing groups at each respective time point. In (E, G and H) significance is indicated for WT animals treated with vehicle versus WT animals treated with antagonist.

Figure 5. Loss of Fpr1 alters intestinal microbiome composition in obese/HFD mice. (A) fMLF levels in blood plasma and (B) ileum of Fpr1-KO versus WT mice after 20 weeks HFD (n

= 6-11 mice per group). (C) Shannon diversity index in fecal 16S rRNA gene sequencing data from WT and Fpr1-KO mice on NCD and HFD (n = 6-10 mice per group). Legend also applies to (D). (D) Analysis of dissimilarity between samples, or beta diversity. The pair-wise Bray-

Curtis dissimilarity between samples is represented by a 2-dimensional Principal Coordinate

Analysis ordination plot. Samples separate into 3 clusters based on diet (Axis 1) and genotype

(Axis 2). The percentage of sample variation due to each axis is indicated. (E) Log 2-fold change of Operational Taxonomic Unit (OTU) abundances in Fpr1-KO versus WT on HFD, showing the

50 most significantly changed taxa, color coded by Phylum. (F) Log 2-fold change of bacterial enzymes predicted altered by inferred metagenomics content analysis, according to Kyoto

Encyclopedia of Genes and Genomes (KEGG) orthology (n = 6-10 mice per group). MTFMT = methionyl-tRNA formyltransferase; PDF = peptide deformylase; purU = formyltetrahydrofolate

28 Page 29 of 230 Diabetes

deformylase; purT = phosphoribosylglycinamide formyltransferase; AICAR-FMT =

phosphoribosylaminoimidazolecarboxamide-formyltransferase. (G) OG-GTT of WT and Fpr1-

KO mice after 10 weeks HFD, comparing mice housed separately based on genotype or co-

housed. Data = mean ± SEM. ns = not significant. *P<0.05, **P<0.001, ***P<0.0001 by One-

way ANOVA with Bonferroni’s post-test (A-B), Two-way ANOVA and Bonferroni’s post-test

(G) or PERMANOVA and DESeq 2 (C-F). In (G), significance is indicated for WT co-housed

versus Fpr1-KO co-housed animals at each respective time point.

Figure 6. Fecal microbiota transfer from WT and Fpr1-KO HFD donor mice to germfree

recipient mice leads to glucose intolerance. (A) OG-GTT of germfree mice fed NCD or placed

on HFD and gavaged with fecal preparations from WT or Fpr1-KO mice fed HFD (n = 3-4 mice

per group, 8 weeks on HFD). (B) Basal insulin levels taken immediately prior to OG-GTTs. (C)

Active GLP-1 levels. (D) Body weight at time of OG-GTTs. (E) Weight of epidydimal white

adipose tissue. (F) Weight of liver. *P<0.05, **P<0.001, ***P<0.0001 by Two-way ANOVA

and Bonferroni’s post-test (A) or One-way ANOVA and Bonferroni’s post-test, comparing the

indicated groups. In (A), significance is indicated for Germfree versus HFT + WT FMT animals

at each respective time point.

29 Diabetes Page 30 of 230

Figure 1. fMLF is increased in HFD/obese mice and requires Fpr1 for chemotaxis. (A) Blood plasma fMLF levels in lean/NCD versus obese/HFD mice after 16 weeks on HFD (n = 8-12 per group). (B) Timecourse of fMLF levels after placement on HFD (n = 6-8 mice per timepoint). (C) fMLF levels in various intestinal tissues in WT NCD and HFD animals after 8 weeks on diet (n = 8 mice per group). Ileum (D) and colon (E) fMLF levels after 8 and 20 weeks of HFD or NCD (n = 6-8 mice per group). (F) Bacterial DNA levels in colon fecal samples, determined by 16S rRNA gene expression and presented as a measure of bacterial load (n = 8 mice per group).(G) Blood plasma fMLF levels in NCD and HFD mice (after 8 weeks on diet) treated ± antibiotics (n = 6-8 mice per group). (H) Ileum fMLF levels in HFD antibiotic-treated animals, after 8 weeks on diet (n = 4 mice per group). (I) Relative Fpr1 transcript levels in various intestinal tissues of NCD and HFD WT animals after 8 weeks on diet (n = 8 mice per group). (J) Chemotaxis assays of thioglycollate-ellicited intraperitoneal macrophages (IP-Macs) in response to fMLF treatment (250 nM), and after siRNA knockdown of Fpr1 or Fpr2 (n = 3). (K) Chemotaxis assays in response to MCP-1 treatment (100 ng ml-1) demonstrate that knockdown of Fpr1 does not inhibit macrophage activation by other chemokines. (L) mRNA transcript levels of Fpr1 and Fpr2 in IP-Macs after siRNA knockdown. # = below detection limit. Data = mean ± SEM. *P<0.05, **P<0.001, ***P<0.0001 by One-way ANOVA with Bonferroni’s post-test (D-G) or two-tailed t test comparing the indicated groups. In (D-F), statistical significance is indicated comparing groups at each respective time point.

120x163mm (72 x 72 DPI) Page 31 of 230 Diabetes

Figure 2. Loss of Fpr1 in HFD/obese mice improves glucose tolerance and is GLP-1-dependent. (A and B) Oral gavage-glucose tolerance test (OG-GTT) after 10 weeks on HFD, and area under the curve (AUC) (n = 7-10 mice per group). (C) Plasma insulin levels during OG-GTT. (D and E) Intraperitoneal-insulin tolerance test after 12 weeks on HFD, and AUC (n = 7-10 mice per group). (F and G) Glucose-stimulated insulin secretion and intracellular insulin levels in pancreatic islets from HFD WT and Fpr1-KO mice (n = 4 mice per group, 20 islets per incubation). (H) Active GLP-1 levels during the OG-GTT in (A) (n = 24-25 mice per group). (I and J) OG-GTT and corresponding AUC of WT and Fpr1-KO HFD mice after 10 weeks on HFD and treatment ± the Glp1r antagonist Exendin 9-39 (n = 10 – 11 mice per group). (K) Plasma insulin levels during the OG-GTT in (I). (n = 10 – 11 mice per group). Error bars = s.e.m. ns = not significant. *P<0.05, **P<0.001, ***P<0.0001 by Two-way ANOVA and Bonferroni’s post-test (A and I), One-way ANOVA and Bonferroni’s post-test (J) or two-tailed t test. Statistical significance is indicated comparing groups at each respective time point. In (I and K), significance is indicated for WT versus Fpr1-KO animals treated with vehicle. Diabetes Page 32 of 230

120x148mm (600 x 600 DPI) Page 33 of 230 Diabetes

Figure 3. GLP-1 secretion is dependent on Fpr-1 expression. (A) Immunofluorescence labeling of GLP-1 in L- cells of WT and Fpr1-KO HFD colon sections (representative images, scale bars = 50 µm, 16 weeks on HFD). (B) Quantification of (A), including NCD controls (n = 14 – 20 per group). (C) Proglucagon mRNA levels in the ileum of WT and Fpr1-KO mice, relative to WT NCD (n = 8, 16 weeks on HFD). (D) RNA-fluorescence in situ hybridization of proglucagon and fpr1 in colonic L-cells (representative images, scale bars = 10 µm) (n = 6 per group). (E-F) Glucose-stimulated GLP-1 secretion in mGLUTag cells treated with scrambled control siRNA (E) or fpr1 siRNA (F) and different concentrations of fMLF (n = 5). Error bars = s.e.m. ns = not significant. *P<0.05, **P<0.001, ***P<0.0001 by One-way ANOVA and Bonferroni’s post-test, comparing the indicated groups.

120x111mm (600 x 600 DPI) Diabetes Page 34 of 230

Figure 4. Pharmacological control of Fpr1 activity modulates GLP-1 levels and glucose tolerance. (A) OG-GTT of WT HFD mice after acute oral gavage with the Fpr1 agonist fMLF (1 mg/kg) (n = 6 mice per group, 10 weeks on HFD). (B-D) AUC, insulin levels, and active GLP-1 levels measured during the OG-GTT. Legend of (A) also applies to (C-D). (E) OG-GTT of WT and Glp1r-KO mice after 10 weeks HFD and daily oral gavage of the Fpr1 antagonist cFLFLF for 2 weeks (0.5 g/kg) (n = 8 mice per group,). (F-H) AUC, insulin levels, and active GLP-1 levels measured during the OG-GTT. Legend of (E) applies to (G and H). Data = Mean ± SEM. ns = not significant. *P<0.05, **P<0.001 by Two-way ANOVA and Bonferroni’s post-test (A and E), One- way ANOVA and Bonferroni’s post-test (F) or two-tailed t test. Statistical significance is indicated comparing groups at each respective time point. In (E, G and H) significance is indicated for WT animals treated with vehicle versus WT animals treated with antagonist.

120x79mm (600 x 600 DPI) Page 35 of 230 Diabetes

Figure 5. Loss of Fpr1 alters intestinal microbiome composition in obese/HFD mice. (A) fMLF levels in blood plasma and (B) ileum of Fpr1-KO versus WT mice after 20 weeks HFD (n = 6-11 mice per group). (C) Shannon diversity index in fecal 16S rRNA gene sequencing data from WT and Fpr1-KO mice on NCD and HFD (n = 6-10 mice per group). Legend also applies to (D). (D) Analysis of dissimilarity between samples, or beta diversity. The pair-wise Bray-Curtis dissimilarity between samples is represented by a 2-dimensional Principal Coordinate Analysis ordination plot. Samples separate into 3 clusters based on diet (Axis 1) and genotype (Axis 2). The percentage of sample variation due to each axis is indicated. (E) Log 2-fold change of Operational Taxonomic Unit (OTU) abundances in Fpr1-KO versus WT on HFD, showing the 50 most significantly changed taxa, color coded by Phylum. (F) Log 2-fold change of bacterial enzymes predicted altered by inferred metagenomics content analysis, according to Kyoto Encyclopedia of Genes and Genomes (KEGG) orthology (n = 6-10 mice per group). MTFMT = methionyl-tRNA formyltransferase; PDF = peptide deformylase; purU = formyltetrahydrofolate deformylase; purT = phosphoribosylglycinamide formyltransferase; AICAR-FMT = phosphoribosylaminoimidazolecarboxamide-formyltransferase. (G) OG-GTT of WT and Fpr1-KO mice after 10 weeks HFD, comparing mice housed separately based on genotype or co- housed. Data = mean ± SEM. ns = not significant. *P<0.05, **P<0.001, ***P<0.0001 by One-way ANOVA with Bonferroni’s post-test (A-B), Two-way ANOVA and Bonferroni’s post-test (G) or PERMANOVA and DESeq 2 (C-F). In (G), significance is indicated for WT co-housed versus Fpr1-KO co-housed animals at each respective time point.

120x119mm (600 x 600 DPI) Diabetes Page 36 of 230

Figure 6. Fecal microbiota transfer from WT and Fpr1-KO HFD donor mice to germfree recipient mice leads to glucose intolerance. (A) OG-GTT of germfree mice fed NCD or placed on HFD and gavaged with fecal preparations from WT or Fpr1-KO mice fed HFD (n = 3-4 mice per group, 8 weeks on HFD). (B) Basal insulin levels taken immediately prior to OG-GTTs. (C) Active GLP-1 levels. (D) Body weight at time of OG-GTTs. (E) Weight of epidydimal white adipose tissue. (F) Weight of liver. *P<0.05, **P<0.001, ***P<0.0001 by Two-way ANOVA and Bonferroni’s post-test (A) or One-way ANOVA and Bonferroni’s post-test, comparing the indicated groups. In (A), significance is indicated for Germfree versus HFT + WT FMT animals at each respective time point.

103x88mm (600 x 600 DPI) Page 37 of 230 Diabetes

SUPPLEMENTAL FIGURE LEGENDS

Supplemental Figure 1. Fpr1 is expressed in the gastrointestinal tract and influences

cAMP. (A) Levels of fMLF levels in the plasma of germfree animals on NCD (n = 3), compared

to conventional NCD animals (n = 3). (B) Levels of fMLF levels in the colon of germfree

animals on NCD (n = 4), compared to conventional NCD animals (n = 8). (C) Relative Fpr1

gene expression in various tissues of lean 16-week old WT NCD mice (eWAT = epididymal

white adipose tissue; SVF = stromal vascular fraction; BAT = brown adipose tissue). (D)

Relative Fpr1 gene expression in the small intestinal lamina propria, colon, and pancreatic islets

isolated from WT animals fed either NCD or HFD (n = 3). (E) Chemotaxis of thioglycolate-

elicited intraperitoneal macrophages (IP-Macs) in response to fMLF (250 nM) is suppressed by

co-incubation with Pertussis Toxin (PT), an inhibitor of Gi-coupled signaling. (F) Relative

cAMP levels in forskolin-stimulated IP-Macs are reduced by treatment with fMLF. (G) Relative

transcript levels of four related Fpr genes in the colon of WT and Fpr1-KO mice on NCD and

HFD (n = 6 mice per group). (H) Relative transcript levels of related Fpr genes in the ileum of

WT and Fpr1-KO mice on NCD and HFD. Data = mean ± SEM. ns = not significant. # = below

detection limit. *P<0.05, **P<0.001, ***P<0.0001 by two-tailed t test (D) or One-way ANOVA

and Bonferroni’s post-test (E-H), comparing the indicated groups.

Supplemental Figure 2. Obese/HFD Fpr1-KO mice do not display significant differences in

weight gain or organ weight (A) Body weight gain of WT and Fpr1-KO littermates on 60%

HFD (n = 7-10 mice per group). (B) Food intake. (C-F) Weight of epididymal white adipose

tissue, liver, pancreas, and spleen of mice after 13 weeks on HFD. (G) Intestine length (H-I)

weight of the colon and cecum after contents were removed. (J) Area of insulin-positive islets as

a percentage of the pancreas, an estimation of beta cell mass, in HFD WT and Fpr1-KO

1 Diabetes Page 38 of 230

littermates (n = 6-7 mice per group). (K) Average islet size (n = 6-7 mice per group). Data = mean ± SEM.

Supplemental Figure 3. Loss of Fpr1 does not significantly improve glucose tolerance in lean/NCD animals. (A-B) OG-GTT of WT and Fpr1-KO littermates at 16 weeks of age, and corresponding AUC (n = 6-10 mice per group). (C) Body weight of the mice at the time of the

OG-GTT. (D-E) Insulin levels and basal GLP-1 levels measured during the OG-GTT. (F) IP-ITT at 17 weeks of age. Data = mean ± SEM.

Supplemental Figure 4. Analysis of basal glucagon and gastric hormone levels in obese/HFD animals. (A) Basal fasted blood plasma glucagon levels measured immediately prior to OG-GTT in HFD WT and Fpr1-KO littermates (n = 9 mice per group). (B-H) Active GLP-1,

Total GLP-1, Peptide YY (PYY), Gastric Inhibitory Polypeptide (GIP), Leptin, Ghrelin, and

Resistin levels in the basal fasted state measured immediately prior to OG-GTT (n = 7-10 mice per group). Data = mean ± SEM. ns = not significant. *P<0.05, by two-tailed t test.

Supplemental Figure 5. Oral treatment with broad-spectrum antibiotics improves glucose tolerance and increases GLP-1 levels. (A) OG-GTT of WT HFD animals after daily oral gavage of broad-spectrum antibiotics for two weeks (n = 8 mice per group). (B) Basal active

GLP-1 levels measured immediately prior to OG-GTT. (C) Basal insulin levels prior to OG-

GTT. Error bars = s.e.m. n.d. = not detectable. *P<0.05 by One-way ANOVA with Bonferroni’s post-test.

Supplemental Figure 6. fMLF Acts upon Fpr1 on L-cells to modulate GLP-1 secretion in obese/HFD animals. (A) Quantification of GLP-1 immunofluorescence labeling in the ileum of

WT and Fpr1-KO animals on NCD and HFD (n = 8). (B) Ileum proglucagon transcript levels in

Fpr1-KO HFD animals relative to WT HFD (n = 8). (C) Relative mRNA levels of proglucagon

2 Page 39 of 230 Diabetes

in the colon of WT and Fpr1-KO HFD mice. (D) Relative Fpr1 mRNA expression in

Proglucagon-positive L-cells as detected by RNA-fluorescence in situ hybridization in colon

sections from NCD and HFD animals (n = 4). (E) Immunofluorescence staining of GLP-1 and

FPR in L-cells of WT HFD colon sections (representative images, scale bars = 10 µm). (F)

Western immunoblot of FPR and HSP90 in colon tissue lysates of WT NCD versus HFD

animals, normalized densitometry quantification shown in (G) (n = 3 per group). (H) siRNA

knockdown of fpr1 transcript levels in mGLUTag cells (n = 5). (I) mRNA transcript levels of

fpr1, il-1β and proglucagon in mGLUTag cells treated with or without 400 µM palmitate for 24

hours (n = 3). Data = mean ± SEM., ns = not significant. *P<0.05, **P<0.001, ***P<0.0001 by

One-way ANOVA with Bonferroni’s post-test (A and D) or two-tailed t test.

Supplemental Figure 7. Intestinal leukocyte composition and inflammatory gene expression

in WT and Fpr1-KO mice. (A) Total CD11b+ leukocytes in the small intestinal lamina propria

isolated from WT and Fpr1-KO littermates on NCD and HFD (percentage of CD45+ cells) (n =

6 mice per group). (B) MHCII- SigletF+ eosinophils (C) MHCII+ SigletF- macrophages (D)

CD11b- CD11c+ dendritic cells (E) CD45+ CD3+ T cells (F) CD8+ T cells (G) CD4+ T cells

(H) CD4+ Foxp3+ Treg cells. (I) mRNA transcript levels of pro-inflammatory TNF, ALOX5,

and IL1 in immune cells of the small intestinal lamina propria from WT and Fpr1-KO

littermates (n = 4-6 mice per group). (J) mRNA transcript levels of IL-10 (n = 4-6 mice per

group). (K) Levels of circulating chemokines and cytokines in the blood plasma of WT and

Fpr1-KO mice (n = 8-9 mice per group). Data = mean ± SEM. ns = not significant. *P<0.05,

**P<0.001, ***P<0.0001 by One-way ANOVA and Bonferroni’s post-test.

Supplemental Figure 8. Analysis of inflammation in epidydimal white adipose tissue of WT

and Fpr1-KO mice on HFD. (A) Mac-2 staining of eWAT sections (representative images, n =

3 Diabetes Page 40 of 230

8 mice per group, scale bar = 250 m). (B) FACS analysis of F4/80+ macrophages isolated from eWAT tissue. (C) mRNA transcript levels of pro-inflammatory “M1-type” genes in eWAT. (D) mRNA transcript levels of IL-10. Data = mean ± SEM. *P<0.05, **P<0.001, ***P<0.0001 by two-tailed t test.

Supplemental Figure 9. (A) OG-GTT of WT NCD animals after daily oral gavage with the

Fpr1 agonist fMLF for 2 weeks (1 mg/kg) (n = 8 mice per group). (B) Matrix-assisted laser desorption-time of flight (MALDI-TOF) mass spectra of synthesized Fpr1 antagonist cFLFLF, positive ion mode. (C) Body weight of WT HFD mice during daily oral gavage treatment with the Fpr1 antagonist cFLFLF (0.5 mg/kg) or vehicle for three weeks (n = 8 mice per group). (D)

Food intake during antagonist treatment. (E-H) Weight of epididymal white adipose tissue, liver, pancreas, and spleen upon sacrifice. Data = mean ± SEM. ns = not significant. *P<0.05,

**P<0.001 by two-tailed t test.

Supplemental Figure 10. Analysis of intestinal permeability and microbiome composition in WT and Fpr1-KO littermates. (A) Analysis of fecal albumin levels in WT and Fpr1-KO littermates (n = 12-18 mice per group). (B) Blood plasma FITC-Dextran levels in lean/NCD and obese/HFD mice (n = 4-6 mice per group). (C) A second measure of alpha diversity, OTU richness, confirms that Fpr1-KO mice on HFD have significantly increased microbiome diversity within each sample compared to WT animals on HFD. Legend also applies to (D-H). (n = 6-10 mice per group). (D) Mean relative abundance of members of the Phylum Bacteroidetes within each sample. (E) Mean relative abundance of members of the Phylum Firmicutes within each sample. (F) Mean relative abundance of members of the Family Lactobacillaceae within each sample. (G) Mean relative abundance of members of the Family Lachnospiraceae within each sample. WT animals on HFD display increased abundance of this Family compared to NCD,

4 Page 41 of 230 Diabetes

whereas Fpr1-KO animals on HFD have significantly lower levels, resembling NCD. (H) Mean

relative abundance of members of the Family Rikenellaceae within each sample. WT animals on

HFD have reduced abundances compared to NCD, whereas Fpr1-KO animals on HFD have

significantly elevated levels compared to WT (n = 6-10 mice per group). (I) Log 2-fold change

of bacterial pathways predicted altered by inferred metagenomics content analysis, according to

Kyoto Encyclopedia of Genes and Genomes (KEGG) orthology (n = 6-10 mice per group). (J)

Analysis of Bray-Curtis dissimilarity distances between Fpr1-KO and WT HFD microbiome

samples, from 3 cohorts of HFD microbiome samples, comparing mice housed separately or co-

housed. Data = mean ± SEM. ns = not significant. *P<0.05, **P<0.001, ***P<0.0001 by One-

way ANOVA and Bonferroni’s post-test (A-B) or PERMANOVA and DESeq 2 (D-H, J).

Supplemental Figure 11. Model of microbiota-produced fMLF action upon GLP-1

secretion and glucose tolerance in diet-induced obesity. (A) In lean NCD conditions, a healthy

intestinal microbiota produces low levels of N-formyl peptides including fMLF. After a meal,

glucose in the intestine is taken up by L-cells in the intestinal epithelium, stimulating production

and secretion of extra-pancreatic GLP-1 by these cells into systemic circulation, which promotes

glucose tolerance through both insulin-dependent and independent mechanisms, including

suppression of gastric emptying, reduced glucagon production, CNS effects and neuronal

signaling from the gut to the brain. In this paradigm, the effects of GLP-1 from either -cells or

L-cells to stimulate insulin secretion would represent only one arm of GLP-1 regulation of

glucose homeostasis. (B) In obese HFD conditions, intestinal dysbiosis leads to increased N-

formyl peptide levels, and L-cells express higher levels of FPR1. Increased intestinal

permeability in HFD animals also leads to elevated levels of N-formyl peptides entering

5 Diabetes Page 42 of 230

circulation. In the gut, N-formyl peptides activate FPR1 on L-cells to suppress GLP-1 secretion, leading to reduced glucose tolerance.

SUPPLEMENTAL TABLES AND LEGENDS

Supplementary Table 1. qPCR primer Sequence Information.

Supplementary Table 2. Antibodies Used in Immunoblot, Immunofluorescence and Flow

Cytometry Analyses.

Supplementary Table 3. Significantly different taxa in Fpr1-KO mice versus WT mice in obese/HFD conditions. Listing of OTUs is displayed with taxonomic identification, ranked by p-value and Log 2-Fold Change in Fpr1-KO versus WT (n = 6-10 mice per group). The first 50 most significantly different OTUs are listed in order of log fold change, and graphically displayed in Figure 4e. Remaining OTUs are listed in order of p-value. Significance was determined as a false discovery rate-corrected p-value of less than or equal to 0.05, and an absolute Log 2-Fold Change value greater than or equal to 1.

Supplementary Table 4. Functional bacterial pathways predicted as significantly changed depending upon diet or genotype. Inferred metagenomics analysis prediction of functional bacterial pathways altered in WT HFD versus WT NCD mice or Fpr1-KO HFD versus WT HFD

(comparison), ranked by p-value, with KEGG pathway information (n = 6-10 mice per group).

Significance was determined as a false discovery rate-corrected p-value of less than or equal to

0.05, and an absolute Log 2-Fold Change value greater than or equal to 1.

Supplementary Table 5. Bacterial gene composition predicted as significantly altered depending upon diet or genotype. Inferred metagenomics analysis prediction of gene

6 Page 43 of 230 Diabetes

composition changes in WT HFD versus WT NCD mice or Fpr1-KO HFD versus WT HFD

(comparison), ranked by p-value, with KEGG ortholog information (n = 6-10 mice per group).

Significance was determined as a false discovery rate-corrected p-value of less than or equal to

0.05, and an absolute Log 2-Fold Change value greater than or equal to 1.

7 Diabetes Page 44 of 230

120x144mm (600 x 600 DPI) Page 45 of 230 Diabetes

120x127mm (600 x 600 DPI) Diabetes Page 46 of 230

120x88mm (600 x 600 DPI) Page 47 of 230 Diabetes

105x88mm (600 x 600 DPI) Diabetes Page 48 of 230

107x50mm (600 x 600 DPI) Page 49 of 230 Diabetes

101x149mm (600 x 600 DPI) Diabetes Page 50 of 230

117x184mm (72 x 72 DPI) Page 51 of 230 Diabetes

122x132mm (600 x 600 DPI) Diabetes Page 52 of 230

114x139mm (600 x 600 DPI) Page 53 of 230 Diabetes

107x152mm (600 x 600 DPI) Diabetes Page 54 of 230

120x76mm (600 x 600 DPI) Page 55 of 230 Diabetes

SUPPLEMENTAL TABLE 1. qPCR Sequence Information. Name Sequence/Ordering Information GAPDH For TCACCACCATGGAGAAGGC

GAPDH Rev GCTAAGCAGTTGGTGGTGCA

Fpr1 For CCATTTGGTTGGTTCATGTGC

Fpr1 Rev CTTCTTGGCTAGGCTCACAGT

Fpr2 For CACCATTGAGAGGATCCACAG

Fpr2 Rev CACAGGAACCGAAGAGTGTAAG

Proglucagon For ACACCTGTTCGCAGCTCAGGC

Proglucagon Rev AAATCTTGGGCACGGCGGGAG

IL-1 For AAATACCTGTGGCCTTGGGC

IL-1 Rev CTTGGGATCCACACTCTCCAG

TNF For GCCACCACGCTCTTCTGCCT

TNF Rev GGCTGATGGTGTGGGTGAGG

IL-10 For CATGGCCCAGAAATCAAGGA

IL-10 Rev GGAGAAATCGATGACAGCGC

Alox5 For ACTACATCTACCTCAGCCTCATT

Alox5 Rev GGTGACATCGTAGGAGTCCAC

Fpr3 For IDT PrimeTime qPCR Assay Mm.PT.58.16696236.g

Fpr3 Rev IDT PrimeTime qPCR Assay Mm.PT.58.16696236.g

Fpr-rs4 For IDT PrimeTime qPCR Assay Mm.PT.56a.29119106.g

Fpr-rs4 Rev IDT PrimeTime qPCR Assay Mm.PT.56a.29119106.g Diabetes Page 56 of 230

SUPPLEMENTAL TABLE 2. Antibodies Used in Immunoblot, Immunofluorescence and Flow Cytometry Analyses. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies

Guinea pig anti-insulin DAKO Cat# IS002

Donkey anti-guinea pig Jackson Labs Cat# 706-545-148 Alexafluor488

Goat anti-GLP-1 Santa Cruz Cat# sc-7782

Rabbit anti-FPR Abcam Cat# ab113531

Donkey anti-rabbit Alexafluor568 ThermoFisher Cat# A10042

Rat anti-Mac2(Galectin-3) Cedarlane Cat# CL8942AP

Rabbit anti-HSP90αβ (H-114) Santa Cruz Cat# sc-7947

Rabbit anti-FPR Genetex Cat# GTX71283

APC/Cy7 Rat anti-MHCII Biolegend Cat# 107627

PE Rat anti-Siglec F BD Biosciences Cat# 552126

APC/Cy7 Rat anti-CD4 Biolegend Cat# 100413

FITC Rat anti-CD11b eBioscience Cat# 11-0112-41

APC Rat anti-CD19 eBioscience Cat# 17-0193-80

PE/Cy7 Rat anti-F4/80 eBioscience Cat# 25-4801-82

NC206 Rat anti-CD45 eBioscience Cat# 12-0451-81 eFluor450 Armenian hamster anti- eBioscience Cat# 48-0114-80 CD11c

LIVE/DEAD™ Fixable Aqua Dead eBioscience Cat# L34957 Cell Stain Kit

FITC Rat anti-GATA3(CD8a) eBioscience Cat# 11-0081-81

PE Rat anti-CD8 eBioscience Cat# 12-0081-81

APC Rat anti-rorg(t) eBioscience Cat# 17-6988-80 Page 57 of 230 Diabetes

PE/Cy7 Rat anti-FOXP3 eBioscience Cat# 25-5773-80

eVolve605 Rat anti-CD45 eBioscience Cat# 83-0451-42

PacificBlue Mouse anti-CD3 eBioscience Cat# MHCD0328 Diabetes Page 58 of 230

Supplemental Table 3. Significantly different taxa in Fpr1-KO mice versus WT mice in obese/HFD conditions.

Assigned Value OTU Kingdom Phylum Class 1 otu20 k__Bacteria p__Actinobacteria c__Coriobacteriia 2 otu7 k__Bacteria p__Bacteroidetes c__Bacteroidia 3 otu88 k__Bacteria p__Firmicutes c__Clostridia 4 otu422 k__Bacteria p__Firmicutes c__Clostridia 5 otu35 k__Bacteria p__Firmicutes c__Clostridia 6 otu21 k__Bacteria p__Bacteroidetes c__Bacteroidia 7 otu133 k__Bacteria p__Firmicutes c__Clostridia 8 otu29 k__Bacteria p__Firmicutes c__Clostridia 9 otu137 k__Bacteria p__Firmicutes c__Clostridia 10 otu502 k__Bacteria p__Firmicutes c__Clostridia 11 otu156 k__Bacteria p__Firmicutes c__Erysipelotrichi 12 otu1106 k__Bacteria p__Firmicutes c__Erysipelotrichi 13 otu294 k__Bacteria p__Firmicutes c__Clostridia 14 otu1027 k__Bacteria p__Firmicutes c__Clostridia 15 otu183 k__Bacteria p__Firmicutes c__Clostridia 16 otu181 k__Bacteria p__Firmicutes c__Clostridia 17 otu144 k__Bacteria p__Firmicutes c__Clostridia 18 otu123 k__Bacteria p__Firmicutes c__Clostridia 19 otu145 k__Bacteria p__Bacteroidetes c__Bacteroidia 20 otu71 k__Bacteria p__Bacteroidetes c__Bacteroidia 21 otu73 k__Bacteria p__Bacteroidetes c__Bacteroidia 22 otu122 k__Bacteria p__Bacteroidetes c__Bacteroidia 23 otu1096 k__Bacteria p__Bacteroidetes c__Bacteroidia 24 otu136 k__Bacteria p__Bacteroidetes c__Bacteroidia 25 otu51 k__Bacteria p__Bacteroidetes c__Bacteroidia 26 otu443 k__Bacteria p__Bacteroidetes c__Bacteroidia 27 otu221 k__Bacteria p__Deferribacteres c__Deferribacteres 28 otu61 k__Bacteria p__Firmicutes c__Clostridia 29 otu134 k__Bacteria p__Bacteroidetes c__Bacteroidia 30 otu700 k__Bacteria p__Bacteroidetes c__Bacteroidia 31 otu6 k__Bacteria p__Bacteroidetes c__Bacteroidia 32 otu31 k__Bacteria p__Bacteroidetes c__Bacteroidia 33 otu33 k__Bacteria p__Bacteroidetes c__Bacteroidia 34 otu66 k__Bacteria p__Bacteroidetes c__Bacteroidia 35 otu32 k__Bacteria p__Firmicutes c__Bacilli 36 otu5 k__Bacteria p__Proteobacteria c__Deltaproteobacteria 37 otu11 k__Bacteria p__Bacteroidetes c__Bacteroidia 38 otu26 k__Bacteria p__Firmicutes c__Clostridia 39 otu1084 k__Bacteria p__Deferribacteres c__Deferribacteres 40 otu36 k__Bacteria p__Bacteroidetes c__Bacteroidia 41 otu60 k__Bacteria p__Bacteroidetes c__Bacteroidia 42 otu52 k__Bacteria p__Bacteroidetes c__Bacteroidia 43 otu18 k__Bacteria p__Bacteroidetes c__Bacteroidia 44 otu22 k__Bacteria p__Bacteroidetes c__Bacteroidia 45 otu1111 k__Bacteria p__Bacteroidetes c__Bacteroidia 46 otu166 k__Bacteria p__Bacteroidetes c__Bacteroidia 47 otu160 k__Bacteria p__Bacteroidetes c__Bacteroidia 48 otu69 k__Bacteria p__Bacteroidetes c__Bacteroidia 49 otu19 k__Bacteria p__Bacteroidetes c__Bacteroidia 50 otu23 k__Bacteria p__Bacteroidetes c__Bacteroidia Page 59 of 230 Diabetes

51 otu116 k__Bacteria p__Firmicutes c__Clostridia 52 otu240 k__Bacteria p__Firmicutes c__Clostridia 53 otu230 k__Bacteria p__Bacteroidetes c__Bacteroidia 54 otu1068 k__Bacteria p__Proteobacteria c__Deltaproteobacteria 55 otu86 k__Bacteria p__Bacteroidetes c__Bacteroidia 56 otu25 k__Bacteria p__Firmicutes c__Clostridia 57 otu514 k__Bacteria p__Firmicutes c__Clostridia 58 otu306 k__Bacteria p__Firmicutes c__Clostridia 59 otu93 k__Bacteria p__Firmicutes c__Clostridia 60 otu102 k__Bacteria p__Firmicutes c__Clostridia 61 otu334 k__Bacteria p__Firmicutes c__Clostridia 62 otu444 k__Bacteria p__Bacteroidetes c__Bacteroidia 63 otu816 k__Bacteria p__Firmicutes c__Bacilli 64 otu406 k__Bacteria p__Firmicutes c__Clostridia 65 otu450 k__Bacteria p__Firmicutes c__Erysipelotrichi 66 otu127 k__Bacteria p__Firmicutes c__Clostridia 67 otu653 k__Bacteria p__Firmicutes c__Clostridia 68 otu40 k__Bacteria p__Firmicutes c__Clostridia 69 otu979 k__Bacteria p__Firmicutes c__Clostridia 70 otu184 k__Bacteria p__Actinobacteria c__Coriobacteriia 71 otu28 k__Bacteria p__Firmicutes c__Clostridia 72 otu89 k__Bacteria p__Bacteroidetes c__Bacteroidia 73 otu173 k__Bacteria p__Firmicutes c__Clostridia 74 otu128 k__Bacteria p__Bacteroidetes c__Bacteroidia 75 otu810 k__Bacteria p__Bacteroidetes c__Bacteroidia 76 otu797 k__Bacteria p__Bacteroidetes c__Bacteroidia 77 otu90 k__Bacteria p__Firmicutes c__Clostridia 78 otu171 k__Bacteria p__Firmicutes c__Clostridia 79 otu1038 k__Bacteria p__Firmicutes c__Erysipelotrichi 80 otu458 k__Bacteria p__Bacteroidetes c__Bacteroidia 81 otu265 k__Bacteria p__Bacteroidetes c__Bacteroidia 82 otu170 k__Bacteria p__Firmicutes c__Clostridia 83 otu990 k__Bacteria p__Firmicutes c__Clostridia 84 otu286 k__Bacteria p__Firmicutes c__Clostridia 85 otu725 k__Bacteria p__Firmicutes c__Clostridia 86 otu194 k__Bacteria p__Firmicutes c__Clostridia 87 otu225 k__Bacteria p__Firmicutes c__Clostridia 88 otu472 k__Bacteria p__Firmicutes c__Clostridia 89 otu283 k__Bacteria p__Firmicutes c__Clostridia 90 otu281 k__Bacteria p__Firmicutes c__Clostridia 91 otu87 k__Bacteria p__Bacteroidetes c__Bacteroidia 92 otu169 k__Bacteria p__Bacteroidetes c__Bacteroidia 93 otu376 k__Bacteria p__Firmicutes c__Clostridia 94 otu1097 k__Bacteria p__Firmicutes c__Clostridia 95 otu666 k__Bacteria p__Firmicutes c__Clostridia 96 otu1065 k__Bacteria p__Bacteroidetes c__Bacteroidia 97 otu517 k__Bacteria p__Bacteroidetes c__Bacteroidia 98 otu198 k__Bacteria p__Deferribacteres c__Deferribacteres 99 otu124 k__Bacteria p__Firmicutes c__Clostridia 100 otu966 k__Bacteria p__Firmicutes c__Bacilli 101 otu541 k__Bacteria p__Firmicutes c__Clostridia 102 otu580 k__Bacteria p__Firmicutes c__Clostridia 103 otu610 k__Bacteria p__Firmicutes c__Clostridia Diabetes Page 60 of 230

104 otu578 k__Bacteria p__Bacteroidetes c__Bacteroidia 105 otu54 k__Bacteria p__Firmicutes c__Clostridia 106 otu215 k__Bacteria p__Firmicutes c__Clostridia 107 otu218 k__Bacteria p__Firmicutes c__Clostridia 108 otu191 k__Bacteria p__Proteobacteria c__Deltaproteobacteria 109 otu374 k__Bacteria p__Deferribacteres c__Deferribacteres 110 otu239 k__Bacteria p__Bacteroidetes c__Bacteroidia 111 otu659 k__Bacteria p__Firmicutes c__Bacilli 112 otu532 k__Bacteria p__Firmicutes c__Clostridia 113 otu210 k__Bacteria p__Firmicutes c__Clostridia 114 otu1102 k__Bacteria p__Firmicutes c__Erysipelotrichi 115 otu338 k__Bacteria p__Firmicutes c__Clostridia 116 otu1069 k__Bacteria p__Firmicutes c__Clostridia 117 otu845 k__Bacteria p__Firmicutes c__Erysipelotrichi 118 otu892 k__Bacteria p__Proteobacteria c__Deltaproteobacteria 119 otu288 k__Bacteria p__Actinobacteria c__Coriobacteriia 120 otu212 k__Bacteria p__Firmicutes c__Clostridia 121 otu100 k__Bacteria p__Firmicutes c__Clostridia 122 otu223 k__Bacteria p__Bacteroidetes c__Bacteroidia 123 otu529 k__Bacteria p__Firmicutes c__Clostridia 124 otu143 k__Bacteria p__TM7 c__TM7-3 125 otu885 k__Bacteria p__Bacteroidetes c__Bacteroidia 126 otu363 k__Bacteria p__Bacteroidetes c__Bacteroidia 127 otu577 k__Bacteria p__Firmicutes c__Clostridia 128 otu831 k__Bacteria p__Bacteroidetes c__Bacteroidia 129 otu486 k__Bacteria p__Firmicutes c__Clostridia 130 otu130 k__Bacteria p__Firmicutes c__Clostridia 131 otu971 k__Bacteria p__Firmicutes c__Clostridia 132 otu182 k__Bacteria p__Bacteroidetes c__Bacteroidia 133 otu806 k__Bacteria p__Bacteroidetes c__Bacteroidia 134 otu96 k__Bacteria p__Firmicutes c__Clostridia 135 otu149 k__Bacteria p__Firmicutes c__Clostridia 136 otu231 k__Bacteria p__Firmicutes c__Clostridia 137 otu162 k__Bacteria p__Firmicutes c__Clostridia 138 otu899 k__Bacteria p__Bacteroidetes c__Bacteroidia 139 otu161 k__Bacteria p__Firmicutes c__Clostridia 140 otu1047 k__Bacteria p__Bacteroidetes c__Bacteroidia 141 otu508 k__Bacteria p__Firmicutes c__Clostridia 142 otu154 k__Bacteria p__Firmicutes c__Clostridia 143 otu201 k__Bacteria p__Firmicutes c__Clostridia 144 otu428 k__Bacteria p__Firmicutes c__Clostridia 145 otu1039 k__Bacteria p__Firmicutes c__Clostridia 146 otu690 k__Bacteria p__Firmicutes c__Clostridia 147 otu271 k__Bacteria p__Firmicutes c__Clostridia 148 otu339 k__Bacteria p__Firmicutes c__Clostridia 149 otu1025 k__Bacteria p__Bacteroidetes c__Bacteroidia 150 otu256 k__Bacteria p__Firmicutes c__Clostridia 151 otu83 k__Bacteria p__Firmicutes c__Clostridia 152 otu3 k__Bacteria p__Bacteroidetes c__Bacteroidia 153 otu233 k__Bacteria p__Firmicutes c__Clostridia 154 otu189 k__Bacteria p__Firmicutes c__Clostridia 155 otu1125 k__Bacteria p__Bacteroidetes c__Bacteroidia 156 otu947 k__Bacteria p__Bacteroidetes c__Bacteroidia Page 61 of 230 Diabetes

157 otu257 k__Bacteria p__Bacteroidetes c__Bacteroidia 158 otu500 k__Bacteria p__Firmicutes c__Clostridia 159 otu898 k__Bacteria p__Firmicutes c__Clostridia 160 otu719 k__Bacteria p__Firmicutes c__Clostridia 161 otu279 k__Bacteria p__Firmicutes c__Clostridia 162 otu138 k__Bacteria p__Firmicutes c__Clostridia 163 otu266 k__Bacteria p__Firmicutes c__Clostridia 164 otu479 k__Bacteria p__Firmicutes c__Clostridia 165 otu1121 k__Bacteria p__Firmicutes c__Clostridia 166 otu799 k__Bacteria p__Firmicutes c__Clostridia 167 otu599 k__Bacteria p__Firmicutes c__Clostridia 168 otu989 k__Bacteria p__Firmicutes c__Clostridia 169 otu53 k__Bacteria p__Firmicutes c__Clostridia 170 otu646 k__Bacteria p__Firmicutes c__Clostridia 171 otu823 k__Bacteria p__Firmicutes c__Clostridia 172 otu268 k__Bacteria p__Firmicutes c__Clostridia 173 otu202 k__Bacteria p__Firmicutes c__Clostridia 174 otu67 k__Bacteria p__Firmicutes c__Clostridia 175 otu311 k__Bacteria p__Actinobacteria c__Coriobacteriia 176 otu235 k__Bacteria p__Bacteroidetes c__Bacteroidia 177 otu295 k__Bacteria p__Firmicutes c__Clostridia 178 otu9 k__Bacteria p__Firmicutes c__Clostridia 179 otu988 k__Bacteria p__Firmicutes c__Clostridia 180 otu345 k__Bacteria p__Firmicutes c__Clostridia 181 otu811 k__Bacteria p__Firmicutes c__Clostridia 182 otu315 k__Bacteria p__Firmicutes c__Clostridia 183 otu769 k__Bacteria p__Firmicutes c__Clostridia 184 otu190 k__Bacteria p__Firmicutes c__Clostridia 185 otu121 k__Bacteria p__Firmicutes c__Erysipelotrichi 186 otu199 k__Bacteria p__Firmicutes c__Clostridia 187 otu1077 k__Bacteria p__Firmicutes c__Bacilli 188 otu476 k__Bacteria p__Firmicutes c__Clostridia 189 otu253 k__Bacteria p__Firmicutes c__Clostridia 190 otu1035 k__Bacteria p__Bacteroidetes c__Bacteroidia 191 otu327 k__Bacteria p__Firmicutes c__Clostridia 192 otu269 k__Bacteria p__Firmicutes c__Clostridia 193 otu1132 k__Bacteria p__Firmicutes c__Bacilli 194 otu976 k__Bacteria p__Firmicutes c__Clostridia 195 otu146 k__Bacteria p__Proteobacteria c__Alphaproteobacteria 196 otu263 k__Bacteria p__Firmicutes c__Clostridia 197 otu1094 k__Bacteria p__Bacteroidetes c__Bacteroidia 198 otu208 k__Bacteria p__Firmicutes c__Clostridia 199 otu1041 k__Bacteria p__Firmicutes c__Clostridia 200 otu1093 k__Bacteria p__Firmicutes c__Clostridia 201 otu105 k__Bacteria p__Firmicutes c__Clostridia 202 otu359 k__Bacteria p__Firmicutes c__Clostridia 203 otu314 k__Bacteria p__Firmicutes c__Clostridia 204 otu180 k__Bacteria p__Firmicutes c__Clostridia 205 otu274 k__Bacteria p__Firmicutes c__Clostridia 206 otu522 k__Bacteria p__Firmicutes c__Clostridia 207 otu986 k__Bacteria p__Bacteroidetes c__Bacteroidia 208 otu220 k__Bacteria p__Bacteroidetes c__Bacteroidia 209 otu255 k__Bacteria p__Firmicutes c__Clostridia Diabetes Page 62 of 230

210 otu340 k__Bacteria p__Firmicutes c__Clostridia 211 otu870 k__Bacteria p__Firmicutes c__Clostridia 212 otu77 k__Bacteria p__Firmicutes c__Clostridia 213 otu380 k__Bacteria p__Firmicutes c__Bacilli 214 otu97 k__Bacteria p__Bacteroidetes c__Bacteroidia 215 otu801 k__Bacteria p__Firmicutes c__Clostridia 216 otu677 k__Bacteria p__Firmicutes c__Clostridia 217 otu98 k__Bacteria p__Firmicutes c__Clostridia 218 otu196 k__Bacteria p__Bacteroidetes c__Bacteroidia 219 otu758 k__Bacteria p__Firmicutes c__Clostridia 220 otu894 k__Bacteria p__Bacteroidetes c__Bacteroidia 221 otu412 k__Bacteria p__Firmicutes c__Clostridia 222 otu362 k__Bacteria p__Firmicutes c__Clostridia 223 otu81 k__Bacteria p__Firmicutes c__Clostridia 224 otu366 k__Bacteria p__Firmicutes c__Clostridia 225 otu12 k__Bacteria p__Tenericutes c__Mollicutes 226 otu270 k__Bacteria p__Firmicutes c__Clostridia 227 otu702 k__Bacteria p__Firmicutes c__Clostridia 228 otu782 k__Bacteria p__Bacteroidetes c__Bacteroidia 229 otu177 k__Bacteria p__Proteobacteria c__Alphaproteobacteria 230 otu377 k__Bacteria p__Bacteroidetes c__Bacteroidia 231 otu792 k__Bacteria p__Actinobacteria c__Coriobacteriia 232 otu195 k__Bacteria p__Firmicutes c__Clostridia 233 otu629 k__Bacteria p__Firmicutes c__Clostridia 234 otu496 k__Bacteria p__Bacteroidetes c__Bacteroidia 235 otu985 k__Bacteria p__Firmicutes c__Clostridia 236 otu923 k__Bacteria p__Bacteroidetes c__Bacteroidia 237 otu1040 k__Bacteria p__Firmicutes c__Clostridia 238 otu948 k__Bacteria p__Firmicutes c__Clostridia 239 otu872 k__Bacteria p__unclassified c__unclassified 240 otu437 k__Bacteria p__Firmicutes c__Clostridia 241 otu252 k__Bacteria p__Actinobacteria c__Coriobacteriia 242 otu403 k__Bacteria p__Firmicutes c__Clostridia 243 otu946 k__Bacteria p__Bacteroidetes c__Bacteroidia 244 otu523 k__Bacteria p__Firmicutes c__Clostridia 245 otu766 k__Bacteria p__Bacteroidetes c__Bacteroidia 246 otu115 k__Bacteria p__Firmicutes c__Clostridia 247 otu323 k__Bacteria p__Firmicutes c__Clostridia 248 otu308 k__Bacteria p__Firmicutes c__Bacilli 249 otu942 k__Bacteria p__Firmicutes c__Bacilli 250 otu484 k__Bacteria p__Bacteroidetes c__Bacteroidia 251 otu74 k__Bacteria p__Firmicutes c__Clostridia 252 otu292 k__Bacteria p__Firmicutes c__Clostridia 253 otu1070 k__Bacteria p__Bacteroidetes c__Bacteroidia 254 otu586 k__Bacteria p__Firmicutes c__Clostridia 255 otu188 k__Bacteria p__Firmicutes c__Clostridia 256 otu1000 k__Bacteria p__Firmicutes c__Clostridia 257 otu936 k__Bacteria p__Firmicutes c__Clostridia 258 otu882 k__Bacteria p__Bacteroidetes c__Bacteroidia 259 otu941 k__Bacteria p__Firmicutes c__Clostridia 260 otu1058 k__Bacteria p__Bacteroidetes c__Bacteroidia 261 otu331 k__Bacteria p__Firmicutes c__Clostridia 262 otu697 k__Bacteria p__Bacteroidetes c__Bacteroidia Page 63 of 230 Diabetes

263 otu289 k__Bacteria p__Firmicutes c__Clostridia 264 otu261 k__Bacteria p__Firmicutes c__Clostridia 265 otu740 k__Bacteria p__Bacteroidetes c__Bacteroidia 266 otu379 k__Bacteria p__Firmicutes c__Clostridia 267 otu781 k__Bacteria p__Firmicutes c__Clostridia 268 otu299 k__Bacteria p__Firmicutes c__Clostridia 269 otu685 k__Bacteria p__Firmicutes c__Clostridia 270 otu1083 k__Bacteria p__Firmicutes c__Clostridia 271 otu895 k__Bacteria p__Bacteroidetes c__Bacteroidia 272 otu1135 k__Bacteria p__Bacteroidetes c__Bacteroidia 273 otu722 k__Bacteria p__Firmicutes c__Clostridia 274 otu638 k__Bacteria p__Firmicutes c__Clostridia 275 otu552 k__Bacteria p__Actinobacteria c__Coriobacteriia 276 otu957 k__Bacteria p__Firmicutes c__Clostridia 277 otu344 k__Bacteria p__Firmicutes c__Clostridia 278 otu301 k__Bacteria p__Firmicutes c__Clostridia 279 otu155 k__Bacteria p__Firmicutes c__Clostridia 280 otu847 k__Bacteria p__Firmicutes c__Clostridia 281 otu1030 k__Bacteria p__Firmicutes c__Clostridia 282 otu16 k__Bacteria p__Bacteroidetes c__Bacteroidia 283 otu822 k__Bacteria p__Firmicutes c__Clostridia 284 otu912 k__Bacteria p__Firmicutes c__Bacilli 285 otu211 k__Bacteria p__Firmicutes c__Clostridia 286 otu247 k__Bacteria p__Firmicutes c__Clostridia 287 otu635 k__Bacteria p__unclassified c__unclassified 288 otu418 k__Bacteria p__Firmicutes c__Clostridia 289 otu676 k__Bacteria p__Proteobacteria c__Deltaproteobacteria 290 otu139 k__Bacteria p__Firmicutes c__Clostridia 291 otu1033 k__Bacteria p__Bacteroidetes c__Bacteroidia 292 otu55 k__Bacteria p__Firmicutes c__Clostridia 293 otu497 k__Bacteria p__Firmicutes c__Clostridia 294 otu65 k__Bacteria p__Bacteroidetes c__Bacteroidia 295 otu474 k__Bacteria p__Firmicutes c__Clostridia 296 otu657 k__Bacteria p__Firmicutes c__Clostridia 297 otu505 k__Bacteria p__Bacteroidetes c__Bacteroidia 298 otu795 k__Bacteria p__unclassified c__unclassified 299 otu303 k__Bacteria p__Firmicutes c__Clostridia 300 otu251 k__Bacteria p__Firmicutes c__Clostridia 301 otu784 k__Bacteria p__Firmicutes c__Clostridia 302 otu237 k__Bacteria p__Actinobacteria c__Coriobacteriia 303 otu750 k__Bacteria p__Firmicutes c__Erysipelotrichi 304 otu473 k__Bacteria p__Firmicutes c__Clostridia 305 otu916 k__Bacteria p__Bacteroidetes c__Bacteroidia 306 otu332 k__Bacteria p__Firmicutes c__Clostridia 307 otu535 k__Bacteria p__Firmicutes c__Clostridia 308 otu808 k__Bacteria p__Firmicutes c__Clostridia 309 otu825 k__Bacteria p__Firmicutes c__Clostridia 310 otu737 k__Bacteria p__Firmicutes c__Clostridia 311 otu939 k__Bacteria p__Firmicutes c__Clostridia 312 otu348 k__Bacteria p__Firmicutes c__Erysipelotrichi 313 otu350 k__Bacteria p__Firmicutes c__Clostridia 314 otu172 k__Bacteria p__Firmicutes c__Clostridia 315 otu714 k__Bacteria p__Bacteroidetes c__Bacteroidia Diabetes Page 64 of 230

316 otu68 k__Bacteria p__Firmicutes c__Clostridia 317 otu455 k__Bacteria p__Bacteroidetes c__Bacteroidia 318 otu776 k__Bacteria p__Bacteroidetes c__Bacteroidia 319 otu987 k__Bacteria p__Firmicutes c__Clostridia 320 otu837 k__Bacteria p__Actinobacteria c__Coriobacteriia 321 otu859 k__Bacteria p__Bacteroidetes c__Bacteroidia 322 otu245 k__Bacteria p__Firmicutes c__Clostridia 323 otu262 k__Bacteria p__Firmicutes c__Clostridia 324 otu342 k__Bacteria p__Firmicutes c__Clostridia 325 otu368 k__Bacteria p__Actinobacteria c__Coriobacteriia 326 otu637 k__Bacteria p__Firmicutes c__Clostridia 327 otu388 k__Bacteria p__Firmicutes c__Clostridia 328 otu652 k__Bacteria p__Firmicutes c__Clostridia 329 otu622 k__Bacteria p__Firmicutes c__Clostridia 330 otu309 k__Bacteria p__Firmicutes c__Clostridia 331 otu242 k__Bacteria p__Tenericutes c__Mollicutes 332 otu591 k__Bacteria p__Bacteroidetes c__Bacteroidia 333 otu229 k__Bacteria p__Firmicutes c__Clostridia 334 otu835 k__Bacteria p__Actinobacteria c__Coriobacteriia 335 otu818 k__Bacteria p__Bacteroidetes c__Bacteroidia 336 otu798 k__Bacteria p__Firmicutes c__Clostridia 337 otu991 k__Bacteria p__Bacteroidetes c__Bacteroidia 338 otu423 k__Bacteria p__Firmicutes c__Clostridia 339 otu107 k__Bacteria p__Firmicutes c__Clostridia 340 otu305 k__Bacteria p__Firmicutes c__Clostridia 341 otu393 k__Bacteria p__Firmicutes c__Clostridia 342 otu889 k__Bacteria p__Firmicutes c__Clostridia 343 otu824 k__Bacteria p__Firmicutes c__Clostridia 344 otu37 k__Bacteria p__Bacteroidetes c__Bacteroidia 345 otu731 k__Bacteria p__Firmicutes c__Clostridia 346 otu843 k__Bacteria p__Firmicutes c__Clostridia 347 otu485 k__Bacteria p__Firmicutes c__Clostridia 348 otu883 k__Bacteria p__Firmicutes c__Clostridia 349 otu662 k__Bacteria p__Firmicutes c__Clostridia 350 otu929 k__Bacteria p__Firmicutes c__Erysipelotrichi 351 otu387 k__Bacteria p__Firmicutes c__Clostridia 352 otu993 k__Bacteria p__Firmicutes c__Clostridia 353 otu964 k__Bacteria p__Firmicutes c__Clostridia 354 otu358 k__Bacteria p__Firmicutes c__Clostridia 355 otu453 k__Bacteria p__Bacteroidetes c__Bacteroidia 356 otu567 k__Bacteria p__Firmicutes c__Clostridia 357 otu410 k__Bacteria p__Firmicutes c__Erysipelotrichi 358 otu216 k__Bacteria p__Firmicutes c__Clostridia 359 otu42 k__Bacteria p__Firmicutes c__Clostridia 360 otu59 k__Bacteria p__Firmicutes c__Clostridia 361 otu335 k__Bacteria p__Firmicutes c__Clostridia 362 otu280 k__Bacteria p__Firmicutes c__Clostridia 363 otu296 k__Bacteria p__Firmicutes c__Clostridia 364 otu429 k__Bacteria p__Firmicutes c__Bacilli 365 otu723 k__Bacteria p__Firmicutes c__Clostridia 366 otu594 k__Bacteria p__Firmicutes c__Clostridia Page 65 of 230 Diabetes

Supplemental Table 3. Significantly different taxa in Fpr1-KO mice versus WT mice in obese/HFD conditions.

Order Family Genus Species o__Coriobacteriales f__Coriobacteriaceae g__94otu19385 s__97otu70240 o__Bacteroidales f__S24-7 g__94otu19296 s__97otu15293 o__Clostridiales f__91otu740 g__94otu1467 s__97otu51165 o__Clostridiales f__91otu11268 g__94otu9695 s__97otu8324 o__Clostridiales f__Clostridiaceae g__94otu6138 s__97otu92837 o__Bacteroidales f__S24-7 g__94otu11032 s__97otu53444 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu9084 g__94otu23583 s__97otu5100 o__Clostridiales f__Ruminococcaceae g__Ruminococcus s__97otu10429 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Erysipelotrichales f__Erysipelotrichaceae g__94otu43063 s__97otu52850 o__Erysipelotrichales f__Erysipelotrichaceae g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu1346 s__97otu60654 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__91otu5032 g__94otu12980 s__97otu31603 o__Clostridiales f__91otu4244 g__94otu28754 s__97otu31668 o__Clostridiales f__Lachnospiraceae g__94otu11775 s__unclassified o__Clostridiales f__Lachnospiraceae g__unclassified s__unclassified o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified o__Bacteroidales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__S24-7 g__94otu1116 s__97otu8254 o__Bacteroidales f__S24-7 g__94otu2557 s__97otu2899 o__Bacteroidales f__Rikenellaceae g__94otu20339 s__97otu824 o__Bacteroidales f__S24-7 g__94otu9584 s__unclassified o__Bacteroidales f__S24-7 g__94otu2756 s__97otu3142 o__Bacteroidales f__Rikenellaceae g__Rikenella s__unclassified o__Deferribacterales f__Deferribacteraceae g__Mucispirillum s__schaedleri o__Clostridiales f__Peptococcaceae g__94otu7801 s__97otu9437 o__Bacteroidales f__S24-7 g__94otu10153 s__97otu12508 o__Bacteroidales f__91otu547 g__94otu13803 s__97otu65263 o__Bacteroidales f__Rikenellaceae g__Rikenella s__unclassified o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__97otu16938 o__Bacteroidales f__Rikenellaceae g__94otu36926 s__97otu41102 o__Bacteroidales f__S24-7 g__94otu1086 s__97otu86044 o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__reuteri o__Desulfovibrionales f__Desulfovibrionaceae g__Bilophila s__97otu11197 o__Bacteroidales f__Rikenellaceae g__AF12 s__97otu95501 o__Clostridiales f__91otu22026 g__94otu46108 s__97otu52301 o__Deferribacterales f__Deferribacteraceae g__Mucispirillum s__schaedleri o__Bacteroidales f__S24-7 g__94otu4147 s__97otu4768 o__Bacteroidales f__S24-7 g__94otu12623 s__97otu44010 o__Bacteroidales f__S24-7 g__94otu20625 s__97otu71432 o__Bacteroidales f__91otu547 g__94otu13803 s__97otu65263 o__Bacteroidales f__[Odoribacteraceae] g__Odoribacter s__97otu18999 o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__acidifaciens o__Bacteroidales f__S24-7 g__94otu24209 s__97otu74956 o__Bacteroidales f__S24-7 g__94otu9699 s__97otu21995 o__Bacteroidales f__S24-7 g__94otu17548 s__97otu20731 o__Bacteroidales f__[Odoribacteraceae] g__Odoribacter s__unclassified o__Bacteroidales f__Rikenellaceae g__94otu35480 s__97otu39434 Diabetes Page 66 of 230

o__Clostridiales f__91otu10082 g__94otu27226 s__97otu37977 o__Clostridiales f__Ruminococcaceae g__94otu40139 s__97otu91725 o__Bacteroidales f__Rikenellaceae g__unclassified s__unclassified o__Desulfovibrionales f__Desulfovibrionaceae g__Desulfovibrio s__C21_c20 o__Bacteroidales f__Rikenellaceae g__94otu17083 s__97otu19087 o__Clostridiales f__91otu6389 g__94otu12971 s__97otu87063 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu740 g__94otu29134 s__97otu32062 o__Clostridiales f__91otu10284 g__94otu43195 s__97otu77701 o__Clostridiales f__[Mogibacteriaceae] g__94otu17676 s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__Rikenellaceae g__AF12 s__97otu95501 o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__unclassified o__Clostridiales f__Ruminococcaceae g__Ruminococcus s__97otu7135 o__Erysipelotrichales f__Erysipelotrichaceae g__94otu43063 s__97otu52850 o__Clostridiales f__Ruminococcaceae g__Ruminococcus s__97otu19391 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__97otu6084 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Coriobacteriales f__Coriobacteriaceae g__Adlercreutzia s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__97otu13166 o__Bacteroidales f__S24-7 g__94otu13361 s__97otu5679 o__Clostridiales f__Lachnospiraceae g__94otu25092 s__97otu31085 o__Bacteroidales f__Porphyromonadaceae g__Parabacteroides s__unclassified o__Bacteroidales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__Rikenellaceae g__Rikenella s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Erysipelotrichales f__Erysipelotrichaceae g__94otu43063 s__97otu52850 o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified o__Bacteroidales f__S24-7 g__94otu7438 s__97otu87775 o__Clostridiales f__91otu6920 g__94otu30979 s__unclassified o__Clostridiales f__91otu4999 g__94otu14419 s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu14613 s__97otu16261 o__Clostridiales f__91otu9084 g__94otu9787 s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu42849 s__97otu89586 o__Clostridiales f__Ruminococcaceae g__94otu18214 s__97otu20080 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu24824 s__97otu27233 o__Clostridiales f__Lachnospiraceae g__94otu24773 s__97otu4047 o__Bacteroidales f__Rikenellaceae g__94otu17906 s__97otu76588 o__Bacteroidales f__S24-7 g__94otu14796 s__97otu3361 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Ruminococcaceae g__Anaerotruncus s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__91otu547 g__94otu13803 s__97otu65263 o__Bacteroidales f__91otu547 g__94otu13803 s__97otu65263 o__Deferribacterales f__Deferribacteraceae g__Mucispirillum s__schaedleri o__Clostridiales f__Lachnospiraceae g__Dorea s__97otu90286 o__Lactobacillales f__Streptococcaceae g__Lactococcus s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Clostridiaceae g__unclassified s__unclassified Page 67 of 230 Diabetes

o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__[Ruminococcus] s__gnavus o__Clostridiales f__91otu13759 g__94otu288 s__97otu314 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__97otu44117 o__Desulfovibrionales f__Desulfovibrionaceae g__unclassified s__unclassified o__Deferribacterales f__Deferribacteraceae g__Mucispirillum s__schaedleri o__Bacteroidales f__S24-7 g__94otu37942 s__97otu89308 o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Lachnospiraceae g__unclassified s__unclassified o__Erysipelotrichales f__Erysipelotrichaceae g__94otu43063 s__97otu52850 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Erysipelotrichales f__Erysipelotrichaceae g__94otu43063 s__unclassified o__Desulfovibrionales f__Desulfovibrionaceae g__Bilophila s__97otu11197 o__Coriobacteriales f__Coriobacteriaceae g__Adlercreutzia s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu45591 s__97otu54409 o__Clostridiales f__Lachnospiraceae g__94otu26710 s__97otu29370 o__Bacteroidales f__Porphyromonadaceae g__Parabacteroides s__distasonis o__Clostridiales f__91otu9084 g__94otu9787 s__unclassified o__CW040 f__F16 g__94otu1266 s__97otu18441 o__Bacteroidales f__Rikenellaceae g__94otu35480 s__97otu39434 o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__Rikenellaceae g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu40061 s__97otu97581 o__Clostridiales f__91otu6389 g__94otu12971 s__unclassified o__Bacteroidales f__S24-7 g__94otu22671 s__97otu34824 o__Bacteroidales f__Rikenellaceae g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu5626 g__94otu12408 s__unclassified o__Clostridiales f__Ruminococcaceae g__94otu32563 s__unclassified o__Clostridiales f__Ruminococcaceae g__94otu25284 s__unclassified o__Bacteroidales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu7765 g__94otu20164 s__97otu30584 o__Bacteroidales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu8957 g__94otu17317 s__97otu8513 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__97otu14086 o__Clostridiales f__91otu7810 g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__[Mogibacteriaceae] g__94otu13888 s__97otu5542 o__Clostridiales f__Ruminococcaceae g__94otu9261 s__unclassified o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__97otu62045 o__Clostridiales f__Ruminococcaceae g__94otu16215 s__97otu97670 o__Bacteroidales f__[Paraprevotellaceae] g__[Prevotella] s__unclassified o__Clostridiales f__91otu4244 g__94otu28754 s__97otu31668 o__Clostridiales f__Clostridiaceae g__94otu42703 s__97otu48077 o__Bacteroidales f__Porphyromonadaceae g__Parabacteroides s__97otu99185 o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified Diabetes Page 68 of 230

o__Bacteroidales f__Rikenellaceae g__94otu1542 s__97otu74772 o__Clostridiales f__91otu15478 g__94otu34855 s__97otu53739 o__Clostridiales f__91otu740 g__94otu29134 s__97otu32062 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__[Mogibacteriaceae] g__94otu44055 s__97otu90747 o__Clostridiales f__91otu4292 g__94otu13710 s__97otu74747 o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Clostridiaceae g__94otu972 s__97otu1180 o__Clostridiales f__Lachnospiraceae g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__Coprococcus s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu8029 g__94otu15369 s__97otu12644 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__[Mogibacteriaceae] g__94otu1330 s__97otu1577 o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Clostridiales f__Dehalobacteriaceae g__Dehalobacterium s__97otu86093 o__Coriobacteriales f__Coriobacteriaceae g__unclassified s__unclassified o__Bacteroidales f__S24-7 g__94otu10608 s__97otu12190 o__Clostridiales f__Ruminococcaceae g__94otu20988 s__97otu23046 o__Clostridiales f__Ruminococcaceae g__94otu36685 s__97otu9865 o__Clostridiales f__Clostridiaceae g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__91otu4691 g__94otu10569 s__97otu3565 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu5977 g__94otu20147 s__97otu22114 o__Erysipelotrichales f__Erysipelotrichaceae g__Coprobacillus s__97otu73651 o__Clostridiales f__Lachnospiraceae g__94otu13710 s__97otu78359 o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu1395 g__94otu13359 s__97otu43034 o__Bacteroidales f__S24-7 g__94otu20625 s__97otu71432 o__Clostridiales f__Christensenellaceae g__94otu45968 s__97otu98887 o__Clostridiales f__Lachnospiraceae g__Coprococcus s__unclassified o__Lactobacillales f__Streptococcaceae g__Streptococcus s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__RF32 f__91otu6104 g__unclassified s__unclassified o__Clostridiales f__91otu4244 g__94otu28754 s__97otu31668 o__Bacteroidales f__Rikenellaceae g__94otu20339 s__unclassified o__Clostridiales f__Ruminococcaceae g__Ruminococcus s__97otu81310 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__Coprococcus s__97otu5218 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Ruminococcaceae g__94otu35382 s__97otu8268 o__Clostridiales f__91otu9624 g__94otu18563 s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu11016 s__97otu20812 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Bacteroidales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__Rikenellaceae g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified Page 69 of 230 Diabetes

o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu14757 s__97otu24626 o__Lactobacillales f__Streptococcaceae g__Streptococcus s__unclassified o__Bacteroidales f__S24-7 g__94otu16251 s__97otu24066 o__Clostridiales f__Lachnospiraceae g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Clostridiaceae g__94otu972 s__97otu1180 o__Bacteroidales f__S24-7 g__94otu14279 s__97otu18102 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Bacteroidales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__Roseburia s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Anaeroplasmatales f__Anaeroplasmataceae g__Anaeroplasma s__97otu8978 o__Clostridiales f__Christensenellaceae g__94otu32868 s__97otu83827 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified o__RF32 f__91otu6104 g__94otu43320 s__97otu48840 o__Bacteroidales f__S24-7 g__94otu9715 s__unclassified o__Coriobacteriales f__Coriobacteriaceae g__Adlercreutzia s__unclassified o__Clostridiales f__Ruminococcaceae g__94otu7573 s__97otu56547 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Bacteroidales f__Rikenellaceae g__AF12 s__97otu95501 o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Bacteroidales f__S24-7 g__94otu11032 s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__unclassified f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu457 g__94otu32464 s__97otu73431 o__Coriobacteriales f__Coriobacteriaceae g__Adlercreutzia s__97otu10130 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__Clostridiaceae g__unclassified s__unclassified o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__91otu14676 g__94otu28846 s__97otu95441 o__Clostridiales f__Ruminococcaceae g__94otu37453 s__97otu90140 o__Lactobacillales f__Enterococcaceae g__Enterococcus s__unclassified o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__unclassified o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__94otu18905 s__97otu20811 o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Bacteroidales f__[Odoribacteraceae] g__Odoribacter s__97otu18999 o__Clostridiales f__Ruminococcaceae g__Ruminococcus s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu18071 s__97otu71822 o__Clostridiales f__Ruminococcaceae g__94otu9261 s__97otu29867 o__Clostridiales f__[Mogibacteriaceae] g__94otu44055 s__97otu49774 o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu20550 s__97otu83482 o__Bacteroidales f__S24-7 g__unclassified s__unclassified Diabetes Page 70 of 230

o__Clostridiales f__Ruminococcaceae g__94otu9417 s__97otu19610 o__Clostridiales f__Lachnospiraceae g__unclassified s__unclassified o__Bacteroidales f__Rikenellaceae g__Rikenella s__unclassified o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Clostridiales f__Clostridiaceae g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__Anaerostipes s__97otu18915 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Lachnospiraceae g__Roseburia s__97otu25366 o__Bacteroidales f__Rikenellaceae g__94otu17906 s__97otu52145 o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__uniformis o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Clostridiales f__91otu740 g__94otu29134 s__unclassified o__Coriobacteriales f__Coriobacteriaceae g__Adlercreutzia s__97otu64052 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu4244 g__94otu28754 s__97otu70935 o__Clostridiales f__91otu457 g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__unclassified s__unclassified o__Bacteroidales f__S24-7 g__94otu16218 s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__97otu63987 o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__unclassified o__Clostridiales f__91otu7810 g__94otu39587 s__97otu26382 o__Clostridiales f__91otu16941 g__94otu2808 s__97otu55052 o__unclassified f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Desulfovibrionales f__Desulfovibrionaceae g__Bilophila s__97otu11197 o__Clostridiales f__Lachnospiraceae g__94otu9307 s__97otu12886 o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__97otu22944 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__97otu17024 o__Bacteroidales f__Rikenellaceae g__94otu9546 s__97otu6719 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Bacteroidales f__Rikenellaceae g__unclassified s__unclassified o__unclassified f__unclassified g__unclassified s__unclassified o__Clostridiales f__Clostridiaceae g__94otu44705 s__97otu50621 o__Clostridiales f__Lachnospiraceae g__Coprococcus s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Coriobacteriales f__Coriobacteriaceae g__Adlercreutzia s__unclassified o__Erysipelotrichales f__Erysipelotrichaceae g__94otu43063 s__97otu52850 o__Clostridiales f__Ruminococcaceae g__Anaerotruncus s__unclassified o__Bacteroidales f__Porphyromonadaceae g__Parabacteroides s__97otu99185 o__Clostridiales f__91otu419 g__94otu12834 s__97otu24793 o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__Ruminococcaceae g__Anaerotruncus s__unclassified o__Clostridiales f__Lachnospiraceae g__Dorea s__unclassified o__Clostridiales f__91otu11268 g__94otu9695 s__unclassified o__Erysipelotrichales f__Erysipelotrichaceae g__94otu15456 s__97otu17132 o__Clostridiales f__Clostridiaceae g__94otu10426 s__unclassified o__Clostridiales f__91otu7180 g__94otu15349 s__97otu28277 o__Bacteroidales f__Rikenellaceae g__Rikenella s__unclassified Page 71 of 230 Diabetes

o__Clostridiales f__Lachnospiraceae g__unclassified s__unclassified o__Bacteroidales f__Rikenellaceae g__unclassified s__unclassified o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Coriobacteriales f__Coriobacteriaceae g__Adlercreutzia s__97otu64052 o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu6352 g__94otu17022 s__97otu49370 o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Coriobacteriales f__Coriobacteriaceae g__Adlercreutzia s__97otu28559 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu40315 s__97otu82078 o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu11370 s__unclassified o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__RF39 f__91otu7931 g__94otu23118 s__97otu94759 o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified o__Clostridiales f__Lachnospiraceae g__94otu29380 s__97otu3552 o__Coriobacteriales f__Coriobacteriaceae g__94otu19385 s__97otu70240 o__Bacteroidales f__S24-7 g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__Rikenellaceae g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__91otu6340 g__94otu10119 s__97otu87645 o__Clostridiales f__91otu8083 g__94otu15780 s__97otu18581 o__Clostridiales f__91otu8755 g__94otu38287 s__97otu60739 o__Clostridiales f__Lachnospiraceae g__Roseburia s__97otu18384 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Bacteroidales f__S24-7 g__94otu1014 s__97otu1224 o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__91otu22026 g__94otu46108 s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified o__Erysipelotrichales f__Erysipelotrichaceae g__94otu43063 s__97otu52850 o__Clostridiales f__Ruminococcaceae g__94otu45504 s__97otu97897 o__Clostridiales f__unclassified g__unclassified s__unclassified o__Clostridiales f__Lachnospiraceae g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__Ruminococcus s__97otu48847 o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__unclassified o__Clostridiales f__Ruminococcaceae g__Oscillospira s__unclassified o__Erysipelotrichales f__Erysipelotrichaceae g__94otu21719 s__97otu37234 o__Clostridiales f__Ruminococcaceae g__unclassified s__unclassified o__Clostridiales f__Ruminococcaceae g__94otu9261 s__97otu13002 o__Clostridiales f__91otu982 g__94otu11102 s__97otu13388 o__Clostridiales f__Ruminococcaceae g__94otu41712 s__97otu46809 o__Clostridiales f__91otu5738 g__94otu11972 s__97otu13605 o__Clostridiales f__Ruminococcaceae g__94otu24695 s__97otu74676 o__Lactobacillales f__Streptococcaceae g__Streptococcus s__unclassified o__Clostridiales f__91otu9084 g__94otu9787 s__unclassified o__Clostridiales f__unclassified g__unclassified s__unclassified Diabetes Page 72 of 230

baseMean log2FoldChange lfcSE stat pvalue padj 2359.87353 -12.96177406 0.96762 -13.396 6.42E-41 2.17E-39 9011.91898 -12.71479462 0.83303 -15.263 1.34E-52 9.60E-51 153.633899 -12.00040158 1.32445 -9.0606 1.30E-19 2.61E-18 365.124513 -9.8997164 0.61579 -16.077 3.72E-58 3.43E-56 960.015686 -7.190261378 0.41653 -17.262 9.02E-67 9.68E-65 1166.56321 -6.35337656 0.42485 -14.954 1.46E-50 8.56E-49 249.558379 -6.058328235 0.82922 -7.3061 2.75E-13 3.62E-12 1613.08537 -5.924633877 0.5253 -11.279 1.67E-29 4.90E-28 55.4865352 -5.435106196 0.62009 -8.7651 1.87E-18 3.43E-17 392.51063 -5.224698188 0.42743 -12.223 2.33E-34 7.14E-33 606.008422 -5.031756691 0.62227 -8.0861 6.16E-16 9.67E-15 1498.13109 -5.007075307 0.59534 -8.4105 4.08E-17 7.11E-16 6.35025908 -4.906873173 0.61335 -8.0001 1.24E-15 1.91E-14 72.4712964 -3.089540318 0.43267 -7.1407 9.29E-13 1.20E-11 37.0657383 3.448501454 0.34814 9.90564 3.93E-23 9.05E-22 27.2434436 4.319539176 0.53329 8.09984 5.50E-16 8.86E-15 47.3190579 6.657715629 0.76119 8.74643 2.20E-18 3.94E-17 63.90198 7.469205447 0.74919 9.96972 2.07E-23 4.93E-22 284.742355 9.180479002 0.62943 14.5855 3.47E-48 1.86E-46 87.2345953 9.311220568 1.01989 9.12966 6.87E-20 1.43E-18 221.088842 9.333804846 1.11196 8.39398 4.70E-17 7.96E-16 90.0660872 9.377937973 1.01556 9.23422 2.60E-20 5.59E-19 55.3697881 9.493352041 1.23814 7.66741 1.75E-14 2.51E-13 65.0266327 9.605769277 1.25936 7.62753 2.39E-14 3.35E-13 225.315479 9.610480575 1.17042 8.21116 2.19E-16 3.62E-15 112.721041 9.640907452 1.06744 9.03184 1.69E-19 3.29E-18 209.289022 9.853624968 1.29908 7.58507 3.32E-14 4.55E-13 238.79971 9.877596759 0.79139 12.4813 9.45E-36 3.04E-34 89.4726165 10.124131 1.28361 7.88725 3.09E-15 4.63E-14 125.149174 10.63726696 1.1958 8.8955 5.82E-19 1.10E-17 4800.91064 10.94734516 0.58204 18.8087 6.40E-79 1.03E-76 1065.3343 11.07382442 0.78658 14.0785 5.15E-45 2.21E-43 855.005514 11.11575088 1.00588 11.0508 2.17E-28 6.08E-27 454.272364 11.16703446 0.81606 13.6841 1.26E-42 5.08E-41 1227.76248 11.26177656 0.61775 18.2305 2.96E-74 3.81E-72 5096.31705 11.3081166 0.43838 25.7949 1.01E-146 6.51E-144 4510.38005 11.38444157 0.51469 22.1192 2.07E-108 4.44E-106 2121.19994 11.47115944 0.84572 13.5638 6.57E-42 2.35E-40 1961.31381 11.58085055 1.11734 10.3647 3.59E-25 9.25E-24 831.813796 11.64865032 0.82278 14.1577 1.67E-45 7.70E-44 376.720475 12.10660645 1.25636 9.63629 5.62E-22 1.25E-20 369.705785 12.13338167 1.19923 10.1176 4.62E-24 1.14E-22 4971.66025 12.16564142 0.49053 24.8009 8.77E-136 2.82E-133 1366.34952 12.18680269 0.81082 15.0302 4.65E-51 3.00E-49 953.659542 12.2090529 0.8971 13.6095 3.51E-42 1.33E-40 155.262469 12.32549468 1.65592 7.44328 9.82E-14 1.32E-12 493.484146 12.49380843 1.19716 10.4362 1.69E-25 4.54E-24 177.230022 12.53129476 1.63156 7.68056 1.58E-14 2.32E-13 1750.96922 12.5643851 0.81853 15.3499 3.54E-53 2.85E-51 1481.91319 12.82898307 0.8832 14.5256 8.34E-48 4.13E-46 Page 73 of 230 Diabetes

55.787303 3.092294389 0.43362 7.13137 9.94E-13 1.25E-11 14.513103 5.891885096 0.8359 7.04857 1.81E-12 2.24E-11 88.5138231 11.58253272 1.64435 7.04384 1.87E-12 2.24E-11 15.3878195 6.378189188 0.90566 7.0426 1.89E-12 2.24E-11 89.8023802 11.59834533 1.6474 7.04037 1.92E-12 2.24E-11 1454.34269 -1.684708722 0.2414 -6.979 2.97E-12 3.42E-11 49.2442527 -3.687423058 0.53023 -6.9544 3.54E-12 3.91E-11 53.0291589 9.344437874 1.344 6.95269 3.58E-12 3.91E-11 103.00154 11.73929725 1.68842 6.95284 3.58E-12 3.91E-11 77.78585 11.39672105 1.65446 6.8885 5.64E-12 6.05E-11 188.572988 -3.699620394 0.53778 -6.8794 6.01E-12 6.35E-11 75.6314799 11.36183801 1.65265 6.87492 6.20E-12 6.44E-11 5.23541821 -4.840286666 0.7173 -6.7479 1.50E-11 1.53E-10 23.096753 -10.60547493 1.59461 -6.6508 2.91E-11 2.93E-10 81.1026048 -4.334792004 0.65844 -6.5834 4.60E-11 4.55E-10 46.3073865 10.70077726 1.64951 6.48725 8.74E-11 8.53E-10 14.7534771 -3.827005277 0.59062 -6.4796 9.20E-11 8.84E-10 1329.22295 3.194104661 0.49346 6.4729 9.61E-11 9.10E-10 12.5136934 4.350980014 0.67301 6.46499 1.01E-10 9.45E-10 30.485975 -10.9030527 1.68755 -6.4609 1.04E-10 9.58E-10 1271.87552 1.415782625 0.22164 6.38778 1.68E-10 1.53E-09 54.047043 10.85977148 1.70278 6.37768 1.80E-10 1.61E-09 39.5637916 10.490132 1.64712 6.36876 1.91E-10 1.68E-09 48.0392051 10.71255926 1.69159 6.33283 2.41E-10 2.09E-09 48.7820923 10.72864006 1.69509 6.32924 2.46E-10 2.09E-09 50.7159761 10.774232 1.70241 6.3288 2.47E-10 2.09E-09 517.202605 11.8217336 1.87893 6.29172 3.14E-10 2.63E-09 25.7322631 6.416218759 1.02439 6.26347 3.77E-10 3.11E-09 11.9623417 -4.892801256 0.78326 -6.2468 4.19E-10 3.42E-09 33.8053298 10.27067959 1.655 6.20584 5.44E-10 4.34E-09 16.8320265 -10.14578514 1.63505 -6.2052 5.46E-10 4.34E-09 39.0504771 10.43119898 1.69361 6.15916 7.31E-10 5.74E-09 16.3142153 -8.867926385 1.44039 -6.1566 7.43E-10 5.77E-09 10.2153454 -9.516139069 1.55324 -6.1266 8.98E-10 6.88E-09 23.9812736 -2.357299308 0.38917 -6.0572 1.39E-09 1.05E-08 30.3280227 -10.80457225 1.78414 -6.0559 1.40E-09 1.05E-08 5.74003499 -8.816338185 1.47994 -5.9572 2.57E-09 1.90E-08 11.2399986 -9.608450663 1.6302 -5.894 3.77E-09 2.76E-08 11.6740841 -5.386247882 0.91443 -5.8903 3.86E-09 2.79E-08 12.316016 5.907409256 1.00528 5.87641 4.19E-09 3.00E-08 34.8812705 10.2290817 1.74756 5.85336 4.82E-09 3.41E-08 27.1199114 9.928931178 1.70514 5.82293 5.78E-09 4.03E-08 22.941942 3.121989157 0.53625 5.82185 5.82E-09 4.03E-08 4.68432029 -8.542194746 1.48021 -5.7709 7.88E-09 5.40E-08 75.8832014 -1.910208221 0.33771 -5.6563 1.55E-08 1.05E-07 19.6822834 9.51374289 1.68589 5.64317 1.67E-08 1.12E-07 15.1514603 9.208810518 1.63459 5.6337 1.76E-08 1.16E-07 44.3177026 10.43736139 1.8527 5.6336 1.76E-08 1.16E-07 77.7230267 -2.846633987 0.50788 -5.6049 2.08E-08 1.36E-07 10.7669613 3.86127184 0.68956 5.59963 2.15E-08 1.38E-07 7.86618143 -7.868673693 1.40678 -5.5934 2.23E-08 1.42E-07 8.41536396 -4.678463937 0.83801 -5.5828 2.37E-08 1.49E-07 4.6240773 -7.209121672 1.30869 -5.5086 3.62E-08 2.26E-07 Diabetes Page 74 of 230

3.18856351 -8.050386455 1.46188 -5.5069 3.65E-08 2.26E-07 460.295871 -1.938902527 0.35318 -5.4898 4.02E-08 2.47E-07 9.18240611 -9.284376571 1.69396 -5.4809 4.23E-08 2.57E-07 16.5526138 9.27488072 1.69386 5.4756 4.36E-08 2.62E-07 16.5355789 9.268159059 1.70102 5.44859 5.08E-08 3.03E-07 30.5270276 9.962330796 1.83693 5.42335 5.85E-08 3.46E-07 12.250845 8.902153593 1.64838 5.40055 6.64E-08 3.89E-07 65.2706125 -1.499881571 0.2796 -5.3643 8.13E-08 4.71E-07 11.939181 8.869929195 1.65523 5.35873 8.38E-08 4.82E-07 17.4534443 7.785093527 1.45483 5.35122 8.74E-08 4.98E-07 2.87616459 -7.880850747 1.47462 -5.3443 9.08E-08 5.13E-07 409.265341 -2.711530157 0.51031 -5.3135 1.08E-07 6.02E-07 10.2375834 2.96626909 0.5594 5.30259 1.14E-07 6.34E-07 14.6203507 -4.878573187 0.9224 -5.289 1.23E-07 6.77E-07 11.5211466 8.80975915 1.66956 5.27671 1.32E-07 7.18E-07 4.24492171 3.51420756 0.67346 5.21812 1.81E-07 9.78E-07 12.1391404 6.508560012 1.25073 5.20381 1.95E-07 1.05E-06 84.5761993 -2.888641762 0.55603 -5.1951 2.05E-07 1.09E-06 13.9543742 8.994983503 1.75664 5.12056 3.05E-07 1.61E-06 16.3609148 -1.689529846 0.33143 -5.0976 3.44E-07 1.80E-06 15.0005101 9.062120684 1.78704 5.07103 3.96E-07 2.05E-06 8.56695223 8.407482251 1.65916 5.06732 4.03E-07 2.08E-06 8.75313814 8.437565397 1.66938 5.05431 4.32E-07 2.21E-06 4.41637278 -6.256275403 1.24098 -5.0414 4.62E-07 2.33E-06 8.79298002 8.437546764 1.67375 5.0411 4.63E-07 2.33E-06 13.8708001 4.973453802 0.98962 5.02564 5.02E-07 2.50E-06 62.796296 -1.949290181 0.38955 -5.004 5.62E-07 2.78E-06 5.45840096 -2.369827797 0.47492 -4.99 6.04E-07 2.97E-06 9.18374653 8.463393756 1.70479 4.96448 6.89E-07 3.36E-06 10.816634 8.659375879 1.74875 4.95176 7.35E-07 3.56E-06 5.22175674 5.35594645 1.08458 4.93828 7.88E-07 3.79E-06 21.0876177 9.403763131 1.90661 4.9322 8.13E-07 3.88E-06 9.33419232 8.481827173 1.72029 4.93046 8.20E-07 3.88E-06 5.59485404 6.293989053 1.28326 4.90471 9.36E-07 4.40E-06 7.34321488 8.19182527 1.67218 4.89888 9.64E-07 4.50E-06 5.16053319 4.39870266 0.90267 4.873 1.10E-06 5.09E-06 7.67331622 8.244031934 1.69374 4.86735 1.13E-06 5.20E-06 7.92154093 8.273103164 1.70495 4.85239 1.22E-06 5.57E-06 41.9798746 -9.687395701 1.99726 -4.8503 1.23E-06 5.59E-06 12.052073 8.747555832 1.81061 4.83127 1.36E-06 6.11E-06 23.5636949 -8.999217138 1.87774 -4.7926 1.65E-06 7.36E-06 11.6546181 -2.273999221 0.47464 -4.791 1.66E-06 7.37E-06 1.81227509 -7.217722582 1.51272 -4.7714 1.83E-06 8.02E-06 5.47362133 6.263471154 1.31276 4.77122 1.83E-06 8.02E-06 19.9047857 3.691864829 0.77398 4.76998 1.84E-06 8.02E-06 7.40980418 8.1759614 1.71839 4.75792 1.96E-06 8.45E-06 6.09317071 7.92638457 1.66927 4.7484 2.05E-06 8.80E-06 168.255608 3.445248714 0.72763 4.73487 2.19E-06 9.35E-06 43.0575616 4.343025702 0.91791 4.73143 2.23E-06 9.45E-06 6.2922663 7.970001553 1.70147 4.68419 2.81E-06 1.18E-05 3.69331649 -6.82963856 1.45874 -4.6819 2.84E-06 1.19E-05 6.10474437 7.923035868 1.709 4.63608 3.55E-06 1.48E-05 5.4651692 7.789989013 1.68204 4.63128 3.63E-06 1.50E-05 Page 75 of 230 Diabetes

4.73696305 7.619943087 1.65081 4.61589 3.91E-06 1.60E-05 32.1499472 7.245301702 1.56969 4.61575 3.92E-06 1.60E-05 6.68093204 8.016347209 1.74448 4.59526 4.32E-06 1.75E-05 2.11340155 -7.377333724 1.60674 -4.5915 4.40E-06 1.77E-05 4.47427388 7.540472359 1.64414 4.58627 4.51E-06 1.80E-05 47.4885893 3.690033456 0.8054 4.58162 4.61E-06 1.83E-05 5.90853609 7.869217301 1.72313 4.56682 4.95E-06 1.96E-05 5.52994523 7.784930482 1.71065 4.55086 5.34E-06 2.10E-05 684.348629 2.616321253 0.58199 4.49549 6.94E-06 2.71E-05 22.8956017 9.306481118 2.08847 4.45612 8.35E-06 3.24E-05 4.31527671 7.472230029 1.67745 4.45453 8.41E-06 3.24E-05 4.36541724 -3.619292119 0.82105 -4.4081 1.04E-05 4.00E-05 6.44044147 -5.077628153 1.15514 -4.3957 1.10E-05 4.21E-05 1.31984184 -6.78490832 1.55573 -4.3612 1.29E-05 4.90E-05 20.4783112 -1.47536564 0.34114 -4.3248 1.53E-05 5.75E-05 3.46851093 7.178502933 1.66487 4.31174 1.62E-05 6.06E-05 14.3785605 8.760863841 2.04304 4.28815 1.80E-05 6.71E-05 138.214204 1.805647766 0.42215 4.27731 1.89E-05 7.00E-05 3.48037898 7.153584212 1.67352 4.27456 1.92E-05 7.05E-05 3.94187979 7.32735972 1.716 4.27001 1.95E-05 7.13E-05 2.09136276 -4.319496693 1.01176 -4.2693 1.96E-05 7.13E-05 3511.86755 3.619729049 0.84855 4.26578 1.99E-05 7.21E-05 1.96624878 -5.964851985 1.40953 -4.2318 2.32E-05 8.34E-05 3.1383404 3.648925473 0.86386 4.22396 2.40E-05 8.59E-05 6.55071301 7.879579373 1.88356 4.18335 2.87E-05 0.0001022 2.34505263 -7.40377047 1.77691 -4.1667 3.09E-05 0.0001094 22.7545044 -2.751730389 0.66159 -4.1592 3.19E-05 0.0001121 3.37747974 -7.810533862 1.87819 -4.1585 3.20E-05 0.0001121 73.1628263 -6.014154059 1.44703 -4.1562 3.24E-05 0.0001126 3.50413917 4.76088127 1.14777 4.14793 3.35E-05 0.0001162 2.89833927 6.952942457 1.67697 4.14613 3.38E-05 0.0001165 14.8832878 -3.731537597 0.9029 -4.1328 3.58E-05 0.0001227 3.83638251 5.744973312 1.39071 4.13097 3.61E-05 0.0001231 2.83635301 6.894364993 1.6705 4.12714 3.67E-05 0.0001245 2.82562723 6.881844824 1.67063 4.11931 3.80E-05 0.0001281 2.91238567 6.94798004 1.68891 4.11389 3.89E-05 0.0001305 3.78638521 7.241252014 1.76889 4.09367 4.25E-05 0.0001417 1.00719495 -6.343870703 1.55076 -4.0908 4.30E-05 0.0001427 3.80491917 7.24895493 1.77268 4.08925 4.33E-05 0.0001429 4.32502505 7.388869107 1.81079 4.08046 4.49E-05 0.0001477 2.50403304 6.752481294 1.65883 4.07063 4.69E-05 0.0001533 36.2208236 -4.671919217 1.15229 -4.0545 5.03E-05 0.0001634 2.70286971 6.83820632 1.69115 4.04352 5.27E-05 0.0001704 3.73844536 -1.976353446 0.49004 -4.033 5.51E-05 0.0001773 150.58187 -1.813118782 0.45064 -4.0234 5.74E-05 0.0001838 42.8968726 -1.620667727 0.40855 -3.9669 7.28E-05 0.0002321 2.3432186 6.666421661 1.6816 3.96433 7.36E-05 0.0002335 3.48610412 7.091378563 1.81765 3.9014 9.56E-05 0.0003019 6.53559863 -2.511686807 0.64873 -3.8717 0.0001081 0.0003395 11.8434962 -1.572001647 0.40685 -3.8638 0.0001116 0.000349 2.38448748 6.653976736 1.72281 3.86227 0.0001123 0.0003495 2.94095368 6.879506404 1.79049 3.84225 0.0001219 0.0003775 2.56606264 6.726020446 1.75244 3.83809 0.000124 0.0003821 Diabetes Page 76 of 230

54.1805871 2.950408109 0.77109 3.8263 0.0001301 0.0003989 6.38221347 -1.728575788 0.45203 -3.824 0.0001313 0.0004008 237.477284 -1.361537009 0.35663 -3.8177 0.0001347 0.0004091 2.23023487 6.565029514 1.7203 3.81621 0.0001355 0.0004097 6.69168127 7.771192693 2.03703 3.81496 0.0001362 0.0004099 2.21266842 -4.240926844 1.12005 -3.7864 0.0001529 0.0004579 2.03779978 6.441899153 1.71232 3.76208 0.0001685 0.0005024 923.744922 2.108893128 0.56203 3.75228 0.0001752 0.0005201 3.2251842 6.966422441 1.86106 3.74325 0.0001817 0.0005366 11.1603227 1.692697629 0.45271 3.73903 0.0001847 0.0005432 1.84042184 6.3264388 1.69281 3.73725 0.000186 0.0005446 39.6110793 -4.022055849 1.08578 -3.7043 0.000212 0.0006177 1.90205746 4.801471705 1.30106 3.69044 0.0002239 0.0006494 689.182514 2.250395976 0.61243 3.67452 0.0002383 0.0006882 1.84923721 6.281276809 1.7141 3.66448 0.0002478 0.0007126 4.56540551 -2.923448656 0.79858 -3.6608 0.0002514 0.0007196 1.52113146 6.092588843 1.67631 3.63453 0.0002785 0.0007936 5.89389805 -1.659922102 0.4594 -3.6133 0.0003024 0.0008578 1.75585496 6.215159017 1.72116 3.61103 0.000305 0.0008614 3.50148655 7.007253845 1.94185 3.60854 0.0003079 0.000866 2.21340542 6.506530558 1.80416 3.60641 0.0003105 0.0008693 1.9413849 -5.03645869 1.39799 -3.6026 0.000315 0.0008782 21.5372312 3.329635614 0.92912 3.58363 0.0003389 0.0009406 42.0988243 1.927420459 0.54011 3.56857 0.0003589 0.0009921 1.54968024 6.075744281 1.70841 3.55637 0.000376 0.0010348 1.814479 6.264653612 1.76344 3.55252 0.0003816 0.0010435 1.0720201 -6.337239014 1.78441 -3.5515 0.0003831 0.0010435 1.03758801 -5.170175152 1.45605 -3.5508 0.000384 0.0010435 294.070795 -1.033093398 0.2911 -3.5489 0.0003869 0.0010461 1.45239625 6.010316855 1.69402 3.54796 0.0003882 0.0010461 17.2331407 8.471772522 2.39203 3.54167 0.0003976 0.0010669 2.09424636 6.415561808 1.81281 3.53901 0.0004016 0.0010732 87.6125345 2.931263603 0.83264 3.52046 0.0004308 0.0011418 1.33895564 5.909377672 1.67859 3.52044 0.0004308 0.0011418 2.73336905 5.233957431 1.49982 3.48973 0.0004835 0.0012761 1.10041453 -6.310721819 1.80941 -3.4877 0.0004872 0.0012805 17.0067858 8.394953071 2.4198 3.46927 0.0005219 0.0013662 1.32092878 5.851989454 1.69047 3.46175 0.0005367 0.0013909 4.32032197 -3.916058776 1.13133 -3.4615 0.0005372 0.0013909 1.63621507 6.125464703 1.76976 3.46119 0.0005378 0.0013909 2.33421902 -7.170630451 2.07269 -3.4596 0.000541 0.0013937 265.547521 -4.977446368 1.4396 -3.4575 0.0005452 0.0013988 6.21261979 -1.414453282 0.4104 -3.4465 0.0005679 0.0014458 1.73816829 6.182881515 1.79398 3.44646 0.000568 0.0014458 2.05952294 6.364331275 1.85579 3.42945 0.0006048 0.0015299 20.9466198 3.48328919 1.01583 3.42901 0.0006058 0.0015299 1.66711055 6.130855638 1.79844 3.40899 0.000652 0.0016403 1.6555699 -3.565286776 1.04823 -3.4012 0.0006708 0.001681 1.29105449 5.813172122 1.71326 3.39305 0.0006912 0.0017253 1.3983521 5.910711818 1.74404 3.38909 0.0007013 0.0017437 1.39760173 5.88430526 1.73808 3.38552 0.0007104 0.0017597 1.38402559 5.877932892 1.75473 3.34976 0.0008088 0.0019957 1.09145538 5.608222626 1.67648 3.34524 0.0008221 0.0020208 Page 77 of 230 Diabetes

2.78845611 6.65974487 1.99877 3.33193 0.0008625 0.0021119 96.9527138 -3.479945194 1.05169 -3.3089 0.0009366 0.0022847 1.333192 5.84990496 1.77344 3.29861 0.0009716 0.0023613 1.11034655 5.589040334 1.70244 3.28295 0.0010273 0.0024871 6.65455084 2.514458169 0.76623 3.2816 0.0010322 0.0024896 0.59416804 -5.662085028 1.72917 -3.2745 0.0010586 0.0025439 1.49884398 5.933526592 1.84287 3.21972 0.0012831 0.0030719 222.140608 -3.603487196 1.12238 -3.2106 0.0013247 0.0031598 1.07188959 5.553158425 1.73919 3.19296 0.0014082 0.0033465 2.40050386 3.425607148 1.07568 3.18459 0.0014496 0.0034321 0.54746118 -5.542244859 1.74155 -3.1824 0.0014608 0.0034459 1.56665596 5.994421038 1.8847 3.18058 0.0014698 0.0034546 15.58837 -1.826551038 0.5775 -3.1629 0.0015623 0.0036586 0.47047371 -5.37264421 1.71423 -3.1341 0.0017236 0.0040217 1.50451957 5.892037912 1.888 3.12079 0.0018037 0.0041934 1.45861061 4.390722223 1.41523 3.10248 0.0019191 0.0044456 33.1524229 4.272796108 1.40056 3.05077 0.0022826 0.0052687 3.46164781 -3.360774772 1.10314 -3.0466 0.0023148 0.0053241 2.33856448 6.348930117 2.09552 3.02976 0.0024475 0.0056092 2.29542208 -1.641280825 0.54634 -3.0041 0.0026633 0.0060822 1.95733651 2.366200145 0.7896 2.99671 0.0027291 0.0062051 1.01165733 -2.539744339 0.84774 -2.9959 0.0027364 0.0062051 25.1839993 -2.57241925 0.86117 -2.9871 0.0028162 0.0063636 1.07529505 -6.143996831 2.0633 -2.9777 0.0029038 0.0065182 0.79087788 5.132316227 1.72362 2.97763 0.0029048 0.0065182 0.86182888 5.21928731 1.75895 2.96728 0.0030045 0.0067184 0.77068522 5.132722568 1.73377 2.96044 0.003072 0.0068456 3.95300337 6.828970094 2.31831 2.94567 0.0032226 0.0071563 0.41703791 -5.190928514 1.76743 -2.937 0.0033141 0.0073342 433.523842 -1.74741136 0.59562 -2.9338 0.0033488 0.0073857 2.5882058 2.782777514 0.94948 2.93085 0.0033803 0.0074298 138.189265 3.735933662 1.27862 2.92186 0.0034795 0.0076218 1.8729033 6.080310282 2.08391 2.91774 0.0035258 0.007697 3.08301218 6.576551074 2.25934 2.91083 0.0036047 0.0078426 0.81302279 5.176970704 1.77965 2.90897 0.0036262 0.0078628 0.81680869 5.207230267 1.7942 2.90226 0.0037048 0.0079804 1.10621443 5.509918133 1.89851 2.90223 0.0037052 0.0079804 5.55838979 2.56347857 0.88903 2.88344 0.0039336 0.0084441 9.19492778 -1.419821248 0.4929 -2.8805 0.0039699 0.0084938 6.55897829 -1.094646048 0.38042 -2.8775 0.0040085 0.0085479 0.32868866 -4.915917097 1.72439 -2.8508 0.0043607 0.0092683 0.38278345 -5.059233663 1.7764 -2.848 0.0043991 0.0093191 0.79889791 5.14135963 1.81358 2.83493 0.0045836 0.0096782 1.95989304 3.856586638 1.36368 2.82808 0.0046829 0.0098554 10.0823891 2.839229756 1.00797 2.81677 0.004851 0.0101759 38.4074072 1.132129959 0.40303 2.80905 0.0049688 0.0103893 0.41600814 -5.042733107 1.79824 -2.8043 0.0050431 0.0105106 1.90349756 3.561213912 1.2706 2.80277 0.0050665 0.0105253 0.8321517 -3.311902911 1.18842 -2.7868 0.0053228 0.0110221 1.87847339 -3.273774663 1.1776 -2.78 0.0054351 0.0112187 1.2246135 3.260868529 1.1804 2.7625 0.005736 0.0118019 32.1915055 -1.651268444 0.59941 -2.7548 0.0058723 0.0120439 0.63325971 4.878273013 1.77952 2.74135 0.0061188 0.0124699 Diabetes Page 78 of 230

313.074712 -1.315686601 0.48979 -2.6863 0.0072259 0.0146797 1.2141938 4.030542374 1.50366 2.68049 0.0073515 0.014888 0.56253623 4.707854289 1.75921 2.67613 0.0074479 0.0150358 12.026194 -1.290828722 0.4826 -2.6747 0.007479 0.0150515 11.8029453 -1.498457166 0.56406 -2.6566 0.0078941 0.0158373 0.60239045 4.739974817 1.79122 2.64623 0.0081395 0.0162791 0.53623518 4.627965448 1.75291 2.64017 0.0082865 0.0165218 9.33807338 -3.132189651 1.19083 -2.6303 0.0085321 0.0169588 1.6784292 5.832885955 2.23332 2.61175 0.0090079 0.0178496 0.61992797 4.71955597 1.81297 2.60322 0.0092351 0.0182436 4.30412242 1.496435672 0.57579 2.59891 0.009352 0.018418 1.39425866 -1.934575506 0.74963 -2.5807 0.00986 0.0193004 0.57864521 4.707433552 1.84327 2.55385 0.010654 0.0207287 1.74716521 -2.248331159 0.8817 -2.55 0.0107726 0.0208962 7.00689258 1.329805106 0.52216 2.54674 0.0108736 0.0210288 1.09104563 -4.853615151 1.91438 -2.5353 0.0112338 0.0216603 0.49706163 4.513106397 1.79074 2.52025 0.0117272 0.0225443 13.0589625 1.379491473 0.54987 2.50875 0.0121159 0.0232222 0.4021718 -4.985933501 1.99429 -2.5001 0.0124156 0.023726 0.49714297 -5.148891886 2.06523 -2.4931 0.0126624 0.0241259 0.76240742 4.955603386 2.0117 2.4634 0.0137628 0.0260152 0.52627066 4.541413402 1.8438 2.46307 0.0137751 0.0260152 118.661825 1.115088765 0.45967 2.42586 0.0152721 0.0286741 1.21766587 5.399162291 2.22966 2.42152 0.0154557 0.0289345 1.64096374 -4.66718013 1.92836 -2.4203 0.0155085 0.0289491 0.4727612 -3.692901382 1.53669 -2.4032 0.0162542 0.0302535 0.43024438 -3.821586858 1.59459 -2.3966 0.0165482 0.0307119 0.49921774 -5.009217932 2.10611 -2.3784 0.0173872 0.0321762 754.061954 -3.95517604 1.66492 -2.3756 0.0175204 0.03233 28.5812854 -1.188292422 0.50274 -2.3636 0.0180962 0.0332022 1.05415472 5.25229099 2.22322 2.36247 0.0181536 0.0332128 0.87682307 5.06531216 2.15916 2.34597 0.0189777 0.0346223 59.8451417 1.731384 0.73954 2.34118 0.0192231 0.0349709 0.33792725 -4.744803159 2.04996 -2.3146 0.0206359 0.0374353 0.68071426 -3.511711899 1.52077 -2.3092 0.0209345 0.0378702 0.40882476 4.205886978 1.82849 2.30019 0.0214372 0.0385825 0.6659029 -2.718166255 1.18181 -2.3 0.021448 0.0385825 1.32908398 -3.006515953 1.30925 -2.2964 0.0216547 0.0387819 72.8253901 -2.955380092 1.28722 -2.2959 0.0216793 0.0387819 0.51149152 4.488462808 1.95883 2.2914 0.02194 0.0391395 13.5533006 1.882141945 0.82389 2.28445 0.0223454 0.0397526 0.5186195 4.471471873 1.96215 2.27886 0.0226755 0.0402287 0.59489396 4.6196196 2.03864 2.26603 0.0234493 0.0414872 921.708972 -1.093209033 0.4867 -2.2462 0.024692 0.0435661 427.356648 -5.293086385 2.36353 -2.2395 0.0251245 0.0440254 0.55088454 4.477140397 1.9995 2.23913 0.0251476 0.0440254 1.43853001 5.456539052 2.43788 2.23824 0.0252057 0.0440254 0.49062136 4.3729552 1.95402 2.23793 0.0252257 0.0440254 1.21903151 -1.478184465 0.6649 -2.2232 0.0262041 0.0456093 0.44518919 4.313782333 1.94433 2.21864 0.0265111 0.0460192 0.76901962 4.855104748 2.21656 2.19038 0.0284968 0.049217 Page 79 of 230 Diabetes

Comparison KEGG Pathway WT HFD vs WT NCD ko00010 WT HFD vs WT NCD ko00071 WT HFD vs WT NCD ko00350 WT HFD vs WT NCD ko00625 WT HFD vs WT NCD ko00626 WT HFD vs WT NCD ko00830 WT HFD vs WT NCD ko00980 WT HFD vs WT NCD ko00982 WT HFD vs WT NCD ko01220 WT HFD vs WT NCD ko00260 WT HFD vs WT NCD ko00270 WT HFD vs WT NCD ko00300 WT HFD vs WT NCD ko01230 WT HFD vs WT NCD ko00650 WT HFD vs WT NCD ko00561 WT HFD vs WT NCD ko00640 WT HFD vs WT NCD ko00040 WT HFD vs WT NCD ko00051 WT HFD vs WT NCD ko00521 WT HFD vs WT NCD ko00562 WT HFD vs WT NCD ko00053 WT HFD vs WT NCD ko00500 WT HFD vs WT NCD ko00520 WT HFD vs WT NCD ko00340 WT HFD vs WT NCD ko00400 WT HFD vs WT NCD ko00630 WT HFD vs WT NCD ko00620 WT HFD vs WT NCD ko00680 WT HFD vs WT NCD ko01200 WT HFD vs WT NCD ko00072 WT HFD vs WT NCD ko00280 WT HFD vs WT NCD ko00900 WT HFD vs WT NCD ko04152 WT HFD vs WT NCD ko00020 WT HFD vs WT NCD ko00710 WT HFD vs WT NCD ko00720 WT HFD vs WT NCD ko02020 WT HFD vs WT NCD ko01210 WT HFD vs WT NCD ko00480 WT HFD vs WT NCD ko04146 WT HFD vs WT NCD ko00030 WT HFD vs WT NCD ko00052 WT HFD vs WT NCD ko05230 WT HFD vs WT NCD ko00290 WT HFD vs WT NCD ko00660 WT HFD vs WT NCD ko00770 WT HFD vs WT NCD ko00622 WT HFD vs WT NCD ko00564 WT HFD vs WT NCD ko00061 Diabetes Page 80 of 230

WT HFD vs WT NCD ko00780 WT HFD vs WT NCD ko01040 WT HFD vs WT NCD ko01212 WT HFD vs WT NCD ko00523 WT HFD vs WT NCD ko00230 WT HFD vs WT NCD ko00362 WT HFD vs WT NCD ko00550 WT HFD vs WT NCD ko00740 WT HFD vs WT NCD ko00983 WT HFD vs WT NCD ko00750 WT HFD vs WT NCD ko00363 WT HFD vs WT NCD ko00591 WT HFD vs WT NCD ko00310 WT HFD vs WT NCD ko00330 WT HFD vs WT NCD ko00380 WT HFD vs WT NCD ko00903 WT HFD vs WT NCD ko04066 WT HFD vs WT NCD ko05010 WT HFD vs WT NCD ko00250 WT HFD vs WT NCD ko00627 WT HFD vs WT NCD ko00643 WT HFD vs WT NCD ko00332 WT HFD vs WT NCD ko00633 WT HFD vs WT NCD ko00401 WT HFD vs WT NCD ko00240 WT HFD vs WT NCD ko00190 WT HFD vs WT NCD ko05134 WT HFD vs WT NCD ko00430 WT HFD vs WT NCD ko00910 WT HFD vs WT NCD ko00471 WT HFD vs WT NCD ko04964 WT HFD vs WT NCD ko00311 WT HFD vs WT NCD ko00760 WT HFD vs WT NCD ko00670 WT HFD vs WT NCD ko00790 WT HFD vs WT NCD ko00920 WT HFD vs WT NCD ko00130 WT HFD vs WT NCD ko04918 WT HFD vs WT NCD ko00450 WT HFD vs WT NCD ko00361 WT HFD vs WT NCD ko00621 WT HFD vs WT NCD ko05206 WT HFD vs WT NCD ko04122 WT HFD vs WT NCD ko02030 WT HFD vs WT NCD ko00940 WT HFD vs WT NCD ko00460 WT HFD vs WT NCD ko00970 WT HFD vs WT NCD ko01051 WT HFD vs WT NCD ko00642 WT HFD vs WT NCD ko01501 Page 81 of 230 Diabetes

WT HFD vs WT NCD ko04910 WT HFD vs WT NCD ko00600 WT HFD vs WT NCD ko00510 WT HFD vs WT NCD ko03013 WT HFD vs WT NCD ko00730 WT HFD vs WT NCD ko00908 WT HFD vs WT NCD ko00473 WT HFD vs WT NCD ko00524 WT HFD vs WT NCD ko04930 WT HFD vs WT NCD ko04973 WT HFD vs WT NCD ko03018 WT HFD vs WT NCD ko04622 WT HFD vs WT NCD ko04626 WT HFD vs WT NCD ko05203 WT HFD vs WT NCD ko04070 WT HFD vs WT NCD ko04917 WT HFD vs WT NCD ko01502 WT HFD vs WT NCD ko05152 WT HFD vs WT NCD ko04724 WT HFD vs WT NCD ko03430 WT HFD vs WT NCD ko03410 WT HFD vs WT NCD ko03440 WT HFD vs WT NCD ko00511 WT HFD vs WT NCD ko04141 WT HFD vs WT NCD ko04974 WT HFD vs WT NCD ko04112 WT HFD vs WT NCD ko05150 WT HFD vs WT NCD ko04727 WT HFD vs WT NCD ko05120 WT HFD vs WT NCD ko00120 WT HFD vs WT NCD ko00121 WT HFD vs WT NCD ko05340 WT HFD vs WT NCD ko04940 WT HFD vs WT NCD ko04920 WT HFD vs WT NCD ko05200 WT HFD vs WT NCD ko05211 WT HFD vs WT NCD ko01055 WT HFD vs WT NCD ko01054 WT HFD vs WT NCD ko00253 WT HFD vs WT NCD ko03420 WT HFD vs WT NCD ko03030 WT HFD vs WT NCD ko03010 WT HFD vs WT NCD ko03060 WT HFD vs WT NCD ko02010 WT HFD vs WT NCD ko00195 WT HFD vs WT NCD ko05111 WT HFD vs WT NCD ko05132 WT HFD vs WT NCD ko03070 WT HFD vs WT NCD ko02060 WT HFD vs WT NCD ko05205 Diabetes Page 82 of 230

WT HFD vs WT NCD ko03020 WT HFD vs WT NCD ko03008 WT HFD vs WT NCD ko00603 WT HFD vs WT NCD ko00410 WT HFD vs WT NCD ko00860 WT HFD vs WT NCD ko00960 WT HFD vs WT NCD ko05014 WT HFD vs WT NCD ko00360 WT HFD vs WT NCD ko00440 WT HFD vs WT NCD ko04210 WT HFD vs WT NCD ko02040 WT HFD vs WT NCD ko01053 WT HFD vs WT NCD ko00590 WT HFD vs WT NCD ko00565 WT HFD vs WT NCD ko05231 WT HFD vs WT NCD ko00281 WT HFD vs WT NCD ko04151 WT HFD vs WT NCD ko04612 WT HFD vs WT NCD ko04914 WT HFD vs WT NCD ko04915 WT HFD vs WT NCD ko05215 WT HFD vs WT NCD ko05133 FPR1 HFD vs WT HFD ko00633 FPR1 HFD vs WT HFD ko00531 FPR1 HFD vs WT HFD ko00930 FPR1 HFD vs WT HFD ko00540 FPR1 HFD vs WT HFD ko00604 FPR1 HFD vs WT HFD ko00791 FPR1 HFD vs WT HFD ko00281 FPR1 HFD vs WT HFD ko05014 FPR1 HFD vs WT HFD ko00623 FPR1 HFD vs WT HFD ko05133 FPR1 HFD vs WT HFD ko00510 FPR1 HFD vs WT HFD ko04920 FPR1 HFD vs WT HFD ko04210 FPR1 HFD vs WT HFD ko04974 FPR1 HFD vs WT HFD ko04142 FPR1 HFD vs WT HFD ko04068 FPR1 HFD vs WT HFD ko04011 FPR1 HFD vs WT HFD ko00140 FPR1 HFD vs WT HFD ko00785 FPR1 HFD vs WT HFD ko02030 FPR1 HFD vs WT HFD ko03320 Page 83 of 230 Diabetes

Pathway Description p value Adjusted p value Glycolysis / Gluconeogenesis 0.005340993 0.009065632 Fatty acid degradation 0.005340993 0.009065632 Tyrosine metabolism 0.005340993 0.009065632 Chloroalkane and chloroalkene degradation 0.005340993 0.009065632 Naphthalene degradation 0.005340993 0.009065632 Retinol metabolism 0.003405236 0.009065632 Metabolism of xenobiotics by cytochrome P450 0.003405236 0.009065632 Drug metabolism - cytochrome P450 0.003405236 0.009065632 Degradation of aromatic compounds 0.005340993 0.009065632 Glycine, serine and threonine metabolism 0.005340993 0.009065632 Cysteine and methionine metabolism 0.005340993 0.009065632 Lysine biosynthesis 0.005340993 0.009065632 Biosynthesis of amino acids 0.005340993 0.009065632 Butanoate metabolism 0.005340993 0.009065632 Glycerolipid metabolism 0.005340993 0.009065632 Propanoate metabolism 0.005340993 0.009065632 Pentose and glucuronate interconversions 0.005340993 0.009065632 Fructose and mannose metabolism 0.005340993 0.009065632 Streptomycin biosynthesis 0.005340993 0.009065632 Inositol phosphate metabolism 0.005340993 0.009065632 Ascorbate and aldarate metabolism 0.005340993 0.009065632 Starch and sucrose metabolism 0.005340993 0.009065632 Amino sugar and nucleotide sugar metabolism 0.005340993 0.009065632 Histidine metabolism 0.005340993 0.009065632 Phenylalanine, tyrosine and tryptophan biosynthesis 0.003405236 0.009065632 Glyoxylate and dicarboxylate metabolism 0.005340993 0.009065632 Pyruvate metabolism 0.005340993 0.009065632 Methane metabolism 0.005340993 0.009065632 Carbon metabolism 0.005340993 0.009065632 Synthesis and degradation of ketone bodies 0.005340993 0.009065632 Valine, leucine and isoleucine degradation 0.005340993 0.009065632 Terpenoid backbone biosynthesis 0.005340993 0.009065632 AMPK signaling pathway 0.005340993 0.009065632 Citrate cycle (TCA cycle) 0.005340993 0.009065632 Carbon fixation in photosynthetic organisms 0.005340993 0.009065632 Carbon fixation pathways in prokaryotes 0.005340993 0.009065632 Two-component system 0.005340993 0.009065632 2-Oxocarboxylic acid metabolism 0.005340993 0.009065632 Glutathione metabolism 0.005340993 0.009065632 Peroxisome 0.005340993 0.009065632 Pentose phosphate pathway 0.005340993 0.009065632 Galactose metabolism 0.005340993 0.009065632 Central carbon metabolism in cancer 0.005340993 0.009065632 Valine, leucine and isoleucine biosynthesis 0.005340993 0.009065632 C5-Branched dibasic acid metabolism 0.005340993 0.009065632 Pantothenate and CoA biosynthesis 0.005340993 0.009065632 Xylene degradation 0.005340993 0.009065632 Glycerophospholipid metabolism 0.005340993 0.009065632 Fatty acid biosynthesis 0.005340993 0.009065632 Diabetes Page 84 of 230

Biotin metabolism 0.005340993 0.009065632 Biosynthesis of unsaturated fatty acids 0.005340993 0.009065632 Fatty acid metabolism 0.005340993 0.009065632 Polyketide sugar unit biosynthesis 0.005340993 0.009065632 Purine metabolism 0.005340993 0.009065632 Benzoate degradation 0.005340993 0.009065632 Peptidoglycan biosynthesis 0.005340993 0.009065632 Riboflavin metabolism 0.005340993 0.009065632 Drug metabolism - other enzymes 0.005340993 0.009065632 Vitamin B6 metabolism 0.005340993 0.009065632 Bisphenol degradation 0.005340993 0.009065632 Linoleic acid metabolism 0.005340993 0.009065632 Lysine degradation 0.005340993 0.009065632 Arginine and proline metabolism 0.005340993 0.009065632 Tryptophan metabolism 0.005340993 0.009065632 Limonene and pinene degradation 0.003405236 0.009065632 HIF-1 signaling pathway 0.005340993 0.009065632 Alzheimer's disease 0.005340993 0.009065632 Alanine, aspartate and glutamate metabolism 0.005340993 0.009065632 Aminobenzoate degradation 0.005340993 0.009065632 Styrene degradation 0.003405236 0.009065632 Carbapenem biosynthesis 0.003405236 0.009065632 Nitrotoluene degradation 0.003405236 0.009065632 Novobiocin biosynthesis 0.003405236 0.009065632 Pyrimidine metabolism 0.005340993 0.009065632 Oxidative phosphorylation 0.005340993 0.009065632 Legionellosis 0.005340993 0.009065632 Taurine and hypotaurine metabolism 0.005340993 0.009065632 Nitrogen metabolism 0.005340993 0.009065632 D-Glutamine and D-glutamate metabolism 0.005340993 0.009065632 Proximal tubule bicarbonate reclamation 0.005340993 0.009065632 Penicillin and cephalosporin biosynthesis 0.005340993 0.009065632 Nicotinate and nicotinamide metabolism 0.005340993 0.009065632 One carbon pool by folate 0.005340993 0.009065632 Folate biosynthesis 0.005340993 0.009065632 Sulfur metabolism 0.003405236 0.009065632 Ubiquinone and other terpenoid-quinone biosynthesis 0.005340993 0.009065632 Thyroid hormone synthesis 0.005340993 0.009065632 Selenocompound metabolism 0.005340993 0.009065632 Chlorocyclohexane and chlorobenzene degradation 0.005340993 0.009065632 Dioxin degradation 0.005340993 0.009065632 MicroRNAs in cancer 0.005340993 0.009065632 Sulfur relay system 0.005340993 0.009065632 Bacterial chemotaxis 0.003405236 0.009065632 Phenylpropanoid biosynthesis 0.003405236 0.009065632 Cyanoamino acid metabolism 0.005340993 0.009065632 Aminoacyl-tRNA biosynthesis 0.005340993 0.009065632 Biosynthesis of ansamycins 0.003405236 0.009065632 Ethylbenzene degradation 0.003405236 0.009065632 beta-Lactam resistance 0.005340993 0.009065632 Page 85 of 230 Diabetes

Insulin signaling pathway 0.003405236 0.009065632 Sphingolipid metabolism 0.005340993 0.009065632 N-Glycan biosynthesis 0.003405236 0.009065632 RNA transport 0.005340993 0.009065632 Thiamine metabolism 0.005340993 0.009065632 Zeatin biosynthesis 0.005340993 0.009065632 D-Alanine metabolism 0.005340993 0.009065632 Butirosin and neomycin biosynthesis 0.003405236 0.009065632 Type II diabetes mellitus 0.005340993 0.009065632 Carbohydrate digestion and absorption 0.003405236 0.009065632 RNA degradation 0.005340993 0.009065632 RIG-I-like receptor signaling pathway 0.003361339 0.009065632 Plant-pathogen interaction 0.003405236 0.009065632 Viral carcinogenesis 0.005340993 0.009065632 Phosphatidylinositol signaling system 0.005340993 0.009065632 Prolactin signaling pathway 0.005340993 0.009065632 Vancomycin resistance 0.005340993 0.009065632 Tuberculosis 0.005340993 0.009065632 Glutamatergic synapse 0.005340993 0.009065632 Mismatch repair 0.005340993 0.009065632 Base excision repair 0.005340993 0.009065632 Homologous recombination 0.005340993 0.009065632 Other glycan degradation 0.005340993 0.009065632 Protein processing in endoplasmic reticulum 0.005340993 0.009065632 Protein digestion and absorption 0.003405236 0.009065632 Cell cycle - Caulobacter 0.005340993 0.009065632 Staphylococcus aureus infection 0.005340993 0.009065632 GABAergic synapse 0.005340993 0.009065632 Epithelial cell signaling in Helicobacter pylori infection 0.003405236 0.009065632 Primary bile acid biosynthesis 0.005340993 0.009065632 Secondary bile acid biosynthesis 0.005340993 0.009065632 Primary immunodeficiency 0.005340993 0.009065632 Type I diabetes mellitus 0.005340993 0.009065632 Adipocytokine signaling pathway 0.003405236 0.009065632 Pathways in cancer 0.005340993 0.009065632 Renal cell carcinoma 0.005340993 0.009065632 Biosynthesis of vancomycin group antibiotics 0.005340993 0.009065632 Nonribosomal peptide structures 0.005340993 0.009065632 Tetracycline biosynthesis 0.003405236 0.009065632 Nucleotide excision repair 0.005340993 0.009065632 DNA replication 0.005340993 0.009065632 Ribosome 0.005340993 0.009065632 Protein export 0.005340993 0.009065632 ABC transporters 0.005340993 0.009065632 Photosynthesis 0.005340993 0.009065632 Vibrio cholerae pathogenic cycle 0.005340993 0.009065632 Salmonella infection 0.003405236 0.009065632 Bacterial secretion system 0.005340993 0.009065632 Phosphotransferase system (PTS) 0.005340993 0.009065632 Proteoglycans in cancer 0.005340993 0.009065632 Diabetes Page 86 of 230

RNA polymerase 0.005340993 0.009065632 Ribosome biogenesis in eukaryotes 0.005340993 0.009065632 Glycosphingolipid biosynthesis - globo series 0.005340993 0.009065632 beta-Alanine metabolism 0.008220971 0.013596222 Porphyrin and chlorophyll metabolism 0.008220971 0.013596222 Tropane, piperidine and pyridine alkaloid biosynthesis 0.008220971 0.013596222 Amyotrophic lateral sclerosis (ALS) 0.008220971 0.013596222 Phenylalanine metabolism 0.012419331 0.020026171 Phosphonate and phosphinate metabolism 0.012419331 0.020026171 Apoptosis 0.012419331 0.020026171 Flagellar assembly 0.012419331 0.020026171 Biosynthesis of siderophore group nonribosomal peptides 0.018416161 0.028971765 Arachidonic acid metabolism 0.018416161 0.028971765 Ether lipid metabolism 0.018416161 0.028971765 Choline metabolism in cancer 0.018416161 0.028971765 Geraniol degradation 0.026809131 0.040448864 PI3K-Akt signaling pathway 0.026809131 0.040448864 Antigen processing and presentation 0.026809131 0.040448864 Progesterone-mediated oocyte maturation 0.026809131 0.040448864 Estrogen signaling pathway 0.026809131 0.040448864 Prostate cancer 0.026809131 0.040448864 Pertussis 0.026809131 0.040448864 Nitrotoluene degradation 0.000760306 0.014282888 Glycosaminoglycan degradation 0.000760306 0.014282888 Caprolactam degradation 0.000760306 0.014282888 Lipopolysaccharide biosynthesis 0.000760306 0.014282888 Glycosphingolipid biosynthesis - ganglio series 0.000760306 0.014282888 Atrazine degradation 0.000760306 0.014282888 Geraniol degradation 0.000760306 0.014282888 Amyotrophic lateral sclerosis (ALS) 0.000760306 0.014282888 Toluene degradation 0.000760306 0.014282888 Pertussis 0.000760306 0.014282888 N-Glycan biosynthesis 0.000760306 0.014282888 Adipocytokine signaling pathway 0.000760306 0.014282888 Apoptosis 0.000760306 0.014282888 Protein digestion and absorption 0.000760306 0.014282888 Lysosome 0.001515624 0.02657394 FoxO signaling pathway 0.002915636 0.040358544 MAPK signaling pathway - yeast 0.002915636 0.040358544 Steroid hormone biosynthesis 0.002915636 0.040358544 Lipoic acid metabolism 0.002915636 0.040358544 Bacterial chemotaxis 0.003990583 0.049977295 PPAR signaling pathway 0.003990583 0.049977295 Page 87 of 230 Diabetes

log2FoldChange SD 4.643533544 2.839475831 3.884506012 2.364659857 4.183065591 2.469341659 4.95196712 3.036121338 4.860303261 2.990132147 4.234371803 1.580961207 4.159178991 1.546206503 4.153146168 1.541096652 4.662025501 2.866241416 4.042044423 2.41178847 4.027174457 2.364209667 4.316927249 2.618616316 3.951177509 2.280286739 4.426131409 2.657746814 4.57828261 2.727906071 4.007111996 2.359768745 3.418879692 1.845091292 4.626362958 2.835730326 3.556075276 2.070199928 3.672487344 2.179422338 2.706814143 1.505057432 4.401475681 2.619973526 4.311220963 2.61498015 2.584832755 1.243193733 3.32129431 1.394646682 3.649647453 2.099034639 4.23328915 2.539802289 4.39249583 2.658092514 4.106366091 2.439063044 5.522340291 3.529454108 3.516089874 2.091323954 4.469027484 2.718578509 3.832952499 2.21315664 3.321068233 1.918025495 4.145795822 2.487119106 3.821131618 2.266352816 4.529496927 2.597073411 3.405433776 1.762146751 4.344163332 2.646061187 3.010346023 1.795019522 4.285329486 2.568144463 4.322644461 2.622693535 4.334158956 2.636458771 3.388950671 1.615031172 3.890103326 2.186035825 4.050104928 2.352746657 4.204283424 2.577372664 4.596986247 2.780969237 3.106361682 1.617211012 Diabetes Page 88 of 230

2.995710327 1.412777441 3.808813797 2.169676651 3.175553535 1.659532323 3.523011376 2.076263402 4.29712251 2.59696494 4.774538082 2.885826081 4.496244531 2.725620015 3.379014235 1.810249176 4.231010521 2.557497774 3.309777341 1.90130173 5.491733088 3.344572221 5.567590265 3.435814629 4.144085691 2.515587152 3.501783235 1.948368185 4.59831333 2.749527859 4.467802421 1.518385979 4.724967127 2.875480107 4.560761447 2.74649719 4.010615431 2.401934433 4.593372437 2.730296192 7.320389653 1.499635923 2.91612121 1.135127187 7.108690227 1.180047564 2.724079855 1.168436201 4.427047945 2.693621358 3.916441147 2.331721751 4.304080749 2.565486468 4.304105264 2.617749975 3.209845941 1.667866054 4.395241418 2.700817672 4.059601597 2.529947799 4.745704825 2.981065673 3.797249952 2.261168627 4.086509173 2.451590468 3.185169687 1.788770295 2.987981696 1.283447303 3.775983237 2.18213463 4.609753294 2.800726344 4.302397774 2.564727078 5.276035525 2.677623513 4.249287497 2.602968559 3.82205314 2.154298512 4.399946681 2.62353917 6.157010141 2.852990487 3.726269378 1.085665442 4.045662037 2.243668209 4.763868861 2.923414341 3.338150051 1.120092107 5.596109545 1.749814213 4.007353435 2.36992029 Page 89 of 230 Diabetes

2.826086178 1.280155694 3.129831711 1.823382318 -5.866871318 2.029247686 4.556331818 2.763609482 4.156313568 2.437910586 4.062884543 2.45840998 4.894756094 3.033782335 3.321517635 1.277038424 4.292280779 2.609699044 2.874750625 1.376922699 4.299388231 2.592595456 Inf NA 3.159157192 1.404596276 4.496549859 2.74701738 3.732969911 2.157958481 5.744019286 3.751570167 4.437996419 2.670274146 4.431455167 2.673808344 3.984987781 2.428514325 4.587352329 2.795001534 4.517457082 2.766155709 4.502600912 2.742716314 2.322240352 1.297347017 3.46389964 2.089820363 -6.926166361 1.911271799 4.421485942 2.695626668 5.580008344 3.616701799 3.817582514 2.31153307 2.641742095 1.162300348 4.832338821 3.007450418 4.83253631 3.007602102 4.67337952 2.884404192 4.02847796 2.419508754 -6.352342325 1.888957055 4.310812733 2.638657813 5.552765097 3.67476291 3.458831367 2.038521027 5.824548594 3.91314508 3.413205196 1.278044792 4.545914657 2.785315379 4.51252581 2.756753143 4.488156638 2.749792861 4.378558442 2.661732473 4.826629808 2.901460816 4.661826859 2.818300559 4.34530558 2.598380302 4.602447173 1.435993893 4.271381661 2.587221896 5.785885554 3.805235861 4.589664641 2.804967015 Diabetes Page 90 of 230

4.781906851 2.957827493 4.578349783 2.817604444 2.480605221 1.410097642 2.344649931 1.362271291 2.231793601 1.167626856 2.227868074 1.187284925 -3.442375794 1.842397102 2.201329267 1.31096596 2.168131901 1.399160802 -5.904285348 2.476792326 6.880517853 4.215573697 2.20844029 1.478861728 2.780418439 1.884438898 -2.733605373 1.793691951 2.472258562 1.625802716 -2.967421293 1.886648606 2.388829205 1.892286106 2.390384939 1.892808627 2.390384939 1.892808627 2.390384939 1.892808627 2.390384939 1.892808627 -4.844499887 2.364070408 -4.178666745 1.831611901 2.886859126 1.265470902 3.554753531 2.074768953 3.723190013 1.522063322 4.083476166 1.557383184 4.185320534 1.708656693 4.756147155 1.826573466 5.584930779 1.918515887 7.017102357 1.494233233 7.432873061 1.394584695 7.786283567 1.779148356 8.12809366 1.838152606 8.414750319 2.229619076 8.741568688 1.74986706 2.420211447 1.295051664 1.465715654 1.497165904 1.841331284 1.503217506 1.903255318 1.507251025 2.082509999 1.442195494 -2.076805105 1.279225314 1.50736183 1.14977441 Page 91 of 230 Diabetes

Comparison KEGG Orthology WT HFD vs WT NCD K00001 WT HFD vs WT NCD K00003 WT HFD vs WT NCD K00004 WT HFD vs WT NCD K00009 WT HFD vs WT NCD K00012 WT HFD vs WT NCD K00013 WT HFD vs WT NCD K00014 WT HFD vs WT NCD K00016 WT HFD vs WT NCD K00020 WT HFD vs WT NCD K00027 WT HFD vs WT NCD K00031 WT HFD vs WT NCD K00033 WT HFD vs WT NCD K00036 WT HFD vs WT NCD K00040 WT HFD vs WT NCD K00052 WT HFD vs WT NCD K00053 WT HFD vs WT NCD K00054 WT HFD vs WT NCD K00057 WT HFD vs WT NCD K00058 WT HFD vs WT NCD K00059 WT HFD vs WT NCD K00067 WT HFD vs WT NCD K00075 WT HFD vs WT NCD K00088 WT HFD vs WT NCD K00100 WT HFD vs WT NCD K00111 WT HFD vs WT NCD K00124 WT HFD vs WT NCD K00133 WT HFD vs WT NCD K00134 WT HFD vs WT NCD K00135 WT HFD vs WT NCD K00145 WT HFD vs WT NCD K00147 WT HFD vs WT NCD K00158 WT HFD vs WT NCD K00161 WT HFD vs WT NCD K00162 WT HFD vs WT NCD K00169 WT HFD vs WT NCD K00170 WT HFD vs WT NCD K00172 WT HFD vs WT NCD K00184 WT HFD vs WT NCD K00185 WT HFD vs WT NCD K00215 WT HFD vs WT NCD K00219 WT HFD vs WT NCD K00226 WT HFD vs WT NCD K00240 WT HFD vs WT NCD K00243 WT HFD vs WT NCD K00244 WT HFD vs WT NCD K00245 WT HFD vs WT NCD K00266 WT HFD vs WT NCD K00286 WT HFD vs WT NCD K00287 Diabetes Page 92 of 230

WT HFD vs WT NCD K00297 WT HFD vs WT NCD K00298 WT HFD vs WT NCD K00313 WT HFD vs WT NCD K00364 WT HFD vs WT NCD K00375 WT HFD vs WT NCD K00383 WT HFD vs WT NCD K00384 WT HFD vs WT NCD K00425 WT HFD vs WT NCD K00426 WT HFD vs WT NCD K00525 WT HFD vs WT NCD K00526 WT HFD vs WT NCD K00527 WT HFD vs WT NCD K00537 WT HFD vs WT NCD K00540 WT HFD vs WT NCD K00548 WT HFD vs WT NCD K00549 WT HFD vs WT NCD K00554 WT HFD vs WT NCD K00560 WT HFD vs WT NCD K00561 WT HFD vs WT NCD K00563 WT HFD vs WT NCD K00564 WT HFD vs WT NCD K00566 WT HFD vs WT NCD K00567 WT HFD vs WT NCD K00571 WT HFD vs WT NCD K00574 WT HFD vs WT NCD K00600 WT HFD vs WT NCD K00602 WT HFD vs WT NCD K00604 WT HFD vs WT NCD K00609 WT HFD vs WT NCD K00611 WT HFD vs WT NCD K00613 WT HFD vs WT NCD K00615 WT HFD vs WT NCD K00620 WT HFD vs WT NCD K00625 WT HFD vs WT NCD K00626 WT HFD vs WT NCD K00627 WT HFD vs WT NCD K00640 WT HFD vs WT NCD K00645 WT HFD vs WT NCD K00655 WT HFD vs WT NCD K00657 WT HFD vs WT NCD K00661 WT HFD vs WT NCD K00662 WT HFD vs WT NCD K00674 WT HFD vs WT NCD K00680 WT HFD vs WT NCD K00687 WT HFD vs WT NCD K00688 WT HFD vs WT NCD K00690 WT HFD vs WT NCD K00691 WT HFD vs WT NCD K00692 WT HFD vs WT NCD K00700 Page 93 of 230 Diabetes

WT HFD vs WT NCD K00703 WT HFD vs WT NCD K00705 WT HFD vs WT NCD K00712 WT HFD vs WT NCD K00721 WT HFD vs WT NCD K00754 WT HFD vs WT NCD K00756 WT HFD vs WT NCD K00759 WT HFD vs WT NCD K00760 WT HFD vs WT NCD K00761 WT HFD vs WT NCD K00762 WT HFD vs WT NCD K00763 WT HFD vs WT NCD K00765 WT HFD vs WT NCD K00766 WT HFD vs WT NCD K00773 WT HFD vs WT NCD K00783 WT HFD vs WT NCD K00784 WT HFD vs WT NCD K00786 WT HFD vs WT NCD K00788 WT HFD vs WT NCD K00789 WT HFD vs WT NCD K00790 WT HFD vs WT NCD K00791 WT HFD vs WT NCD K00794 WT HFD vs WT NCD K00798 WT HFD vs WT NCD K00800 WT HFD vs WT NCD K00805 WT HFD vs WT NCD K00806 WT HFD vs WT NCD K00812 WT HFD vs WT NCD K00817 WT HFD vs WT NCD K00820 WT HFD vs WT NCD K00821 WT HFD vs WT NCD K00826 WT HFD vs WT NCD K00831 WT HFD vs WT NCD K00837 WT HFD vs WT NCD K00839 WT HFD vs WT NCD K00841 WT HFD vs WT NCD K00844 WT HFD vs WT NCD K00845 WT HFD vs WT NCD K00847 WT HFD vs WT NCD K00849 WT HFD vs WT NCD K00850 WT HFD vs WT NCD K00851 WT HFD vs WT NCD K00852 WT HFD vs WT NCD K00854 WT HFD vs WT NCD K00857 WT HFD vs WT NCD K00858 WT HFD vs WT NCD K00859 WT HFD vs WT NCD K00863 WT HFD vs WT NCD K00864 WT HFD vs WT NCD K00865 WT HFD vs WT NCD K00867 Diabetes Page 94 of 230

WT HFD vs WT NCD K00868 WT HFD vs WT NCD K00869 WT HFD vs WT NCD K00872 WT HFD vs WT NCD K00873 WT HFD vs WT NCD K00874 WT HFD vs WT NCD K00876 WT HFD vs WT NCD K00878 WT HFD vs WT NCD K00882 WT HFD vs WT NCD K00891 WT HFD vs WT NCD K00897 WT HFD vs WT NCD K00917 WT HFD vs WT NCD K00924 WT HFD vs WT NCD K00925 WT HFD vs WT NCD K00926 WT HFD vs WT NCD K00927 WT HFD vs WT NCD K00928 WT HFD vs WT NCD K00930 WT HFD vs WT NCD K00931 WT HFD vs WT NCD K00936 WT HFD vs WT NCD K00938 WT HFD vs WT NCD K00939 WT HFD vs WT NCD K00941 WT HFD vs WT NCD K00942 WT HFD vs WT NCD K00943 WT HFD vs WT NCD K00945 WT HFD vs WT NCD K00948 WT HFD vs WT NCD K00949 WT HFD vs WT NCD K00951 WT HFD vs WT NCD K00954 WT HFD vs WT NCD K00962 WT HFD vs WT NCD K00963 WT HFD vs WT NCD K00965 WT HFD vs WT NCD K00969 WT HFD vs WT NCD K00970 WT HFD vs WT NCD K00973 WT HFD vs WT NCD K00974 WT HFD vs WT NCD K00975 WT HFD vs WT NCD K00980 WT HFD vs WT NCD K00981 WT HFD vs WT NCD K00995 WT HFD vs WT NCD K00997 WT HFD vs WT NCD K01000 WT HFD vs WT NCD K01008 WT HFD vs WT NCD K01011 WT HFD vs WT NCD K01048 WT HFD vs WT NCD K01056 WT HFD vs WT NCD K01057 WT HFD vs WT NCD K01071 WT HFD vs WT NCD K01081 WT HFD vs WT NCD K01090 Page 95 of 230 Diabetes

WT HFD vs WT NCD K01092 WT HFD vs WT NCD K01101 WT HFD vs WT NCD K01104 WT HFD vs WT NCD K01118 WT HFD vs WT NCD K01119 WT HFD vs WT NCD K01126 WT HFD vs WT NCD K01129 WT HFD vs WT NCD K01142 WT HFD vs WT NCD K01153 WT HFD vs WT NCD K01154 WT HFD vs WT NCD K01156 WT HFD vs WT NCD K01163 WT HFD vs WT NCD K01176 WT HFD vs WT NCD K01179 WT HFD vs WT NCD K01182 WT HFD vs WT NCD K01183 WT HFD vs WT NCD K01187 WT HFD vs WT NCD K01190 WT HFD vs WT NCD K01191 WT HFD vs WT NCD K01193 WT HFD vs WT NCD K01198 WT HFD vs WT NCD K01200 WT HFD vs WT NCD K01201 WT HFD vs WT NCD K01207 WT HFD vs WT NCD K01215 WT HFD vs WT NCD K01216 WT HFD vs WT NCD K01220 WT HFD vs WT NCD K01223 WT HFD vs WT NCD K01226 WT HFD vs WT NCD K01232 WT HFD vs WT NCD K01234 WT HFD vs WT NCD K01239 WT HFD vs WT NCD K01243 WT HFD vs WT NCD K01246 WT HFD vs WT NCD K01250 WT HFD vs WT NCD K01256 WT HFD vs WT NCD K01258 WT HFD vs WT NCD K01259 WT HFD vs WT NCD K01261 WT HFD vs WT NCD K01262 WT HFD vs WT NCD K01263 WT HFD vs WT NCD K01265 WT HFD vs WT NCD K01270 WT HFD vs WT NCD K01271 WT HFD vs WT NCD K01278 WT HFD vs WT NCD K01281 WT HFD vs WT NCD K01297 WT HFD vs WT NCD K01299 WT HFD vs WT NCD K01304 WT HFD vs WT NCD K01338 Diabetes Page 96 of 230

WT HFD vs WT NCD K01356 WT HFD vs WT NCD K01358 WT HFD vs WT NCD K01361 WT HFD vs WT NCD K01372 WT HFD vs WT NCD K01409 WT HFD vs WT NCD K01419 WT HFD vs WT NCD K01420 WT HFD vs WT NCD K01421 WT HFD vs WT NCD K01424 WT HFD vs WT NCD K01425 WT HFD vs WT NCD K01426 WT HFD vs WT NCD K01442 WT HFD vs WT NCD K01443 WT HFD vs WT NCD K01462 WT HFD vs WT NCD K01465 WT HFD vs WT NCD K01467 WT HFD vs WT NCD K01476 WT HFD vs WT NCD K01478 WT HFD vs WT NCD K01482 WT HFD vs WT NCD K01486 WT HFD vs WT NCD K01488 WT HFD vs WT NCD K01489 WT HFD vs WT NCD K01491 WT HFD vs WT NCD K01493 WT HFD vs WT NCD K01512 WT HFD vs WT NCD K01515 WT HFD vs WT NCD K01520 WT HFD vs WT NCD K01524 WT HFD vs WT NCD K01531 WT HFD vs WT NCD K01533 WT HFD vs WT NCD K01534 WT HFD vs WT NCD K01537 WT HFD vs WT NCD K01560 WT HFD vs WT NCD K01567 WT HFD vs WT NCD K01571 WT HFD vs WT NCD K01575 WT HFD vs WT NCD K01577 WT HFD vs WT NCD K01581 WT HFD vs WT NCD K01586 WT HFD vs WT NCD K01588 WT HFD vs WT NCD K01589 WT HFD vs WT NCD K01591 WT HFD vs WT NCD K01595 WT HFD vs WT NCD K01597 WT HFD vs WT NCD K01598 WT HFD vs WT NCD K01607 WT HFD vs WT NCD K01609 WT HFD vs WT NCD K01610 WT HFD vs WT NCD K01611 WT HFD vs WT NCD K01613 Page 97 of 230 Diabetes

WT HFD vs WT NCD K01619 WT HFD vs WT NCD K01621 WT HFD vs WT NCD K01624 WT HFD vs WT NCD K01625 WT HFD vs WT NCD K01626 WT HFD vs WT NCD K01628 WT HFD vs WT NCD K01629 WT HFD vs WT NCD K01635 WT HFD vs WT NCD K01639 WT HFD vs WT NCD K01641 WT HFD vs WT NCD K01643 WT HFD vs WT NCD K01646 WT HFD vs WT NCD K01647 WT HFD vs WT NCD K01649 WT HFD vs WT NCD K01652 WT HFD vs WT NCD K01653 WT HFD vs WT NCD K01657 WT HFD vs WT NCD K01658 WT HFD vs WT NCD K01662 WT HFD vs WT NCD K01664 WT HFD vs WT NCD K01677 WT HFD vs WT NCD K01678 WT HFD vs WT NCD K01679 WT HFD vs WT NCD K01681 WT HFD vs WT NCD K01687 WT HFD vs WT NCD K01689 WT HFD vs WT NCD K01693 WT HFD vs WT NCD K01695 WT HFD vs WT NCD K01696 WT HFD vs WT NCD K01703 WT HFD vs WT NCD K01704 WT HFD vs WT NCD K01710 WT HFD vs WT NCD K01714 WT HFD vs WT NCD K01715 WT HFD vs WT NCD K01733 WT HFD vs WT NCD K01735 WT HFD vs WT NCD K01736 WT HFD vs WT NCD K01738 WT HFD vs WT NCD K01739 WT HFD vs WT NCD K01740 WT HFD vs WT NCD K01744 WT HFD vs WT NCD K01745 WT HFD vs WT NCD K01751 WT HFD vs WT NCD K01752 WT HFD vs WT NCD K01754 WT HFD vs WT NCD K01755 WT HFD vs WT NCD K01756 WT HFD vs WT NCD K01760 WT HFD vs WT NCD K01771 WT HFD vs WT NCD K01772 Diabetes Page 98 of 230

WT HFD vs WT NCD K01775 WT HFD vs WT NCD K01776 WT HFD vs WT NCD K01778 WT HFD vs WT NCD K01779 WT HFD vs WT NCD K01783 WT HFD vs WT NCD K01784 WT HFD vs WT NCD K01785 WT HFD vs WT NCD K01788 WT HFD vs WT NCD K01790 WT HFD vs WT NCD K01791 WT HFD vs WT NCD K01802 WT HFD vs WT NCD K01803 WT HFD vs WT NCD K01807 WT HFD vs WT NCD K01808 WT HFD vs WT NCD K01809 WT HFD vs WT NCD K01810 WT HFD vs WT NCD K01811 WT HFD vs WT NCD K01812 WT HFD vs WT NCD K01813 WT HFD vs WT NCD K01814 WT HFD vs WT NCD K01819 WT HFD vs WT NCD K01821 WT HFD vs WT NCD K01823 WT HFD vs WT NCD K01834 WT HFD vs WT NCD K01835 WT HFD vs WT NCD K01838 WT HFD vs WT NCD K01839 WT HFD vs WT NCD K01854 WT HFD vs WT NCD K01858 WT HFD vs WT NCD K01866 WT HFD vs WT NCD K01867 WT HFD vs WT NCD K01868 WT HFD vs WT NCD K01869 WT HFD vs WT NCD K01870 WT HFD vs WT NCD K01872 WT HFD vs WT NCD K01873 WT HFD vs WT NCD K01874 WT HFD vs WT NCD K01875 WT HFD vs WT NCD K01876 WT HFD vs WT NCD K01878 WT HFD vs WT NCD K01879 WT HFD vs WT NCD K01881 WT HFD vs WT NCD K01883 WT HFD vs WT NCD K01887 WT HFD vs WT NCD K01889 WT HFD vs WT NCD K01890 WT HFD vs WT NCD K01892 WT HFD vs WT NCD K01893 WT HFD vs WT NCD K01897 WT HFD vs WT NCD K01902 Page 99 of 230 Diabetes

WT HFD vs WT NCD K01903 WT HFD vs WT NCD K01910 WT HFD vs WT NCD K01914 WT HFD vs WT NCD K01915 WT HFD vs WT NCD K01916 WT HFD vs WT NCD K01921 WT HFD vs WT NCD K01922 WT HFD vs WT NCD K01923 WT HFD vs WT NCD K01924 WT HFD vs WT NCD K01925 WT HFD vs WT NCD K01926 WT HFD vs WT NCD K01928 WT HFD vs WT NCD K01929 WT HFD vs WT NCD K01934 WT HFD vs WT NCD K01937 WT HFD vs WT NCD K01938 WT HFD vs WT NCD K01939 WT HFD vs WT NCD K01940 WT HFD vs WT NCD K01945 WT HFD vs WT NCD K01951 WT HFD vs WT NCD K01952 WT HFD vs WT NCD K01953 WT HFD vs WT NCD K01955 WT HFD vs WT NCD K01956 WT HFD vs WT NCD K01958 WT HFD vs WT NCD K01962 WT HFD vs WT NCD K01963 WT HFD vs WT NCD K01972 WT HFD vs WT NCD K01975 WT HFD vs WT NCD K01977 WT HFD vs WT NCD K01978 WT HFD vs WT NCD K01980 WT HFD vs WT NCD K01985 WT HFD vs WT NCD K01989 WT HFD vs WT NCD K01990 WT HFD vs WT NCD K01992 WT HFD vs WT NCD K01995 WT HFD vs WT NCD K01996 WT HFD vs WT NCD K01997 WT HFD vs WT NCD K01998 WT HFD vs WT NCD K02003 WT HFD vs WT NCD K02004 WT HFD vs WT NCD K02010 WT HFD vs WT NCD K02011 WT HFD vs WT NCD K02012 WT HFD vs WT NCD K02013 WT HFD vs WT NCD K02015 WT HFD vs WT NCD K02017 WT HFD vs WT NCD K02018 WT HFD vs WT NCD K02020 Diabetes Page 100 of 230

WT HFD vs WT NCD K02025 WT HFD vs WT NCD K02026 WT HFD vs WT NCD K02027 WT HFD vs WT NCD K02028 WT HFD vs WT NCD K02029 WT HFD vs WT NCD K02030 WT HFD vs WT NCD K02031 WT HFD vs WT NCD K02032 WT HFD vs WT NCD K02033 WT HFD vs WT NCD K02034 WT HFD vs WT NCD K02035 WT HFD vs WT NCD K02036 WT HFD vs WT NCD K02037 WT HFD vs WT NCD K02038 WT HFD vs WT NCD K02039 WT HFD vs WT NCD K02040 WT HFD vs WT NCD K02041 WT HFD vs WT NCD K02042 WT HFD vs WT NCD K02044 WT HFD vs WT NCD K02045 WT HFD vs WT NCD K02046 WT HFD vs WT NCD K02047 WT HFD vs WT NCD K02048 WT HFD vs WT NCD K02056 WT HFD vs WT NCD K02057 WT HFD vs WT NCD K02068 WT HFD vs WT NCD K02069 WT HFD vs WT NCD K02071 WT HFD vs WT NCD K02072 WT HFD vs WT NCD K02073 WT HFD vs WT NCD K02074 WT HFD vs WT NCD K02075 WT HFD vs WT NCD K02077 WT HFD vs WT NCD K02078 WT HFD vs WT NCD K02082 WT HFD vs WT NCD K02086 WT HFD vs WT NCD K02108 WT HFD vs WT NCD K02109 WT HFD vs WT NCD K02110 WT HFD vs WT NCD K02111 WT HFD vs WT NCD K02112 WT HFD vs WT NCD K02113 WT HFD vs WT NCD K02114 WT HFD vs WT NCD K02115 WT HFD vs WT NCD K02117 WT HFD vs WT NCD K02121 WT HFD vs WT NCD K02122 WT HFD vs WT NCD K02160 WT HFD vs WT NCD K02193 WT HFD vs WT NCD K02194 Page 101 of 230 Diabetes

WT HFD vs WT NCD K02195 WT HFD vs WT NCD K02197 WT HFD vs WT NCD K02198 WT HFD vs WT NCD K02203 WT HFD vs WT NCD K02221 WT HFD vs WT NCD K02226 WT HFD vs WT NCD K02236 WT HFD vs WT NCD K02237 WT HFD vs WT NCD K02238 WT HFD vs WT NCD K02240 WT HFD vs WT NCD K02242 WT HFD vs WT NCD K02243 WT HFD vs WT NCD K02244 WT HFD vs WT NCD K02245 WT HFD vs WT NCD K02246 WT HFD vs WT NCD K02248 WT HFD vs WT NCD K02279 WT HFD vs WT NCD K02282 WT HFD vs WT NCD K02283 WT HFD vs WT NCD K02313 WT HFD vs WT NCD K02314 WT HFD vs WT NCD K02315 WT HFD vs WT NCD K02316 WT HFD vs WT NCD K02334 WT HFD vs WT NCD K02335 WT HFD vs WT NCD K02337 WT HFD vs WT NCD K02338 WT HFD vs WT NCD K02340 WT HFD vs WT NCD K02341 WT HFD vs WT NCD K02342 WT HFD vs WT NCD K02343 WT HFD vs WT NCD K02346 WT HFD vs WT NCD K02348 WT HFD vs WT NCD K02355 WT HFD vs WT NCD K02356 WT HFD vs WT NCD K02357 WT HFD vs WT NCD K02358 WT HFD vs WT NCD K02363 WT HFD vs WT NCD K02371 WT HFD vs WT NCD K02372 WT HFD vs WT NCD K02417 WT HFD vs WT NCD K02428 WT HFD vs WT NCD K02429 WT HFD vs WT NCD K02433 WT HFD vs WT NCD K02434 WT HFD vs WT NCD K02435 WT HFD vs WT NCD K02437 WT HFD vs WT NCD K02440 WT HFD vs WT NCD K02445 WT HFD vs WT NCD K02469 Diabetes Page 102 of 230

WT HFD vs WT NCD K02470 WT HFD vs WT NCD K02473 WT HFD vs WT NCD K02481 WT HFD vs WT NCD K02484 WT HFD vs WT NCD K02493 WT HFD vs WT NCD K02495 WT HFD vs WT NCD K02500 WT HFD vs WT NCD K02501 WT HFD vs WT NCD K02502 WT HFD vs WT NCD K02503 WT HFD vs WT NCD K02517 WT HFD vs WT NCD K02518 WT HFD vs WT NCD K02519 WT HFD vs WT NCD K02520 WT HFD vs WT NCD K02528 WT HFD vs WT NCD K02529 WT HFD vs WT NCD K02530 WT HFD vs WT NCD K02531 WT HFD vs WT NCD K02548 WT HFD vs WT NCD K02549 WT HFD vs WT NCD K02552 WT HFD vs WT NCD K02556 WT HFD vs WT NCD K02563 WT HFD vs WT NCD K02564 WT HFD vs WT NCD K02567 WT HFD vs WT NCD K02568 WT HFD vs WT NCD K02570 WT HFD vs WT NCD K02573 WT HFD vs WT NCD K02574 WT HFD vs WT NCD K02600 WT HFD vs WT NCD K02601 WT HFD vs WT NCD K02619 WT HFD vs WT NCD K02621 WT HFD vs WT NCD K02622 WT HFD vs WT NCD K02654 WT HFD vs WT NCD K02687 WT HFD vs WT NCD K02744 WT HFD vs WT NCD K02749 WT HFD vs WT NCD K02750 WT HFD vs WT NCD K02755 WT HFD vs WT NCD K02756 WT HFD vs WT NCD K02757 WT HFD vs WT NCD K02759 WT HFD vs WT NCD K02760 WT HFD vs WT NCD K02761 WT HFD vs WT NCD K02768 WT HFD vs WT NCD K02769 WT HFD vs WT NCD K02770 WT HFD vs WT NCD K02773 WT HFD vs WT NCD K02774 Page 103 of 230 Diabetes

WT HFD vs WT NCD K02775 WT HFD vs WT NCD K02777 WT HFD vs WT NCD K02778 WT HFD vs WT NCD K02779 WT HFD vs WT NCD K02781 WT HFD vs WT NCD K02786 WT HFD vs WT NCD K02787 WT HFD vs WT NCD K02788 WT HFD vs WT NCD K02793 WT HFD vs WT NCD K02794 WT HFD vs WT NCD K02795 WT HFD vs WT NCD K02796 WT HFD vs WT NCD K02798 WT HFD vs WT NCD K02799 WT HFD vs WT NCD K02800 WT HFD vs WT NCD K02808 WT HFD vs WT NCD K02809 WT HFD vs WT NCD K02810 WT HFD vs WT NCD K02822 WT HFD vs WT NCD K02823 WT HFD vs WT NCD K02824 WT HFD vs WT NCD K02825 WT HFD vs WT NCD K02834 WT HFD vs WT NCD K02835 WT HFD vs WT NCD K02836 WT HFD vs WT NCD K02837 WT HFD vs WT NCD K02838 WT HFD vs WT NCD K02851 WT HFD vs WT NCD K02859 WT HFD vs WT NCD K02860 WT HFD vs WT NCD K02863 WT HFD vs WT NCD K02864 WT HFD vs WT NCD K02867 WT HFD vs WT NCD K02871 WT HFD vs WT NCD K02874 WT HFD vs WT NCD K02876 WT HFD vs WT NCD K02878 WT HFD vs WT NCD K02879 WT HFD vs WT NCD K02881 WT HFD vs WT NCD K02884 WT HFD vs WT NCD K02886 WT HFD vs WT NCD K02887 WT HFD vs WT NCD K02888 WT HFD vs WT NCD K02890 WT HFD vs WT NCD K02892 WT HFD vs WT NCD K02895 WT HFD vs WT NCD K02897 WT HFD vs WT NCD K02899 WT HFD vs WT NCD K02902 WT HFD vs WT NCD K02904 Diabetes Page 104 of 230

WT HFD vs WT NCD K02906 WT HFD vs WT NCD K02907 WT HFD vs WT NCD K02909 WT HFD vs WT NCD K02911 WT HFD vs WT NCD K02913 WT HFD vs WT NCD K02914 WT HFD vs WT NCD K02916 WT HFD vs WT NCD K02919 WT HFD vs WT NCD K02926 WT HFD vs WT NCD K02931 WT HFD vs WT NCD K02933 WT HFD vs WT NCD K02935 WT HFD vs WT NCD K02939 WT HFD vs WT NCD K02945 WT HFD vs WT NCD K02946 WT HFD vs WT NCD K02948 WT HFD vs WT NCD K02950 WT HFD vs WT NCD K02952 WT HFD vs WT NCD K02954 WT HFD vs WT NCD K02956 WT HFD vs WT NCD K02959 WT HFD vs WT NCD K02961 WT HFD vs WT NCD K02963 WT HFD vs WT NCD K02965 WT HFD vs WT NCD K02967 WT HFD vs WT NCD K02968 WT HFD vs WT NCD K02970 WT HFD vs WT NCD K02982 WT HFD vs WT NCD K02986 WT HFD vs WT NCD K02988 WT HFD vs WT NCD K02990 WT HFD vs WT NCD K02992 WT HFD vs WT NCD K02994 WT HFD vs WT NCD K02996 WT HFD vs WT NCD K03040 WT HFD vs WT NCD K03043 WT HFD vs WT NCD K03046 WT HFD vs WT NCD K03048 WT HFD vs WT NCD K03060 WT HFD vs WT NCD K03070 WT HFD vs WT NCD K03073 WT HFD vs WT NCD K03075 WT HFD vs WT NCD K03076 WT HFD vs WT NCD K03086 WT HFD vs WT NCD K03091 WT HFD vs WT NCD K03095 WT HFD vs WT NCD K03100 WT HFD vs WT NCD K03101 WT HFD vs WT NCD K03106 WT HFD vs WT NCD K03110 Page 105 of 230 Diabetes

WT HFD vs WT NCD K03111 WT HFD vs WT NCD K03146 WT HFD vs WT NCD K03149 WT HFD vs WT NCD K03151 WT HFD vs WT NCD K03152 WT HFD vs WT NCD K03168 WT HFD vs WT NCD K03177 WT HFD vs WT NCD K03183 WT HFD vs WT NCD K03205 WT HFD vs WT NCD K03210 WT HFD vs WT NCD K03215 WT HFD vs WT NCD K03216 WT HFD vs WT NCD K03217 WT HFD vs WT NCD K03218 WT HFD vs WT NCD K03271 WT HFD vs WT NCD K03273 WT HFD vs WT NCD K03282 WT HFD vs WT NCD K03284 WT HFD vs WT NCD K03292 WT HFD vs WT NCD K03293 WT HFD vs WT NCD K03294 WT HFD vs WT NCD K03303 WT HFD vs WT NCD K03305 WT HFD vs WT NCD K03308 WT HFD vs WT NCD K03310 WT HFD vs WT NCD K03311 WT HFD vs WT NCD K03315 WT HFD vs WT NCD K03316 WT HFD vs WT NCD K03319 WT HFD vs WT NCD K03320 WT HFD vs WT NCD K03321 WT HFD vs WT NCD K03322 WT HFD vs WT NCD K03328 WT HFD vs WT NCD K03342 WT HFD vs WT NCD K03346 WT HFD vs WT NCD K03366 WT HFD vs WT NCD K03367 WT HFD vs WT NCD K03402 WT HFD vs WT NCD K03424 WT HFD vs WT NCD K03427 WT HFD vs WT NCD K03429 WT HFD vs WT NCD K03431 WT HFD vs WT NCD K03436 WT HFD vs WT NCD K03437 WT HFD vs WT NCD K03438 WT HFD vs WT NCD K03439 WT HFD vs WT NCD K03442 WT HFD vs WT NCD K03444 WT HFD vs WT NCD K03453 WT HFD vs WT NCD K03455 Diabetes Page 106 of 230

WT HFD vs WT NCD K03465 WT HFD vs WT NCD K03466 WT HFD vs WT NCD K03469 WT HFD vs WT NCD K03470 WT HFD vs WT NCD K03471 WT HFD vs WT NCD K03475 WT HFD vs WT NCD K03481 WT HFD vs WT NCD K03483 WT HFD vs WT NCD K03484 WT HFD vs WT NCD K03486 WT HFD vs WT NCD K03488 WT HFD vs WT NCD K03489 WT HFD vs WT NCD K03492 WT HFD vs WT NCD K03495 WT HFD vs WT NCD K03496 WT HFD vs WT NCD K03497 WT HFD vs WT NCD K03499 WT HFD vs WT NCD K03500 WT HFD vs WT NCD K03501 WT HFD vs WT NCD K03502 WT HFD vs WT NCD K03518 WT HFD vs WT NCD K03521 WT HFD vs WT NCD K03523 WT HFD vs WT NCD K03524 WT HFD vs WT NCD K03525 WT HFD vs WT NCD K03529 WT HFD vs WT NCD K03530 WT HFD vs WT NCD K03531 WT HFD vs WT NCD K03533 WT HFD vs WT NCD K03536 WT HFD vs WT NCD K03544 WT HFD vs WT NCD K03545 WT HFD vs WT NCD K03546 WT HFD vs WT NCD K03547 WT HFD vs WT NCD K03549 WT HFD vs WT NCD K03550 WT HFD vs WT NCD K03551 WT HFD vs WT NCD K03553 WT HFD vs WT NCD K03555 WT HFD vs WT NCD K03558 WT HFD vs WT NCD K03564 WT HFD vs WT NCD K03565 WT HFD vs WT NCD K03569 WT HFD vs WT NCD K03570 WT HFD vs WT NCD K03571 WT HFD vs WT NCD K03572 WT HFD vs WT NCD K03574 WT HFD vs WT NCD K03575 WT HFD vs WT NCD K03581 WT HFD vs WT NCD K03584 Page 107 of 230 Diabetes

WT HFD vs WT NCD K03588 WT HFD vs WT NCD K03589 WT HFD vs WT NCD K03590 WT HFD vs WT NCD K03593 WT HFD vs WT NCD K03595 WT HFD vs WT NCD K03596 WT HFD vs WT NCD K03601 WT HFD vs WT NCD K03602 WT HFD vs WT NCD K03621 WT HFD vs WT NCD K03624 WT HFD vs WT NCD K03625 WT HFD vs WT NCD K03629 WT HFD vs WT NCD K03630 WT HFD vs WT NCD K03631 WT HFD vs WT NCD K03637 WT HFD vs WT NCD K03639 WT HFD vs WT NCD K03646 WT HFD vs WT NCD K03647 WT HFD vs WT NCD K03648 WT HFD vs WT NCD K03650 WT HFD vs WT NCD K03652 WT HFD vs WT NCD K03654 WT HFD vs WT NCD K03655 WT HFD vs WT NCD K03657 WT HFD vs WT NCD K03664 WT HFD vs WT NCD K03665 WT HFD vs WT NCD K03667 WT HFD vs WT NCD K03671 WT HFD vs WT NCD K03685 WT HFD vs WT NCD K03686 WT HFD vs WT NCD K03687 WT HFD vs WT NCD K03693 WT HFD vs WT NCD K03695 WT HFD vs WT NCD K03696 WT HFD vs WT NCD K03697 WT HFD vs WT NCD K03698 WT HFD vs WT NCD K03699 WT HFD vs WT NCD K03700 WT HFD vs WT NCD K03701 WT HFD vs WT NCD K03702 WT HFD vs WT NCD K03703 WT HFD vs WT NCD K03704 WT HFD vs WT NCD K03705 WT HFD vs WT NCD K03706 WT HFD vs WT NCD K03707 WT HFD vs WT NCD K03708 WT HFD vs WT NCD K03709 WT HFD vs WT NCD K03710 WT HFD vs WT NCD K03711 WT HFD vs WT NCD K03713 Diabetes Page 108 of 230

WT HFD vs WT NCD K03718 WT HFD vs WT NCD K03719 WT HFD vs WT NCD K03722 WT HFD vs WT NCD K03723 WT HFD vs WT NCD K03724 WT HFD vs WT NCD K03731 WT HFD vs WT NCD K03733 WT HFD vs WT NCD K03734 WT HFD vs WT NCD K03737 WT HFD vs WT NCD K03739 WT HFD vs WT NCD K03740 WT HFD vs WT NCD K03741 WT HFD vs WT NCD K03742 WT HFD vs WT NCD K03743 WT HFD vs WT NCD K03744 WT HFD vs WT NCD K03758 WT HFD vs WT NCD K03763 WT HFD vs WT NCD K03767 WT HFD vs WT NCD K03768 WT HFD vs WT NCD K03777 WT HFD vs WT NCD K03778 WT HFD vs WT NCD K03784 WT HFD vs WT NCD K03785 WT HFD vs WT NCD K03789 WT HFD vs WT NCD K03790 WT HFD vs WT NCD K03797 WT HFD vs WT NCD K03798 WT HFD vs WT NCD K03799 WT HFD vs WT NCD K03810 WT HFD vs WT NCD K03811 WT HFD vs WT NCD K03816 WT HFD vs WT NCD K03817 WT HFD vs WT NCD K03823 WT HFD vs WT NCD K03826 WT HFD vs WT NCD K03827 WT HFD vs WT NCD K03830 WT HFD vs WT NCD K03885 WT HFD vs WT NCD K03892 WT HFD vs WT NCD K03924 WT HFD vs WT NCD K03925 WT HFD vs WT NCD K03930 WT HFD vs WT NCD K03933 WT HFD vs WT NCD K03975 WT HFD vs WT NCD K03976 WT HFD vs WT NCD K03977 WT HFD vs WT NCD K03978 WT HFD vs WT NCD K03979 WT HFD vs WT NCD K04041 WT HFD vs WT NCD K04042 WT HFD vs WT NCD K04043 Page 109 of 230 Diabetes

WT HFD vs WT NCD K04047 WT HFD vs WT NCD K04063 WT HFD vs WT NCD K04066 WT HFD vs WT NCD K04068 WT HFD vs WT NCD K04070 WT HFD vs WT NCD K04072 WT HFD vs WT NCD K04074 WT HFD vs WT NCD K04075 WT HFD vs WT NCD K04076 WT HFD vs WT NCD K04077 WT HFD vs WT NCD K04078 WT HFD vs WT NCD K04083 WT HFD vs WT NCD K04094 WT HFD vs WT NCD K04095 WT HFD vs WT NCD K04096 WT HFD vs WT NCD K04103 WT HFD vs WT NCD K04477 WT HFD vs WT NCD K04485 WT HFD vs WT NCD K04486 WT HFD vs WT NCD K04487 WT HFD vs WT NCD K04488 WT HFD vs WT NCD K04517 WT HFD vs WT NCD K04567 WT HFD vs WT NCD K04651 WT HFD vs WT NCD K04652 WT HFD vs WT NCD K04750 WT HFD vs WT NCD K04751 WT HFD vs WT NCD K04758 WT HFD vs WT NCD K04759 WT HFD vs WT NCD K04763 WT HFD vs WT NCD K05311 WT HFD vs WT NCD K05337 WT HFD vs WT NCD K05340 WT HFD vs WT NCD K05343 WT HFD vs WT NCD K05349 WT HFD vs WT NCD K05350 WT HFD vs WT NCD K05363 WT HFD vs WT NCD K05366 WT HFD vs WT NCD K05592 WT HFD vs WT NCD K05601 WT HFD vs WT NCD K05780 WT HFD vs WT NCD K05781 WT HFD vs WT NCD K05796 WT HFD vs WT NCD K05800 WT HFD vs WT NCD K05808 WT HFD vs WT NCD K05822 WT HFD vs WT NCD K05823 WT HFD vs WT NCD K05832 WT HFD vs WT NCD K05833 WT HFD vs WT NCD K05837 Diabetes Page 110 of 230

WT HFD vs WT NCD K05845 WT HFD vs WT NCD K05846 WT HFD vs WT NCD K05847 WT HFD vs WT NCD K05878 WT HFD vs WT NCD K05879 WT HFD vs WT NCD K05896 WT HFD vs WT NCD K05910 WT HFD vs WT NCD K05919 WT HFD vs WT NCD K05945 WT HFD vs WT NCD K05946 WT HFD vs WT NCD K05966 WT HFD vs WT NCD K05970 WT HFD vs WT NCD K05985 WT HFD vs WT NCD K06023 WT HFD vs WT NCD K06024 WT HFD vs WT NCD K06131 WT HFD vs WT NCD K06147 WT HFD vs WT NCD K06148 WT HFD vs WT NCD K06153 WT HFD vs WT NCD K06158 WT HFD vs WT NCD K06162 WT HFD vs WT NCD K06163 WT HFD vs WT NCD K06164 WT HFD vs WT NCD K06165 WT HFD vs WT NCD K06166 WT HFD vs WT NCD K06173 WT HFD vs WT NCD K06177 WT HFD vs WT NCD K06178 WT HFD vs WT NCD K06180 WT HFD vs WT NCD K06181 WT HFD vs WT NCD K06183 WT HFD vs WT NCD K06187 WT HFD vs WT NCD K06188 WT HFD vs WT NCD K06191 WT HFD vs WT NCD K06193 WT HFD vs WT NCD K06196 WT HFD vs WT NCD K06198 WT HFD vs WT NCD K06199 WT HFD vs WT NCD K06200 WT HFD vs WT NCD K06201 WT HFD vs WT NCD K06206 WT HFD vs WT NCD K06207 WT HFD vs WT NCD K06215 WT HFD vs WT NCD K06216 WT HFD vs WT NCD K06217 WT HFD vs WT NCD K06286 WT HFD vs WT NCD K06333 WT HFD vs WT NCD K06346 WT HFD vs WT NCD K06442 WT HFD vs WT NCD K06446 Page 111 of 230 Diabetes

WT HFD vs WT NCD K06518 WT HFD vs WT NCD K06610 WT HFD vs WT NCD K06726 WT HFD vs WT NCD K06864 WT HFD vs WT NCD K06871 WT HFD vs WT NCD K06872 WT HFD vs WT NCD K06878 WT HFD vs WT NCD K06881 WT HFD vs WT NCD K06885 WT HFD vs WT NCD K06889 WT HFD vs WT NCD K06890 WT HFD vs WT NCD K06898 WT HFD vs WT NCD K06901 WT HFD vs WT NCD K06904 WT HFD vs WT NCD K06909 WT HFD vs WT NCD K06910 WT HFD vs WT NCD K06919 WT HFD vs WT NCD K06921 WT HFD vs WT NCD K06925 WT HFD vs WT NCD K06929 WT HFD vs WT NCD K06940 WT HFD vs WT NCD K06941 WT HFD vs WT NCD K06942 WT HFD vs WT NCD K06948 WT HFD vs WT NCD K06949 WT HFD vs WT NCD K06950 WT HFD vs WT NCD K06956 WT HFD vs WT NCD K06958 WT HFD vs WT NCD K06959 WT HFD vs WT NCD K06960 WT HFD vs WT NCD K06966 WT HFD vs WT NCD K06967 WT HFD vs WT NCD K06969 WT HFD vs WT NCD K06972 WT HFD vs WT NCD K06973 WT HFD vs WT NCD K06988 WT HFD vs WT NCD K06994 WT HFD vs WT NCD K06997 WT HFD vs WT NCD K07005 WT HFD vs WT NCD K07006 WT HFD vs WT NCD K07007 WT HFD vs WT NCD K07009 WT HFD vs WT NCD K07010 WT HFD vs WT NCD K07012 WT HFD vs WT NCD K07015 WT HFD vs WT NCD K07023 WT HFD vs WT NCD K07024 WT HFD vs WT NCD K07025 WT HFD vs WT NCD K07027 WT HFD vs WT NCD K07029 Diabetes Page 112 of 230

WT HFD vs WT NCD K07030 WT HFD vs WT NCD K07032 WT HFD vs WT NCD K07038 WT HFD vs WT NCD K07040 WT HFD vs WT NCD K07042 WT HFD vs WT NCD K07045 WT HFD vs WT NCD K07050 WT HFD vs WT NCD K07052 WT HFD vs WT NCD K07053 WT HFD vs WT NCD K07056 WT HFD vs WT NCD K07058 WT HFD vs WT NCD K07069 WT HFD vs WT NCD K07079 WT HFD vs WT NCD K07082 WT HFD vs WT NCD K07088 WT HFD vs WT NCD K07090 WT HFD vs WT NCD K07095 WT HFD vs WT NCD K07104 WT HFD vs WT NCD K07105 WT HFD vs WT NCD K07106 WT HFD vs WT NCD K07118 WT HFD vs WT NCD K07124 WT HFD vs WT NCD K07126 WT HFD vs WT NCD K07133 WT HFD vs WT NCD K07137 WT HFD vs WT NCD K07139 WT HFD vs WT NCD K07146 WT HFD vs WT NCD K07147 WT HFD vs WT NCD K07166 WT HFD vs WT NCD K07170 WT HFD vs WT NCD K07171 WT HFD vs WT NCD K07173 WT HFD vs WT NCD K07177 WT HFD vs WT NCD K07185 WT HFD vs WT NCD K07217 WT HFD vs WT NCD K07238 WT HFD vs WT NCD K07240 WT HFD vs WT NCD K07258 WT HFD vs WT NCD K07259 WT HFD vs WT NCD K07260 WT HFD vs WT NCD K07271 WT HFD vs WT NCD K07272 WT HFD vs WT NCD K07284 WT HFD vs WT NCD K07304 WT HFD vs WT NCD K07305 WT HFD vs WT NCD K07306 WT HFD vs WT NCD K07307 WT HFD vs WT NCD K07308 WT HFD vs WT NCD K07309 WT HFD vs WT NCD K07310 Page 113 of 230 Diabetes

WT HFD vs WT NCD K07313 WT HFD vs WT NCD K07316 WT HFD vs WT NCD K07322 WT HFD vs WT NCD K07334 WT HFD vs WT NCD K07335 WT HFD vs WT NCD K07386 WT HFD vs WT NCD K07402 WT HFD vs WT NCD K07404 WT HFD vs WT NCD K07407 WT HFD vs WT NCD K07443 WT HFD vs WT NCD K07444 WT HFD vs WT NCD K07447 WT HFD vs WT NCD K07452 WT HFD vs WT NCD K07456 WT HFD vs WT NCD K07459 WT HFD vs WT NCD K07461 WT HFD vs WT NCD K07462 WT HFD vs WT NCD K07464 WT HFD vs WT NCD K07467 WT HFD vs WT NCD K07473 WT HFD vs WT NCD K07474 WT HFD vs WT NCD K07478 WT HFD vs WT NCD K07482 WT HFD vs WT NCD K07483 WT HFD vs WT NCD K07491 WT HFD vs WT NCD K07493 WT HFD vs WT NCD K07497 WT HFD vs WT NCD K07498 WT HFD vs WT NCD K07507 WT HFD vs WT NCD K07533 WT HFD vs WT NCD K07560 WT HFD vs WT NCD K07566 WT HFD vs WT NCD K07570 WT HFD vs WT NCD K07574 WT HFD vs WT NCD K07584 WT HFD vs WT NCD K07586 WT HFD vs WT NCD K07652 WT HFD vs WT NCD K07658 WT HFD vs WT NCD K07665 WT HFD vs WT NCD K07668 WT HFD vs WT NCD K07706 WT HFD vs WT NCD K07707 WT HFD vs WT NCD K07726 WT HFD vs WT NCD K07727 WT HFD vs WT NCD K07729 WT HFD vs WT NCD K07736 WT HFD vs WT NCD K07738 WT HFD vs WT NCD K07739 WT HFD vs WT NCD K07741 WT HFD vs WT NCD K07742 Diabetes Page 114 of 230

WT HFD vs WT NCD K07749 WT HFD vs WT NCD K07816 WT HFD vs WT NCD K07979 WT HFD vs WT NCD K08151 WT HFD vs WT NCD K08152 WT HFD vs WT NCD K08153 WT HFD vs WT NCD K08161 WT HFD vs WT NCD K08177 WT HFD vs WT NCD K08217 WT HFD vs WT NCD K08234 WT HFD vs WT NCD K08289 WT HFD vs WT NCD K08303 WT HFD vs WT NCD K08311 WT HFD vs WT NCD K08315 WT HFD vs WT NCD K08316 WT HFD vs WT NCD K08317 WT HFD vs WT NCD K08321 WT HFD vs WT NCD K08352 WT HFD vs WT NCD K08368 WT HFD vs WT NCD K08483 WT HFD vs WT NCD K08590 WT HFD vs WT NCD K08591 WT HFD vs WT NCD K08600 WT HFD vs WT NCD K08602 WT HFD vs WT NCD K08641 WT HFD vs WT NCD K08659 WT HFD vs WT NCD K08680 WT HFD vs WT NCD K08681 WT HFD vs WT NCD K08724 WT HFD vs WT NCD K08728 WT HFD vs WT NCD K08884 WT HFD vs WT NCD K08963 WT HFD vs WT NCD K08978 WT HFD vs WT NCD K08987 WT HFD vs WT NCD K08996 WT HFD vs WT NCD K08998 WT HFD vs WT NCD K09013 WT HFD vs WT NCD K09014 WT HFD vs WT NCD K09015 WT HFD vs WT NCD K09116 WT HFD vs WT NCD K09117 WT HFD vs WT NCD K09121 WT HFD vs WT NCD K09125 WT HFD vs WT NCD K09134 WT HFD vs WT NCD K09138 WT HFD vs WT NCD K09153 WT HFD vs WT NCD K09155 WT HFD vs WT NCD K09157 WT HFD vs WT NCD K09384 WT HFD vs WT NCD K09458 Page 115 of 230 Diabetes

WT HFD vs WT NCD K09469 WT HFD vs WT NCD K09680 WT HFD vs WT NCD K09685 WT HFD vs WT NCD K09692 WT HFD vs WT NCD K09693 WT HFD vs WT NCD K09698 WT HFD vs WT NCD K09704 WT HFD vs WT NCD K09710 WT HFD vs WT NCD K09747 WT HFD vs WT NCD K09748 WT HFD vs WT NCD K09762 WT HFD vs WT NCD K09765 WT HFD vs WT NCD K09767 WT HFD vs WT NCD K09772 WT HFD vs WT NCD K09773 WT HFD vs WT NCD K09775 WT HFD vs WT NCD K09779 WT HFD vs WT NCD K09787 WT HFD vs WT NCD K09799 WT HFD vs WT NCD K09809 WT HFD vs WT NCD K09811 WT HFD vs WT NCD K09812 WT HFD vs WT NCD K09861 WT HFD vs WT NCD K09903 WT HFD vs WT NCD K09927 WT HFD vs WT NCD K09936 WT HFD vs WT NCD K09952 WT HFD vs WT NCD K09962 WT HFD vs WT NCD K09963 WT HFD vs WT NCD K09976 WT HFD vs WT NCD K10039 WT HFD vs WT NCD K10040 WT HFD vs WT NCD K10041 WT HFD vs WT NCD K10112 WT HFD vs WT NCD K10117 WT HFD vs WT NCD K10254 WT HFD vs WT NCD K10353 WT HFD vs WT NCD K10439 WT HFD vs WT NCD K10440 WT HFD vs WT NCD K10441 WT HFD vs WT NCD K10536 WT HFD vs WT NCD K10563 WT HFD vs WT NCD K10716 WT HFD vs WT NCD K10773 WT HFD vs WT NCD K10823 WT HFD vs WT NCD K10907 WT HFD vs WT NCD K10947 WT HFD vs WT NCD K11041 WT HFD vs WT NCD K11050 WT HFD vs WT NCD K11051 Diabetes Page 116 of 230

WT HFD vs WT NCD K11065 WT HFD vs WT NCD K11068 WT HFD vs WT NCD K11069 WT HFD vs WT NCD K11070 WT HFD vs WT NCD K11071 WT HFD vs WT NCD K11072 WT HFD vs WT NCD K11144 WT HFD vs WT NCD K11145 WT HFD vs WT NCD K11175 WT HFD vs WT NCD K11189 WT HFD vs WT NCD K11358 WT HFD vs WT NCD K11381 WT HFD vs WT NCD K11617 WT HFD vs WT NCD K11704 WT HFD vs WT NCD K11705 WT HFD vs WT NCD K11706 WT HFD vs WT NCD K11717 WT HFD vs WT NCD K11733 WT HFD vs WT NCD K11741 WT HFD vs WT NCD K11749 WT HFD vs WT NCD K11752 WT HFD vs WT NCD K11753 WT HFD vs WT NCD K11754 WT HFD vs WT NCD K11755 WT HFD vs WT NCD K11928 WT HFD vs WT NCD K11991 WT HFD vs WT NCD K12136 WT HFD vs WT NCD K12138 WT HFD vs WT NCD K12143 WT HFD vs WT NCD K12267 WT HFD vs WT NCD K12268 WT HFD vs WT NCD K12269 WT HFD vs WT NCD K12270 WT HFD vs WT NCD K12296 WT HFD vs WT NCD K12297 WT HFD vs WT NCD K12308 WT HFD vs WT NCD K12410 WT HFD vs WT NCD K12452 WT HFD vs WT NCD K12454 WT HFD vs WT NCD K12507 WT HFD vs WT NCD K12510 WT HFD vs WT NCD K12511 WT HFD vs WT NCD K12555 WT HFD vs WT NCD K12556 WT HFD vs WT NCD K12573 WT HFD vs WT NCD K12574 WT HFD vs WT NCD K12700 WT HFD vs WT NCD K12942 WT HFD vs WT NCD K12960 WT HFD vs WT NCD K12996 Page 117 of 230 Diabetes

WT HFD vs WT NCD K12997 WT HFD vs WT NCD K13001 WT HFD vs WT NCD K13018 WT HFD vs WT NCD K13038 WT HFD vs WT NCD K13051 WT HFD vs WT NCD K13052 WT HFD vs WT NCD K13252 WT HFD vs WT NCD K13256 WT HFD vs WT NCD K13280 WT HFD vs WT NCD K13292 WT HFD vs WT NCD K13530 WT HFD vs WT NCD K13531 WT HFD vs WT NCD K13653 WT HFD vs WT NCD K13678 WT HFD vs WT NCD K13727 WT HFD vs WT NCD K13789 WT HFD vs WT NCD K13953 WT HFD vs WT NCD K13993 WT HFD vs WT NCD K14088 WT HFD vs WT NCD K14155 WT HFD vs WT NCD K14170 WT HFD vs WT NCD K14188 WT HFD vs WT NCD K14189 WT HFD vs WT NCD K14218 WT HFD vs WT NCD K14219 WT HFD vs WT NCD K14220 WT HFD vs WT NCD K14221 WT HFD vs WT NCD K14222 WT HFD vs WT NCD K14223 WT HFD vs WT NCD K14224 WT HFD vs WT NCD K14225 WT HFD vs WT NCD K14226 WT HFD vs WT NCD K14227 WT HFD vs WT NCD K14228 WT HFD vs WT NCD K14229 WT HFD vs WT NCD K14230 WT HFD vs WT NCD K14231 WT HFD vs WT NCD K14232 WT HFD vs WT NCD K14233 WT HFD vs WT NCD K14234 WT HFD vs WT NCD K14235 WT HFD vs WT NCD K14236 WT HFD vs WT NCD K14237 WT HFD vs WT NCD K14260 WT HFD vs WT NCD K14392 WT HFD vs WT NCD K14540 WT HFD vs WT NCD K14623 WT HFD vs WT NCD K14652 WT HFD vs WT NCD K14982 WT HFD vs WT NCD K15035 Diabetes Page 118 of 230

WT HFD vs WT NCD K15051 WT HFD vs WT NCD K15531 WT HFD vs WT NCD K15580 WT HFD vs WT NCD K15581 WT HFD vs WT NCD K15582 WT HFD vs WT NCD K15583 WT HFD vs WT NCD K15634 WT HFD vs WT NCD K15669 WT HFD vs WT NCD K15738 WT HFD vs WT NCD K15770 WT HFD vs WT NCD K15771 WT HFD vs WT NCD K15772 WT HFD vs WT NCD K15773 WT HFD vs WT NCD K15830 WT HFD vs WT NCD K15876 WT HFD vs WT NCD K15986 WT HFD vs WT NCD K16012 WT HFD vs WT NCD K16013 WT HFD vs WT NCD K16137 WT HFD vs WT NCD K16169 WT HFD vs WT NCD K16209 WT HFD vs WT NCD K16210 WT HFD vs WT NCD K16211 WT HFD vs WT NCD K16214 WT HFD vs WT NCD K16264 WT HFD vs WT NCD K16435 WT HFD vs WT NCD K16509 WT HFD vs WT NCD K16511 WT HFD vs WT NCD K16785 WT HFD vs WT NCD K16786 WT HFD vs WT NCD K16787 WT HFD vs WT NCD K16788 WT HFD vs WT NCD K16789 WT HFD vs WT NCD K16898 WT HFD vs WT NCD K16899 WT HFD vs WT NCD K16923 WT HFD vs WT NCD K16924 WT HFD vs WT NCD K16925 WT HFD vs WT NCD K17073 WT HFD vs WT NCD K17074 WT HFD vs WT NCD K17076 WT HFD vs WT NCD K17318 WT HFD vs WT NCD K17319 WT HFD vs WT NCD K17320 WT HFD vs WT NCD K17677 WT HFD vs WT NCD K17686 WT HFD vs WT NCD K17810 WT HFD vs WT NCD K17828 WT HFD vs WT NCD K17836 WT HFD vs WT NCD K17992 Page 119 of 230 Diabetes

WT HFD vs WT NCD K18104 WT HFD vs WT NCD K18330 WT HFD vs WT NCD K18331 WT HFD vs WT NCD K18332 WT HFD vs WT NCD K18349 WT HFD vs WT NCD K18672 WT HFD vs WT NCD K18682 WT HFD vs WT NCD K18692 WT HFD vs WT NCD K18702 WT HFD vs WT NCD K18704 WT HFD vs WT NCD K18830 WT HFD vs WT NCD K06897 WT HFD vs WT NCD K16698 WT HFD vs WT NCD K00968 WT HFD vs WT NCD K16927 WT HFD vs WT NCD K18350 WT HFD vs WT NCD K08679 WT HFD vs WT NCD K12992 WT HFD vs WT NCD K17103 WT HFD vs WT NCD K00123 WT HFD vs WT NCD K00131 WT HFD vs WT NCD K00171 WT HFD vs WT NCD K00265 WT HFD vs WT NCD K00558 WT HFD vs WT NCD K00575 WT HFD vs WT NCD K00603 WT HFD vs WT NCD K00616 WT HFD vs WT NCD K00638 WT HFD vs WT NCD K00648 WT HFD vs WT NCD K00656 WT HFD vs WT NCD K00764 WT HFD vs WT NCD K00848 WT HFD vs WT NCD K00978 WT HFD vs WT NCD K00991 WT HFD vs WT NCD K01041 WT HFD vs WT NCD K01091 WT HFD vs WT NCD K01144 WT HFD vs WT NCD K01151 WT HFD vs WT NCD K01173 WT HFD vs WT NCD K01186 WT HFD vs WT NCD K01205 WT HFD vs WT NCD K01267 WT HFD vs WT NCD K01277 WT HFD vs WT NCD K01470 WT HFD vs WT NCD K01507 WT HFD vs WT NCD K01620 WT HFD vs WT NCD K01787 WT HFD vs WT NCD K01885 WT HFD vs WT NCD K01999 WT HFD vs WT NCD K02016 Diabetes Page 120 of 230

WT HFD vs WT NCD K02019 WT HFD vs WT NCD K02049 WT HFD vs WT NCD K02050 WT HFD vs WT NCD K02058 WT HFD vs WT NCD K02278 WT HFD vs WT NCD K02398 WT HFD vs WT NCD K02400 WT HFD vs WT NCD K02412 WT HFD vs WT NCD K02420 WT HFD vs WT NCD K02422 WT HFD vs WT NCD K02438 WT HFD vs WT NCD K02474 WT HFD vs WT NCD K02803 WT HFD vs WT NCD K02804 WT HFD vs WT NCD K03092 WT HFD vs WT NCD K03147 WT HFD vs WT NCD K03407 WT HFD vs WT NCD K03412 WT HFD vs WT NCD K03413 WT HFD vs WT NCD K03522 WT HFD vs WT NCD K03606 WT HFD vs WT NCD K03608 WT HFD vs WT NCD K03609 WT HFD vs WT NCD K03610 WT HFD vs WT NCD K03614 WT HFD vs WT NCD K03628 WT HFD vs WT NCD K03781 WT HFD vs WT NCD K04069 WT HFD vs WT NCD K05367 WT HFD vs WT NCD K05995 WT HFD vs WT NCD K06133 WT HFD vs WT NCD K06168 WT HFD vs WT NCD K06334 WT HFD vs WT NCD K06999 WT HFD vs WT NCD K07031 WT HFD vs WT NCD K07078 WT HFD vs WT NCD K07080 WT HFD vs WT NCD K07114 WT HFD vs WT NCD K07175 WT HFD vs WT NCD K07257 WT HFD vs WT NCD K07504 WT HFD vs WT NCD K07699 WT HFD vs WT NCD K07813 WT HFD vs WT NCD K07862 WT HFD vs WT NCD K08138 WT HFD vs WT NCD K08325 WT HFD vs WT NCD K08676 WT HFD vs WT NCD K08986 WT HFD vs WT NCD K09768 WT HFD vs WT NCD K09815 Page 121 of 230 Diabetes

WT HFD vs WT NCD K09922 WT HFD vs WT NCD K10119 WT HFD vs WT NCD K10206 WT HFD vs WT NCD K11031 WT HFD vs WT NCD K11690 WT HFD vs WT NCD K12257 WT HFD vs WT NCD K13043 WT HFD vs WT NCD K14761 WT HFD vs WT NCD K15635 WT HFD vs WT NCD K15725 WT HFD vs WT NCD K15727 WT HFD vs WT NCD K16053 WT HFD vs WT NCD K16055 WT HFD vs WT NCD K16363 WT HFD vs WT NCD K16936 WT HFD vs WT NCD K17218 WT HFD vs WT NCD K17723 WT HFD vs WT NCD K18369 WT HFD vs WT NCD K18707 WT HFD vs WT NCD K02475 WT HFD vs WT NCD K02476 WT HFD vs WT NCD K09703 WT HFD vs WT NCD K06404 WT HFD vs WT NCD K07502 WT HFD vs WT NCD K11184 WT HFD vs WT NCD K00428 WT HFD vs WT NCD K06182 WT HFD vs WT NCD K16937 WT HFD vs WT NCD K07403 WT HFD vs WT NCD K00010 WT HFD vs WT NCD K00029 WT HFD vs WT NCD K00346 WT HFD vs WT NCD K00347 WT HFD vs WT NCD K00348 WT HFD vs WT NCD K00349 WT HFD vs WT NCD K00350 WT HFD vs WT NCD K00351 WT HFD vs WT NCD K00573 WT HFD vs WT NCD K00633 WT HFD vs WT NCD K00895 WT HFD vs WT NCD K01012 WT HFD vs WT NCD K01197 WT HFD vs WT NCD K01284 WT HFD vs WT NCD K01843 WT HFD vs WT NCD K01847 WT HFD vs WT NCD K01950 WT HFD vs WT NCD K01966 WT HFD vs WT NCD K01991 WT HFD vs WT NCD K01993 WT HFD vs WT NCD K02022 Diabetes Page 122 of 230

WT HFD vs WT NCD K02230 WT HFD vs WT NCD K02387 WT HFD vs WT NCD K02388 WT HFD vs WT NCD K02389 WT HFD vs WT NCD K02390 WT HFD vs WT NCD K02395 WT HFD vs WT NCD K02397 WT HFD vs WT NCD K02404 WT HFD vs WT NCD K02408 WT HFD vs WT NCD K02409 WT HFD vs WT NCD K02410 WT HFD vs WT NCD K02414 WT HFD vs WT NCD K02416 WT HFD vs WT NCD K02419 WT HFD vs WT NCD K02443 WT HFD vs WT NCD K02589 WT HFD vs WT NCD K02590 WT HFD vs WT NCD K03324 WT HFD vs WT NCD K03327 WT HFD vs WT NCD K03408 WT HFD vs WT NCD K03411 WT HFD vs WT NCD K03430 WT HFD vs WT NCD K03446 WT HFD vs WT NCD K03498 WT HFD vs WT NCD K03543 WT HFD vs WT NCD K03585 WT HFD vs WT NCD K03594 WT HFD vs WT NCD K03773 WT HFD vs WT NCD K03779 WT HFD vs WT NCD K03780 WT HFD vs WT NCD K03803 WT HFD vs WT NCD K03814 WT HFD vs WT NCD K03839 WT HFD vs WT NCD K03856 WT HFD vs WT NCD K03929 WT HFD vs WT NCD K04045 WT HFD vs WT NCD K04562 WT HFD vs WT NCD K04653 WT HFD vs WT NCD K04654 WT HFD vs WT NCD K04655 WT HFD vs WT NCD K04656 WT HFD vs WT NCD K05306 WT HFD vs WT NCD K05776 WT HFD vs WT NCD K05795 WT HFD vs WT NCD K05801 WT HFD vs WT NCD K06179 WT HFD vs WT NCD K06209 WT HFD vs WT NCD K06310 WT HFD vs WT NCD K06317 WT HFD vs WT NCD K06381 Page 123 of 230 Diabetes

WT HFD vs WT NCD K06395 WT HFD vs WT NCD K06396 WT HFD vs WT NCD K06405 WT HFD vs WT NCD K06409 WT HFD vs WT NCD K06411 WT HFD vs WT NCD K06412 WT HFD vs WT NCD K06859 WT HFD vs WT NCD K06894 WT HFD vs WT NCD K06896 WT HFD vs WT NCD K06923 WT HFD vs WT NCD K06996 WT HFD vs WT NCD K07138 WT HFD vs WT NCD K07181 WT HFD vs WT NCD K07263 WT HFD vs WT NCD K07568 WT HFD vs WT NCD K07576 WT HFD vs WT NCD K07588 WT HFD vs WT NCD K07718 WT HFD vs WT NCD K07720 WT HFD vs WT NCD K07722 WT HFD vs WT NCD K08169 WT HFD vs WT NCD K08218 WT HFD vs WT NCD K08223 WT HFD vs WT NCD K09002 WT HFD vs WT NCD K09696 WT HFD vs WT NCD K09697 WT HFD vs WT NCD K09706 WT HFD vs WT NCD K09766 WT HFD vs WT NCD K09789 WT HFD vs WT NCD K09808 WT HFD vs WT NCD K09810 WT HFD vs WT NCD K10188 WT HFD vs WT NCD K10189 WT HFD vs WT NCD K10190 WT HFD vs WT NCD K10540 WT HFD vs WT NCD K10541 WT HFD vs WT NCD K10542 WT HFD vs WT NCD K10797 WT HFD vs WT NCD K11104 WT HFD vs WT NCD K11618 WT HFD vs WT NCD K11782 WT HFD vs WT NCD K11785 WT HFD vs WT NCD K12340 WT HFD vs WT NCD K13378 WT HFD vs WT NCD K13747 WT HFD vs WT NCD K15726 WT HFD vs WT NCD K15923 WT HFD vs WT NCD K16089 WT HFD vs WT NCD K16092 WT HFD vs WT NCD K16345 Diabetes Page 124 of 230

WT HFD vs WT NCD K16692 WT HFD vs WT NCD K17234 WT HFD vs WT NCD K17235 WT HFD vs WT NCD K17236 WT HFD vs WT NCD K18138 WT HFD vs WT NCD K18234 WT HFD vs WT NCD K18285 WT HFD vs WT NCD K18640 WT HFD vs WT NCD K11784 WT HFD vs WT NCD K00433 WT HFD vs WT NCD K02651 WT HFD vs WT NCD K07003 WT HFD vs WT NCD K12527 WT HFD vs WT NCD K03605 FPR1 HFD vs WT HFD K00005 FPR1 HFD vs WT HFD K00010 FPR1 HFD vs WT HFD K00024 FPR1 HFD vs WT HFD K00029 FPR1 HFD vs WT HFD K00055 FPR1 HFD vs WT HFD K00086 FPR1 HFD vs WT HFD K00097 FPR1 HFD vs WT HFD K00156 FPR1 HFD vs WT HFD K00174 FPR1 HFD vs WT HFD K00175 FPR1 HFD vs WT HFD K00176 FPR1 HFD vs WT HFD K00177 FPR1 HFD vs WT HFD K00210 FPR1 HFD vs WT HFD K00231 FPR1 HFD vs WT HFD K00239 FPR1 HFD vs WT HFD K00240 FPR1 HFD vs WT HFD K00241 FPR1 HFD vs WT HFD K00254 FPR1 HFD vs WT HFD K00257 FPR1 HFD vs WT HFD K00259 FPR1 HFD vs WT HFD K00275 FPR1 HFD vs WT HFD K00281 FPR1 HFD vs WT HFD K00330 FPR1 HFD vs WT HFD K00331 FPR1 HFD vs WT HFD K00337 FPR1 HFD vs WT HFD K00338 FPR1 HFD vs WT HFD K00339 FPR1 HFD vs WT HFD K00340 FPR1 HFD vs WT HFD K00341 FPR1 HFD vs WT HFD K00342 FPR1 HFD vs WT HFD K00343 FPR1 HFD vs WT HFD K00346 FPR1 HFD vs WT HFD K00347 FPR1 HFD vs WT HFD K00348 FPR1 HFD vs WT HFD K00349 FPR1 HFD vs WT HFD K00350 Page 125 of 230 Diabetes

FPR1 HFD vs WT HFD K00351 FPR1 HFD vs WT HFD K00370 FPR1 HFD vs WT HFD K00371 FPR1 HFD vs WT HFD K00373 FPR1 HFD vs WT HFD K00374 FPR1 HFD vs WT HFD K00375 FPR1 HFD vs WT HFD K00389 FPR1 HFD vs WT HFD K00428 FPR1 HFD vs WT HFD K00547 FPR1 HFD vs WT HFD K00556 FPR1 HFD vs WT HFD K00573 FPR1 HFD vs WT HFD K00603 FPR1 HFD vs WT HFD K00605 FPR1 HFD vs WT HFD K00633 FPR1 HFD vs WT HFD K00634 FPR1 HFD vs WT HFD K00638 FPR1 HFD vs WT HFD K00639 FPR1 HFD vs WT HFD K00641 FPR1 HFD vs WT HFD K00647 FPR1 HFD vs WT HFD K00652 FPR1 HFD vs WT HFD K00658 FPR1 HFD vs WT HFD K00677 FPR1 HFD vs WT HFD K00684 FPR1 HFD vs WT HFD K00689 FPR1 HFD vs WT HFD K00721 FPR1 HFD vs WT HFD K00748 FPR1 HFD vs WT HFD K00798 FPR1 HFD vs WT HFD K00812 FPR1 HFD vs WT HFD K00819 FPR1 HFD vs WT HFD K00823 FPR1 HFD vs WT HFD K00844 FPR1 HFD vs WT HFD K00853 FPR1 HFD vs WT HFD K00860 FPR1 HFD vs WT HFD K00895 FPR1 HFD vs WT HFD K00912 FPR1 HFD vs WT HFD K00929 FPR1 HFD vs WT HFD K00940 FPR1 HFD vs WT HFD K00946 FPR1 HFD vs WT HFD K00970 FPR1 HFD vs WT HFD K00978 FPR1 HFD vs WT HFD K00979 FPR1 HFD vs WT HFD K00983 FPR1 HFD vs WT HFD K00986 FPR1 HFD vs WT HFD K01041 FPR1 HFD vs WT HFD K01057 FPR1 HFD vs WT HFD K01082 FPR1 HFD vs WT HFD K01089 FPR1 HFD vs WT HFD K01130 FPR1 HFD vs WT HFD K01144 FPR1 HFD vs WT HFD K01155 Diabetes Page 126 of 230

FPR1 HFD vs WT HFD K01159 FPR1 HFD vs WT HFD K01163 FPR1 HFD vs WT HFD K01173 FPR1 HFD vs WT HFD K01186 FPR1 HFD vs WT HFD K01194 FPR1 HFD vs WT HFD K01197 FPR1 HFD vs WT HFD K01201 FPR1 HFD vs WT HFD K01205 FPR1 HFD vs WT HFD K01216 FPR1 HFD vs WT HFD K01235 FPR1 HFD vs WT HFD K01241 FPR1 HFD vs WT HFD K01250 FPR1 HFD vs WT HFD K01277 FPR1 HFD vs WT HFD K01278 FPR1 HFD vs WT HFD K01284 FPR1 HFD vs WT HFD K01297 FPR1 HFD vs WT HFD K01322 FPR1 HFD vs WT HFD K01338 FPR1 HFD vs WT HFD K01422 FPR1 HFD vs WT HFD K01428 FPR1 HFD vs WT HFD K01429 FPR1 HFD vs WT HFD K01430 FPR1 HFD vs WT HFD K01433 FPR1 HFD vs WT HFD K01447 FPR1 HFD vs WT HFD K01468 FPR1 HFD vs WT HFD K01476 FPR1 HFD vs WT HFD K01480 FPR1 HFD vs WT HFD K01485 FPR1 HFD vs WT HFD K01492 FPR1 HFD vs WT HFD K01546 FPR1 HFD vs WT HFD K01547 FPR1 HFD vs WT HFD K01548 FPR1 HFD vs WT HFD K01573 FPR1 HFD vs WT HFD K01585 FPR1 HFD vs WT HFD K01590 FPR1 HFD vs WT HFD K01599 FPR1 HFD vs WT HFD K01611 FPR1 HFD vs WT HFD K01627 FPR1 HFD vs WT HFD K01639 FPR1 HFD vs WT HFD K01665 FPR1 HFD vs WT HFD K01666 FPR1 HFD vs WT HFD K01667 FPR1 HFD vs WT HFD K01676 FPR1 HFD vs WT HFD K01698 FPR1 HFD vs WT HFD K01699 FPR1 HFD vs WT HFD K01709 FPR1 HFD vs WT HFD K01712 FPR1 HFD vs WT HFD K01719 FPR1 HFD vs WT HFD K01730 FPR1 HFD vs WT HFD K01744 Page 127 of 230 Diabetes

FPR1 HFD vs WT HFD K01745 FPR1 HFD vs WT HFD K01749 FPR1 HFD vs WT HFD K01750 FPR1 HFD vs WT HFD K01771 FPR1 HFD vs WT HFD K01787 FPR1 HFD vs WT HFD K01802 FPR1 HFD vs WT HFD K01818 FPR1 HFD vs WT HFD K01840 FPR1 HFD vs WT HFD K01843 FPR1 HFD vs WT HFD K01845 FPR1 HFD vs WT HFD K01847 FPR1 HFD vs WT HFD K01858 FPR1 HFD vs WT HFD K01897 FPR1 HFD vs WT HFD K01902 FPR1 HFD vs WT HFD K01903 FPR1 HFD vs WT HFD K01919 FPR1 HFD vs WT HFD K01950 FPR1 HFD vs WT HFD K01960 FPR1 HFD vs WT HFD K01966 FPR1 HFD vs WT HFD K01991 FPR1 HFD vs WT HFD K01993 FPR1 HFD vs WT HFD K02009 FPR1 HFD vs WT HFD K02014 FPR1 HFD vs WT HFD K02065 FPR1 HFD vs WT HFD K02066 FPR1 HFD vs WT HFD K02067 FPR1 HFD vs WT HFD K02076 FPR1 HFD vs WT HFD K02080 FPR1 HFD vs WT HFD K02117 FPR1 HFD vs WT HFD K02121 FPR1 HFD vs WT HFD K02169 FPR1 HFD vs WT HFD K02190 FPR1 HFD vs WT HFD K02191 FPR1 HFD vs WT HFD K02217 FPR1 HFD vs WT HFD K02230 FPR1 HFD vs WT HFD K02304 FPR1 HFD vs WT HFD K02361 FPR1 HFD vs WT HFD K02377 FPR1 HFD vs WT HFD K02426 FPR1 HFD vs WT HFD K02429 FPR1 HFD vs WT HFD K02437 FPR1 HFD vs WT HFD K02472 FPR1 HFD vs WT HFD K02473 FPR1 HFD vs WT HFD K02474 FPR1 HFD vs WT HFD K02477 FPR1 HFD vs WT HFD K02481 FPR1 HFD vs WT HFD K02492 FPR1 HFD vs WT HFD K02509 FPR1 HFD vs WT HFD K02517 FPR1 HFD vs WT HFD K02523 Diabetes Page 128 of 230

FPR1 HFD vs WT HFD K02525 FPR1 HFD vs WT HFD K02527 FPR1 HFD vs WT HFD K02536 FPR1 HFD vs WT HFD K02566 FPR1 HFD vs WT HFD K02575 FPR1 HFD vs WT HFD K02619 FPR1 HFD vs WT HFD K02651 FPR1 HFD vs WT HFD K02784 FPR1 HFD vs WT HFD K02839 FPR1 HFD vs WT HFD K02840 FPR1 HFD vs WT HFD K02856 FPR1 HFD vs WT HFD K02858 FPR1 HFD vs WT HFD K02897 FPR1 HFD vs WT HFD K03077 FPR1 HFD vs WT HFD K03092 FPR1 HFD vs WT HFD K03113 FPR1 HFD vs WT HFD K03118 FPR1 HFD vs WT HFD K03146 FPR1 HFD vs WT HFD K03149 FPR1 HFD vs WT HFD K03179 FPR1 HFD vs WT HFD K03187 FPR1 HFD vs WT HFD K03188 FPR1 HFD vs WT HFD K03189 FPR1 HFD vs WT HFD K03190 FPR1 HFD vs WT HFD K03269 FPR1 HFD vs WT HFD K03270 FPR1 HFD vs WT HFD K03274 FPR1 HFD vs WT HFD K03281 FPR1 HFD vs WT HFD K03296 FPR1 HFD vs WT HFD K03299 FPR1 HFD vs WT HFD K03307 FPR1 HFD vs WT HFD K03313 FPR1 HFD vs WT HFD K03327 FPR1 HFD vs WT HFD K03388 FPR1 HFD vs WT HFD K03389 FPR1 HFD vs WT HFD K03390 FPR1 HFD vs WT HFD K03394 FPR1 HFD vs WT HFD K03399 FPR1 HFD vs WT HFD K03430 FPR1 HFD vs WT HFD K03444 FPR1 HFD vs WT HFD K03446 FPR1 HFD vs WT HFD K03449 FPR1 HFD vs WT HFD K03453 FPR1 HFD vs WT HFD K03473 FPR1 HFD vs WT HFD K03474 FPR1 HFD vs WT HFD K03503 FPR1 HFD vs WT HFD K03526 FPR1 HFD vs WT HFD K03534 FPR1 HFD vs WT HFD K03543 FPR1 HFD vs WT HFD K03558 Page 129 of 230 Diabetes

FPR1 HFD vs WT HFD K03559 FPR1 HFD vs WT HFD K03561 FPR1 HFD vs WT HFD K03564 FPR1 HFD vs WT HFD K03585 FPR1 HFD vs WT HFD K03587 FPR1 HFD vs WT HFD K03593 FPR1 HFD vs WT HFD K03594 FPR1 HFD vs WT HFD K03606 FPR1 HFD vs WT HFD K03614 FPR1 HFD vs WT HFD K03635 FPR1 HFD vs WT HFD K03636 FPR1 HFD vs WT HFD K03638 FPR1 HFD vs WT HFD K03644 FPR1 HFD vs WT HFD K03651 FPR1 HFD vs WT HFD K03658 FPR1 HFD vs WT HFD K03688 FPR1 HFD vs WT HFD K03694 FPR1 HFD vs WT HFD K03718 FPR1 HFD vs WT HFD K03719 FPR1 HFD vs WT HFD K03742 FPR1 HFD vs WT HFD K03743 FPR1 HFD vs WT HFD K03748 FPR1 HFD vs WT HFD K03753 FPR1 HFD vs WT HFD K03760 FPR1 HFD vs WT HFD K03770 FPR1 HFD vs WT HFD K03771 FPR1 HFD vs WT HFD K03772 FPR1 HFD vs WT HFD K03773 FPR1 HFD vs WT HFD K03775 FPR1 HFD vs WT HFD K03781 FPR1 HFD vs WT HFD K03786 FPR1 HFD vs WT HFD K03801 FPR1 HFD vs WT HFD K03803 FPR1 HFD vs WT HFD K03814 FPR1 HFD vs WT HFD K03818 FPR1 HFD vs WT HFD K03820 FPR1 HFD vs WT HFD K03824 FPR1 HFD vs WT HFD K03832 FPR1 HFD vs WT HFD K03839 FPR1 HFD vs WT HFD K03924 FPR1 HFD vs WT HFD K03928 FPR1 HFD vs WT HFD K03931 FPR1 HFD vs WT HFD K03932 FPR1 HFD vs WT HFD K03973 FPR1 HFD vs WT HFD K04024 FPR1 HFD vs WT HFD K04029 FPR1 HFD vs WT HFD K04031 FPR1 HFD vs WT HFD K04084 FPR1 HFD vs WT HFD K04086 FPR1 HFD vs WT HFD K04477 Diabetes Page 130 of 230

FPR1 HFD vs WT HFD K04749 FPR1 HFD vs WT HFD K04761 FPR1 HFD vs WT HFD K04762 FPR1 HFD vs WT HFD K04773 FPR1 HFD vs WT HFD K05306 FPR1 HFD vs WT HFD K05338 FPR1 HFD vs WT HFD K05339 FPR1 HFD vs WT HFD K05343 FPR1 HFD vs WT HFD K05346 FPR1 HFD vs WT HFD K05367 FPR1 HFD vs WT HFD K05515 FPR1 HFD vs WT HFD K05595 FPR1 HFD vs WT HFD K05606 FPR1 HFD vs WT HFD K05776 FPR1 HFD vs WT HFD K05785 FPR1 HFD vs WT HFD K05800 FPR1 HFD vs WT HFD K05801 FPR1 HFD vs WT HFD K05807 FPR1 HFD vs WT HFD K05811 FPR1 HFD vs WT HFD K05895 FPR1 HFD vs WT HFD K05945 FPR1 HFD vs WT HFD K06041 FPR1 HFD vs WT HFD K06042 FPR1 HFD vs WT HFD K06076 FPR1 HFD vs WT HFD K06079 FPR1 HFD vs WT HFD K06142 FPR1 HFD vs WT HFD K06155 FPR1 HFD vs WT HFD K06167 FPR1 HFD vs WT HFD K06177 FPR1 HFD vs WT HFD K06188 FPR1 HFD vs WT HFD K06194 FPR1 HFD vs WT HFD K06223 FPR1 HFD vs WT HFD K06400 FPR1 HFD vs WT HFD K06861 FPR1 HFD vs WT HFD K06871 FPR1 HFD vs WT HFD K06891 FPR1 HFD vs WT HFD K06894 FPR1 HFD vs WT HFD K06897 FPR1 HFD vs WT HFD K06903 FPR1 HFD vs WT HFD K06907 FPR1 HFD vs WT HFD K06909 FPR1 HFD vs WT HFD K06911 FPR1 HFD vs WT HFD K06921 FPR1 HFD vs WT HFD K06934 FPR1 HFD vs WT HFD K06970 FPR1 HFD vs WT HFD K06989 FPR1 HFD vs WT HFD K06996 FPR1 HFD vs WT HFD K07002 FPR1 HFD vs WT HFD K07011 FPR1 HFD vs WT HFD K07012 Page 131 of 230 Diabetes

FPR1 HFD vs WT HFD K07017 FPR1 HFD vs WT HFD K07031 FPR1 HFD vs WT HFD K07071 FPR1 HFD vs WT HFD K07085 FPR1 HFD vs WT HFD K07091 FPR1 HFD vs WT HFD K07109 FPR1 HFD vs WT HFD K07114 FPR1 HFD vs WT HFD K07138 FPR1 HFD vs WT HFD K07148 FPR1 HFD vs WT HFD K07164 FPR1 HFD vs WT HFD K07175 FPR1 HFD vs WT HFD K07214 FPR1 HFD vs WT HFD K07217 FPR1 HFD vs WT HFD K07221 FPR1 HFD vs WT HFD K07223 FPR1 HFD vs WT HFD K07240 FPR1 HFD vs WT HFD K07248 FPR1 HFD vs WT HFD K07257 FPR1 HFD vs WT HFD K07259 FPR1 HFD vs WT HFD K07263 FPR1 HFD vs WT HFD K07277 FPR1 HFD vs WT HFD K07315 FPR1 HFD vs WT HFD K07319 FPR1 HFD vs WT HFD K07322 FPR1 HFD vs WT HFD K07387 FPR1 HFD vs WT HFD K07397 FPR1 HFD vs WT HFD K07405 FPR1 HFD vs WT HFD K07459 FPR1 HFD vs WT HFD K07460 FPR1 HFD vs WT HFD K07464 FPR1 HFD vs WT HFD K07484 FPR1 HFD vs WT HFD K07496 FPR1 HFD vs WT HFD K07504 FPR1 HFD vs WT HFD K07552 FPR1 HFD vs WT HFD K07571 FPR1 HFD vs WT HFD K07588 FPR1 HFD vs WT HFD K07657 FPR1 HFD vs WT HFD K07665 FPR1 HFD vs WT HFD K07683 FPR1 HFD vs WT HFD K07696 FPR1 HFD vs WT HFD K07704 FPR1 HFD vs WT HFD K07705 FPR1 HFD vs WT HFD K07719 FPR1 HFD vs WT HFD K07735 FPR1 HFD vs WT HFD K07746 FPR1 HFD vs WT HFD K07783 FPR1 HFD vs WT HFD K07787 FPR1 HFD vs WT HFD K07791 FPR1 HFD vs WT HFD K07792 FPR1 HFD vs WT HFD K07798 Diabetes Page 132 of 230

FPR1 HFD vs WT HFD K07979 FPR1 HFD vs WT HFD K08138 FPR1 HFD vs WT HFD K08169 FPR1 HFD vs WT HFD K08191 FPR1 HFD vs WT HFD K08218 FPR1 HFD vs WT HFD K08223 FPR1 HFD vs WT HFD K08289 FPR1 HFD vs WT HFD K08307 FPR1 HFD vs WT HFD K08321 FPR1 HFD vs WT HFD K08325 FPR1 HFD vs WT HFD K08590 FPR1 HFD vs WT HFD K08600 FPR1 HFD vs WT HFD K08641 FPR1 HFD vs WT HFD K08676 FPR1 HFD vs WT HFD K08679 FPR1 HFD vs WT HFD K08717 FPR1 HFD vs WT HFD K08969 FPR1 HFD vs WT HFD K08972 FPR1 HFD vs WT HFD K08978 FPR1 HFD vs WT HFD K09011 FPR1 HFD vs WT HFD K09125 FPR1 HFD vs WT HFD K09181 FPR1 HFD vs WT HFD K09459 FPR1 HFD vs WT HFD K09469 FPR1 HFD vs WT HFD K09474 FPR1 HFD vs WT HFD K09680 FPR1 HFD vs WT HFD K09789 FPR1 HFD vs WT HFD K09793 FPR1 HFD vs WT HFD K09797 FPR1 HFD vs WT HFD K09807 FPR1 HFD vs WT HFD K09808 FPR1 HFD vs WT HFD K09810 FPR1 HFD vs WT HFD K09922 FPR1 HFD vs WT HFD K09924 FPR1 HFD vs WT HFD K09939 FPR1 HFD vs WT HFD K09940 FPR1 HFD vs WT HFD K09979 FPR1 HFD vs WT HFD K10009 FPR1 HFD vs WT HFD K10852 FPR1 HFD vs WT HFD K11031 FPR1 HFD vs WT HFD K11085 FPR1 HFD vs WT HFD K11102 FPR1 HFD vs WT HFD K11105 FPR1 HFD vs WT HFD K11381 FPR1 HFD vs WT HFD K11527 FPR1 HFD vs WT HFD K11537 FPR1 HFD vs WT HFD K11720 FPR1 HFD vs WT HFD K11782 FPR1 HFD vs WT HFD K11784 FPR1 HFD vs WT HFD K11785 Page 133 of 230 Diabetes

FPR1 HFD vs WT HFD K11996 FPR1 HFD vs WT HFD K12267 FPR1 HFD vs WT HFD K12339 FPR1 HFD vs WT HFD K12340 FPR1 HFD vs WT HFD K12373 FPR1 HFD vs WT HFD K12452 FPR1 HFD vs WT HFD K12454 FPR1 HFD vs WT HFD K12524 FPR1 HFD vs WT HFD K12942 FPR1 HFD vs WT HFD K13001 FPR1 HFD vs WT HFD K13018 FPR1 HFD vs WT HFD K13043 FPR1 HFD vs WT HFD K13051 FPR1 HFD vs WT HFD K13378 FPR1 HFD vs WT HFD K13542 FPR1 HFD vs WT HFD K13652 FPR1 HFD vs WT HFD K13694 FPR1 HFD vs WT HFD K13747 FPR1 HFD vs WT HFD K13821 FPR1 HFD vs WT HFD K13919 FPR1 HFD vs WT HFD K13920 FPR1 HFD vs WT HFD K13921 FPR1 HFD vs WT HFD K13922 FPR1 HFD vs WT HFD K13923 FPR1 HFD vs WT HFD K13990 FPR1 HFD vs WT HFD K14205 FPR1 HFD vs WT HFD K14415 FPR1 HFD vs WT HFD K14623 FPR1 HFD vs WT HFD K14742 FPR1 HFD vs WT HFD K15460 FPR1 HFD vs WT HFD K15635 FPR1 HFD vs WT HFD K15669 FPR1 HFD vs WT HFD K15725 FPR1 HFD vs WT HFD K15726 FPR1 HFD vs WT HFD K15727 FPR1 HFD vs WT HFD K15876 FPR1 HFD vs WT HFD K15898 FPR1 HFD vs WT HFD K15923 FPR1 HFD vs WT HFD K15977 FPR1 HFD vs WT HFD K15987 FPR1 HFD vs WT HFD K16052 FPR1 HFD vs WT HFD K16053 FPR1 HFD vs WT HFD K16055 FPR1 HFD vs WT HFD K16089 FPR1 HFD vs WT HFD K16091 FPR1 HFD vs WT HFD K16092 FPR1 HFD vs WT HFD K16153 FPR1 HFD vs WT HFD K16235 FPR1 HFD vs WT HFD K16323 FPR1 HFD vs WT HFD K16345 Diabetes Page 134 of 230

FPR1 HFD vs WT HFD K16363 FPR1 HFD vs WT HFD K16435 FPR1 HFD vs WT HFD K16698 FPR1 HFD vs WT HFD K16936 FPR1 HFD vs WT HFD K16937 FPR1 HFD vs WT HFD K17103 FPR1 HFD vs WT HFD K17680 FPR1 HFD vs WT HFD K17716 FPR1 HFD vs WT HFD K17722 FPR1 HFD vs WT HFD K17723 FPR1 HFD vs WT HFD K17837 FPR1 HFD vs WT HFD K17992 FPR1 HFD vs WT HFD K18138 FPR1 HFD vs WT HFD K18139 FPR1 HFD vs WT HFD K18234 FPR1 HFD vs WT HFD K18285 FPR1 HFD vs WT HFD K18330 FPR1 HFD vs WT HFD K18331 FPR1 HFD vs WT HFD K18332 FPR1 HFD vs WT HFD K18369 FPR1 HFD vs WT HFD K18691 FPR1 HFD vs WT HFD K18831 FPR1 HFD vs WT HFD K00169 FPR1 HFD vs WT HFD K00172 FPR1 HFD vs WT HFD K00666 FPR1 HFD vs WT HFD K01179 FPR1 HFD vs WT HFD K01486 FPR1 HFD vs WT HFD K01571 FPR1 HFD vs WT HFD K01673 FPR1 HFD vs WT HFD K01677 FPR1 HFD vs WT HFD K01678 FPR1 HFD vs WT HFD K01737 FPR1 HFD vs WT HFD K02017 FPR1 HFD vs WT HFD K02018 FPR1 HFD vs WT HFD K02020 FPR1 HFD vs WT HFD K02203 FPR1 HFD vs WT HFD K02614 FPR1 HFD vs WT HFD K03116 FPR1 HFD vs WT HFD K03340 FPR1 HFD vs WT HFD K03465 FPR1 HFD vs WT HFD K03637 FPR1 HFD vs WT HFD K04070 FPR1 HFD vs WT HFD K04651 FPR1 HFD vs WT HFD K04652 FPR1 HFD vs WT HFD K05516 FPR1 HFD vs WT HFD K05810 FPR1 HFD vs WT HFD K06206 FPR1 HFD vs WT HFD K06215 FPR1 HFD vs WT HFD K06864 FPR1 HFD vs WT HFD K06898 Page 135 of 230 Diabetes

FPR1 HFD vs WT HFD K06920 FPR1 HFD vs WT HFD K06972 FPR1 HFD vs WT HFD K07043 FPR1 HFD vs WT HFD K07154 FPR1 HFD vs WT HFD K07391 FPR1 HFD vs WT HFD K07402 FPR1 HFD vs WT HFD K08681 FPR1 HFD vs WT HFD K08963 FPR1 HFD vs WT HFD K08999 FPR1 HFD vs WT HFD K09121 FPR1 HFD vs WT HFD K09457 FPR1 HFD vs WT HFD K09758 FPR1 HFD vs WT HFD K09790 FPR1 HFD vs WT HFD K11358 FPR1 HFD vs WT HFD K11645 FPR1 HFD vs WT HFD K11927 FPR1 HFD vs WT HFD K11928 FPR1 HFD vs WT HFD K12510 FPR1 HFD vs WT HFD K18704 FPR1 HFD vs WT HFD K00968 FPR1 HFD vs WT HFD K01816 FPR1 HFD vs WT HFD K00180 FPR1 HFD vs WT HFD K01895 FPR1 HFD vs WT HFD K01912 FPR1 HFD vs WT HFD K07458 FPR1 HFD vs WT HFD K07646 FPR1 HFD vs WT HFD K07403 FPR1 HFD vs WT HFD K00179 FPR1 HFD vs WT HFD K01206 FPR1 HFD vs WT HFD K01251 FPR1 HFD vs WT HFD K07220 FPR1 HFD vs WT HFD K07455 FPR1 HFD vs WT HFD K10117 FPR1 HFD vs WT HFD K18349 FPR1 HFD vs WT HFD K02626 FPR1 HFD vs WT HFD K00382 FPR1 HFD vs WT HFD K00651 FPR1 HFD vs WT HFD K00950 FPR1 HFD vs WT HFD K01077 FPR1 HFD vs WT HFD K01439 FPR1 HFD vs WT HFD K01580 FPR1 HFD vs WT HFD K01759 FPR1 HFD vs WT HFD K01961 FPR1 HFD vs WT HFD K03386 FPR1 HFD vs WT HFD K06975 FPR1 HFD vs WT HFD K07001 FPR1 HFD vs WT HFD K12343 FPR1 HFD vs WT HFD K00184 FPR1 HFD vs WT HFD K00185 FPR1 HFD vs WT HFD K00219 Diabetes Page 136 of 230

FPR1 HFD vs WT HFD K00613 FPR1 HFD vs WT HFD K01482 FPR1 HFD vs WT HFD K02283 FPR1 HFD vs WT HFD K02363 FPR1 HFD vs WT HFD K02395 FPR1 HFD vs WT HFD K02567 FPR1 HFD vs WT HFD K02568 FPR1 HFD vs WT HFD K02570 FPR1 HFD vs WT HFD K02573 FPR1 HFD vs WT HFD K02574 FPR1 HFD vs WT HFD K02654 FPR1 HFD vs WT HFD K03205 FPR1 HFD vs WT HFD K03646 FPR1 HFD vs WT HFD K05780 FPR1 HFD vs WT HFD K05781 FPR1 HFD vs WT HFD K06019 FPR1 HFD vs WT HFD K06162 FPR1 HFD vs WT HFD K06163 FPR1 HFD vs WT HFD K06164 FPR1 HFD vs WT HFD K06165 FPR1 HFD vs WT HFD K06166 FPR1 HFD vs WT HFD K06416 FPR1 HFD vs WT HFD K06446 FPR1 HFD vs WT HFD K06610 FPR1 HFD vs WT HFD K07306 FPR1 HFD vs WT HFD K07307 FPR1 HFD vs WT HFD K07308 FPR1 HFD vs WT HFD K07309 FPR1 HFD vs WT HFD K07310 FPR1 HFD vs WT HFD K07452 FPR1 HFD vs WT HFD K07739 FPR1 HFD vs WT HFD K08315 FPR1 HFD vs WT HFD K08352 FPR1 HFD vs WT HFD K08372 FPR1 HFD vs WT HFD K09767 FPR1 HFD vs WT HFD K12136 FPR1 HFD vs WT HFD K12138 FPR1 HFD vs WT HFD K12140 FPR1 HFD vs WT HFD K12141 FPR1 HFD vs WT HFD K12143 FPR1 HFD vs WT HFD K12297 FPR1 HFD vs WT HFD K12507 FPR1 HFD vs WT HFD K14088 FPR1 HFD vs WT HFD K15773 FPR1 HFD vs WT HFD K15830 FPR1 HFD vs WT HFD K17319 FPR1 HFD vs WT HFD K09138 FPR1 HFD vs WT HFD K13280 FPR1 HFD vs WT HFD K03317 FPR1 HFD vs WT HFD K00313 Page 137 of 230 Diabetes

FPR1 HFD vs WT HFD K01438 FPR1 HFD vs WT HFD K01633 FPR1 HFD vs WT HFD K02279 FPR1 HFD vs WT HFD K02282 FPR1 HFD vs WT HFD K02558 FPR1 HFD vs WT HFD K03750 FPR1 HFD vs WT HFD K05796 FPR1 HFD vs WT HFD K06915 FPR1 HFD vs WT HFD K07047 FPR1 HFD vs WT HFD K09809 FPR1 HFD vs WT HFD K17318 FPR1 HFD vs WT HFD K17320 Diabetes Page 138 of 230

KEGG Enzyme/Protein Information E1.1.1.1, adh; alcohol dehydrogenase [EC:1.1.1.1] E1.1.1.3; homoserine dehydrogenase [EC:1.1.1.3] BDH, butB; (R,R)-butanediol dehydrogenase / meso-butanediol dehydrogenase / diacetyl reductase [EC:1.1.1.4 1.1.1.- 1.1.1.303] mtlD; mannitol-1-phosphate 5-dehydrogenase [EC:1.1.1.17] UGDH, ugd; UDPglucose 6-dehydrogenase [EC:1.1.1.22] hisD; histidinol dehydrogenase [EC:1.1.1.23] aroE; shikimate dehydrogenase [EC:1.1.1.25] LDH, ldh; L-lactate dehydrogenase [EC:1.1.1.27] E1.1.1.31, mmsB; 3-hydroxyisobutyrate dehydrogenase [EC:1.1.1.31] ME2, sfcA, maeA; malate dehydrogenase (oxaloacetate-decarboxylating) [EC:1.1.1.38] IDH1, IDH2, icd; isocitrate dehydrogenase [EC:1.1.1.42] PGD, gnd, gntZ; 6-phosphogluconate dehydrogenase [EC:1.1.1.44 1.1.1.343] G6PD, zwf; glucose-6-phosphate 1-dehydrogenase [EC:1.1.1.49] uxuB; fructuronate reductase [EC:1.1.1.57] leuB; 3-isopropylmalate dehydrogenase [EC:1.1.1.85] ilvC; ketol-acid reductoisomerase [EC:1.1.1.86] mvaA; hydroxymethylglutaryl-CoA reductase [EC:1.1.1.88] gpsA; glycerol-3-phosphate dehydrogenase (NAD(P)+) [EC:1.1.1.94] serA, PHGDH; D-3-phosphoglycerate dehydrogenase [EC:1.1.1.95] fabG; 3-oxoacyl-[acyl-carrier protein] reductase [EC:1.1.1.100] rfbD, rmlD; dTDP-4-dehydrorhamnose reductase [EC:1.1.1.133] murB; UDP-N-acetylmuramate dehydrogenase [EC:1.3.1.98] guaB; IMP dehydrogenase [EC:1.1.1.205] E1.1.1.- glpA, glpD; glycerol-3-phosphate dehydrogenase [EC:1.1.5.3] fdoH; formate dehydrogenase iron-sulfur subunit asd; aspartate-semialdehyde dehydrogenase [EC:1.2.1.11] GAPDH, gapA; glyceraldehyde 3-phosphate dehydrogenase [EC:1.2.1.12] gabD; succinate-semialdehyde dehydrogenase / glutarate-semialdehyde dehydrogenase [EC:1.2.1.16 1.2.1.79 1.2.1.20] argC; N-acetyl-gamma-glutamyl-phosphate reductase [EC:1.2.1.38] proA; glutamate-5-semialdehyde dehydrogenase [EC:1.2.1.41] E1.2.3.3, poxL; pyruvate oxidase [EC:1.2.3.3] PDHA, pdhA; pyruvate dehydrogenase E1 component alpha subunit [EC:1.2.4.1] PDHB, pdhB; pyruvate dehydrogenase E1 component beta subunit [EC:1.2.4.1] porA; pyruvate ferredoxin oxidoreductase alpha subunit [EC:1.2.7.1] porB; pyruvate ferredoxin oxidoreductase beta subunit [EC:1.2.7.1] porG; pyruvate ferredoxin oxidoreductase gamma subunit [EC:1.2.7.1] K00184; prokaryotic molybdopterin-containing oxidoreductase family, iron-sulfur binding subunit K00185; prokaryotic molybdopterin-containing oxidoreductase family, membrane subunit dapB; 4-hydroxy-tetrahydrodipicolinate reductase [EC:1.17.1.8] fadH; 2,4-dienoyl-CoA reductase (NADPH2) [EC:1.3.1.34] pyrD; dihydroorotate dehydrogenase (fumarate) [EC:1.3.98.1] sdhB, frdB; succinate dehydrogenase / fumarate reductase, iron-sulfur subunit [EC:1.3.5.1 1.3.5.4] K00243; hypothetical protein frdA; fumarate reductase flavoprotein subunit [EC:1.3.5.4] frdB; fumarate reductase iron-sulfur subunit [EC:1.3.5.4] gltD; glutamate synthase (NADPH/NADH) small chain [EC:1.4.1.13 1.4.1.14] proC; pyrroline-5-carboxylate reductase [EC:1.5.1.2] folA; dihydrofolate reductase [EC:1.5.1.3] Page 139 of 230 Diabetes

metF, MTHFR; methylenetetrahydrofolate reductase (NADPH) [EC:1.5.1.20] ceo; N5-(carboxyethyl)ornithine synthase [EC:1.5.1.24] fixC; electron transfer flavoprotein-quinone oxidoreductase [EC:1.5.5.-] E1.7.1.7, guaC; GMP reductase [EC:1.7.1.7] K00375; GntR family transcriptional regulator / MocR family aminotransferase GSR, gor; glutathione reductase (NADPH) [EC:1.8.1.7] trxB; thioredoxin reductase (NADPH) [EC:1.8.1.9] cydA; cytochrome d ubiquinol oxidase subunit I [EC:1.10.3.-] cydB; cytochrome d ubiquinol oxidase subunit II [EC:1.10.3.-] E1.17.4.1A, nrdA, nrdE; ribonucleoside-diphosphate reductase alpha chain [EC:1.17.4.1] E1.17.4.1B, nrdB, nrdF; ribonucleoside-diphosphate reductase beta chain [EC:1.17.4.1] nrdD; ribonucleoside-triphosphate reductase [EC:1.17.4.2] ARSC1, arsC; arsenate reductase [EC:1.20.4.1] E1.-.-.- metH, MTR; 5-methyltetrahydrofolate--homocysteine methyltransferase [EC:2.1.1.13] metE; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase [EC:2.1.1.14] trmD; tRNA (guanine37-N1)-methyltransferase [EC:2.1.1.228] thyA, TYMS; thymidylate synthase [EC:2.1.1.45] ermC, ermA; 23S rRNA (adenine-N6)-dimethyltransferase [EC:2.1.1.184] rlmA1; 23S rRNA (guanine745-N1)-methyltransferase [EC:2.1.1.187] rsmC; 16S rRNA (guanine1207-N2)-methyltransferase [EC:2.1.1.172] mnmA, trmU, TRMU; tRNA-specific 2-thiouridylase [EC:2.8.1.-] ogt, MGMT; methylated-DNA-[protein]-cysteine S-methyltransferase [EC:2.1.1.63] E2.1.1.72; site-specific DNA-methyltransferase (adenine-specific) [EC:2.1.1.72] E2.1.1.79, cfa; cyclopropane-fatty-acyl-phospholipid synthase [EC:2.1.1.79] glyA, SHMT; glycine hydroxymethyltransferase [EC:2.1.2.1] purH; phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [EC:2.1.2.3 3.5.4.10] MTFMT, fmt; methionyl-tRNA formyltransferase [EC:2.1.2.9] pyrB, PYR2; aspartate carbamoyltransferase catalytic subunit [EC:2.1.3.2] OTC, argF, argI; ornithine carbamoyltransferase [EC:2.1.3.3] GATM; glycine amidinotransferase [EC:2.1.4.1] E2.2.1.1, tktA, tktB; transketolase [EC:2.2.1.1] argJ; glutamate N-acetyltransferase / amino-acid N-acetyltransferase [EC:2.3.1.35 2.3.1.1] E2.3.1.8, pta; phosphate acetyltransferase [EC:2.3.1.8] E2.3.1.9, atoB; acetyl-CoA C-acetyltransferase [EC:2.3.1.9] DLAT, aceF, pdhC; pyruvate dehydrogenase E2 component (dihydrolipoamide acetyltransferase) [EC:2.3.1.12] cysE; serine O-acetyltransferase [EC:2.3.1.30] fabD; [acyl-carrier-protein] S-malonyltransferase [EC:2.3.1.39] plsC; 1-acyl-sn-glycerol-3-phosphate acyltransferase [EC:2.3.1.51] speG; diamine N-acetyltransferase [EC:2.3.1.57] maa; maltose O-acetyltransferase [EC:2.3.1.79] aacC; aminoglycoside 3-N-acetyltransferase [EC:2.3.1.81] dapD; 2,3,4,5-tetrahydropyridine-2-carboxylate N-succinyltransferase [EC:2.3.1.117] E2.3.1.- pbp2B, penA; penicillin-binding protein 2B [EC:2.3.2.-] E2.4.1.1, glgP, PYG; starch phosphorylase [EC:2.4.1.1] E2.4.1.7; sucrose phosphorylase [EC:2.4.1.7] E2.4.1.8, mapA; maltose phosphorylase [EC:2.4.1.8] sacB; levansucrase [EC:2.4.1.10] glgB; 1,4-alpha-glucan branching enzyme [EC:2.4.1.18] Diabetes Page 140 of 230

E2.4.1.21, glgA; starch synthase [EC:2.4.1.21] malQ; 4-alpha-glucanotransferase [EC:2.4.1.25] tagE; poly(glycerol-phosphate) alpha-glucosyltransferase [EC:2.4.1.52] DPM1; dolichol-phosphate mannosyltransferase [EC:2.4.1.83] E2.4.1.- E2.4.2.2, pdp; pyrimidine-nucleoside phosphorylase [EC:2.4.2.2] APRT, apt; adenine phosphoribosyltransferase [EC:2.4.2.7] hprT, hpt, HPRT1; hypoxanthine phosphoribosyltransferase [EC:2.4.2.8] upp, UPRT; uracil phosphoribosyltransferase [EC:2.4.2.9] pyrE; orotate phosphoribosyltransferase [EC:2.4.2.10] pncB, NAPRT1; nicotinate phosphoribosyltransferase [EC:6.3.4.21] hisG; ATP phosphoribosyltransferase [EC:2.4.2.17] trpD; anthranilate phosphoribosyltransferase [EC:2.4.2.18] tgt, QTRT1; queuine tRNA-ribosyltransferase [EC:2.4.2.29] rlmH; 23S rRNA (pseudouridine1915-N3)-methyltransferase [EC:2.1.1.177] rnz; ribonuclease Z [EC:3.1.26.11] E2.4.-.- thiE; thiamine-phosphate pyrophosphorylase [EC:2.5.1.3] metK; S-adenosylmethionine synthetase [EC:2.5.1.6] murA; UDP-N-acetylglucosamine 1-carboxyvinyltransferase [EC:2.5.1.7] miaA, TRIT1; tRNA dimethylallyltransferase [EC:2.5.1.75] ribH, RIB4; 6,7-dimethyl-8-ribityllumazine synthase [EC:2.5.1.78] MMAB, pduO; cob(I)alamin adenosyltransferase [EC:2.5.1.17] aroA; 3-phosphoshikimate 1-carboxyvinyltransferase [EC:2.5.1.19] hepST; heptaprenyl diphosphate synthase [EC:2.5.1.30] uppS; undecaprenyl diphosphate synthase [EC:2.5.1.31] aspB; aspartate aminotransferase [EC:2.6.1.1] hisC; histidinol-phosphate aminotransferase [EC:2.6.1.9] glmS, GFPT; glucosamine--fructose-6-phosphate aminotransferase (isomerizing) [EC:2.6.1.16] argD; acetylornithine/N-succinyldiaminopimelate aminotransferase [EC:2.6.1.11 2.6.1.17] E2.6.1.42, ilvE; branched-chain amino acid aminotransferase [EC:2.6.1.42] serC, PSAT1; phosphoserine aminotransferase [EC:2.6.1.52] E2.6.1.- pucG; (S)-ureidoglycine-glyoxylate aminotransferase [EC:2.6.1.-] patA; aminotransferase [EC:2.6.1.-] HK; hexokinase [EC:2.7.1.1] glk; glucokinase [EC:2.7.1.2] E2.7.1.4, scrK; fructokinase [EC:2.7.1.4] galK; galactokinase [EC:2.7.1.6] pfkA, PFK; 6-phosphofructokinase 1 [EC:2.7.1.11] E2.7.1.12, gntK, idnK; gluconokinase [EC:2.7.1.12] rbsK, RBKS; ribokinase [EC:2.7.1.15] xylB, XYLB; xylulokinase [EC:2.7.1.17] tdk, TK; thymidine kinase [EC:2.7.1.21] ppnK, NADK; NAD+ kinase [EC:2.7.1.23] coaE; dephospho-CoA kinase [EC:2.7.1.24] E2.7.1.29, DAK1, DAK2; dihydroxyacetone kinase [EC:2.7.1.29] glpK, GK; glycerol kinase [EC:2.7.1.30] glxK; glycerate kinase [EC:2.7.1.31] coaA; type I pantothenate kinase [EC:2.7.1.33] Page 141 of 230 Diabetes

pdxK, pdxY; pyridoxine kinase [EC:2.7.1.35] E2.7.1.36, MVK, mvaK1; mevalonate kinase [EC:2.7.1.36] thrB1; homoserine kinase [EC:2.7.1.39] PK, pyk; pyruvate kinase [EC:2.7.1.40] kdgK; 2-dehydro-3-deoxygluconokinase [EC:2.7.1.45] udk, UCK; uridine kinase [EC:2.7.1.48] thiM; hydroxyethylthiazole kinase [EC:2.7.1.50] fruK; 1-phosphofructokinase [EC:2.7.1.56] E2.7.1.71, aroK, aroL; shikimate kinase [EC:2.7.1.71] aphA; kanamycin kinase [EC:2.7.1.95] lacC; tagatose 6-phosphate kinase [EC:2.7.1.144] E2.7.1.- ackA; acetate kinase [EC:2.7.2.1] arcC; carbamate kinase [EC:2.7.2.2] PGK, pgk; phosphoglycerate kinase [EC:2.7.2.3] lysC; aspartate kinase [EC:2.7.2.4] argB; acetylglutamate kinase [EC:2.7.2.8] proB; glutamate 5-kinase [EC:2.7.2.11] E2.7.3.- E2.7.4.2, mvaK2; phosphomevalonate kinase [EC:2.7.4.2] adk, AK; adenylate kinase [EC:2.7.4.3] thiD; hydroxymethylpyrimidine/phosphomethylpyrimidine kinase [EC:2.7.1.49 2.7.4.7] E2.7.4.8, gmk; guanylate kinase [EC:2.7.4.8] tmk, DTYMK; dTMP kinase [EC:2.7.4.9] cmk; cytidylate kinase [EC:2.7.4.14] PRPS, prsA; ribose-phosphate pyrophosphokinase [EC:2.7.6.1] thiN, TPK1, THI80; thiamine pyrophosphokinase [EC:2.7.6.2] relA; GTP pyrophosphokinase [EC:2.7.6.5] E2.7.7.3A, coaD, kdtB; pantetheine-phosphate adenylyltransferase [EC:2.7.7.3] pnp, PNPT1; polyribonucleotide nucleotidyltransferase [EC:2.7.7.8] UGP2, galU, galF; UTP--glucose-1-phosphate uridylyltransferase [EC:2.7.7.9] galT, GALT; UDPglucose--hexose-1-phosphate uridylyltransferase [EC:2.7.7.12] nadD; nicotinate-nucleotide adenylyltransferase [EC:2.7.7.18] pcnB; poly(A) polymerase [EC:2.7.7.19] E2.7.7.24, rfbA, rffH; glucose-1-phosphate thymidylyltransferase [EC:2.7.7.24] cca; tRNA nucleotidyltransferase (CCA-adding enzyme) [EC:2.7.7.72 3.1.3.- 3.1.4.-] glgC; glucose-1-phosphate adenylyltransferase [EC:2.7.7.27] tagD; glycerol-3-phosphate cytidylyltransferase [EC:2.7.7.39] E2.7.7.41, CDS1, CDS2, cdsA; phosphatidate cytidylyltransferase [EC:2.7.7.41] pgsA, PGS1; CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase [EC:2.7.8.5] acpS; holo-[acyl-carrier protein] synthase [EC:2.7.8.7] mraY; phospho-N-acetylmuramoyl-pentapeptide-transferase [EC:2.7.8.13] selD, SEPHS; selenide, water dikinase [EC:2.7.9.3] TST, MPST, sseA; thiosulfate/3-mercaptopyruvate sulfurtransferase [EC:2.8.1.1 2.8.1.2] pldB; lysophospholipase [EC:3.1.1.5] PTH1, pth, spoVC; peptidyl-tRNA hydrolase, PTH1 family [EC:3.1.1.29] PGLS, pgl, devB; 6-phosphogluconolactonase [EC:3.1.1.31] MCH; medium-chain acyl-[acyl-carrier-protein] hydrolase [EC:3.1.2.21] E3.1.3.5; 5'-nucleotidase [EC:3.1.3.5] E3.1.3.16; protein phosphatase [EC:3.1.3.16] Diabetes Page 142 of 230

E3.1.3.25, IMPA, suhB; myo-inositol-1(or 4)-monophosphatase [EC:3.1.3.25] E3.1.3.41; 4-nitrophenyl phosphatase [EC:3.1.3.41] E3.1.3.48; protein-tyrosine phosphatase [EC:3.1.3.48] acpD, azoR; FMN-dependent NADH-azoreductase [EC:1.7.-.-] cpdB; 2',3'-cyclic-nucleotide 2'-phosphodiesterase / 3'-nucleotidase [EC:3.1.4.16 3.1.3.6] E3.1.4.46, glpQ, ugpQ; glycerophosphoryl diester phosphodiesterase [EC:3.1.4.46] dgt; dGTPase [EC:3.1.5.1] E3.1.11.2, xthA; exodeoxyribonuclease III [EC:3.1.11.2] hsdR; type I restriction enzyme, R subunit [EC:3.1.21.3] hsdS; type I restriction enzyme, S subunit [EC:3.1.21.3] res; type III restriction enzyme [EC:3.1.21.5] K01163; hypothetical protein E3.2.1.1, amyA, malS; alpha-amylase [EC:3.2.1.1] E3.2.1.4; endoglucanase [EC:3.2.1.4] E3.2.1.10; oligo-1,6-glucosidase [EC:3.2.1.10] E3.2.1.14; chitinase [EC:3.2.1.14] malZ; alpha-glucosidase [EC:3.2.1.20] lacZ; beta-galactosidase [EC:3.2.1.23] E3.2.1.24; alpha-mannosidase [EC:3.2.1.24] E3.2.1.26, sacA; beta-fructofuranosidase [EC:3.2.1.26] xynB; xylan 1,4-beta-xylosidase [EC:3.2.1.37] E3.2.1.41; pullulanase [EC:3.2.1.41] GBA, srfJ; glucosylceramidase [EC:3.2.1.45] nagZ; beta-N-acetylhexosaminidase [EC:3.2.1.52] dexB; glucan 1,6-alpha-glucosidase [EC:3.2.1.70] E3.2.1.73; licheninase [EC:3.2.1.73] E3.2.1.85, lacG; 6-phospho-beta-galactosidase [EC:3.2.1.85] E3.2.1.86B, bglA; 6-phospho-beta-glucosidase [EC:3.2.1.86] treC; trehalose-6-phosphate hydrolase [EC:3.2.1.93] E3.2.1.122, glvA; maltose-6'-phosphate glucosidase [EC:3.2.1.122] E3.2.1.135, nplT; neopullulanase [EC:3.2.1.135] iunH; purine nucleosidase [EC:3.2.2.1] mtnN, mtn, pfs; adenosylhomocysteine nucleosidase [EC:3.2.2.9] tag; DNA-3-methyladenine glycosylase I [EC:3.2.2.20] rihA; pyrimidine-specific ribonucleoside hydrolase [EC:3.2.-.-] pepN; aminopeptidase N [EC:3.4.11.2] pepT; tripeptide aminopeptidase [EC:3.4.11.4] pip; proline iminopeptidase [EC:3.4.11.5] pepA; glutamyl aminopeptidase [EC:3.4.11.7] pepP; Xaa-Pro aminopeptidase [EC:3.4.11.9] E3.4.11.14; cytosol alanyl aminopeptidase [EC:3.4.11.14] map; methionyl aminopeptidase [EC:3.4.11.18] pepD; dipeptidase D [EC:3.4.13.-] pepQ; Xaa-Pro dipeptidase [EC:3.4.13.9] DPP4; dipeptidyl-peptidase 4 [EC:3.4.14.5] E3.4.14.11, pepXP; X-Pro dipeptidyl-peptidase [EC:3.4.14.11] ldcA; muramoyltetrapeptide carboxypeptidase [EC:3.4.17.13] E3.4.17.19; carboxypeptidase Taq [EC:3.4.17.19] E3.4.19.3, pcp; pyroglutamyl-peptidase [EC:3.4.19.3] lon; ATP-dependent Lon protease [EC:3.4.21.53] Page 143 of 230 Diabetes

lexA; repressor LexA [EC:3.4.21.88] clpP, CLPP; ATP-dependent Clp protease, protease subunit [EC:3.4.21.92] E3.4.21.96; lactocepin [EC:3.4.21.96] E3.4.22.40, pepC; bleomycin hydrolase [EC:3.4.22.40] KAE1, tsaD, QRI7; N6-L-threonylcarbamoyladenine synthase [EC:2.3.1.234] hslV, clpQ; ATP-dependent HslUV protease, peptidase subunit HslV [EC:3.4.25.2] fnr; CRP/FNR family transcriptional regulator, anaerobic regulatory protein yhgE; putative membrane protein E3.5.1.1, ansA, ansB; L-asparaginase [EC:3.5.1.1] glsA, GLS; glutaminase [EC:3.5.1.2] E3.5.1.4, amiE; amidase [EC:3.5.1.4] E3.5.1.24; choloylglycine hydrolase [EC:3.5.1.24] nagA, AMDHD2; N-acetylglucosamine-6-phosphate deacetylase [EC:3.5.1.25] PDF, def; peptide deformylase [EC:3.5.1.88] URA4, pyrC; dihydroorotase [EC:3.5.2.3] ampC; beta-lactamase class C [EC:3.5.2.6] E3.5.3.1, rocF, arg; arginase [EC:3.5.3.1] arcA; arginine deiminase [EC:3.5.3.6] DDAH, ddaH; dimethylargininase [EC:3.5.3.18] ade; adenine deaminase [EC:3.5.4.2] add, ADA; adenosine deaminase [EC:3.5.4.4] cdd, CDA; cytidine deaminase [EC:3.5.4.5] folD; methylenetetrahydrofolate dehydrogenase (NADP+) / methenyltetrahydrofolate cyclohydrolase [EC:1.5.1.5 3.5.4.9] comEB; dCMP deaminase [EC:3.5.4.12] acyP; acylphosphatase [EC:3.6.1.7] nudF; ADP-ribose pyrophosphatase [EC:3.6.1.13] dut, DUT; dUTP pyrophosphatase [EC:3.6.1.23] ppx-gppA; exopolyphosphatase / guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase [EC:3.6.1.11 3.6.1.40] E3.6.3.2, mgtA, mgtB; Mg2+-importing ATPase [EC:3.6.3.2] copB; Cu2+-exporting ATPase [EC:3.6.3.4] zntA; Cd2+/Zn2+-exporting ATPase [EC:3.6.3.3 3.6.3.5] E3.6.3.8; Ca2+-transporting ATPase [EC:3.6.3.8] E3.8.1.2; 2-haloacid dehalogenase [EC:3.8.1.2] pdaA; peptidoglycan-N-acetylmuramic acid deacetylase [EC:3.5.1.-] oadA; oxaloacetate decarboxylase, alpha subunit [EC:4.1.1.3] alsD, budA, aldC; acetolactate decarboxylase [EC:4.1.1.5] oxc; oxalyl-CoA decarboxylase [EC:4.1.1.8] E4.1.1.17, ODC1, speC, speF; ornithine decarboxylase [EC:4.1.1.17] lysA; diaminopimelate decarboxylase [EC:4.1.1.20] purE; 5-(carboxyamino)imidazole ribonucleotide mutase [EC:5.4.99.18] purK; 5-(carboxyamino)imidazole ribonucleotide synthase [EC:6.3.4.18] pyrF; orotidine-5'-phosphate decarboxylase [EC:4.1.1.23] ppc; phosphoenolpyruvate carboxylase [EC:4.1.1.31] MVD, mvaD; diphosphomevalonate decarboxylase [EC:4.1.1.33] PPCDC, coaC; phosphopantothenoylcysteine decarboxylase [EC:4.1.1.36] pcaC; 4-carboxymuconolactone decarboxylase [EC:4.1.1.44] trpC; indole-3-glycerol phosphate synthase [EC:4.1.1.48] E4.1.1.49, pckA; phosphoenolpyruvate carboxykinase (ATP) [EC:4.1.1.49] speD, AMD1; S-adenosylmethionine decarboxylase [EC:4.1.1.50] psd, PISD; phosphatidylserine decarboxylase [EC:4.1.1.65] Diabetes Page 144 of 230

deoC, DERA; deoxyribose-phosphate aldolase [EC:4.1.2.4] xfp, xpk; xylulose-5-phosphate/fructose-6-phosphate phosphoketolase [EC:4.1.2.9 4.1.2.22] FBA, fbaA; fructose-bisphosphate aldolase, class II [EC:4.1.2.13] eda; 2-dehydro-3-deoxyphosphogluconate aldolase / (4S)-4-hydroxy-2-oxoglutarate aldolase [EC:4.1.2.14 4.1.3.42] E2.5.1.54, aroF, aroG, aroH; 3-deoxy-7-phosphoheptulonate synthase [EC:2.5.1.54] fucA; L-fuculose-phosphate aldolase [EC:4.1.2.17] rhaD; rhamnulose-1-phosphate aldolase [EC:4.1.2.19] lacD; tagatose 1,6-diphosphate aldolase [EC:4.1.2.40] E4.1.3.3, nanA, NPL; N-acetylneuraminate lyase [EC:4.1.3.3] E2.3.3.10; hydroxymethylglutaryl-CoA synthase [EC:2.3.3.10] citF; citrate lyase subunit alpha / citrate CoA-transferase [EC:2.8.3.10] citD; citrate lyase subunit gamma (acyl carrier protein) CS, gltA; citrate synthase [EC:2.3.3.1] leuA; 2-isopropylmalate synthase [EC:2.3.3.13] E2.2.1.6L, ilvB, ilvG, ilvI; acetolactate synthase I/II/III large subunit [EC:2.2.1.6] E2.2.1.6S, ilvH, ilvN; acetolactate synthase I/III small subunit [EC:2.2.1.6] trpE; anthranilate synthase component I [EC:4.1.3.27] trpG; anthranilate synthase component II [EC:4.1.3.27] dxs; 1-deoxy-D-xylulose-5-phosphate synthase [EC:2.2.1.7] pabA; para-aminobenzoate synthetase component II [EC:2.6.1.85] E4.2.1.2AA, fumA; fumarate hydratase subunit alpha [EC:4.2.1.2] E4.2.1.2AB, fumB; fumarate hydratase subunit beta [EC:4.2.1.2] E4.2.1.2B, fumC; fumarate hydratase, class II [EC:4.2.1.2] ACO, acnA; aconitate hydratase [EC:4.2.1.3] ilvD; dihydroxy-acid dehydratase [EC:4.2.1.9] ENO, eno; enolase [EC:4.2.1.11] hisB; imidazoleglycerol-phosphate dehydratase [EC:4.2.1.19] trpA; tryptophan synthase alpha chain [EC:4.2.1.20] trpB; tryptophan synthase beta chain [EC:4.2.1.20] leuC; 3-isopropylmalate/(R)-2-methylmalate dehydratase large subunit [EC:4.2.1.33 4.2.1.35] leuD; 3-isopropylmalate/(R)-2-methylmalate dehydratase small subunit [EC:4.2.1.33 4.2.1.35] E4.2.1.46, rfbB, rffG; dTDP-glucose 4,6-dehydratase [EC:4.2.1.46] dapA; 4-hydroxy-tetrahydrodipicolinate synthase [EC:4.3.3.7] crt; enoyl-CoA hydratase [EC:4.2.1.17] thrC; threonine synthase [EC:4.2.3.1] aroB; 3-dehydroquinate synthase [EC:4.2.3.4] aroC; chorismate synthase [EC:4.2.3.5] cysK; cysteine synthase A [EC:2.5.1.47] metB; cystathionine gamma-synthase [EC:2.5.1.48] E2.5.1.49, metY; O-acetylhomoserine (thiol)-lyase [EC:2.5.1.49] aspA; aspartate ammonia-lyase [EC:4.3.1.1] hutH, HAL; histidine ammonia-lyase [EC:4.3.1.3] E4.3.1.15; diaminopropionate ammonia-lyase [EC:4.3.1.15] E4.3.1.17, sdaA; L-serine dehydratase [EC:4.3.1.17] E4.3.1.19, ilvA, tdcB; threonine dehydratase [EC:4.3.1.19] argH, ASL; argininosuccinate lyase [EC:4.3.2.1] purB, ADSL; adenylosuccinate lyase [EC:4.3.2.2] metC; cystathionine beta-lyase [EC:4.4.1.8] E4.6.1.13, plc; 1-phosphatidylinositol phosphodiesterase [EC:4.6.1.13] hemH, FECH; ferrochelatase [EC:4.99.1.1] Page 145 of 230 Diabetes

alr; alanine racemase [EC:5.1.1.1] murI; glutamate racemase [EC:5.1.1.3] dapF; diaminopimelate epimerase [EC:5.1.1.7] E5.1.1.13; aspartate racemase [EC:5.1.1.13] rpe, RPE; ribulose-phosphate 3-epimerase [EC:5.1.3.1] galE, GALE; UDP-glucose 4-epimerase [EC:5.1.3.2] galM, GALM; aldose 1-epimerase [EC:5.1.3.3] nanE; N-acylglucosamine-6-phosphate 2-epimerase [EC:5.1.3.9] rfbC, rmlC; dTDP-4-dehydrorhamnose 3,5-epimerase [EC:5.1.3.13] wecB; UDP-N-acetylglucosamine 2-epimerase (non-hydrolysing) [EC:5.1.3.14] E5.2.1.8; peptidylprolyl isomerase [EC:5.2.1.8] TPI, tpiA; triosephosphate isomerase (TIM) [EC:5.3.1.1] rpiA; ribose 5-phosphate isomerase A [EC:5.3.1.6] rpiB; ribose 5-phosphate isomerase B [EC:5.3.1.6] manA, MPI; mannose-6-phosphate isomerase [EC:5.3.1.8] GPI, pgi; glucose-6-phosphate isomerase [EC:5.3.1.9] yicI; alpha-D-xyloside xylohydrolase [EC:3.2.1.177] uxaC; glucuronate isomerase [EC:5.3.1.12] rhaA; L-rhamnose isomerase [EC:5.3.1.14] hisA; phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase [EC:5.3.1.16] E5.3.1.26, lacA, lacB; galactose-6-phosphate isomerase [EC:5.3.1.26] praC, xylH; 4-oxalocrotonate tautomerase [EC:5.3.2.6] idi, IDI; isopentenyl-diphosphate delta-isomerase [EC:5.3.3.2] PGAM, gpmA; 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase [EC:5.4.2.11] pgm; phosphoglucomutase [EC:5.4.2.2] pgmB; beta-phosphoglucomutase [EC:5.4.2.6] deoB; phosphopentomutase [EC:5.4.2.7] glf; UDP-galactopyranose mutase [EC:5.4.99.9] INO1, ISYNA1; myo-inositol-1-phosphate synthase [EC:5.5.1.4] YARS, tyrS; tyrosyl-tRNA synthetase [EC:6.1.1.1] WARS, trpS; tryptophanyl-tRNA synthetase [EC:6.1.1.2] TARS, thrS; threonyl-tRNA synthetase [EC:6.1.1.3] LARS, leuS; leucyl-tRNA synthetase [EC:6.1.1.4] IARS, ileS; isoleucyl-tRNA synthetase [EC:6.1.1.5] AARS, alaS; alanyl-tRNA synthetase [EC:6.1.1.7] VARS, valS; valyl-tRNA synthetase [EC:6.1.1.9] MARS, metG; methionyl-tRNA synthetase [EC:6.1.1.10] SARS, serS; seryl-tRNA synthetase [EC:6.1.1.11] DARS, aspS; aspartyl-tRNA synthetase [EC:6.1.1.12] glyQ; glycyl-tRNA synthetase alpha chain [EC:6.1.1.14] glyS; glycyl-tRNA synthetase beta chain [EC:6.1.1.14] PARS, proS; prolyl-tRNA synthetase [EC:6.1.1.15] CARS, cysS; cysteinyl-tRNA synthetase [EC:6.1.1.16] RARS, argS; arginyl-tRNA synthetase [EC:6.1.1.19] FARSA, pheS; phenylalanyl-tRNA synthetase alpha chain [EC:6.1.1.20] FARSB, pheT; phenylalanyl-tRNA synthetase beta chain [EC:6.1.1.20] HARS, hisS; histidyl-tRNA synthetase [EC:6.1.1.21] NARS, asnS; asparaginyl-tRNA synthetase [EC:6.1.1.22] ACSL, fadD; long-chain acyl-CoA synthetase [EC:6.2.1.3] sucD; succinyl-CoA synthetase alpha subunit [EC:6.2.1.5] Diabetes Page 146 of 230

sucC; succinyl-CoA synthetase beta subunit [EC:6.2.1.5] citC; [citrate (pro-3S)-lyase] ligase [EC:6.2.1.22] asnA; aspartate--ammonia ligase [EC:6.3.1.1] glnA, GLUL; glutamine synthetase [EC:6.3.1.2] nadE; NAD+ synthase [EC:6.3.1.5] ddl; D-alanine-D-alanine ligase [EC:6.3.2.4] PPCS, coaB; phosphopantothenate-cysteine ligase [EC:6.3.2.5] purC; phosphoribosylaminoimidazole-succinocarboxamide synthase [EC:6.3.2.6] murC; UDP-N-acetylmuramate--alanine ligase [EC:6.3.2.8] murD; UDP-N-acetylmuramoylalanine--D-glutamate ligase [EC:6.3.2.9] rex; redox-sensing transcriptional repressor murE; UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase [EC:6.3.2.13] murF; UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [EC:6.3.2.10] MTHFS; 5-formyltetrahydrofolate cyclo-ligase [EC:6.3.3.2] pyrG, CTPS; CTP synthase [EC:6.3.4.2] fhs; formate--tetrahydrofolate ligase [EC:6.3.4.3] purA, ADSS; adenylosuccinate synthase [EC:6.3.4.4] argG, ASS1; argininosuccinate synthase [EC:6.3.4.5] purD; phosphoribosylamine--glycine ligase [EC:6.3.4.13] guaA, GMPS; GMP synthase (glutamine-hydrolysing) [EC:6.3.5.2] purL, PFAS; phosphoribosylformylglycinamidine synthase [EC:6.3.5.3] asnB, ASNS; asparagine synthase (glutamine-hydrolysing) [EC:6.3.5.4] carB, CPA2; carbamoyl-phosphate synthase large subunit [EC:6.3.5.5] carA, CPA1; carbamoyl-phosphate synthase small subunit [EC:6.3.5.5] PC, pyc; pyruvate carboxylase [EC:6.4.1.1] accA; acetyl-CoA carboxylase carboxyl transferase subunit alpha [EC:6.4.1.2] accD; acetyl-CoA carboxylase carboxyl transferase subunit beta [EC:6.4.1.2] E6.5.1.2, ligA, ligB; DNA ligase (NAD+) [EC:6.5.1.2] ligT; 2'-5' RNA ligase [EC:6.5.1.-] 16SrRNA, rrs; 16S ribosomal RNA rnpB; M1 RNA 23SrRNA, rrl; 23S ribosomal RNA 5SrRNA, rrf; 5S ribosomal RNA ABC.X4.S; putative ABC transport system substrate-binding protein ABC-2.A; ABC-2 type transport system ATP-binding protein ABC-2.P; ABC-2 type transport system permease protein livG; branched-chain amino acid transport system ATP-binding protein livF; branched-chain amino acid transport system ATP-binding protein livH; branched-chain amino acid transport system permease protein livM; branched-chain amino acid transport system permease protein ABC.CD.A; putative ABC transport system ATP-binding protein ABC.CD.P; putative ABC transport system permease protein afuC, fbpC; iron(III) transport system ATP-binding protein [EC:3.6.3.30] afuB, fbpB; iron(III) transport system permease protein afuA, fbpA; iron(III) transport system substrate-binding protein ABC.FEV.A; iron complex transport system ATP-binding protein [EC:3.6.3.34] ABC.FEV.P; iron complex transport system permease protein modC; molybdate transport system ATP-binding protein [EC:3.6.3.29] modB; molybdate transport system permease protein modA; molybdate transport system substrate-binding protein Page 147 of 230 Diabetes

ABC.MS.P; multiple sugar transport system permease protein ABC.MS.P1; multiple sugar transport system permease protein ABC.MS.S; multiple sugar transport system substrate-binding protein ABC.PA.A; polar amino acid transport system ATP-binding protein [EC:3.6.3.21] ABC.PA.P; polar amino acid transport system permease protein ABC.PA.S; polar amino acid transport system substrate-binding protein ABC.PE.A; peptide/nickel transport system ATP-binding protein ABC.PE.A1; peptide/nickel transport system ATP-binding protein ABC.PE.P; peptide/nickel transport system permease protein ABC.PE.P1; peptide/nickel transport system permease protein ABC.PE.S; peptide/nickel transport system substrate-binding protein pstB; phosphate transport system ATP-binding protein [EC:3.6.3.27] pstC; phosphate transport system permease protein pstA; phosphate transport system permease protein phoU; phosphate transport system protein pstS; phosphate transport system substrate-binding protein phnC; phosphonate transport system ATP-binding protein [EC:3.6.3.28] phnE; phosphonate transport system permease protein phnD; phosphonate transport system substrate-binding protein cysA; sulfate transport system ATP-binding protein [EC:3.6.3.25] cysU; sulfate transport system permease protein cysW; sulfate transport system permease protein cysP, sbp; sulfate transport system substrate-binding protein ABC.SS.A; simple sugar transport system ATP-binding protein [EC:3.6.3.17] ABC.SS.P; simple sugar transport system permease protein ABC.X2.A; putative ABC transport system ATP-binding protein ABC.X2.P; putative ABC transport system permease protein metN; D-methionine transport system ATP-binding protein metI; D-methionine transport system permease protein metQ; D-methionine transport system substrate-binding protein ABC.ZM.A; zinc/manganese transport system ATP-binding protein ABC.ZM.P; zinc/manganese transport system permease protein ABC.ZM.S; zinc/manganese transport system substrate-binding protein acpP; acyl carrier protein agaS; tagatose-6-phosphate ketose/aldose isomerase [EC:5.-.-.-] dnaD; DNA replication protein ATPF0A, atpB; F-type H+-transporting ATPase subunit a ATPF0B, atpF; F-type H+-transporting ATPase subunit b ATPF0C, atpE; F-type H+-transporting ATPase subunit c ATPF1A, atpA; F-type H+-transporting ATPase subunit alpha [EC:3.6.3.14] ATPF1B, atpD; F-type H+-transporting ATPase subunit beta [EC:3.6.3.14] ATPF1D, atpH; F-type H+-transporting ATPase subunit delta ATPF1E, atpC; F-type H+-transporting ATPase subunit epsilon ATPF1G, atpG; F-type H+-transporting ATPase subunit gamma ATPVA, ntpA, atpA; V/A-type H+-transporting ATPase subunit A [EC:3.6.3.14] ATPVE, ntpE, atpE; V/A-type H+-transporting ATPase subunit E ATPVF, ntpF, atpF; V/A-type H+-transporting ATPase subunit F accB, bccP; acetyl-CoA carboxylase biotin carboxyl carrier protein ccmA; heme exporter protein A [EC:3.6.3.41] ccmB; heme exporter protein B Diabetes Page 148 of 230

ccmC; heme exporter protein C ccmE; cytochrome c-type biogenesis protein CcmE ccmF; cytochrome c-type biogenesis protein CcmF thrH; phosphoserine / homoserine phosphotransferase [EC:3.1.3.3 2.7.1.39] yggT; YggT family protein cobC2, cobC, phpB; alpha-ribazole phosphatase [EC:3.1.3.73] comC; leader peptidase (prepilin peptidase) / N-methyltransferase [EC:3.4.23.43 2.1.1.-] comEA; competence protein ComEA comEC; competence protein ComEC comFA; competence protein ComFA comFC; competence protein ComFC comGA; competence protein ComGA comGB; competence protein ComGB comGC; competence protein ComGC comGD; competence protein ComGD comGF; competence protein ComGF cpaB, rcpC; pilus assembly protein CpaB cpaE, tadZ; pilus assembly protein CpaE cpaF, tadA; pilus assembly protein CpaF dnaA; chromosomal replication initiator protein dnaB; replicative DNA helicase [EC:3.6.4.12] dnaC; DNA replication protein DnaC dnaG; DNA primase [EC:2.7.7.-] dpo; DNA polymerase bacteriophage-type [EC:2.7.7.7] DPO1, polA; DNA polymerase I [EC:2.7.7.7] DPO3A1, dnaE; DNA polymerase III subunit alpha [EC:2.7.7.7] DPO3B, dnaN; DNA polymerase III subunit beta [EC:2.7.7.7] DPO3D1, holA; DNA polymerase III subunit delta [EC:2.7.7.7] DPO3D2, holB; DNA polymerase III subunit delta' [EC:2.7.7.7] DPO3E, dnaQ; DNA polymerase III subunit epsilon [EC:2.7.7.7] DPO3G, dnaX; DNA polymerase III subunit gamma/tau [EC:2.7.7.7] DPO4, dinB; DNA polymerase IV [EC:2.7.7.7] elaA; ElaA protein fusA, GFM, EFG; elongation factor G efp; elongation factor P tsf, TSFM; elongation factor Ts tuf, TUFM; elongation factor Tu entE, dhbE, vibE, mxcE; 2,3-dihydroxybenzoate-AMP ligase [EC:2.7.7.58] fabK; enoyl-[acyl-carrier protein] reductase II [EC:1.3.1.9] fabZ; 3-hydroxyacyl-[acyl-carrier-protein] dehydratase [EC:4.2.1.59] fliNY, fliN; flagellar motor switch protein FliN/FliY rdgB; XTP/dITP diphosphohydrolase [EC:3.6.1.66] fucP; MFS transporter, FHS family, L-fucose permease gatA, QRSL1; aspartyl-tRNA(Asn)/glutamyl-tRNA(Gln) amidotransferase subunit A [EC:6.3.5.6 6.3.5.7] gatB, PET112; aspartyl-tRNA(Asn)/glutamyl-tRNA(Gln) amidotransferase subunit B [EC:6.3.5.6 6.3.5.7] gatC, GATC; aspartyl-tRNA(Asn)/glutamyl-tRNA(Gln) amidotransferase subunit C [EC:6.3.5.6 6.3.5.7] gcvH, GCSH; glycine cleavage system H protein GLPF; glycerol uptake facilitator protein glpT; MFS transporter, OPA family, glycerol-3-phosphate transporter gyrA; DNA gyrase subunit A [EC:5.99.1.3] Page 149 of 230 Diabetes

gyrB; DNA gyrase subunit B [EC:5.99.1.3] E5.1.3.7, wbpP; UDP-N-acetylglucosamine 4-epimerase [EC:5.1.3.7] K02481; two-component system, NtrC family, response regulator K02484; two-component system, OmpR family, sensor kinase [EC:2.7.13.3] hemK, prmC, HEMK; release factor glutamine methyltransferase [EC:2.1.1.297] hemN, hemZ; oxygen-independent coproporphyrinogen III oxidase [EC:1.3.99.22] hisF; cyclase [EC:4.1.3.-] hisH; glutamine amidotransferase [EC:2.4.2.-] hisZ; ATP phosphoribosyltransferase regulatory subunit HINT1, hinT, hit; histidine triad (HIT) family protein lpxL, htrB; KDO2-lipid IV(A) lauroyltransferase [EC:2.3.1.241] infA; translation initiation factor IF-1 infB, MTIF2; translation initiation factor IF-2 infC, MTIF3; translation initiation factor IF-3 ksgA; 16S rRNA (adenine1518-N6/adenine1519-N6)-dimethyltransferase [EC:2.1.1.182] lacI, galR; LacI family transcriptional regulator lacR; DeoR family transcriptional regulator, lactose phosphotransferase system repressor lacT; transcriptional antiterminator menA; 1,4-dihydroxy-2-naphthoate octaprenyltransferase [EC:2.5.1.74 2.5.1.-] menC; O-succinylbenzoate synthase [EC:4.2.1.113] menF; menaquinone-specific isochorismate synthase [EC:5.4.4.2] motA; chemotaxis protein MotA murG; UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase [EC:2.4.1.227] nagB, GNPDA; glucosamine-6-phosphate deaminase [EC:3.5.99.6] napA; periplasmic nitrate reductase NapA [EC:1.7.99.4] napB; cytochrome c-type protein NapB napD; periplasmic nitrate reductase NapD napG; ferredoxin-type protein NapG napH; ferredoxin-type protein NapH nusA; N utilization substance protein A nusG; transcriptional antiterminator NusG pabC; 4-amino-4-deoxychorismate lyase [EC:4.1.3.38] parC; topoisomerase IV subunit A [EC:5.99.1.-] parE; topoisomerase IV subunit B [EC:5.99.1.-] pilD, pppA; leader peptidase (prepilin peptidase) / N-methyltransferase [EC:3.4.23.43 2.1.1.-] prmA; ribosomal protein L11 methyltransferase [EC:2.1.1.-] PTS-Aga-EIIA, agaF; PTS system, N-acetylgalactosamine-specific IIA component [EC:2.7.1.69] PTS-Arb-EIIB, glvB; PTS system, arbutin-like IIB component [EC:2.7.1.69] PTS-Arb-EIIC, glvC; PTS system, arbutin-like IIC component PTS-Bgl-EIIA, bglF; PTS system, beta-glucosides-specific IIA component [EC:2.7.1.69] PTS-Bgl-EIIB, bglF; PTS system, beta-glucosides-specific IIB component [EC:2.7.1.69] PTS-Bgl-EIIC, bglF; PTS system, beta-glucosides-specific IIC component PTS-Cel-EIIA, celC; PTS system, cellobiose-specific IIA component [EC:2.7.1.69] PTS-Cel-EIIB, celA; PTS system, cellobiose-specific IIB component [EC:2.7.1.69] PTS-Cel-EIIC, celB; PTS system, cellobiose-specific IIC component PTS-Fru-EIIA, fruB; PTS system, fructose-specific IIA component [EC:2.7.1.69] PTS-Fru-EIIB, fruA; PTS system, fructose-specific IIB component [EC:2.7.1.69] PTS-Fru-EIIC, fruA; PTS system, fructose-specific IIC component PTS-Gat-EIIA, gatA; PTS system, galactitol-specific IIA component [EC:2.7.1.69] PTS-Gat-EIIB, gatB; PTS system, galactitol-specific IIB component [EC:2.7.1.69] Diabetes Page 150 of 230

PTS-Gat-EIIC, gatC; PTS system, galactitol-specific IIC component PTS-Glc-EIIA, crr; PTS system, glucose-specific IIA component [EC:2.7.1.69] PTS-Glc-EIIB, ptsG; PTS system, glucose-specific IIB component [EC:2.7.1.69] PTS-Glc-EIIC, ptsG; PTS system, glucose-specific IIC component PTS-Gut-EIIA, srlB; PTS system, glucitol/sorbitol-specific IIA component [EC:2.7.1.69] PTS-Lac-EIIA, lacF; PTS system, lactose-specific IIA component [EC:2.7.1.69] PTS-Lac-EIIB, lacE; PTS system, lactose-specific IIB component [EC:2.7.1.69] PTS-Lac-EIIC, lacE; PTS system, lactose-specific IIC component PTS-Man-EIIA, manX; PTS system, mannose-specific IIA component [EC:2.7.1.69] PTS-Man-EIIB, manX; PTS system, mannose-specific IIB component [EC:2.7.1.69] PTS-Man-EIIC, manY; PTS system, mannose-specific IIC component PTS-Man-EIID, manZ; PTS system, mannose-specific IID component PTS-Mtl-EIIA, mtlA; PTS system, mannitol-specific IIA component [EC:2.7.1.69] PTS-Mtl-EIIB, mtlA; PTS system, mannitol-specific IIB component [EC:2.7.1.69] PTS-Mtl-EIIC, mtlA; PTS system, mannitol-specific IIC component PTS-Scr-EIIA, scrA; PTS system, sucrose-specific IIA component [EC:2.7.1.69] PTS-Scr-EIIB, scrA; PTS system, sucrose-specific IIB component [EC:2.7.1.69] PTS-Scr-EIIC, scrA; PTS system, sucrose-specific IIC component PTS-Ula-EIIB, ulaB, sgaB; PTS system, ascorbate-specific IIB component [EC:2.7.1.69] pyrDII; dihydroorotate dehydrogenase electron transfer subunit pyrP, uraA; uracil permease pyrR; pyrimidine operon attenuation protein / uracil phosphoribosyltransferase [EC:2.4.2.9] rbfA; ribosome-binding factor A prfA, MTRF1, MRF1; peptide chain release factor 1 prfB; peptide chain release factor 2 prfC; peptide chain release factor 3 frr, MRRF, RRF; ribosome recycling factor wecA, tagO, rfe; UDP-GlcNAc:undecaprenyl-phosphate GlcNAc-1-phosphate transferase [EC:2.7.8.33] ribT; riboflavin biosynthesis RibT protein rimM; 16S rRNA processing protein RimM RP-L1, MRPL1, rplA; large subunit ribosomal protein L1 RP-L10, MRPL10, rplJ; large subunit ribosomal protein L10 RP-L11, MRPL11, rplK; large subunit ribosomal protein L11 RP-L13, MRPL13, rplM; large subunit ribosomal protein L13 RP-L14, MRPL14, rplN; large subunit ribosomal protein L14 RP-L15, MRPL15, rplO; large subunit ribosomal protein L15 RP-L16, MRPL16, rplP; large subunit ribosomal protein L16 RP-L17, MRPL17, rplQ; large subunit ribosomal protein L17 RP-L18, MRPL18, rplR; large subunit ribosomal protein L18 RP-L19, MRPL19, rplS; large subunit ribosomal protein L19 RP-L2, MRPL2, rplB; large subunit ribosomal protein L2 RP-L20, MRPL20, rplT; large subunit ribosomal protein L20 RP-L21, MRPL21, rplU; large subunit ribosomal protein L21 RP-L22, MRPL22, rplV; large subunit ribosomal protein L22 RP-L23, MRPL23, rplW; large subunit ribosomal protein L23 RP-L24, MRPL24, rplX; large subunit ribosomal protein L24 RP-L25, rplY; large subunit ribosomal protein L25 RP-L27, MRPL27, rpmA; large subunit ribosomal protein L27 RP-L28, MRPL28, rpmB; large subunit ribosomal protein L28 RP-L29, rpmC; large subunit ribosomal protein L29 Page 151 of 230 Diabetes

RP-L3, MRPL3, rplC; large subunit ribosomal protein L3 RP-L30, MRPL30, rpmD; large subunit ribosomal protein L30 RP-L31, rpmE; large subunit ribosomal protein L31 RP-L32, MRPL32, rpmF; large subunit ribosomal protein L32 RP-L33, MRPL33, rpmG; large subunit ribosomal protein L33 RP-L34, MRPL34, rpmH; large subunit ribosomal protein L34 RP-L35, MRPL35, rpmI; large subunit ribosomal protein L35 RP-L36, MRPL36, rpmJ; large subunit ribosomal protein L36 RP-L4, MRPL4, rplD; large subunit ribosomal protein L4 RP-L5, MRPL5, rplE; large subunit ribosomal protein L5 RP-L6, MRPL6, rplF; large subunit ribosomal protein L6 RP-L7, MRPL12, rplL; large subunit ribosomal protein L7/L12 RP-L9, MRPL9, rplI; large subunit ribosomal protein L9 RP-S1, rpsA; small subunit ribosomal protein S1 RP-S10, MRPS10, rpsJ; small subunit ribosomal protein S10 RP-S11, MRPS11, rpsK; small subunit ribosomal protein S11 RP-S12, MRPS12, rpsL; small subunit ribosomal protein S12 RP-S13, rpsM; small subunit ribosomal protein S13 RP-S14, MRPS14, rpsN; small subunit ribosomal protein S14 RP-S15, MRPS15, rpsO; small subunit ribosomal protein S15 RP-S16, MRPS16, rpsP; small subunit ribosomal protein S16 RP-S17, MRPS17, rpsQ; small subunit ribosomal protein S17 RP-S18, MRPS18, rpsR; small subunit ribosomal protein S18 RP-S19, rpsS; small subunit ribosomal protein S19 RP-S2, MRPS2, rpsB; small subunit ribosomal protein S2 RP-S20, rpsT; small subunit ribosomal protein S20 RP-S21, MRPS21, rpsU; small subunit ribosomal protein S21 RP-S3, rpsC; small subunit ribosomal protein S3 RP-S4, rpsD; small subunit ribosomal protein S4 RP-S5, MRPS5, rpsE; small subunit ribosomal protein S5 RP-S6, MRPS6, rpsF; small subunit ribosomal protein S6 RP-S7, MRPS7, rpsG; small subunit ribosomal protein S7 RP-S8, rpsH; small subunit ribosomal protein S8 RP-S9, MRPS9, rpsI; small subunit ribosomal protein S9 rpoA; DNA-directed RNA polymerase subunit alpha [EC:2.7.7.6] rpoB; DNA-directed RNA polymerase subunit beta [EC:2.7.7.6] rpoC; DNA-directed RNA polymerase subunit beta' [EC:2.7.7.6] rpoE; DNA-directed RNA polymerase subunit delta rpoZ; DNA-directed RNA polymerase subunit omega [EC:2.7.7.6] secA; preprotein translocase subunit SecA secE; preprotein translocase subunit SecE secG; preprotein translocase subunit SecG secY; preprotein translocase subunit SecY SIG1, rpoD; RNA polymerase primary sigma factor SIG3.4; RNA polymerase sporulation-specific sigma factor sprL; SprT-like protein lepB; signal peptidase I [EC:3.4.21.89] lspA; signal peptidase II [EC:3.4.23.36] SRP54, ffh; signal recognition particle subunit SRP54 ftsY; fused signal recognition particle receptor Diabetes Page 152 of 230

ssb; single-strand DNA-binding protein THI4, THI1; thiamine thiazole synthase thiG; thiazole synthase [EC:2.8.1.10] thiI; thiamine biosynthesis protein ThiI thiJ; 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis topA; DNA topoisomerase I [EC:5.99.1.2] truB, PUS4, TRUB1; tRNA pseudouridine55 synthase [EC:5.4.99.25] ubiE; demethylmenaquinone methyltransferase / 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase [EC:2.1.1.163 2.1.1.201] virD4, lvhD4; type IV secretion system protein VirD4 yajC; preprotein translocase subunit YajC rumA; 23S rRNA (uracil1939-C5)-methyltransferase [EC:2.1.1.190] trmL, cspR; tRNA (cytidine/uridine-2'-O-)-methyltransferase [EC:2.1.1.207] yidC, spoIIIJ, OXA1; YidC/Oxa1 family membrane protein insertase rlmB; 23S rRNA (guanosine2251-2'-O)-methyltransferase [EC:2.1.1.185] gmhA, lpcA; D-sedoheptulose 7-phosphate isomerase [EC:5.3.1.28] gmhB; D-glycero-D-manno-heptose 1,7-bisphosphate phosphatase [EC:3.1.3.82 3.1.3.83] mscL; large conductance mechanosensitive channel corA; magnesium transporter TC.GPH; glycoside/pentoside/hexuronide:cation symporter, GPH family TC.AAT; amino acid transporter, AAT family TC.APA; basic amino acid/polyamine antiporter, APA family lctP; lactate permease TC.POT; proton-dependent oligopeptide transporter, POT family TC.NSS; neurotransmitter:Na+ symporter, NSS family TC.AGCS; alanine or glycine:cation symporter, AGCS family TC.LIVCS; branched-chain amino acid:cation transporter, LIVCS family nhaC; Na+:H+ antiporter, NhaC family TC.CPA1; monovalent cation:H+ antiporter, CPA1 family TC.DASS; divalent anion:Na+ symporter, DASS family amt, AMT, MEP; ammonium transporter, Amt family TC.SULP; sulfate permease, SulP family mntH; manganese transport protein TC.PST; polysaccharide transporter, PST family pabBC; para-aminobenzoate synthetase / 4-amino-4-deoxychorismate lyase [EC:2.6.1.85 4.1.3.38] dnaB2, dnaB; replication initiation and membrane attachment protein butA, budC; meso-butanediol dehydrogenase / (S,S)-butanediol dehydrogenase / diacetyl reductase [EC:1.1.1.- 1.1.1.76 1.1.1.304] dltA; D-alanine--poly(phosphoribitol) ligase subunit 1 [EC:6.1.1.13] argR, ahrC; transcriptional regulator of arginine metabolism tatD; TatD DNase family protein [EC:3.1.21.-] hsdM; type I restriction enzyme M protein [EC:2.1.1.72] ugtP; processive 1,2-diacylglycerol beta-glucosyltransferase [EC:2.4.1.157 2.4.1.315] glmM; phosphoglucosamine mutase [EC:5.4.2.10] fruR2, fruR; DeoR family transcriptional regulator, fructose operon transcriptional repressor spoU; RNA methyltransferase, TrmH family mraW, rsmH; 16S rRNA (cytosine1402-N4)-methyltransferase [EC:2.1.1.199] trmB, METTL1; tRNA (guanine-N7-)-methyltransferase [EC:2.1.1.33] mscS; small conductance mechanosensitive channel MFS.SP; MFS transporter, SP family, sugar porter, other TC.BASS; bile acid:Na+ symporter, BASS family TC.KEF; monovalent cation:H+ antiporter-2, CPA2 family Page 153 of 230 Diabetes

E2.1.1.148, thyX, thy1; thymidylate synthase (FAD) [EC:2.1.1.148] ftsK, spoIIIE; DNA segregation ATPase FtsK/SpoIIIE, S-DNA-T family rnhA, RNASEH1; ribonuclease HI [EC:3.1.26.4] rnhB; ribonuclease HII [EC:3.1.26.4] rnhC; ribonuclease HIII [EC:3.1.26.4] PTS-Ula-EIIC, ulaA, sgaT; PTS system, ascorbate-specific IIC component glvR; RpiR family transcriptional regulator, glv operon transcriptional regulator mtlR; mannitol operon transcriptional antiterminator scrR; LacI family transcriptional regulator, sucrose operon repressor treR2, treR; GntR family transcriptional regulator, trehalose operon transcriptional repressor licT, bglG; beta-glucoside operon transcriptional antiterminator yydK; GntR family transcriptional regulator, transcriptional regulator of bglA ydhQ; GntR family transcriptional regulator gidA, mnmG, MTO1; tRNA uridine 5-carboxymethylaminomethyl modification enzyme parA, soj; chromosome partitioning protein parB, spo0J; chromosome partitioning protein, ParB family trkA; trk system potassium uptake protein TrkA rsmB, sun; 16S rRNA (cytosine967-C5)-methyltransferase [EC:2.1.1.176] gidB, rsmG; 16S rRNA (guanine527-N7)-methyltransferase [EC:2.1.1.170] DPO5C, umuC; DNA polymerase V coxS; carbon-monoxide dehydrogenase small subunit [EC:1.2.99.2] fixA, etfB; electron transfer flavoprotein beta subunit bioY; biotin transport system substrate-specific component birA; BirA family transcriptional regulator, biotin operon repressor / biotin-[acetyl-CoA-carboxylase] ligase [EC:6.3.4.15] coaX; type III pantothenate kinase [EC:2.7.1.33] smc; chromosome segregation protein hupB; DNA-binding protein HU-beta ftsZ; cell division protein FtsZ torD; TorA specific chaperone rnpA; ribonuclease P protein component [EC:3.1.26.5] clpX, CLPX; ATP-dependent Clp protease ATP-binding subunit ClpX tig; trigger factor sbcC; exonuclease SbcC sbcD; exonuclease SbcD kup; KUP system potassium uptake protein ruvA; holliday junction DNA helicase RuvA [EC:3.6.4.12] ruvB; holliday junction DNA helicase RuvB [EC:3.6.4.12] recA; recombination protein RecA mutS; DNA mismatch repair protein MutS cvpA; membrane protein required for colicin V production BCP, PRXQ, DOT5; peroxiredoxin Q/BCP [EC:1.11.1.15] recX; regulatory protein mreB; rod shape-determining protein MreB and related proteins mreC; rod shape-determining protein MreC mreD; rod shape-determining protein MreD mutL; DNA mismatch repair protein MutL mutT, NUDT15, MTH2; 8-oxo-dGTP diphosphatase [EC:3.6.1.55] mutY; A/G-specific adenine glycosylase [EC:3.2.2.-] recD; exodeoxyribonuclease V alpha subunit [EC:3.1.11.5] recO; DNA repair protein RecO (recombination protein O) Diabetes Page 154 of 230

ftsW, spoVE; cell division protein FtsW ftsQ; cell division protein FtsQ ftsA; cell division protein FtsA mrp, NUBPL; ATP-binding protein involved in chromosome partitioning era; GTP-binding protein Era lepA; GTP-binding protein LepA xseA; exodeoxyribonuclease VII large subunit [EC:3.1.11.6] xseB; exodeoxyribonuclease VII small subunit [EC:3.1.11.6] plsX; glycerol-3-phosphate acyltransferase PlsX [EC:2.3.1.15] greA; transcription elongation factor GreA nusB; N utilization substance protein B recF; DNA replication and repair protein RecF radC; DNA repair protein RadC recN; DNA repair protein RecN (Recombination protein N) moaC; cyclic pyranopterin phosphate synthase [EC:4.1.99.18] MOCS1, moaA; cyclic pyranopterin phosphate synthase [EC:4.1.99.18] tolA; colicin import membrane protein nrdI; protein involved in ribonucleotide reduction UNG, UDG; uracil-DNA glycosylase [EC:3.2.2.27] mnmE, trmE, MSS1; tRNA modification GTPase [EC:3.6.-.-] MPG; DNA-3-methyladenine glycosylase [EC:3.2.2.21] recQ; ATP-dependent DNA helicase RecQ [EC:3.6.4.12] recG; ATP-dependent DNA helicase RecG [EC:3.6.4.12] uvrD, pcrA; DNA helicase II / ATP-dependent DNA helicase PcrA [EC:3.6.4.12] smpB; SsrA-binding protein hflX; GTP-binding protein HflX hslU; ATP-dependent HslUV protease ATP-binding subunit HslU trxA; thioredoxin 1 rnc, DROSHA, RNT1; ribonuclease III [EC:3.1.26.3] dnaJ; molecular chaperone DnaJ GRPE; molecular chaperone GrpE pbp; penicillin-binding protein clpB; ATP-dependent Clp protease ATP-binding subunit ClpB clpC; ATP-dependent Clp protease ATP-binding subunit ClpC clpE; ATP-dependent Clp protease ATP-binding subunit ClpE cbf, cbf1; 3'-5' exoribonuclease [EC:3.1.-.-] tlyC; putative hemolysin recU; recombination protein U uvrA; excinuclease ABC subunit A uvrB; excinuclease ABC subunit B uvrC; excinuclease ABC subunit C cspA; cold shock protein (beta-ribbon, CspA family) hrcA; heat-inducible transcriptional repressor codY; transcriptional pleiotropic repressor tenA; thiaminase (transcriptional activator TenA) [EC:3.5.99.2] ctsR; transcriptional regulator of stress and heat shock response troR; DtxR family transcriptional regulator, Mn-dependent transcriptional regulator K03710; GntR family transcriptional regulator fur; Fur family transcriptional regulator, ferric uptake regulator glnR; MerR family transcriptional regulator, glutamine synthetase repressor Page 155 of 230 Diabetes

asnC; Lrp/AsnC family transcriptional regulator, regulator for asnA, asnC and gidA lrp; Lrp/AsnC family transcriptional regulator, leucine-responsive regulatory protein dinG; ATP-dependent DNA helicase DinG [EC:3.6.4.12] mfd; transcription-repair coupling factor (superfamily II helicase) [EC:3.6.4.-] lhr; ATP-dependent helicase Lhr and Lhr-like helicase [EC:3.6.4.-] E2.4.1.216; trehalose 6-phosphate phosphorylase [EC:2.4.1.216] xerC; integrase/recombinase XerC apbE; thiamine biosynthesis lipoprotein por, nifJ; pyruvate-ferredoxin/flavodoxin oxidoreductase [EC:1.2.7.1 1.2.7.-] dltB; membrane protein involved in D-alanine export dltD; D-alanine transfer protein ARSC2, arsC; arsenate reductase [EC:1.20.4.1] pncC; nicotinamide-nucleotide amidase [EC:3.5.1.42] pncC; nicotinamide-nucleotide amidase [EC:3.5.1.42] lemA; LemA protein arcD, lysl, lysP; arginine:ornithine antiporter / lysine permease DPO3A2, polC; DNA polymerase III subunit alpha, Gram-positive type [EC:2.7.7.7] PPIA; peptidyl-prolyl cis-trans isomerase A (cyclophilin A) [EC:5.2.1.8] PPIB, ppiB; peptidyl-prolyl cis-trans isomerase B (cyclophilin B) [EC:5.2.1.8] dld; D-lactate dehydrogenase [EC:1.1.1.28] ldhA; D-lactate dehydrogenase [EC:1.1.1.28] deoD; purine-nucleoside phosphorylase [EC:2.4.2.1] aroD; 3-dehydroquinate dehydratase I [EC:4.2.1.10] rimI; ribosomal-protein-alanine N-acetyltransferase [EC:2.3.1.128] rimJ; ribosomal-protein-alanine N-acetyltransferase [EC:2.3.1.128] E3.4.21.102, prc, ctpA; carboxyl-terminal processing protease [EC:3.4.21.102] ftsH, hflB; cell division protease FtsH [EC:3.4.24.-] htpX; heat shock protein HtpX [EC:3.4.24.-] mviM; virulence factor pnuC; nicotinamide mononucleotide transporter xpt; xanthine phosphoribosyltransferase [EC:2.4.2.22] rimL; ribosomal-protein-serine acetyltransferase [EC:2.3.1.-] pat; phosphinothricin acetyltransferase [EC:2.3.1.183] yiaC; putative acetyltransferase [EC:2.3.1.-] yjaB; putative acetyltransferase [EC:2.3.1.-] yafP; putative acetyltransferase [EC:2.3.1.-] ndh; NADH dehydrogenase [EC:1.6.99.3] arsR; ArsR family transcriptional regulator moxR; MoxR-like ATPase [EC:3.6.3.-] mraZ; MraZ protein estA; putative tributyrin esterase [EC:3.1.1.-] cpbD; chitin-binding protein dedA; membrane-associated protein ybaK, ebsC; Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase [EC:3.1.1.-] engA; GTP-binding protein engB; GTP-binding protein obg; GTP-binding protein fbp3; fructose-1,6-bisphosphatase III [EC:3.1.3.11] glmU; bifunctional UDP-N-acetylglucosamine pyrophosphorylase / Glucosamine-1-phosphate N-acetyltransferase [EC:2.7.7.23 2.3.1.157] dnaK; molecular chaperone DnaK Diabetes Page 156 of 230

dps; starvation-inducible DNA-binding protein osmC; osmotically inducible protein OsmC priA; primosomal protein N' (replication factor Y) (superfamily II helicase) [EC:3.6.4.-] nrdG; anaerobic ribonucleoside-triphosphate reductase activating protein [EC:1.97.1.4] pflX; putative pyruvate formate lyase activating enzyme [EC:1.97.1.4] adhE; acetaldehyde dehydrogenase / alcohol dehydrogenase [EC:1.2.1.10 1.1.1.1] divIVA; cell division initiation protein tilS, mesJ; tRNA(Ile)-lysidine synthase [EC:6.3.4.19] lonB; Lon-like ATP-dependent protease [EC:3.4.21.-] groEL, HSPD1; chaperonin GroEL groES, HSPE1; chaperonin GroES hslO; molecular chaperone Hsp33 trmFO, gid; methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase [EC:2.1.1.74] fic; cell filamentation protein smf; DNA processing protein E4.1.1.74, ipdC; indolepyruvate decarboxylase [EC:4.1.1.74] ycdX; putative hydrolase sms, radA; DNA repair protein RadA/Sms E3.1.3.15B; histidinol-phosphatase (PHP family) [EC:3.1.3.15] iscS, NFS1; cysteine desulfurase [EC:2.8.1.7] iscU, nifU; nitrogen fixation protein NifU and related proteins tyrA2; prephenate dehydrogenase [EC:1.3.1.12] KARS, lysS; lysyl-tRNA synthetase, class II [EC:6.1.1.6] hypA, hybF; hydrogenase nickel incorporation protein HypA/HybF hypB; hydrogenase nickel incorporation protein HypB phnB; PhnB protein glnB; nitrogen regulatory protein P-II 1 feoA; ferrous iron transport protein A feoB; ferrous iron transport protein B xerD; integrase/recombinase XerD cggR; central glycolytic genes regulator fer; ferredoxin glcU; glucose uptake protein treS; maltose alpha-D-glucosyltransferase/ alpha-amylase [EC:5.4.99.16 3.2.1.1] bglX; beta-glucosidase [EC:3.2.1.21] bglB; beta-glucosidase [EC:3.2.1.21] murM; serine/alanine adding enzyme [EC:2.3.2.10] mrcA; penicillin-binding protein 1A [EC:2.4.1.- 3.4.-.-] deaD, cshA; ATP-dependent RNA helicase DeaD [EC:3.6.4.13] hcp; hydroxylamine reductase [EC:1.7.99.1] phnL; alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL [EC:2.7.8.37] phnK; putative phosphonate transport system ATP-binding protein hydN; electron transport protein HydN ybaO; Lrp/AsnC family transcriptional regulator yhbH; putative sigma-54 modulation protein dapH, dapD; tetrahydrodipicolinate N-acetyltransferase [EC:2.3.1.89] E3.5.1.47; N-acetyldiaminopimelate deacetylase [EC:3.5.1.47] ABC.X4.P; putative ABC transport system permease protein ABC.X4.A; putative ABC transport system ATP-binding protein rodA, mrdB; rod shape determining protein RodA Page 157 of 230 Diabetes

opuC; osmoprotectant transport system substrate-binding protein opuBD; osmoprotectant transport system permease protein opuA; osmoprotectant transport system ATP-binding protein dhaK; dihydroxyacetone kinase, N-terminal domain [EC:2.7.1.-] dhaL; dihydroxyacetone kinase, C-terminal domain [EC:2.7.1.-] scpA; segregation and condensation protein A npr; NADH peroxidase [EC:1.11.1.1] dfx; superoxide reductase [EC:1.15.1.2] E2.4.1.58 E2.4.1.187, tagA; N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D-mannosaminyltransferase [EC:2.4.1.187] citG; triphosphoribosyl-dephospho-CoA synthase [EC:2.4.2.52] SIAE; sialate O-acetylesterase [EC:3.1.1.53] E3.1.26.8, rnmV; ribonuclease M5 [EC:3.1.26.8] hprK, ptsK; HPr kinase/phosphorylase [EC:2.7.11.- 2.7.4.-] scpB; segregation and condensation protein B cls; cardiolipin synthase [EC:2.7.8.-] ABCB-BAC; ATP-binding cassette, subfamily B, bacterial ABCC-BAC; ATP-binding cassette, subfamily C, bacterial bacA; undecaprenyl-diphosphatase [EC:3.6.1.27] ABCF3; ATP-binding cassette, subfamily F, member 3 phnM; alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase [EC:3.6.1.63] phnJ; alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase [EC:4.7.1.1] phnI; alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI [EC:2.7.8.37] phnH; alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnH [EC:2.7.8.37] phnG; alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnG [EC:2.7.8.37] truA, PUS1; tRNA pseudouridine38-40 synthase [EC:5.4.99.12] rluA; tRNA pseudouridine32 synthase / 23S rRNA pseudouridine746 synthase [EC:5.4.99.28 5.4.99.29] rluB; 23S rRNA pseudouridine2605 synthase [EC:5.4.99.22] rluD; 23S rRNA pseudouridine1911/1915/1917 synthase [EC:5.4.99.23] rluE; 23S rRNA pseudouridine2457 synthase [EC:5.4.99.20] rsuA; 16S rRNA pseudouridine516 synthase [EC:5.4.99.19] recR; recombination protein RecR aqpZ; aquaporin Z nrdH; glutaredoxin-like protein NrdH phnA; phosphonoacetate hydrolase [EC:3.11.1.2] ccdA; cytochrome c-type biogenesis protein coiA; competence protein CoiA crcB; CrcB protein cstA; carbon starvation protein cutC; copper homeostasis protein sfsA; sugar fermentation stimulation protein A typA, bipA; GTP-binding protein pdxS, pdx1; pyridoxal 5'-phosphate synthase pdxS subunit [EC:4.3.3.6] rbsU; putative ribose uptake protein phoH, phoL; phosphate starvation-inducible protein PhoH and related proteins ezrA; septation ring formation regulator cotJB; spore coat protein JB jag; spoIIIJ-associated protein tlyA; 23S rRNA (cytidine1920-2'-O)/16S rRNA (cytidine1409-2'-O)-methyltransferase [EC:2.1.1.226 2.1.1.227] DCAA; acyl-CoA dehydrogenase [EC:1.3.99.-] Diabetes Page 158 of 230

cidA; holin-like protein iolF; MFS transporter, SP family, inositol transporter rbsD; D-ribose pyranase [EC:5.4.99.62] K06864; uncharacterized protein K06871; uncharacterized protein K06872; uncharacterized protein K06878; tRNA-binding protein K06881; phosphoesterase RecJ domain-containing protein K06885 K06889 K06890 K06898 pbuG; putative MFS transporter, AGZA family, xanthine/uracil permease K06904 xtmB; phage terminase large subunit K06910 K06919; putative DNA primase/helicase K06921 tsaE; tRNA threonylcarbamoyladenosine biosynthesis protein TsaE K06929 K06940 rlmN; 23S rRNA (adenine2503-C2)-methyltransferase [EC:2.1.1.192] K06942 K06948 rsgA, engC; ribosome biogenesis GTPase [EC:3.6.1.-] K06950; uncharacterized protein K06956 yhbJ; UPF0042 nucleotide-binding protein K06959; uncharacterized protein K06960 K06966 trmK; tRNA (adenine22-N1)-methyltransferase [EC:2.1.1.217] rlmI; 23S rRNA (cytosine1962-C5)-methyltransferase [EC:2.1.1.191] K06972 K06973 K06988 K06994; putative drug exporter of the RND superfamily yggS, PROSC; PLP dependent protein K07005 K07006 K07007 K07009 K07010; putative glutamine amidotransferase cas3; CRISPR-associated endonuclease/helicase Cas3 [EC:3.1.-.- 3.6.4.-] K07015 K07023; putative hydrolases of HD superfamily K07024 K07025; putative hydrolase of the HAD superfamily K07027 dagK; diacylglycerol kinase (ATP) [EC:2.7.1.107] Page 159 of 230 Diabetes

K07030 K07032 K07038; inner membrane protein K07040; uncharacterized protein ybeY, yqfG; probable rRNA maturation factor K07045 AARSD1, ALAX; misacylated tRNA(Ala) deacylase [EC:3.1.1.-] K07052 K07053 rsmI; 16S rRNA (cytidine1402-2'-O)-methyltransferase [EC:2.1.1.198] K07058; membrane protein K07069 K07079 K07082; UPF0755 protein K07088 K07090 K07095 catE; catechol 2,3-dioxygenase [EC:1.13.11.2] K07105 murQ; N-acetylmuramic acid 6-phosphate etherase [EC:4.2.1.126] K07118 K07124 K07126 K07133 K07137 K07139 K07146; UPF0176 protein yedY; sulfoxide reductase catalytic subunit YedY [EC:1.8.-.-] K07166; ACT domain-containing protein K07170; GAF domain-containing protein mazF, ndoA, chpA; mRNA interferase MazF [EC:3.1.-.-] luxS; S-ribosylhomocysteine lyase [EC:4.4.1.21] K07177; PDZ domain-containing protein tspO; tryptophan-rich sensory protein K07217; Mn-containing catalase TC.ZIP, zupT, ZRT3, ZIP2; zinc transporter, ZIP family chrA; chromate transporter dacC, dacA, dacD; D-alanyl-D-alanine carboxypeptidase (penicillin-binding protein 5/6) [EC:3.4.16.4] dacB; D-alanyl-D-alanine carboxypeptidase / D-alanyl-D-alanine-endopeptidase (penicillin-binding protein 4) [EC:3.4.16.4 3.4.21.-] vanY; D-alanyl-D-alanine carboxypeptidase [EC:3.4.16.4] licD; lipopolysaccharide cholinephosphotransferase [EC:2.7.8.-] rgpF; rhamnosyltransferase [EC:2.4.1.-] srtA; sortase A [EC:3.4.22.70] msrA; peptide-methionine (S)-S-oxide reductase [EC:1.8.4.11] msrB; peptide-methionine (R)-S-oxide reductase [EC:1.8.4.12] dmsA; anaerobic dimethyl sulfoxide reductase subunit A [EC:1.8.5.3] dmsB; anaerobic dimethyl sulfoxide reductase subunit B (DMSO reductase iron- sulfur subunit) dmsC; anaerobic dimethyl sulfoxide reductase subunit C (DMSO reductase anchor subunit) ynfE; Tat-targeted selenate reductase subunit YnfE [EC:1.97.1.9] ynfF; Tat-targeted selenate reductase subunit YnfF [EC:1.97.1.9] Diabetes Page 160 of 230

pphA; serine/threonine protein phosphatase 1 [EC:3.1.3.16] mod; adenine-specific DNA-methyltransferase [EC:2.1.1.72] ytfE, scdA; regulator of cell morphogenesis and NO signaling higA; proteic killer suppression protein bmpA, bmpB, tmpC; basic membrane protein A and related proteins pepO; putative endopeptidase [EC:3.4.24.-] xdhC; xanthine dehydrogenase accessory factor pgl; 6-phosphogluconolactonase [EC:3.1.1.31] E3.2.1.22B, galA, rafA; alpha-galactosidase [EC:3.2.1.22] ybaZ; methylated-DNA-protein-cysteine methyltransferase related protein ypsC; putative N6-adenine-specific DNA methylase [EC:2.1.1.-] ruvX; putative holliday junction resolvase [EC:3.1.-.-] mcrB; 5-methylcytosine-specific restriction enzyme B [EC:3.1.21.-] mutS2; DNA mismatch repair protein MutS2 ybjD; putative ATP-dependent endonuclease of the OLD family K07461; putative endonuclease recJ; single-stranded-DNA-specific exonuclease [EC:3.1.-.-] cas4; CRISPR-associated exonuclease Cas4 [EC:3.1.12.1] rstA1; phage replication initiation protein dinJ; DNA-damage-inducible protein J xtmA; phage terminase small subunit ycaJ; putative ATPase K07482; transposase, IS30 family K07483; transposase K07491; putative transposase K07493; putative transposase K07497; putative transposase K07498; putative transposase mgtC; putative Mg2+ transporter-C (MgtC) family protein prsA; foldase protein PrsA [EC:5.2.1.8] dtd, DTD1; D-tyrosyl-tRNA(Tyr) deacylase [EC:3.1.-.-] tsaC, rimN, SUA5; L-threonylcarbamoyladenylate synthase [EC:2.7.7.87] GSP13; general stress protein 13 yhbY; RNA-binding protein K07584; hypothetical protein K07586; hypothetical protein vicK; two-component system, OmpR family, sensor histidine kinase VicK [EC:2.7.13.3] phoB1, phoP; two-component system, OmpR family, alkaline phosphatase synthesis response regulator PhoP cusR, copR, silR; two-component system, OmpR family, copper resistance phosphate regulon response regulator CusR vicR; two-component system, OmpR family, response regulator VicR agrC; two-component system, AgrA family, sensor histidine kinase AgrC [EC:2.7.13.-] agrA; two-component system, AgrA family, response regulator AgrA K07726; putative transcriptional regulator K07727; putative transcriptional regulator K07729; putative transcriptional regulator carD; CarD family transcriptional regulator nrdR; transcriptional repressor NrdR ELP3, KAT9; elongator complex protein 3 [EC:2.3.1.48] K07741; anti-repressor protein K07742; hypothetical protein Page 161 of 230 Diabetes

frc; formyl-CoA transferase [EC:2.8.3.16] E2.7.6.5X; putative GTP pyrophosphokinase [EC:2.7.6.5] ytrA; GntR family transcriptional regulator tetA; MFS transporter, DHA1 family, tetracycline resistance protein lmrP; MFS transporter, DHA1 family, multidrug resistance protein B blt, norA; MFS transporter, DHA1 family, multidrug resistance protein mdtG; MFS transporter, DHA1 family, multidrug resistance protein oxlT; MFS transporter, OFA family, oxalate/formate antiporter mef; MFS transporter, DHA3 family, macrolide efflux protein yaeR; glyoxylase I family protein purT; phosphoribosylglycinamide formyltransferase 2 [EC:2.1.2.2] K08303; putative protease [EC:3.4.-.-] nudH; putative (di)nucleoside polyphosphate hydrolase [EC:3.6.1.-] hycI; hydrogenase 3 maturation protease [EC:3.4.23.51] rsmD; 16S rRNA (guanine966-N2)-methyltransferase [EC:2.1.1.171] ybdH; uncharacterized oxidoreductase [EC:1.1.-.-] lsrF; putative autoinducer-2 (AI-2) aldolase [EC:4.1.2.-] phsA, psrA; thiosulfate reductase / polysulfide reductase chain A yaaU; MFS transporter, putative metabolite transport protein PTS-EI.PTSI, ptsI; phosphotransferase system, enzyme I, PtsI [EC:2.7.3.9] mtnU; carbon-nitrogen hydrolase family protein plsY; glycerol-3-phosphate acyltransferase PlsY [EC:2.3.1.15] srtB; sortase B [EC:3.4.22.70] pepF, pepB; oligoendopeptidase F [EC:3.4.24.-] vanX; D-alanyl-D-alanine dipeptidase [EC:3.4.13.22] pepDA, pepDB; dipeptidase [EC:3.4.-.-] menH; 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase [EC:4.2.99.20] pdxT, pdx2; 5'-phosphate synthase pdxT subunit [EC:4.3.3.6] pbpB; penicillin-binding protein 2B E2.4.2.6; nucleoside deoxyribosyltransferase [EC:2.4.2.6] K08884; serine/threonine protein kinase, bacterial [EC:2.7.11.1] mtnA; methylthioribose-1-phosphate isomerase [EC:5.3.1.23] TC.BAT1; bacterial/archaeal transporter family protein K08987; putative membrane protein yagU; putative membrane protein K08998; hypothetical protein sufC; Fe-S cluster assembly ATP-binding protein sufB; Fe-S cluster assembly protein SufB sufD; Fe-S cluster assembly protein SufD K09116; hypothetical protein K09117; hypothetical protein K09121; hypothetical protein K09125; hypothetical protein K09134; hypothetical protein K09138; hypothetical protein K09153; hypothetical protein K09155; hypothetical protein K09157; hypothetical protein K09384; hypothetical protein fabF; 3-oxoacyl-[acyl-carrier-protein] synthase II [EC:2.3.1.179] Diabetes Page 162 of 230

aepZ; 2-aminoethylphosphonate-pyruvate transaminase coaW; type II pantothenate kinase [EC:2.7.1.33] purR; purine operon repressor tagG; teichoic acid transport system permease protein tagH; teichoic acid transport system ATP-binding protein [EC:3.6.3.40] gltX; nondiscriminating glutamyl-tRNA synthetase [EC:6.1.1.24] K09704; hypothetical protein ybeB; ribosome-associated protein K09747; hypothetical protein rimP; ribosome maturation factor RimP K09762; hypothetical protein K09765; hypothetical protein K09767; hypothetical protein sepF; cell division inhibitor SepF K09773; hypothetical protein K09775; hypothetical protein K09779; hypothetical protein K09787; hypothetical protein K09799; hypothetical protein tagF; CDP-glycerol glycerophosphotransferase [EC:2.7.8.12] ftsX; cell division transport system permease protein ftsE; cell division transport system ATP-binding protein K09861; hypothetical protein pyrH; uridylate kinase [EC:2.7.4.22] K09927; hypothetical protein TC.BAT2; bacterial/archaeal transporter family-2 protein csn1, cas9; CRISPR-associated endonuclease Csn1 [EC:3.1.-.-] K09962; hypothetical protein K09963; hypothetical protein K09976; hypothetical protein ABC.GLN1.S; putative glutamine transport system substrate-binding protein ABC.GLN1.P; putative glutamine transport system permease protein ABC.GLN1.A; putative glutamine transport system ATP-binding protein [EC:3.6.3.-] msmX, msmK, malK, sugC, ggtA, msiK; multiple sugar transport system ATP-binding protein msmE; raffinose/stachyose/melibiose transport system substrate-binding protein ohyA, sph; oleate hydratase [EC:4.2.1.53] E2.7.1.76, dak; deoxyadenosine kinase [EC:2.7.1.76] rbsB; ribose transport system substrate-binding protein rbsC; ribose transport system permease protein rbsA; ribose transport system ATP-binding protein [EC:3.6.3.17] aguA; agmatine deiminase [EC:3.5.3.12] mutM, fpg; formamidopyrimidine-DNA glycosylase [EC:3.2.2.23 4.2.99.18] kch, trkA, mthK, pch; voltage-gated potassium channel NTH; endonuclease III [EC:4.2.99.18] oppF; oligopeptide transport system ATP-binding protein K10907; aminotransferase [EC:2.6.1.-] padR; PadR family transcriptional regulator, regulatory protein PadR eta; exfoliative toxin A/B ABC-2.CYL.A, cylA; multidrug/hemolysin transport system ATP-binding protein ABC-2.CYL.P, cylB; multidrug/hemolysin transport system permease protein Page 163 of 230 Diabetes

tpx; thiol peroxidase, atypical 2-Cys peroxiredoxin [EC:1.11.1.15] hlyIII; hemolysin III potD; spermidine/putrescine transport system substrate-binding protein potC; spermidine/putrescine transport system permease protein potB; spermidine/putrescine transport system permease protein potA; spermidine/putrescine transport system ATP-binding protein [EC:3.6.3.31] dnaI; primosomal protein DnaI K11145; ribonuclease III family protein [EC:3.1.26.-] purN; phosphoribosylglycinamide formyltransferase 1 [EC:2.1.2.2] PTS-HPR; phosphocarrier protein yhdR; aspartate aminotransferase [EC:2.6.1.1] bkdA; 2-oxoisovalerate dehydrogenase E1 component [EC:1.2.4.4] liaS; two-component system, NarL family, sensor histidine kinase LiaS [EC:2.7.13.3] mtsA; iron/zinc/copper transport system substrate-binding protein mtsB; iron/zinc/copper transport system permease protein mtsC; iron/zinc/copper transport system ATP-binding protein sufS; cysteine desulfurase / selenocysteine lyase [EC:2.8.1.7 4.4.1.16] lysP; lysine-specific permease sugE; quaternary ammonium compound-resistance protein SugE rseP; regulator of sigma E protease [EC:3.4.24.-] ribD; diaminohydroxyphosphoribosylaminopyrimidine deaminase / 5-amino-6-(5-phosphoribosylamino)uracil reductase [EC:3.5.4.26 1.1.1.193] ribF; riboflavin kinase / FMN adenylyltransferase [EC:2.7.1.26 2.7.7.2] folC; dihydrofolate synthase / folylpolyglutamate synthase [EC:6.3.2.12 6.3.2.17] hisIE; phosphoribosyl-ATP pyrophosphohydrolase / phosphoribosyl-AMP cyclohydrolase [EC:3.6.1.31 3.5.4.19] putP; sodium/proline symporter tadA; tRNA(adenine34) deaminase [EC:3.5.4.33] hyfA; hydrogenase-4 component A [EC:1.-.-.-] hyfC; hydrogenase-4 component C [EC:1.-.-.-] hyfH; hydrogenase-4 component H msrAB; peptide methionine sulfoxide reductase msrA/msrB [EC:1.8.4.11 1.8.4.12] asp1; accessory secretory protein Asp1 asp2; accessory secretory protein Asp2 asp3; accessory secretory protein Asp3 comX1_2; competence protein ComX rlmL, rlmK; 23S rRNA (guanine2445-N2)-methyltransferase / 23S rRNA (guanine2069-N7)-methyltransferase [EC:2.1.1.173 2.1.1.264] bgaB, lacA; beta-galactosidase [EC:3.2.1.23] npdA; NAD-dependent deacetylase [EC:3.5.1.-] rfbH; CDP-6-deoxy-D-xylo-4-hexulose-3-dehydrase rfbE; CDP-paratose 2-epimerase [EC:5.1.3.10] fadK; acyl-CoA synthetase [EC:6.2.1.-] tadB; tight adherence protein B tadC; tight adherence protein C pbp2A; penicillin-binding protein 2A [EC:2.4.1.129 2.3.2.-] pbp2X; penicillin-binding protein 2X [EC:2.3.2.-] rnr, vacB; ribonuclease R [EC:3.1.-.-] rnj; ribonuclease J [EC:3.1.-.-] rihC; non-specific riboncleoside hydrolase [EC:3.2.-.-] abgT; aminobenzoyl-glutamate transport protein mtaD; 5-methylthioadenosine/S-adenosylhomocysteine deaminase [EC:3.5.4.31 3.5.4.28] rgpA; rhamnosyltransferase [EC:2.4.1.-] Diabetes Page 164 of 230

rgpB; rhamnosyltransferase [EC:2.4.1.-] wbyK; mannosyltransferase [EC:2.4.1.-] wbpD, wlbB; UDP-2-acetamido-3-amino-2,3-dideoxy-glucuronate N-acetyltransferase [EC:2.3.1.201] coaBC, dfp; phosphopantothenoylcysteine decarboxylase / phosphopantothenate--cysteine ligase [EC:4.1.1.36 6.3.2.5] iaaA, ASRGL1; beta-aspartyl-peptidase (threonine type) [EC:3.4.19.5] divIC, divA; cell division protein DivIC ptcA; putrescine carbamoyltransferase [EC:2.1.3.6] psiE; protein PsiE SEC11, sipW; signal peptidase, endoplasmic reticulum-type [EC:3.4.-.-] lgt, umpA; phosphatidylglycerol:prolipoprotein diacylglycerol transferase [EC:2.-.-.-] adaA; AraC family transcriptional regulator, regulatory protein of adaptative response / methylphosphotriester-DNA alkyltransferase methyltransferase [EC:2.1.1.-] adaB; methylated-DNA-[protein]-cysteine S-methyltransferase [EC:2.1.1.63] K13653; AraC family transcriptional regulator cpoA; 1,2-diacylglycerol-3-alpha-glucose alpha-1,2-galactosyltransferase [EC:2.4.1.-] pdc; phenolic acid decarboxylase [EC:4.1.1.-] GGPS; geranylgeranyl diphosphate synthase, type II [EC:2.5.1.1 2.5.1.10 2.5.1.29] adhP; alcohol dehydrogenase, propanol-preferring [EC:1.1.1.1] HSP20; HSP20 family protein echC; ech hydrogenase subunit C patB, malY; cystathione beta-lyase [EC:4.4.1.8] pheA; chorismate mutase / prephenate dehydratase [EC:5.4.99.5 4.2.1.51] dltC; D-alanine--poly(phosphoribitol) ligase subunit 2 [EC:6.1.1.13] dltE; uncharacterized oxidoreductase [EC:1.-.-.-] tRNA-Ala; tRNA Ala tRNA-Arg; tRNA Arg tRNA-Asn; tRNA Asn tRNA-Asp; tRNA Asp tRNA-Cys; tRNA Cys tRNA-Gln; tRNA Gln tRNA-Glu; tRNA Glu tRNA-Gly; tRNA Gly tRNA-His; tRNA His tRNA-Ile; tRNA Ile tRNA-Leu; tRNA Leu tRNA-Lys; tRNA Lys tRNA-Met; tRNA Met tRNA-Phe; tRNA Phe tRNA-Pro; tRNA Pro tRNA-Ser; tRNA Ser tRNA-Thr; tRNA Thr tRNA-Trp; tRNA Trp tRNA-Tyr; tRNA Tyr tRNA-Val; tRNA Val alaA; alanine-synthesizing transaminase [EC:2.6.1.66 2.6.1.2] panF; sodium/pantothenate symporter rbgA; ribosome biogenesis GTPase A dinD; DNA-damage-inducible protein D ribBA; 3,4-dihydroxy 2-butanone 4-phosphate synthase / GTP cyclohydrolase II [EC:4.1.99.12 3.5.4.25] ciaH; two-component system, OmpR family, sensor histidine kinase CiaH [EC:2.7.13.3] ssrA, sipB; transfer-messenger RNA Page 165 of 230 Diabetes

K15051, endA; DNA-entry nuclease rexA; oligosaccharide reducing-end xylanase [EC:3.2.1.156] oppA, mppA; oligopeptide transport system substrate-binding protein oppB; oligopeptide transport system permease protein oppC; oligopeptide transport system permease protein oppD; oligopeptide transport system ATP-binding protein gpmB; probable phosphoglycerate mutase [EC:5.4.2.12] hddC; D-glycero-alpha-D-manno-heptose 1-phosphate guanylyltransferase [EC:2.7.7.71] uup; ATP-binding cassette, subfamily F, uup cycB, ganO; arabinogalactan oligomer / maltooligosaccharide transport system substrate-binding protein ganP; arabinogalactan oligomer / maltooligosaccharide transport system permease protein ganQ; arabinogalactan oligomer / maltooligosaccharide transport system permease protein hipB; HTH-type transcriptional regulator / antitoxin HipB hycE; formate hydrogenlyase subunit 5 nrfH; cytochrome c nitrite reductase small subunit ppaC; manganese-dependent inorganic pyrophosphatase [EC:3.6.1.1] cydC; ATP-binding cassette, subfamily C, bacterial CydC cydD; ATP-binding cassette, subfamily C, bacterial CydD nemR; TetR/AcrR family transcriptional regulator, transcriptional repressor for nem operon pbuX; xanthine permease lacS, galP, rafP; lactose/raffinose/galactose permease togT, rhiT; oligogalacturonide transporter malY, malT; maltose/moltooligosaccharide transporter pezT; UDP-N-acetylglucosamine kinase [EC:2.7.1.176] czcD, zitB; cobalt-zinc-cadmium efflux system protein evaA; oxidase EvaA spxA; regulatory protein spx mecA1_2; adapter protein MecA 1/2 ecfT; energy-coupling factor transport system permease protein ecfA1; energy-coupling factor transport system ATP-binding protein [EC:3.6.3.-] ecfA2; energy-coupling factor transport system ATP-binding protein [EC:3.6.3.-] niaX; niacin transporter thiT; thiamine transporter addA; ATP-dependent helicase/nuclease subunit A [EC:3.1.-.- 3.6.4.12] addB; ATP-dependent helicase/nuclease subunit B [EC:3.1.-.- 3.6.4.12] qrtT; energy-coupling factor transport system substrate-specific component mtsT; energy-coupling factor transport system substrate-specific component ykoE; energy-coupling factor transport system substrate-specific component lysX1; putative lysine transport system substrate-binding protein lysX2; putative lysine transport system permease protein K17076, lysY; putative lysine transport system ATP-binding protein [EC:3.6.3.-] K17318, lplA; putative aldouronate transport system substrate-binding protein lplB; putative aldouronate transport system permease protein lplC; putative aldouronate transport system permease protein IRC3; ATP-dependent helicase IRC3 [EC:3.6.4.-] copA, ATP7; Cu+-exporting ATPase [EC:3.6.3.54] asl; D-aspartate ligase [EC:6.3.1.12] pyrDI; dihydroorotate dehydrogenase (NAD+) catalytic subunit [EC:1.3.1.14] penP; beta-lactamase class A [EC:3.5.2.6] hndB; NADP-reducing hydrogenase subunit HndB [EC:1.12.1.3] Diabetes Page 166 of 230

abcA, bmrA; ATP-binding cassette, subfamily B, bacterial AbcA/BmrA [EC:3.6.3.44] hndA; NADP-reducing hydrogenase subunit HndA [EC:1.12.1.3] hndC; NADP-reducing hydrogenase subunit HndC [EC:1.12.1.3] hndD; NADP-reducing hydrogenase subunit HndD [EC:1.12.1.3] vanRC, vanRE, vanRG; two-component system, OmpR family, response regulator VanR dacA; diadenylate cyclase [EC:2.7.7.85] rny; ribonucrease Y [EC:3.1.-.-] cshB; ATP-dependent RNA helicase CshB [EC:3.6.4.13] uctC; CoA:oxalate CoA-transferase [EC:2.8.3.19] tarL; CDP-ribitol ribitolphosphotransferase [EC:2.7.8.14] pezA; HTH-type transcriptional regulator / antitoxin PezA K06897; 7,8-dihydropterin-6-yl-methyl-4-(beta-D-ribofuranosyl)aminobenzene 5'-phosphate synthase [EC:2.5.1.105] tuaG; teichuronic acid biosynthesis glycosyltransferase TuaG [EC:2.4.-.-] PCYT1; choline-phosphate cytidylyltransferase [EC:2.7.7.15] cbrT; energy-coupling factor transport system substrate-specific component vanSC, vanSE, vanSG; two-component system, OmpR family, sensor histidine kinase VanS [EC:2.7.13.3] E5.1.3.6; UDP-glucuronate 4-epimerase [EC:5.1.3.6] rfbN; rhamnosyltransferase [EC:2.4.1.-] CHO1, pssA; CDP-diacylglycerol---serine O-phosphatidyltransferase [EC:2.7.8.8] fdoG, fdfH; formate dehydrogenase major subunit [EC:1.2.1.2] gapN; glyceraldehyde-3-phosphate dehydrogenase (NADP+) [EC:1.2.1.9] porD; pyruvate ferredoxin oxidoreductase delta subunit [EC:1.2.7.1] gltB; glutamate synthase (NADPH/NADH) large chain [EC:1.4.1.13 1.4.1.14] DNMT1, dcm; DNA (cytosine-5)-methyltransferase 1 [EC:2.1.1.37] cheR; chemotaxis protein methyltransferase CheR [EC:2.1.1.80] fctD; glutamate formiminotransferase [EC:2.1.2.5] E2.2.1.2, talA, talB; transaldolase [EC:2.2.1.2] catB; chloramphenicol O-acetyltransferase type B [EC:2.3.1.28] fabH; 3-oxoacyl-[acyl-carrier-protein] synthase III [EC:2.3.1.180] E2.3.1.54, pflD; formate C-acetyltransferase [EC:2.3.1.54] purF, PPAT; amidophosphoribosyltransferase [EC:2.4.2.14] rhaB; rhamnulokinase [EC:2.7.1.5] rfbF; glucose-1-phosphate cytidylyltransferase [EC:2.7.7.33] ispD; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase [EC:2.7.7.60] E2.8.3.- gph; phosphoglycolate phosphatase [EC:3.1.3.18] E3.1.11.5; exodeoxyribonuclease V [EC:3.1.11.5] nfo; deoxyribonuclease IV [EC:3.1.21.2] ENDOG; endonuclease G, mitochondrial NEU1; sialidase-1 [EC:3.2.1.18] NAGLU; alpha-N-acetylglucosaminidase [EC:3.2.1.50] DNPEP; aspartyl aminopeptidase [EC:3.4.11.21] DPP3; dipeptidyl-peptidase III [EC:3.4.14.4] E3.5.2.10; creatinine amidohydrolase [EC:3.5.2.10] ppa; inorganic pyrophosphatase [EC:3.6.1.1] ltaE; threonine aldolase [EC:4.1.2.5] RENBP; N-acylglucosamine 2-epimerase [EC:5.1.3.8] EARS, gltX; glutamyl-tRNA synthetase [EC:6.1.1.17] livK; branched-chain amino acid transport system substrate-binding protein ABC.FEV.S; iron complex transport system substrate-binding protein Page 167 of 230 Diabetes

modE; molybdate transport system regulatory protein ABC.SN.A; NitT/TauT family transport system ATP-binding protein ABC.SN.P; NitT/TauT family transport system permease protein ABC.SS.S; simple sugar transport system substrate-binding protein cpaA, tadV; prepilin peptidase CpaA [EC:3.4.23.43] flgM; negative regulator of flagellin synthesis FlgM flhA; flagellar biosynthesis protein FlhA fliI; flagellum-specific ATP synthase [EC:3.6.3.14] fliQ; flagellar biosynthetic protein FliQ fliS; flagellar protein FliS treX, glgX; glycogen operon protein [EC:3.2.1.-] wbpO; UDP-N-acetyl-D-galactosamine dehydrogenase [EC:1.1.1.-] PTS-Nag-EIIB, nagE; PTS system, N-acetylglucosamine-specific IIB component [EC:2.7.1.69] PTS-Nag-EIIC, nagE; PTS system, N-acetylglucosamine-specific IIC component SIG54, rpoN; RNA polymerase sigma-54 factor thiC; phosphomethylpyrimidine synthase [EC:4.1.99.17] cheA; two-component system, chemotaxis family, sensor kinase CheA [EC:2.7.13.3] cheB; two-component system, chemotaxis family, response regulator CheB [EC:3.1.1.61] cheY; two-component system, chemotaxis family, response regulator CheY fixB, etfA; electron transfer flavoprotein alpha subunit wcaJ; putative colanic acid biosysnthesis UDP-glucose lipid carrier transferase minE; cell division topological specificity factor minD; septum site-determining protein MinD minC; septum site-determining protein MinC rnfD; electron transport complex protein RnfD rho; transcription termination factor Rho katE, CAT, catB, srpA; catalase [EC:1.11.1.6] pflA, pflC, pflE; pyruvate formate lyase activating enzyme [EC:1.97.1.4] pbpC; penicillin-binding protein 1C [EC:2.4.1.-] pepE; dipeptidase E [EC:3.4.13.21] LYS5, acpT; 4'-phosphopantetheinyl transferase [EC:2.7.8.-] miaB; tRNA-2-methylthio-N6-dimethylallyladenosine synthase [EC:2.8.4.3] cotJC; spore coat protein JC K06999; phospholipase/carboxylesterase hddA; D-glycero-alpha-D-manno-heptose-7-phosphate kinase [EC:2.7.1.168] K07078 K07080 yfbK; Ca-activated chloride channel homolog phoH2; PhoH-like ATPase spsF; spore coat polysaccharide biosynthesis protein SpsF K07504; hypothetical protein spo0A; two-component system, response regulator, stage 0 sporulation protein A agrB; accessory gene regulator B sstT; serine/threonine transporter xylE; MFS transporter, SP family, xylose:H+ symportor yqhD; NADP-dependent alcohol dehydrogenase [EC:1.1.-.-] tri; tricorn protease [EC:3.4.21.-] ycgQ; putative membrane protein K09768; hypothetical protein znuA; zinc transport system substrate-binding protein Diabetes Page 168 of 230

K09922; hypothetical protein msmG; raffinose/stachyose/melibiose transport system permease protein E2.6.1.83; LL-diaminopimelate aminotransferase [EC:2.6.1.83] slo; thiol-activated cytolysin dctM; C4-dicarboxylate transporter, DctM subunit secDF; SecD/SecF fusion protein argF; N-succinyl-L-ornithine transcarbamylase [EC:2.1.3.11] ybcJ; ribosome-associated protein apgM; 2,3-bisphosphoglycerate-independent phosphoglycerate mutase [EC:5.4.2.12] czcC; outer membrane protein, cobalt-zinc-cadmium efflux system czcB; membrane fusion protein, cobalt-zinc-cadmium efflux system mscM; miniconductance mechanosensitive channel TPS; trehalose 6-phosphate synthase/phosphatase [EC:2.4.1.15 3.1.3.12] lpxC-fabZ; UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase / 3-hydroxyacyl-[acyl-carrier-protein] dehydratase [EC:3.5.1.108 4.2.1.59] doxA; thiosulfate dehydrogenase [quinone] small subunit [EC:1.8.5.2] sqr; sulfide:quinone oxidoreductase [EC:1.8.5.-] preA; dihydropyrimidine dehydrogenase (NAD+) subunit PreA [EC:1.3.1.1] adh2; alcohol dehydrogenase [EC:1.1.1.-] mtaB; threonylcarbamoyladenosine tRNA methylthiotransferase MtaB [EC:2.8.4.5] K02475; two-component system, CitB family, response regulator K02476; two-component system, CitB family, sensor kinase [EC:2.7.13.3] K09703; hypothetical protein spoVAB; stage V sporulation protein AB K07502; hypothetical protein chr, crh; catabolite repression HPr-like protein E1.11.1.5; cytochrome c peroxidase [EC:1.11.1.5] rluF; 23S rRNA pseudouridine2604 synthase [EC:5.4.99.21] doxD; thiosulfate dehydrogenase [quinone] large subunit [EC:1.8.5.2] nfeD; membrane-bound serine protease (ClpP class) iolG; myo-inositol 2-dehydrogenase / D-chiro-inositol 1-dehydrogenase [EC:1.1.1.18 1.1.1.369] E1.1.1.40, maeB; malate dehydrogenase (oxaloacetate-decarboxylating)(NADP+) [EC:1.1.1.40] nqrA; Na+-transporting NADH:ubiquinone oxidoreductase subunit A [EC:1.6.5.-] nqrB; Na+-transporting NADH:ubiquinone oxidoreductase subunit B [EC:1.6.5.-] nqrC; Na+-transporting NADH:ubiquinone oxidoreductase subunit C [EC:1.6.5.-] nqrD; Na+-transporting NADH:ubiquinone oxidoreductase subunit D [EC:1.6.5.-] nqrE; Na+-transporting NADH:ubiquinone oxidoreductase subunit E [EC:1.6.5.-] nqrF; Na+-transporting NADH:ubiquinone oxidoreductase subunit F [EC:1.6.5.-] E2.1.1.77, pcm; protein-L-isoaspartate(D-aspartate) O-methyltransferase [EC:2.1.1.77] lacA; galactoside O-acetyltransferase [EC:2.3.1.18] E2.7.1.90, pfk; pyrophosphate--fructose-6-phosphate 1-phosphotransferase [EC:2.7.1.90] bioB; biotin synthase [EC:2.8.1.6] hya; hyaluronoglucosaminidase [EC:3.2.1.35] dcp; peptidyl-dipeptidase Dcp [EC:3.4.15.5] kamA; lysine 2,3-aminomutase [EC:5.4.3.2] MUT; methylmalonyl-CoA mutase [EC:5.4.99.2] E6.3.5.1, NADSYN1, QNS1, nadE; NAD+ synthase (glutamine-hydrolysing) [EC:6.3.5.1] PCCB, pccB; propionyl-CoA carboxylase beta chain [EC:6.4.1.3] ABC-2.OM, wza; polysaccharide export outer membrane protein ABC-2.TX; HlyD family secretion protein ABC.MR.TX; HlyD family secretion protein Page 169 of 230 Diabetes

cobN; cobaltochelatase CobN [EC:6.6.1.2] flgB; flagellar basal-body rod protein FlgB flgC; flagellar basal-body rod protein FlgC flgD; flagellar basal-body rod modification protein FlgD flgE; flagellar hook protein FlgE flgJ; flagellar protein FlgJ flgL; flagellar hook-associated protein 3 FlgL flhF; flagellar biosynthesis protein FlhF fliE; flagellar hook-basal body complex protein FliE fliF; flagellar M-ring protein FliF fliG; flagellar motor switch protein FliG fliK; flagellar hook-length control protein FliK fliM; flagellar motor switch protein FliM fliP; flagellar biosynthetic protein FliP glpP; glycerol uptake operon antiterminator nifHD1, nifI1; nitrogen regulatory protein PII 1 nifHD2, nifI2; nitrogen regulatory protein PII 2 yjbB; phosphate:Na+ symporter TC.MATE, SLC47A, norM, mdtK, dinF; multidrug resistance protein, MATE family cheW; purine-binding chemotaxis protein CheW cheD; chemotaxis protein CheD [EC:3.5.1.44] phnW; 2-aminoethylphosphonate-pyruvate transaminase [EC:2.6.1.37] emrB; MFS transporter, DHA2 family, multidrug resistance protein trkH; trk system potassium uptake protein TrkH emrA; membrane fusion protein, multidrug efflux system acrA, mexA, adeI, smeD, mtrC, cmeA; membrane fusion protein, multidrug efflux system bfr; bacterioferritin [EC:1.16.3.1] fklB; FKBP-type peptidyl-prolyl cis-trans isomerase FklB [EC:5.2.1.8] ttdA; L(+)-tartrate dehydratase alpha subunit [EC:4.2.1.32] ttdB; L(+)-tartrate dehydratase beta subunit [EC:4.2.1.32] rseC; sigma-E factor negative regulatory protein RseC mtgA; monofunctional biosynthetic peptidoglycan transglycosylase [EC:2.4.1.-] fldA, nifF, isiB; flavodoxin I AROA2, aroA; 3-deoxy-7-phosphoheptulonate synthase [EC:2.5.1.54] pnbA; para-nitrobenzyl esterase [EC:3.1.1.-] hscC; molecular chaperone HscC flhG, fleN; flagellar biosynthesis protein FlhG hypC; hydrogenase expression/formation protein HypC hypD; hydrogenase expression/formation protein HypD hypE; hydrogenase expression/formation protein HypE hypF; hydrogenase maturation protein HypF phnX; phosphonoacetaldehyde hydrolase [EC:3.11.1.1] modF; molybdate transport system ATP-binding protein terD; tellurium resistance protein TerD djlA; DnaJ like chaperone protein rluC; 23S rRNA pseudouridine955/2504/2580 synthase [EC:5.4.99.24] pheB; chorismate mutase [EC:5.4.99.5] yndD; spore germination protein bofA; inhibitor of the pro-sigma K processing machinery spoIID; stage II sporulation protein D Diabetes Page 170 of 230

spoIIIAF; stage III sporulation protein AF spoIIIAG; stage III sporulation protein AG spoVAC; stage V sporulation protein AC spoVB; stage V sporulation protein B spoVFB; dipicolinate synthase subunit B spoVG; stage V sporulation protein G pgi1; glucose-6-phosphate isomerase, archaeal [EC:5.3.1.9] K06894 mapP; maltose 6'-phosphate phosphatase [EC:3.1.3.90] K06923 K06996 K07138 K07181; putative signal transduction protein containing EAL and modified HD-GYP domains pqqL; zinc protease [EC:3.4.24.-] queA; S-adenosylmethionine:tRNA ribosyltransferase-isomerase [EC:2.4.99.17] K07576; metallo-beta-lactamase family protein argK; LAO/AO transport system kinase [EC:2.7.-.-] yesM; two-component system, sensor histidine kinase YesM [EC:2.7.13.3] yesN; two-component system, response regulator YesN nikR; CopG family transcriptional regulator, nickel-responsive regulator yebQ; MFS transporter, DHA2 family, multidrug resistance protein ampG; MFS transporter, PAT family, beta-lactamase induction signal transducer AmpG fsr; MFS transporter, FSR family, fosmidomycin resistance protein csm3; CRISPR-associated protein Csm3 natB; sodium transport system permease protein natA; sodium transport system ATP-binding protein K09706; hypothetical protein K09766; hypothetical protein bioG; biotin synthesis protein BioG ABC.LPT.P, lolC, lolE; lipoprotein-releasing system permease protein ABC.LPT.A, lolD; lipoprotein-releasing system ATP-binding protein [EC:3.6.3.-] lacE, araN; lactose/L-arabinose transport system substrate-binding protein lacF, araP; lactose/L-arabinose transport system permease protein lacG, araQ; lactose/L-arabinose transport system permease protein mglB; methyl-galactoside transport system substrate-binding protein mglC; methyl-galactoside transport system permease protein mglA; methyl-galactoside transport system ATP-binding protein [EC:3.6.3.17] enr; 2-enoate reductase [EC:1.3.1.31] melB; melibiose permease liaR; two-component system, NarL family, response regulator LiaR mqnA; chorismate dehydratase [EC:4.2.1.151] mqnD; 1,4-dihydroxy-6-naphthoate synthase [EC:1.14.-.-] tolC; outer membrane protein nuoCD; NADH-quinone oxidoreductase subunit C/D [EC:1.6.5.3] nspC; carboxynorspermidine decarboxylase [EC:4.1.1.96] czcA; cobalt-zinc-cadmium resistance protein CzcA AXY8, FUC95A, afcA; alpha-L-fucosidase 2 [EC:3.2.1.51] TC.FEV.OM2, fepA, iroN, cirA, pfeA, cfrA, hmuR; outer membrane receptor for ferrienterochelin and colicins btuB; vitamin B12 transporter xanP; xanthine permease XanP Page 171 of 230 Diabetes

etk-wzc; tyrosine-protein kinase Etk/Wzc [EC:2.7.10.-] araN; arabinosaccharide transport system substrate-binding protein araP; arabinosaccharide transport system permease protein araQ; arabinosaccharide transport system permease protein acrB, mexB, adeJ, smeE, mtrD, cmeB; multidrug efflux pump vat; virginiamycin A acetyltransferase [EC:2.3.1.-] mqnE; aminodeoxyfutalosine synthase [EC:2.5.1.120] parM; plasmid segregation protein ParM mqnC; cyclic dehypoxanthinyl futalosine synthase [EC:1.21.98.1] cpo; non-heme chloroperoxidase [EC:1.11.1.10] flp, pilA; pilus assembly protein Flp/PilA K07003 ygfK; putative selenate reductase [EC:1.97.1.9] hyaD, hybD; hydrogenase maturation protease [EC:3.4.23.-] gldA; glycerol dehydrogenase [EC:1.1.1.6] iolG; myo-inositol 2-dehydrogenase / D-chiro-inositol 1-dehydrogenase [EC:1.1.1.18 1.1.1.369] mdh; malate dehydrogenase [EC:1.1.1.37] E1.1.1.40, maeB; malate dehydrogenase (oxaloacetate-decarboxylating)(NADP+) [EC:1.1.1.40] E1.1.1.90; aryl-alcohol dehydrogenase [EC:1.1.1.90] dhaT; 1,3-propanediol dehydrogenase [EC:1.1.1.202] pdxA; 4-hydroxythreonine-4-phosphate dehydrogenase [EC:1.1.1.262] poxB; pyruvate dehydrogenase (quinone) [EC:1.2.5.1] korA, oorA; 2-oxoglutarate ferredoxin oxidoreductase subunit alpha [EC:1.2.7.3] korB, oorB; 2-oxoglutarate ferredoxin oxidoreductase subunit beta [EC:1.2.7.3] korD, oorD; 2-oxoglutarate ferredoxin oxidoreductase subunit delta [EC:1.2.7.3] korC, oorC; 2-oxoglutarate ferredoxin oxidoreductase subunit gamma [EC:1.2.7.3] E1.3.1.12; prephenate dehydrogenase [EC:1.3.1.12] PPOX, hemY; oxygen-dependent protoporphyrinogen oxidase [EC:1.3.3.4] sdhA, frdA; succinate dehydrogenase / fumarate reductase, flavoprotein subunit [EC:1.3.5.1 1.3.5.4] sdhB, frdB; succinate dehydrogenase / fumarate reductase, iron-sulfur subunit [EC:1.3.5.1 1.3.5.4] sdhC, frdC; succinate dehydrogenase / fumarate reductase, cytochrome b subunit DHODH, pyrD; dihydroorotate dehydrogenase [EC:1.3.5.2] E1.3.99.- ald; alanine dehydrogenase [EC:1.4.1.1] pdxH, PNPO; pyridoxamine 5'-phosphate oxidase [EC:1.4.3.5] GLDC, gcvP; glycine dehydrogenase [EC:1.4.4.2] nuoA; NADH-quinone oxidoreductase subunit A [EC:1.6.5.3] nuoB; NADH-quinone oxidoreductase subunit B [EC:1.6.5.3] nuoH; NADH-quinone oxidoreductase subunit H [EC:1.6.5.3] nuoI; NADH-quinone oxidoreductase subunit I [EC:1.6.5.3] nuoJ; NADH-quinone oxidoreductase subunit J [EC:1.6.5.3] nuoK; NADH-quinone oxidoreductase subunit K [EC:1.6.5.3] nuoL; NADH-quinone oxidoreductase subunit L [EC:1.6.5.3] nuoM; NADH-quinone oxidoreductase subunit M [EC:1.6.5.3] nuoN; NADH-quinone oxidoreductase subunit N [EC:1.6.5.3] nqrA; Na+-transporting NADH:ubiquinone oxidoreductase subunit A [EC:1.6.5.-] nqrB; Na+-transporting NADH:ubiquinone oxidoreductase subunit B [EC:1.6.5.-] nqrC; Na+-transporting NADH:ubiquinone oxidoreductase subunit C [EC:1.6.5.-] nqrD; Na+-transporting NADH:ubiquinone oxidoreductase subunit D [EC:1.6.5.-] nqrE; Na+-transporting NADH:ubiquinone oxidoreductase subunit E [EC:1.6.5.-] Diabetes Page 172 of 230

nqrF; Na+-transporting NADH:ubiquinone oxidoreductase subunit F [EC:1.6.5.-] narG; nitrate reductase alpha subunit [EC:1.7.99.4] narH; nitrate reductase beta subunit [EC:1.7.99.4] narJ; nitrate reductase delta subunit narI; nitrate reductase gamma subunit [EC:1.7.99.4] K00375; GntR family transcriptional regulator / MocR family aminotransferase yidH; putative membrane protein E1.11.1.5; cytochrome c peroxidase [EC:1.11.1.5] mmuM; homocysteine S-methyltransferase [EC:2.1.1.10] trmH; tRNA (guanosine-2'-O-)-methyltransferase [EC:2.1.1.34] E2.1.1.77, pcm; protein-L-isoaspartate(D-aspartate) O-methyltransferase [EC:2.1.1.77] fctD; glutamate formiminotransferase [EC:2.1.2.5] gcvT, AMT; aminomethyltransferase [EC:2.1.2.10] lacA; galactoside O-acetyltransferase [EC:2.3.1.18] ptb; phosphate butyryltransferase [EC:2.3.1.19] catB; chloramphenicol O-acetyltransferase type B [EC:2.3.1.28] kbl, GCAT; glycine C-acetyltransferase [EC:2.3.1.29] metX; homoserine O-acetyltransferase [EC:2.3.1.31] fabB; 3-oxoacyl-[acyl-carrier-protein] synthase I [EC:2.3.1.41] bioF; 8-amino-7-oxononanoate synthase [EC:2.3.1.47] DLST, sucB; 2-oxoglutarate dehydrogenase E2 component (dihydrolipoamide succinyltransferase) [EC:2.3.1.61] lpxA; UDP-N-acetylglucosamine acyltransferase [EC:2.3.1.129] aat; leucyl/phenylalanyl-tRNA--protein transferase [EC:2.3.2.6] E2.4.1.5; dextransucrase [EC:2.4.1.5] DPM1; dolichol-phosphate mannosyltransferase [EC:2.4.1.83] lpxB; lipid-A-disaccharide synthase [EC:2.4.1.182] MMAB, pduO; cob(I)alamin adenosyltransferase [EC:2.5.1.17] aspB; aspartate aminotransferase [EC:2.6.1.1] rocD, OAT; ornithine--oxo-acid transaminase [EC:2.6.1.13] puuE; 4-aminobutyrate aminotransferase [EC:2.6.1.19] HK; hexokinase [EC:2.7.1.1] araB; L-ribulokinase [EC:2.7.1.16] cysC; adenylylsulfate kinase [EC:2.7.1.25] E2.7.1.90, pfk; pyrophosphate--fructose-6-phosphate 1-phosphotransferase [EC:2.7.1.90] lpxK; tetraacyldisaccharide 4'-kinase [EC:2.7.1.130] E2.7.2.7, buk; butyrate kinase [EC:2.7.2.7] ndk, NME; nucleoside-diphosphate kinase [EC:2.7.4.6] thiL; thiamine-monophosphate kinase [EC:2.7.4.16] pcnB; poly(A) polymerase [EC:2.7.7.19] rfbF; glucose-1-phosphate cytidylyltransferase [EC:2.7.7.33] kdsB; 3-deoxy-manno-octulosonate cytidylyltransferase (CMP-KDO synthetase) [EC:2.7.7.38] E2.7.7.43, neuA, CMAS; N-acylneuraminate cytidylyltransferase [EC:2.7.7.43] E2.7.7.49; RNA-directed DNA polymerase [EC:2.7.7.49] E2.8.3.- PGLS, pgl, devB; 6-phosphogluconolactonase [EC:3.1.1.31] E3.1.3.7, cysQ, MET22, BPNT1; 3'(2'), 5'-bisphosphate nucleotidase [EC:3.1.3.7] hisB; imidazoleglycerol-phosphate dehydratase / histidinol-phosphatase [EC:4.2.1.19 3.1.3.15] E3.1.6.1, aslA; arylsulfatase [EC:3.1.6.1] E3.1.11.5; exodeoxyribonuclease V [EC:3.1.11.5] E3.1.21.4; type II restriction enzyme [EC:3.1.21.4] Page 173 of 230 Diabetes

ruvC; crossover junction endodeoxyribonuclease RuvC [EC:3.1.22.4] K01163; hypothetical protein ENDOG; endonuclease G, mitochondrial NEU1; sialidase-1 [EC:3.2.1.18] E3.2.1.28, treA, treF; alpha,alpha-trehalase [EC:3.2.1.28] hya; hyaluronoglucosaminidase [EC:3.2.1.35] GBA, srfJ; glucosylceramidase [EC:3.2.1.45] NAGLU; alpha-N-acetylglucosaminidase [EC:3.2.1.50] E3.2.1.73; licheninase [EC:3.2.1.73] aguA; alpha-glucuronidase [EC:3.2.1.139] amn; AMP nucleosidase [EC:3.2.2.4] rihA; pyrimidine-specific ribonucleoside hydrolase [EC:3.2.-.-] DPP3; dipeptidyl-peptidase III [EC:3.4.14.4] DPP4; dipeptidyl-peptidase 4 [EC:3.4.14.5] dcp; peptidyl-dipeptidase Dcp [EC:3.4.15.5] ldcA; muramoyltetrapeptide carboxypeptidase [EC:3.4.17.13] PREP; prolyl oligopeptidase [EC:3.4.21.26] lon; ATP-dependent Lon protease [EC:3.4.21.53] AXL1; protease AXL1 [EC:3.4.24.-] ureC; urease subunit alpha [EC:3.5.1.5] ureB; urease subunit beta [EC:3.5.1.5] ureA; urease subunit gamma [EC:3.5.1.5] purU; formyltetrahydrofolate deformylase [EC:3.5.1.10] E3.5.1.28A, cwlA, xlyA, xlyB; N-acetylmuramoyl-L-alanine amidase [EC:3.5.1.28] hutI, AMDHD1; imidazolonepropionase [EC:3.5.2.7] E3.5.3.1, rocF, arg; arginase [EC:3.5.3.1] speB; agmatinase [EC:3.5.3.11] codA; cytosine deaminase [EC:3.5.4.1] E2.1.2.3; phosphoribosylaminoimidazolecarboxamide formyltransferase [EC:2.1.2.3] kdpA; K+-transporting ATPase ATPase A chain [EC:3.6.3.12] kdpB; K+-transporting ATPase ATPase B chain [EC:3.6.3.12] kdpC; K+-transporting ATPase ATPase C chain [EC:3.6.3.12] oadG; oxaloacetate decarboxylase, gamma subunit [EC:4.1.1.3] speA; arginine decarboxylase [EC:4.1.1.19] hdc, HDC; histidine decarboxylase [EC:4.1.1.22] hemE, UROD; uroporphyrinogen decarboxylase [EC:4.1.1.37] speD, AMD1; S-adenosylmethionine decarboxylase [EC:4.1.1.50] kdsA; 2-dehydro-3-deoxyphosphooctonate aldolase (KDO 8-P synthase) [EC:2.5.1.55] E4.1.3.3, nanA, NPL; N-acetylneuraminate lyase [EC:4.1.3.3] pabB; para-aminobenzoate synthetase component I [EC:2.6.1.85] mhpE; 4-hydroxy 2-oxovalerate aldolase [EC:4.1.3.39] tnaA; tryptophanase [EC:4.1.99.1] E4.2.1.2A, fumA, fumB; fumarate hydratase, class I [EC:4.2.1.2] hemB, ALAD; porphobilinogen synthase [EC:4.2.1.24] pduC; propanediol dehydratase large subunit [EC:4.2.1.28] rfbG; CDP-glucose 4,6-dehydratase [EC:4.2.1.45] hutU, UROC1; urocanate hydratase [EC:4.2.1.49] hemD, UROS; uroporphyrinogen-III synthase [EC:4.2.1.75] ogl; oligogalacturonide lyase [EC:4.2.2.6] aspA; aspartate ammonia-lyase [EC:4.3.1.1] Diabetes Page 174 of 230

hutH, HAL; histidine ammonia-lyase [EC:4.3.1.3] hemC, HMBS; hydroxymethylbilane synthase [EC:2.5.1.61] E4.3.1.12, ocd; ornithine cyclodeaminase [EC:4.3.1.12] E4.6.1.13, plc; 1-phosphatidylinositol phosphodiesterase [EC:4.6.1.13] RENBP; N-acylglucosamine 2-epimerase [EC:5.1.3.8] E5.2.1.8; peptidylprolyl isomerase [EC:5.2.1.8] fucI; L-fucose isomerase [EC:5.3.1.25] manB; phosphomannomutase [EC:5.4.2.8] kamA; lysine 2,3-aminomutase [EC:5.4.3.2] hemL; glutamate-1-semialdehyde 2,1-aminomutase [EC:5.4.3.8] MUT; methylmalonyl-CoA mutase [EC:5.4.99.2] INO1, ISYNA1; myo-inositol-1-phosphate synthase [EC:5.5.1.4] ACSL, fadD; long-chain acyl-CoA synthetase [EC:6.2.1.3] sucD; succinyl-CoA synthetase alpha subunit [EC:6.2.1.5] sucC; succinyl-CoA synthetase beta subunit [EC:6.2.1.5] gshA; glutamate--cysteine ligase [EC:6.3.2.2] E6.3.5.1, NADSYN1, QNS1, nadE; NAD+ synthase (glutamine-hydrolysing) [EC:6.3.5.1] pycB; pyruvate carboxylase subunit B [EC:6.4.1.1] PCCB, pccB; propionyl-CoA carboxylase beta chain [EC:6.4.1.3] ABC-2.OM, wza; polysaccharide export outer membrane protein ABC-2.TX; HlyD family secretion protein cbiN; cobalt/nickel transport protein TC.FEV.OM; iron complex outermembrane recepter protein mlaF, linL, mkl; phospholipid/cholesterol/gamma-HCH transport system ATP-binding protein mlaE, linK; phospholipid/cholesterol/gamma-HCH transport system permease protein mlaD, linM; phospholipid/cholesterol/gamma-HCH transport system substrate-binding protein zurR, zur; Fur family transcriptional regulator, zinc uptake regulator agaI; galactosamine-6-phosphate isomerase [EC:5.3.1.-] ATPVA, ntpA, atpA; V/A-type H+-transporting ATPase subunit A [EC:3.6.3.14] ATPVE, ntpE, atpE; V/A-type H+-transporting ATPase subunit E bioC; malonyl-CoA O-methyltransferase [EC:2.1.1.197] cbiK; sirohydrochlorin cobaltochelatase [EC:4.99.1.3] cbiT; cobalt-precorrin-6B (C15)-methyltransferase [EC:2.1.1.196] ftnA, ftn; ferritin [EC:1.16.3.2] cobN; cobaltochelatase CobN [EC:6.6.1.2] MET8; precorrin-2 dehydrogenase / sirohydrochlorin ferrochelatase [EC:1.3.1.76 4.99.1.4] entC; isochorismate synthase [EC:5.4.4.2] TSTA3, fcl; GDP-L-fucose synthase [EC:1.1.1.271] sufE; cysteine desulfuration protein SufE fucP; MFS transporter, FHS family, L-fucose permease gcvH, GCSH; glycine cleavage system H protein wecC; UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase [EC:1.1.1.336] E5.1.3.7, wbpP; UDP-N-acetylglucosamine 4-epimerase [EC:5.1.3.7] wbpO; UDP-N-acetyl-D-galactosamine dehydrogenase [EC:1.1.1.-] K02477; two-component system, LytT family, response regulator K02481; two-component system, NtrC family, response regulator hemA; glutamyl-tRNA reductase [EC:1.2.1.70] hpaH; 2-oxo-hept-3-ene-1,7-dioate hydratase [EC:4.2.1.-] lpxL, htrB; KDO2-lipid IV(A) lauroyltransferase [EC:2.3.1.241] ispB; octaprenyl-diphosphate synthase [EC:2.5.1.90] Page 175 of 230 Diabetes

kdgR; LacI family transcriptional regulator, kdg operon repressor kdtA, waaA; 3-deoxy-D-manno-octulosonic-acid transferase [EC:2.4.99.12 2.4.99.13 2.4.99.14 2.4.99.15] lpxD; UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase [EC:2.3.1.191] nagD; NagD protein NRT, narK, nrtP, nasA; MFS transporter, NNP family, nitrate/nitrite transporter pabC; 4-amino-4-deoxychorismate lyase [EC:4.1.3.38] flp, pilA; pilus assembly protein Flp/PilA PTS-HPR.PTSH, ptsH; phosphocarrier protein HPr prfH; peptide chain release factor waaB, rfaB; UDP-D-galactose:(glucosyl)LPS alpha-1,6-D-galactosyltransferase [EC:2.4.1.-] rhaT; L-rhamnose-H+ transport protein ribB, RIB3; 3,4-dihydroxy 2-butanone 4-phosphate synthase [EC:4.1.99.12] RP-L25, rplY; large subunit ribosomal protein L25 ulaF, sgaE; L-ribulose-5-phosphate 4-epimerase [EC:5.1.3.4] SIG54, rpoN; RNA polymerase sigma-54 factor EIF1, SUI1; translation initiation factor 1 tatC; sec-independent protein translocase protein TatC THI4, THI1; thiamine thiazole synthase thiG; thiazole synthase [EC:2.8.1.10] ubiA; 4-hydroxybenzoate polyprenyltransferase [EC:2.5.1.39] ureE; urease accessory protein ureF; urease accessory protein ureG; urease accessory protein ureD, ureH; urease accessory protein lpxH; UDP-2,3-diacylglucosamine hydrolase [EC:3.6.1.54] kdsC; 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase (KDO 8-P phosphatase) [EC:3.1.3.45] gmhD, rfaD; ADP-L-glycero-D-manno-heptose 6-epimerase [EC:5.1.3.20] TC.CIC; chloride channel protein, CIC family TC.HAE1; hydrophobic/amphiphilic exporter-1 (mainly G- bacteria), HAE1 family TC.GNTP; gluconate:H+ symporter, GntP family TC.SSS; solute:Na+ symporter, SSS family nhaA; Na+:H+ antiporter, NhaA family TC.MATE, SLC47A, norM, mdtK, dinF; multidrug resistance protein, MATE family hdrA; heterodisulfide reductase subunit A [EC:1.8.98.1] hdrB; heterodisulfide reductase subunit B [EC:1.8.98.1] hdrC; heterodisulfide reductase subunit C [EC:1.8.98.1] cobI-cbiL; precorrin-2/cobalt-factor-2 C20-methyltransferase [EC:2.1.1.130 2.1.1.151] cbiE; cobalt-precorrin-7 (C5)-methyltransferase [EC:2.1.1.289] phnW; 2-aminoethylphosphonate-pyruvate transaminase [EC:2.6.1.37] MFS.SP; MFS transporter, SP family, sugar porter, other emrB; MFS transporter, DHA2 family, multidrug resistance protein MFS.CP; MFS transporter, CP family, cyanate transporter TC.BASS; bile acid:Na+ symporter, BASS family pdxB; erythronate-4-phosphate dehydrogenase [EC:1.1.1.290] pdxJ; pyridoxine 5-phosphate synthase [EC:2.6.99.2] DPO5D, umuD; DNA polymerase V [EC:3.4.21.-] gcpE, ispG; (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase [EC:1.17.7.1 1.17.7.3] rhaM; L-rhamnose mutarotase [EC:5.1.3.32] emrA; membrane fusion protein, multidrug efflux system cvpA; membrane protein required for colicin V production Diabetes Page 176 of 230

exbD; biopolymer transport protein ExbD exbB; biopolymer transport protein ExbB BCP, PRXQ, DOT5; peroxiredoxin Q/BCP [EC:1.11.1.15] acrA, mexA, adeI, smeD, mtrC, cmeA; membrane fusion protein, multidrug efflux system ftsI; cell division protein FtsI (penicillin-binding protein 3) mrp, NUBPL; ATP-binding protein involved in chromosome partitioning bfr; bacterioferritin [EC:1.16.3.1] wcaJ; putative colanic acid biosysnthesis UDP-glucose lipid carrier transferase rnfD; electron transport complex protein RnfD MOCS2, moaE; molybdopterin synthase catalytic subunit [EC:2.8.1.12] moaD; molybdopterin synthase sulfur carrier subunit moaB; molybdenum cofactor biosynthesis protein B lipA; lipoic acid synthetase [EC:2.8.1.8] icc; Icc protein helD; DNA helicase IV [EC:3.6.4.12] ubiB, aarF; ubiquinone biosynthesis protein clpA; ATP-dependent Clp protease ATP-binding subunit ClpA asnC; Lrp/AsnC family transcriptional regulator, regulator for asnA, asnC and gidA lrp; Lrp/AsnC family transcriptional regulator, leucine-responsive regulatory protein pncC; nicotinamide-nucleotide amidase [EC:3.5.1.42] pncC; nicotinamide-nucleotide amidase [EC:3.5.1.42] sanA; SanA protein mobB; molybdopterin-guanine dinucleotide biosynthesis protein B eptA; lipid A ethanolaminephosphotransferase [EC:2.7.8.-] ppiD; peptidyl-prolyl cis-trans isomerase D [EC:5.2.1.8] surA; peptidyl-prolyl cis-trans isomerase SurA [EC:5.2.1.8] fkpA; FKBP-type peptidyl-prolyl cis-trans isomerase FkpA [EC:5.2.1.8] fklB; FKBP-type peptidyl-prolyl cis-trans isomerase FklB [EC:5.2.1.8] slyD; FKBP-type peptidyl-prolyl cis-trans isomerase SlyD [EC:5.2.1.8] katE, CAT, catB, srpA; catalase [EC:1.11.1.6] aroQ, qutE; 3-dehydroquinate dehydratase II [EC:4.2.1.10] lipB; lipoyl(octanoyl) transferase [EC:2.3.1.181] rseC; sigma-E factor negative regulatory protein RseC mtgA; monofunctional biosynthetic peptidoglycan transglycosylase [EC:2.4.1.-] wcaF; putative colanic acid biosynthesis acetyltransferase WcaF [EC:2.3.1.-] lnt; apolipoprotein N-acyltransferase [EC:2.3.1.-] yhbS; putative acetyltransferase [EC:2.3.1.-] tonB; periplasmic protein TonB fldA, nifF, isiB; flavodoxin I moxR; MoxR-like ATPase [EC:3.6.3.-] yvaK; carboxylesterase [EC:3.1.1.1] ygjK; putative isomerase lpqC; polyhydroxybutyrate depolymerase pspC; phage shock protein C eutJ; ethanolamine utilization protein EutJ eutP; ethanolamine utilization protein EutP eutS; ethanolamine utilization protein EutS dsbD; thiol:disulfide interchange protein DsbD [EC:1.8.1.8] clpL; ATP-dependent Clp protease ATP-binding subunit ClpL ycdX; putative hydrolase Page 177 of 230 Diabetes

rsbV; anti-sigma B factor antagonist oxyR; LysR family transcriptional regulator, hydrogen peroxide-inducible genes activator hslR; ribosome-associated heat shock protein Hsp15 sppA; protease IV [EC:3.4.21.-] phnX; phosphonoacetaldehyde hydrolase [EC:3.11.1.1] lrgA; holin-like protein lrgB; holin-like protein LrgB treS; maltose alpha-D-glucosyltransferase/ alpha-amylase [EC:5.4.99.16 3.2.1.1] deoR; deoxyribonucleoside regulator pbpC; penicillin-binding protein 1C [EC:2.4.1.-] mrdA; penicillin-binding protein 2 marC; multiple antibiotic resistance protein MCEE, epi; methylmalonyl-CoA/ethylmalonyl-CoA epimerase [EC:5.1.99.1] modF; molybdate transport system ATP-binding protein rfaH; transcriptional antiterminator RfaH ybaO; Lrp/AsnC family transcriptional regulator djlA; DnaJ like chaperone protein bamD; outer membrane protein assembly factor BamD yfiM; putative lipoprotein cobK-cbiJ; precorrin-6A/cobalt-precorrin-6A reductase [EC:1.3.1.54 1.3.1.106] E2.4.1.58 kdsD, kpsF; arabinose-5-phosphate isomerase [EC:5.3.1.13] cobH-cbiC; precorrin-8X/cobalt-precorrin-8 methylmutase [EC:5.4.99.61 5.4.99.60] fadL; long-chain fatty acid transport protein cutF, nlpE; copper homeostasis protein (lipoprotein) hlpA, ompH; outer membrane protein gntT; Gnt-I system high-affinity gluconate transporter phnP; phosphoribosyl 1,2-cyclic phosphate phosphodiesterase [EC:3.1.4.55] rluA; tRNA pseudouridine32 synthase / 23S rRNA pseudouridine746 synthase [EC:5.4.99.28 5.4.99.29] aqpZ; aquaporin Z nlpD; lipoprotein NlpD dam; DNA adenine methylase [EC:2.1.1.72] spoIVCA; site-specific DNA recombinase lptB; lipopolysaccharide export system ATP-binding protein [EC:3.6.3.-] K06871; uncharacterized protein clpS; ATP-dependent Clp protease adaptor protein ClpS K06894 K06897; 7,8-dihydropterin-6-yl-methyl-4-(beta-D-ribofuranosyl)aminobenzene 5'-phosphate synthase [EC:2.5.1.105] K06903 K06907 xtmB; phage terminase large subunit K06911 K06921 K06934 rlmF; 23S rRNA (adenine1618-N6)-methyltransferase [EC:2.1.1.181] nadX; aspartate dehydrogenase [EC:1.4.1.21] K06996 K07002 K07011 cas3; CRISPR-associated endonuclease/helicase Cas3 [EC:3.1.-.- 3.6.4.-] Diabetes Page 178 of 230

K07017 hddA; D-glycero-alpha-D-manno-heptose-7-phosphate kinase [EC:2.7.1.168] K07071 K07085; putative transport protein lptF; lipopolysaccharide export system permease protein K07109 yfbK; Ca-activated chloride channel homolog K07138 K07148; uncharacterized protein K07164 phoH2; PhoH-like ATPase fes; enterochelin esterase and related enzymes K07217; Mn-containing catalase oprO_P; phosphate-selective porin OprO and OprP K07223; putative iron-dependent peroxidase chrA; chromate transporter aldA; lactaldehyde dehydrogenase / glycolaldehyde dehydrogenase [EC:1.2.1.22 1.2.1.21] spsF; spore coat polysaccharide biosynthesis protein SpsF dacB; D-alanyl-D-alanine carboxypeptidase / D-alanyl-D-alanine-endopeptidase (penicillin-binding protein 4) [EC:3.4.16.4 3.4.21.-] pqqL; zinc protease [EC:3.4.24.-] SAM50, TOB55, bamA; outer membrane protein insertion porin family rsbU; sigma-B regulation protein RsbU (phosphoserine phosphatase) yhdJ; adenine-specific DNA-methyltransferase [EC:2.1.1.72] ytfE, scdA; regulator of cell morphogenesis and NO signaling K07387; putative metalloprotease [EC:3.4.24.-] yhfA; putative redox protein E3.2.1.1A; alpha-amylase [EC:3.2.1.1] ybjD; putative ATP-dependent endonuclease of the OLD family yraN; putative endonuclease cas4; CRISPR-associated exonuclease Cas4 [EC:3.1.12.1] K07484; transposase K07496; putative transposase K07504; hypothetical protein bcr; MFS transporter, DHA1 family, bicyclomycin/chloramphenicol resistance protein K07571; S1 RNA binding domain protein argK; LAO/AO transport system kinase [EC:2.7.-.-] phoB; two-component system, OmpR family, phosphate regulon response regulator PhoB cusR, copR, silR; two-component system, OmpR family, copper resistance phosphate regulon response regulator CusR nreB; two-component system, NarL family, sensor histidine kinase NreB [EC:2.7.13.3] nreC; two-component system, NarL family, response regulator NreC lytS; two-component system, LytT family, sensor histidine kinase LytS [EC:2.7.13.3] lytT, lytR; two-component system, LytT family, response regulator LytT ycbB, glnL; two-component system, response regulator YcbB algH; putative transcriptional regulator parD1_3_4; antitoxin ParD1/3/4 uhpC; MFS transporter, OPA family, sugar phosphate sensor protein UhpC cusA, silA; Cu(I)/Ag(I) efflux system membrane protein CusA/SilA dcuA; anaerobic C4-dicarboxylate transporter DcuA dcuB; anaerobic C4-dicarboxylate transporter DcuB cusB, silB; membrane fusion protein, Cu(I)/Ag(I) efflux system Page 179 of 230 Diabetes

ytrA; GntR family transcriptional regulator xylE; MFS transporter, SP family, xylose:H+ symportor yebQ; MFS transporter, DHA2 family, multidrug resistance protein exuT; MFS transporter, ACS family, hexuronate transporter ampG; MFS transporter, PAT family, beta-lactamase induction signal transducer AmpG fsr; MFS transporter, FSR family, fosmidomycin resistance protein purT; phosphoribosylglycinamide formyltransferase 2 [EC:2.1.2.2] mltD, dniR; membrane-bound lytic murein transglycosylase D lsrF; putative autoinducer-2 (AI-2) aldolase [EC:4.1.2.-] yqhD; NADP-dependent alcohol dehydrogenase [EC:1.1.-.-] mtnU; carbon-nitrogen hydrolase family protein srtB; sortase B [EC:3.4.22.70] vanX; D-alanyl-D-alanine dipeptidase [EC:3.4.13.22] tri; tricorn protease [EC:3.4.21.-] E5.1.3.6; UDP-glucuronate 4-epimerase [EC:5.1.3.6] utp; urea transporter mtnE, mtnV; aminotransferase [EC:2.6.1.-] K08972; putative membrane protein TC.BAT1; bacterial/archaeal transporter family protein cimA; D-citramalate synthase [EC:2.3.1.182] K09125; hypothetical protein yfiQ; acetyltransferase E4.1.1.82; phosphonopyruvate decarboxylase [EC:4.1.1.82] aepZ; 2-aminoethylphosphonate-pyruvate transaminase phoN; acid phosphatase (class A) [EC:3.1.3.2] coaW; type II pantothenate kinase [EC:2.7.1.33] bioG; biotin synthesis protein BioG K09793; hypothetical protein K09797; hypothetical protein K09807; hypothetical protein ABC.LPT.P, lolC, lolE; lipoprotein-releasing system permease protein ABC.LPT.A, lolD; lipoprotein-releasing system ATP-binding protein [EC:3.6.3.-] K09922; hypothetical protein K09924; hypothetical protein K09939; hypothetical protein K09940; hypothetical protein K09979; hypothetical protein ABC.CYST.P; cystine transport system permease protein PENDE; isopenicillin-N N-acyltransferase [EC:2.3.1.164] slo; thiol-activated cytolysin msbA; ATP-binding cassette, subfamily B, bacterial MsbA [EC:3.6.3.-] gltP, gltT; proton glutamate symport protein cvrA, nhaP2; cell volume regulation protein A bkdA; 2-oxoisovalerate dehydrogenase E1 component [EC:1.2.4.4] K11527; two-component system, unclassified family, sensor histidine kinase and response regulator [EC:2.7.13.3] xapB; MFS transporter, NHS family, xanthosine permease lptG; lipopolysaccharide export system permease protein mqnA; chorismate dehydratase [EC:4.2.1.151] mqnC; cyclic dehypoxanthinyl futalosine synthase [EC:1.21.98.1] mqnD; 1,4-dihydroxy-6-naphthoate synthase [EC:1.14.-.-] Diabetes Page 180 of 230

MOCS3, UBA4, moeB; adenylyltransferase and sulfurtransferase msrAB; peptide methionine sulfoxide reductase msrA/msrB [EC:1.8.4.11 1.8.4.12] cysM; cysteine synthase B [EC:2.5.1.47] tolC; outer membrane protein HEXA_B; hexosaminidase [EC:3.2.1.52] rfbH; CDP-6-deoxy-D-xylo-4-hexulose-3-dehydrase rfbE; CDP-paratose 2-epimerase [EC:5.1.3.10] thrA; bifunctional aspartokinase / homoserine dehydrogenase 1 [EC:2.7.2.4 1.1.1.3] abgT; aminobenzoyl-glutamate transport protein wbyK; mannosyltransferase [EC:2.4.1.-] wbpD, wlbB; UDP-2-acetamido-3-amino-2,3-dideoxy-glucuronate N-acetyltransferase [EC:2.3.1.201] argF; N-succinyl-L-ornithine transcarbamylase [EC:2.1.3.11] iaaA, ASRGL1; beta-aspartyl-peptidase (threonine type) [EC:3.4.19.5] nuoCD; NADH-quinone oxidoreductase subunit C/D [EC:1.6.5.3] cobA-hemD; uroporphyrinogen III methyltransferase / synthase [EC:2.1.1.107 4.2.1.75] K13652; AraC family transcriptional regulator spr; lipoprotein Spr nspC; carboxynorspermidine decarboxylase [EC:4.1.1.96] putA; RHH-type transcriptional regulator, proline utilization regulon repressor / proline dehydrogenase / delta 1-pyrroline-5-carboxylate dehydrogenase [EC:1.5.5.2 1.2.1.88] pduD; propanediol dehydratase medium subunit [EC:4.2.1.28] pduE; propanediol dehydratase small subunit [EC:4.2.1.28] pduQ; 1-propanol dehydrogenase pduP; propionaldehyde dehydrogenase [EC:1.2.1.87] pduL; phosphate propanoyltransferase [EC:2.3.1.222] FTCD; glutamate formiminotransferase / formiminotetrahydrofolate cyclodeaminase [EC:2.1.2.5 4.3.1.4] mprF, fmtC; phosphatidylglycerol lysyltransferase [EC:2.3.2.3] RTCB, rtcB; tRNA-splicing ligase RtcB [EC:6.5.1.3] dinD; DNA-damage-inducible protein D tsaB; tRNA threonylcarbamoyladenosine biosynthesis protein TsaB yfiC, trmX; tRNA1Val (adenine37-N6)-methyltransferase [EC:2.1.1.223] apgM; 2,3-bisphosphoglycerate-independent phosphoglycerate mutase [EC:5.4.2.12] hddC; D-glycero-alpha-D-manno-heptose 1-phosphate guanylyltransferase [EC:2.7.7.71] czcC; outer membrane protein, cobalt-zinc-cadmium efflux system czcA; cobalt-zinc-cadmium resistance protein CzcA czcB; membrane fusion protein, cobalt-zinc-cadmium efflux system nrfH; cytochrome c nitrite reductase small subunit pseI, neuB3; pseudaminic acid synthase [EC:2.5.1.97] AXY8, FUC95A, afcA; alpha-L-fucosidase 2 [EC:3.2.1.51] K15977; putative oxidoreductase hppA; K(+)-stimulated pyrophosphate-energized sodium pump [EC:3.6.1.1] ynaI, mscMJ, MSL; MscS family membrane protein mscM; miniconductance mechanosensitive channel TPS; trehalose 6-phosphate synthase/phosphatase [EC:2.4.1.15 3.1.3.12] TC.FEV.OM2, fepA, iroN, cirA, pfeA, cfrA, hmuR; outer membrane receptor for ferrienterochelin and colicins fecA; Fe(3+) dicitrate transport protein btuB; vitamin B12 transporter K16153; phosphorylase / glycogen(starch) synthase [EC:2.4.1.1 2.4.1.11] mmuP; S-methylmethionine transporter yxjA, nupG; purine nucleoside transport protein xanP; xanthine permease XanP Page 181 of 230 Diabetes

lpxC-fabZ; UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase / 3-hydroxyacyl-[acyl-carrier-protein] dehydratase [EC:3.5.1.108 4.2.1.59] evaA; oxidase EvaA tuaG; teichuronic acid biosynthesis glycosyltransferase TuaG [EC:2.4.-.-] doxA; thiosulfate dehydrogenase [quinone] small subunit [EC:1.8.5.2] doxD; thiosulfate dehydrogenase [quinone] large subunit [EC:1.8.5.2] CHO1, pssA; CDP-diacylglycerol---serine O-phosphatidyltransferase [EC:2.7.8.8] PEO1; twinkle protein [EC:3.6.4.12] capD; UDP-glucose 4-epimerase [EC:5.1.3.2] preT; dihydropyrimidine dehydrogenase (NAD+) subunit PreT [EC:1.3.1.1] preA; dihydropyrimidine dehydrogenase (NAD+) subunit PreA [EC:1.3.1.1] bla2, blm, ccrA, blaB; metallo-beta-lactamase class B [EC:3.5.2.6] hndB; NADP-reducing hydrogenase subunit HndB [EC:1.12.1.3] acrB, mexB, adeJ, smeE, mtrD, cmeB; multidrug efflux pump oprM, emhC, ttgC, cusC, adeK, smeF, mtrE, cmeC; outer membrane protein, multidrug efflux system vat; virginiamycin A acetyltransferase [EC:2.3.1.-] mqnE; aminodeoxyfutalosine synthase [EC:2.5.1.120] hndA; NADP-reducing hydrogenase subunit HndA [EC:1.12.1.3] hndC; NADP-reducing hydrogenase subunit HndC [EC:1.12.1.3] hndD; NADP-reducing hydrogenase subunit HndD [EC:1.12.1.3] adh2; alcohol dehydrogenase [EC:1.1.1.-] mltF; membrane-bound lytic murein transglycosylase F higA; HTH-type transcriptional regulator / antitoxin HigA porA; pyruvate ferredoxin oxidoreductase alpha subunit [EC:1.2.7.1] porG; pyruvate ferredoxin oxidoreductase gamma subunit [EC:1.2.7.1] K00666; fatty-acyl-CoA synthase [EC:6.2.1.-] E3.2.1.4; endoglucanase [EC:3.2.1.4] ade; adenine deaminase [EC:3.5.4.2] oadA; oxaloacetate decarboxylase, alpha subunit [EC:4.1.1.3] cynT, can; carbonic anhydrase [EC:4.2.1.1] E4.2.1.2AA, fumA; fumarate hydratase subunit alpha [EC:4.2.1.2] E4.2.1.2AB, fumB; fumarate hydratase subunit beta [EC:4.2.1.2] queD, ptpS, PTS; 6-pyruvoyltetrahydropterin/6-carboxytetrahydropterin synthase [EC:4.2.3.12 4.1.2.50] modC; molybdate transport system ATP-binding protein [EC:3.6.3.29] modB; molybdate transport system permease protein modA; molybdate transport system substrate-binding protein thrH; phosphoserine / homoserine phosphotransferase [EC:3.1.3.3 2.7.1.39] paaI; acyl-CoA thioesterase [EC:3.1.2.-] tatA; sec-independent protein translocase protein TatA dapdh; diaminopimelate dehydrogenase [EC:1.4.1.16] E2.1.1.148, thyX, thy1; thymidylate synthase (FAD) [EC:2.1.1.148] moaC; cyclic pyranopterin phosphate synthase [EC:4.1.99.18] pflX; putative pyruvate formate lyase activating enzyme [EC:1.97.1.4] hypA, hybF; hydrogenase nickel incorporation protein HypA/HybF hypB; hydrogenase nickel incorporation protein HypB cbpA; curved DNA-binding protein yfiH; conserved hypothetical protein sfsA; sugar fermentation stimulation protein A pdxS, pdx1; pyridoxal 5'-phosphate synthase pdxS subunit [EC:4.3.3.6] K06864; uncharacterized protein K06898 Diabetes Page 182 of 230

queC; 7-cyano-7-deazaguanine synthase [EC:6.3.4.20] K06972 K07043 hipA; serine/threonine-protein kinase HipA [EC:2.7.11.1] comM; magnesium chelatase family protein xdhC; xanthine dehydrogenase accessory factor pdxT, pdx2; 5'-phosphate synthase pdxT subunit [EC:4.3.3.6] mtnA; methylthioribose-1-phosphate isomerase [EC:5.3.1.23] K08999; hypothetical protein K09121; hypothetical protein queF; 7-cyano-7-deazaguanine reductase [EC:1.7.1.13] asdA; aspartate 4-decarboxylase [EC:4.1.1.12] K09790; hypothetical protein yhdR; aspartate aminotransferase [EC:2.6.1.1] fbaB; fructose-bisphosphate aldolase, class I [EC:4.1.2.13] rhlE; ATP-dependent RNA helicase RhlE [EC:3.6.4.13] putP; sodium/proline symporter tadB; tight adherence protein B tarL; CDP-ribitol ribitolphosphotransferase [EC:2.7.8.14] PCYT1; choline-phosphate cytidylyltransferase [EC:2.7.7.15] hyi, gip; hydroxypyruvate isomerase [EC:5.3.1.22] iorB; indolepyruvate ferredoxin oxidoreductase, beta subunit [EC:1.2.7.8] ACSS, acs; acetyl-CoA synthetase [EC:6.2.1.1] paaK; phenylacetate-CoA ligase [EC:6.2.1.30] vsr; DNA mismatch endonuclease, patch repair protein [EC:3.1.-.-] kdpD; two-component system, OmpR family, sensor histidine kinase KdpD [EC:2.7.13.3] nfeD; membrane-bound serine protease (ClpP class) iorA; indolepyruvate ferredoxin oxidoreductase, alpha subunit [EC:1.2.7.8] FUCA; alpha-L-fucosidase [EC:3.2.1.51] E3.3.1.1, ahcY; adenosylhomocysteinase [EC:3.3.1.1] K07220; hypothetical protein recT; recombination protein RecT msmE; raffinose/stachyose/melibiose transport system substrate-binding protein vanRC, vanRE, vanRG; two-component system, OmpR family, response regulator VanR pdaD; arginine decarboxylase [EC:4.1.1.19] DLD, lpd, pdhD; dihydrolipoamide dehydrogenase [EC:1.8.1.4] metA; homoserine O-succinyltransferase [EC:2.3.1.46] folK; 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase [EC:2.7.6.3] E3.1.3.1, phoA, phoB; alkaline phosphatase [EC:3.1.3.1] dapE; succinyl-diaminopimelate desuccinylase [EC:3.5.1.18] E4.1.1.15, gadB, gadA, GAD; glutamate decarboxylase [EC:4.1.1.15] GLO1, gloA; lactoylglutathione lyase [EC:4.4.1.5] accC; acetyl-CoA carboxylase, biotin carboxylase subunit [EC:6.4.1.2 6.3.4.14] E1.11.1.15, PRDX, ahpC; peroxiredoxin (alkyl hydroperoxide reductase subunit C) [EC:1.11.1.15] K06975 K07001; NTE family protein SRD5A1; 3-oxo-5-alpha-steroid 4-dehydrogenase 1 [EC:1.3.1.22] K00184; prokaryotic molybdopterin-containing oxidoreductase family, iron-sulfur binding subunit K00185; prokaryotic molybdopterin-containing oxidoreductase family, membrane subunit fadH; 2,4-dienoyl-CoA reductase (NADPH2) [EC:1.3.1.34] Page 183 of 230 Diabetes

GATM; glycine amidinotransferase [EC:2.1.4.1] DDAH, ddaH; dimethylargininase [EC:3.5.3.18] cpaF, tadA; pilus assembly protein CpaF entE, dhbE, vibE, mxcE; 2,3-dihydroxybenzoate-AMP ligase [EC:2.7.7.58] flgJ; flagellar protein FlgJ napA; periplasmic nitrate reductase NapA [EC:1.7.99.4] napB; cytochrome c-type protein NapB napD; periplasmic nitrate reductase NapD napG; ferredoxin-type protein NapG napH; ferredoxin-type protein NapH pilD, pppA; leader peptidase (prepilin peptidase) / N-methyltransferase [EC:3.4.23.43 2.1.1.-] virD4, lvhD4; type IV secretion system protein VirD4 tolA; colicin import membrane protein phnL; alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL [EC:2.7.8.37] phnK; putative phosphonate transport system ATP-binding protein ppaX; pyrophosphatase PpaX [EC:3.6.1.1] phnM; alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase [EC:3.6.1.63] phnJ; alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase [EC:4.7.1.1] phnI; alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI [EC:2.7.8.37] phnH; alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnH [EC:2.7.8.37] phnG; alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnG [EC:2.7.8.37] spoVS; stage V sporulation protein S DCAA; acyl-CoA dehydrogenase [EC:1.3.99.-] iolF; MFS transporter, SP family, inositol transporter dmsA; anaerobic dimethyl sulfoxide reductase subunit A [EC:1.8.5.3] dmsB; anaerobic dimethyl sulfoxide reductase subunit B (DMSO reductase iron- sulfur subunit) dmsC; anaerobic dimethyl sulfoxide reductase subunit C (DMSO reductase anchor subunit) ynfE; Tat-targeted selenate reductase subunit YnfE [EC:1.97.1.9] ynfF; Tat-targeted selenate reductase subunit YnfF [EC:1.97.1.9] mcrB; 5-methylcytosine-specific restriction enzyme B [EC:3.1.21.-] ELP3, KAT9; elongator complex protein 3 [EC:2.3.1.48] hycI; hydrogenase 3 maturation protease [EC:3.4.23.51] phsA, psrA; thiosulfate reductase / polysulfide reductase chain A pepD; putative serine protease PepD [EC:3.4.21.-] K09767; hypothetical protein hyfA; hydrogenase-4 component A [EC:1.-.-.-] hyfC; hydrogenase-4 component C [EC:1.-.-.-] hyfE; hydrogenase-4 component E [EC:1.-.-.-] hyfF; hydrogenase-4 component F [EC:1.-.-.-] hyfH; hydrogenase-4 component H rlmL, rlmK; 23S rRNA (guanine2445-N2)-methyltransferase / 23S rRNA (guanine2069-N7)-methyltransferase [EC:2.1.1.173 2.1.1.264] fadK; acyl-CoA synthetase [EC:6.2.1.-] echC; ech hydrogenase subunit C hipB; HTH-type transcriptional regulator / antitoxin HipB hycE; formate hydrogenlyase subunit 5 lplB; putative aldouronate transport system permease protein K09138; hypothetical protein SEC11, sipW; signal peptidase, endoplasmic reticulum-type [EC:3.4.-.-] TC.CNT; concentrative nucleoside transporter, CNT family fixC; electron transfer flavoprotein-quinone oxidoreductase [EC:1.5.5.-] Diabetes Page 184 of 230

argE; acetylornithine deacetylase [EC:3.5.1.16] folB; dihydroneopterin aldolase [EC:4.1.2.25] cpaB, rcpC; pilus assembly protein CpaB cpaE, tadZ; pilus assembly protein CpaE mpl; UDP-N-acetylmuramate: L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase [EC:6.3.2.-] moeA; molybdopterin molybdotransferase [EC:2.10.1.1] hydN; electron transport protein HydN K06915 K07047 tagF; CDP-glycerol glycerophosphotransferase [EC:2.7.8.12] K17318, lplA; putative aldouronate transport system substrate-binding protein lplC; putative aldouronate transport system permease protein Page 185 of 230 Diabetes

p value Adjusted p value log2FoldChange SD 0.003405236 0.020723809 3.903633997 1.5319374 0.005340993 0.020723809 4.912447088 2.687230295 0.003405236 0.020723809 9.776377306 1.459350601 0.003405236 0.020723809 5.729516859 1.514270427 0.005340993 0.020723809 2.775774336 1.621969605 0.003405236 0.020723809 2.985671905 1.177305486 0.003405236 0.020723809 3.518246345 1.091580672 0.005340993 0.020723809 5.672038726 3.740700931 0.003405236 0.020723809 7.99706763 1.724722654 0.003405236 0.020723809 6.304835293 1.558807532 0.003405236 0.020723809 3.172411324 1.218489719 0.005340993 0.020723809 4.606514117 2.821586858 0.005340993 0.020723809 4.538741873 2.819617923 0.003405236 0.020723809 10.17185893 1.637478777 0.003405236 0.020723809 2.987097808 1.177197189 0.003405236 0.020723809 3.123869102 1.201958839 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 4.567268184 2.790570833 0.003405236 0.020723809 3.04358092 1.209889899 0.005340993 0.020723809 3.820784465 2.157374322 0.005340993 0.020723809 3.61613361 2.112930637 0.005340993 0.020723809 4.50480301 2.751808979 0.005340993 0.020723809 4.210698109 2.622815538 0.005340993 0.020723809 6.077356477 3.932071653 0.003405236 0.020723809 5.654658671 1.538237017 0.003405236 0.020723809 4.656764504 2.15949658 0.005340993 0.020723809 4.380932033 2.655680934 0.005340993 0.020723809 4.571036171 2.752278285 0.005340993 0.020723809 5.608249225 3.735081324 0.003405236 0.020723809 2.987450759 1.177501954 0.003405236 0.020723809 2.91612121 1.135127187 0.005340993 0.020723809 5.815548364 3.836019671 0.003405236 0.020723809 5.439285348 1.783506143 0.003405236 0.020723809 5.439285348 1.783506143 0.003405236 0.020723809 Inf NA 0.003231673 0.020723809 Inf NA 0.003405236 0.020723809 Inf NA 0.003231673 0.020723809 Inf NA 0.003231673 0.020723809 Inf NA 0.005340993 0.020723809 4.271541544 2.598833063 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.582863442 2.841818783 0.003405236 0.020723809 -5.642307576 1.703304078 0.005340993 0.020723809 4.605081861 2.79389212 0.005340993 0.020723809 5.861555147 3.948559635 0.004222063 0.020723809 4.312852375 2.243798251 0.003405236 0.020723809 3.099595406 1.154232295 0.003405236 0.020723809 2.916869898 1.18138773 0.005340993 0.020723809 4.588093914 2.804241656 Diabetes Page 186 of 230

0.005340993 0.020723809 2.527802942 1.229539735 0.003231673 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 5.696494019 3.75235184 0.003405236 0.020723809 5.870881443 2.011844954 0.005340993 0.020723809 5.680735548 3.733337623 0.005340993 0.020723809 4.831531965 3.008910184 0.005340993 0.020723809 4.533226946 2.793532299 0.005340993 0.020723809 4.533226176 2.793531879 0.005340993 0.020723809 2.363206435 1.411449473 0.005340993 0.020723809 4.553560086 2.828409513 0.005340993 0.020723809 4.1598114 2.523691628 0.005340993 0.020723809 5.088739428 3.162561151 0.003405236 0.020723809 3.926910239 1.614993946 0.003405236 0.020723809 3.460476509 1.43257976 0.005340993 0.020723809 5.62843085 2.948074654 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.512777509 2.802262234 0.005340993 0.020723809 5.932855194 4.02385379 0.003405236 0.020723809 5.459139179 2.516943344 0.005340993 0.020723809 5.980606163 3.983479147 0.005340993 0.020723809 3.781264136 2.257246921 0.005340993 0.020723809 3.254133586 2.015925799 0.005340993 0.020723809 5.122258306 2.994307817 0.005340993 0.020723809 5.760691381 3.90439658 0.005340993 0.020723809 4.512327991 2.738474559 0.005340993 0.020723809 2.401906439 1.267599709 0.005340993 0.020723809 4.500339632 2.748930275 0.005340993 0.020723809 4.590199428 2.804177193 0.003405236 0.020723809 5.913876061 2.069473893 0.003231673 0.020723809 Inf NA 0.003405236 0.020723809 3.338150051 1.120092107 0.003405236 0.020723809 6.637389283 2.921917912 0.005340993 0.020723809 4.625709287 2.808622958 0.005340993 0.020723809 5.621721626 3.602569463 0.003405236 0.020723809 5.380326244 1.748580422 0.005340993 0.020723809 3.245726672 1.697848214 0.003405236 0.020723809 3.32522201 1.528456187 0.005340993 0.020723809 4.675791816 2.819892128 0.005340993 0.020723809 4.49913022 2.769717574 0.005340993 0.020723809 4.309348306 2.66265341 0.005340993 0.020723809 5.97411887 4.020927267 0.005340993 0.020723809 3.626338188 1.762937363 0.003405236 0.020723809 5.808890359 1.740814777 0.003405236 0.020723809 9.804144557 1.542891351 0.003405236 0.020723809 3.164477221 1.137661104 0.005340993 0.020723809 5.7679275 3.872155478 0.005340993 0.020723809 4.928319639 3.082587121 0.005340993 0.020723809 5.918974835 4.007539071 0.003405236 0.020723809 2.546293606 1.050884541 Page 187 of 230 Diabetes

0.003405236 0.020723809 4.084426433 1.604727002 0.003405236 0.020723809 3.009250392 1.013517105 0.003405236 0.020723809 5.130599471 2.775106396 0.003405236 0.020723809 -5.980591608 1.972436642 0.005340993 0.020723809 5.9330278 4.023982055 0.003405236 0.020723809 6.16548829 1.472481232 0.005340993 0.020723809 4.617016429 2.865608529 0.005340993 0.020723809 4.855337885 3.036720354 0.005340993 0.020723809 4.500721963 2.748918916 0.005340993 0.020723809 4.426308373 2.746807237 0.005340993 0.020723809 5.012056707 3.119242987 0.003405236 0.020723809 2.512353729 1.079953103 0.003405236 0.020723809 3.145409826 1.202526742 0.003405236 0.020723809 2.866928019 1.154860357 0.005340993 0.020723809 4.497735076 2.748841186 0.005340993 0.020723809 4.602151772 2.792487626 0.003405236 0.020723809 Inf NA 0.003405236 0.020723809 3.324659842 1.786388394 0.005340993 0.020723809 4.499081471 2.747477143 0.005340993 0.020723809 4.495272569 2.70958529 0.005340993 0.020723809 4.062884543 2.45840998 0.003405236 0.020723809 3.501624882 1.819831818 0.003405236 0.020723809 -3.608507298 2.074811865 0.003405236 0.020723809 2.974356142 1.170925169 0.005340993 0.020723809 5.765177416 3.71421263 0.005340993 0.020723809 4.500689566 2.749064073 0.003405236 0.020723809 -6.166931644 2.076881259 0.003405236 0.020723809 3.136440722 1.25794097 0.005340993 0.020723809 4.628173453 2.836859952 0.005340993 0.020723809 7.642972973 3.846565184 0.003405236 0.020723809 3.112393084 1.201550415 0.003405236 0.020723809 3.025881635 1.148349802 0.003405236 0.020723809 4.102875006 1.747781915 0.003405236 0.020723809 7.69601615 2.385474704 0.005340993 0.020723809 5.54039622 3.710409914 0.003274558 0.020723809 #NAME? NA 0.003405236 0.020723809 3.507317623 1.372678064 0.005340993 0.020723809 4.054183799 2.453722531 0.005340993 0.020723809 4.503852037 2.749680178 0.005340993 0.020723809 3.835343008 2.214516842 0.005340993 0.020723809 5.56581704 3.682263375 0.005340993 0.020723809 4.716441993 2.959055788 0.003405236 0.020723809 2.613140151 1.148095556 0.005340993 0.020723809 4.439639102 2.736430997 0.005340993 0.020723809 4.500626598 2.74904606 0.005340993 0.020723809 4.500204776 2.748841373 0.003361339 0.020723809 Inf NA 0.003405236 0.020723809 4.178519498 1.651138092 0.005340993 0.020723809 5.606118699 3.580989563 0.005340993 0.020723809 5.820759716 3.90707291 Diabetes Page 188 of 230

0.005340993 0.020723809 4.598107199 2.851654755 0.005340993 0.020723809 5.692253237 3.745853168 0.005340993 0.020723809 5.300325611 3.184598171 0.005340993 0.020723809 4.496504028 2.747002233 0.003405236 0.020723809 3.207158846 1.957242313 0.005340993 0.020723809 4.077911148 2.406089939 0.003405236 0.020723809 5.370307761 2.089453711 0.005340993 0.020723809 5.899025581 3.918583511 0.003405236 0.020723809 3.966622587 1.436627091 0.005340993 0.020723809 5.998894352 4.018738589 0.005340993 0.020723809 5.959243824 3.998381622 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.890884252 3.035107965 0.003405236 0.020723809 7.679289764 1.856159675 0.005340993 0.020723809 4.527741021 2.764980263 0.005340993 0.020723809 3.821258017 2.369638311 0.003405236 0.020723809 2.987434482 1.177496957 0.003405236 0.020723809 2.91612121 1.135127187 0.005340993 0.020723809 4.216804136 2.043169494 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 4.49929595 2.748267297 0.005340993 0.020723809 4.564894957 2.774273641 0.005340993 0.020723809 4.894968494 3.03540099 0.005340993 0.020723809 5.2901009 3.396354821 0.005340993 0.020723809 4.512697963 2.73525925 0.005340993 0.020723809 4.883998113 3.040664799 0.005340993 0.020723809 4.518131846 2.771585349 0.005340993 0.020723809 3.99807333 2.419141492 0.005340993 0.020723809 4.500204776 2.748841373 0.003405236 0.020723809 2.974218218 1.170851432 0.005340993 0.020723809 5.549496351 3.610494364 0.005340993 0.020723809 5.744019286 3.751570167 0.005340993 0.020723809 4.532409748 2.749683272 0.003405236 0.020723809 -4.718128314 2.671458674 0.005340993 0.020723809 3.41599404 2.049418864 0.005340993 0.020723809 5.73529904 3.713670874 0.003405236 0.020723809 7.685055656 3.035276408 0.005340993 0.020723809 5.817730848 3.797847542 0.005340993 0.020723809 4.305986306 2.618008378 0.005340993 0.020723809 5.727892895 3.697631897 0.005340993 0.020723809 5.65783693 3.739816166 0.005340993 0.020723809 4.498644694 2.748218598 0.005340993 0.020723809 7.571329583 4.47901544 0.005340993 0.020723809 3.746673381 2.148361472 0.003405236 0.020723809 7.97485961 4.003649042 0.005340993 0.020723809 4.500204776 2.748841373 0.003405236 0.020723809 -6.27305786 2.247678792 0.005340993 0.020723809 5.761452536 3.887914837 0.005340993 0.020723809 2.885310868 1.78063929 0.005340993 0.020723809 4.930238622 2.864298468 Page 189 of 230 Diabetes

0.003405236 0.020723809 2.839796568 1.140442428 0.005340993 0.020723809 5.821766137 3.907462843 0.005340993 0.020723809 5.164129125 3.275733036 0.003405236 0.020723809 9.890265947 1.454754702 0.005340993 0.020723809 4.602936727 2.801175907 0.005340993 0.020723809 3.96994597 2.2671227 0.005340993 0.020723809 2.667342961 1.352777804 0.005340993 0.020723809 4.822873231 3.013260046 0.005340993 0.020723809 2.438639998 1.201547031 0.003405236 0.020723809 3.117267483 1.084587214 0.005340993 0.020723809 5.047765553 3.166907489 0.005340993 0.020723809 -5.86106426 2.928862657 0.003405236 0.020723809 3.595706445 1.469046973 0.003405236 0.020723809 5.484129614 1.920943946 0.003405236 0.020723809 6.013266886 3.345668228 0.005340993 0.020723809 3.676186576 2.000512269 0.005340993 0.020723809 3.933091481 2.385148984 0.005340993 0.020723809 3.082179397 1.795529648 0.003405236 0.020723809 5.124386639 1.08398336 0.005340993 0.020723809 5.758638201 3.843702545 0.003405236 0.020723809 3.615937882 1.131269514 0.003405236 0.020723809 5.507393539 1.430156514 0.003405236 0.020723809 -4.708375566 2.301919653 0.003405236 0.020723809 7.943788339 3.360740949 0.005340993 0.020723809 6.553646355 3.92526189 0.004222063 0.020723809 #NAME? NA 0.005340993 0.020723809 5.957759594 4.006486724 0.005340993 0.020723809 5.986078986 3.948277845 0.005340993 0.020723809 5.746154631 3.799691329 0.005340993 0.020723809 5.932470844 4.023711598 0.005340993 0.020723809 5.628542482 3.658948733 0.005340993 0.020723809 5.049196326 3.303042734 0.005340993 0.020723809 4.627763831 2.831057352 0.005340993 0.020723809 4.456485831 2.747794199 0.003361339 0.020723809 -5.914669278 1.121673431 0.005340993 0.020723809 4.557921154 2.83277915 0.005340993 0.020723809 4.874389372 3.026892553 0.005340993 0.020723809 5.769681166 3.920351409 0.003405236 0.020723809 7.511235452 2.308811256 0.005340993 0.020723809 3.875660208 2.337520995 0.005340993 0.020723809 5.9330278 4.023982055 0.005340993 0.020723809 4.068315857 2.452712404 0.005340993 0.020723809 2.417056008 1.274467408 0.005340993 0.020723809 5.102112703 2.977672483 0.003405236 0.020723809 -6.928286258 1.909521805 0.005340993 0.020723809 5.821751599 3.907504437 0.003405236 0.020723809 -6.114242801 1.276839728 0.005340993 0.020723809 8.509419457 4.235189589 0.005340993 0.020723809 5.871717177 3.841454457 0.003405236 0.020723809 -4.733481107 2.103254102 Diabetes Page 190 of 230

0.005340993 0.020723809 5.675892271 3.752359058 0.005340993 0.020723809 4.557533157 2.812504662 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.885519499 3.081167067 0.005340993 0.020723809 4.500207465 2.74884322 0.005340993 0.020723809 5.770117989 3.826856003 0.005340993 0.020723809 5.787150625 3.865375984 0.003405236 0.020723809 5.860341792 2.345659332 0.005340993 0.020723809 3.9529852 2.365466289 0.005340993 0.020723809 4.062354328 2.531830151 0.003405236 0.020723809 8.074256532 1.452581737 0.005340993 0.020723809 4.832662312 3.007670143 0.005340993 0.020723809 4.244790414 2.511663661 0.005340993 0.020723809 4.792166817 2.984127424 0.005340993 0.020723809 4.50214213 2.749320673 0.003405236 0.020723809 9.493417753 1.362222077 0.003361339 0.020723809 -4.759407837 1.770001302 0.003405236 0.020723809 5.642512752 2.327234769 0.003231673 0.020723809 Inf NA 0.003405236 0.020723809 6.678269224 1.370636963 0.005340993 0.020723809 5.383422075 3.419435769 0.003405236 0.020723809 3.405604923 1.504867413 0.005340993 0.020723809 4.863575362 3.030915405 0.005340993 0.020723809 4.514127063 2.736118101 0.005340993 0.020723809 5.735691865 3.714373925 0.005340993 0.020723809 5.329117012 3.351507254 0.005340993 0.020723809 4.807140883 2.834197441 0.005340993 0.020723809 1.881730018 1.089578383 0.005340993 0.020723809 5.093156015 3.168829634 0.005340993 0.020723809 4.206591047 2.564300454 0.005340993 0.020723809 4.556926388 2.737088581 0.005340993 0.020723809 5.108087059 3.198127869 0.005340993 0.020723809 5.971799118 3.088553184 0.003231673 0.020723809 Inf NA 0.003405236 0.020723809 6.910769807 1.358535818 0.005340993 0.020723809 5.740352535 3.713934804 0.005340993 0.020723809 5.705899961 3.902271898 0.005340993 0.020723809 5.917859295 4.005916697 0.005340993 0.020723809 3.975338193 2.377779017 0.003405236 0.020723809 2.880836572 1.162239214 0.005340993 0.020723809 3.086119176 1.488520441 0.005340993 0.020723809 4.491151378 2.761647361 0.005340993 0.020723809 5.894917778 4.00539436 0.005340993 0.020723809 5.692236806 3.745850443 0.003405236 0.020723809 9.127029291 1.585280559 0.005340993 0.020723809 5.073338535 3.159763394 0.003405236 0.020723809 3.744908671 1.732110717 0.005340993 0.020723809 4.502433678 2.767422517 0.003405236 0.020723809 -7.204419922 1.549514948 0.005340993 0.020723809 4.814791875 3.033298352 Page 191 of 230 Diabetes

0.005340993 0.020723809 4.349606412 2.672226796 0.005340993 0.020723809 5.449118691 3.732399185 0.005340993 0.020723809 4.482189991 2.740979934 0.003405236 0.020723809 3.775879309 1.765046613 0.003405236 0.020723809 7.334045722 3.414558125 0.005340993 0.020723809 5.940872098 3.89558348 0.003405236 0.020723809 3.439805828 1.583455691 0.005340993 0.020723809 5.946080636 3.994042274 0.003405236 0.020723809 -5.81864203 1.745376301 0.005340993 0.020723809 5.692253237 3.745853168 0.003405236 0.020723809 9.210695788 1.511776018 0.003405236 0.020723809 9.210695788 1.511776018 0.003405236 0.020723809 3.83492029 1.0585588 0.003405236 0.020723809 2.78484286 1.191026059 0.005340993 0.020723809 4.442403249 2.606670878 0.003405236 0.020723809 3.524695706 1.093891232 0.003405236 0.020723809 3.139767919 1.201635497 0.003405236 0.020723809 3.744975925 1.732264636 0.005340993 0.020723809 3.491043169 1.881870566 0.005340993 0.020723809 6.146106707 3.299078201 0.003405236 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 5.552765097 3.67476291 0.003405236 0.020723809 2.761603132 1.167944042 0.003405236 0.020723809 3.470381754 1.124923756 0.005340993 0.020723809 4.933024841 3.054669647 0.003405236 0.020723809 6.617240381 2.90237448 0.003405236 0.020723809 3.139804637 1.201651396 0.003405236 0.020723809 3.139124638 1.201811084 0.003405236 0.020723809 2.982492621 1.176706938 0.003405236 0.020723809 2.574993917 1.115559053 0.005340993 0.020723809 3.494930339 2.060993259 0.005340993 0.020723809 3.99065686 2.374748857 0.005340993 0.020723809 7.755673334 3.873471889 0.005340993 0.020723809 3.409836008 1.757591886 0.003405236 0.020723809 3.435170361 1.519048899 0.003405236 0.020723809 2.990647994 1.18027084 0.003405236 0.020723809 3.723722181 1.721782886 0.003405236 0.020723809 6.434919306 3.050476131 0.005340993 0.020723809 2.573622379 1.16144251 0.003405236 0.020723809 -5.674913381 1.508348353 0.003405236 0.020723809 -5.833332189 1.884998919 0.005340993 0.020723809 5.926315489 4.020829826 0.005340993 0.020723809 4.851180671 2.97060391 0.003405236 0.020723809 3.268017307 1.10237598 0.003405236 0.020723809 2.878878287 1.162406517 0.005340993 0.020723809 4.501407014 2.749233919 0.005340993 0.020723809 4.353926701 2.130017144 0.00331778 0.020723809 #NAME? NA 0.003405236 0.020723809 5.406035284 1.760370761 Diabetes Page 192 of 230

0.005340993 0.020723809 4.482291065 2.736811447 0.005340993 0.020723809 4.48292146 2.804731677 0.005340993 0.020723809 4.416846553 2.658841982 0.005340993 0.020723809 5.824548594 3.91314508 0.005340993 0.020723809 4.52971973 2.748473329 0.005340993 0.020723809 5.006919272 3.090226345 0.005340993 0.020723809 3.634645213 2.089000896 0.005340993 0.020723809 5.836376743 3.753295402 0.005340993 0.020723809 3.56926091 2.085591026 0.005340993 0.020723809 3.574520175 2.192428504 0.003405236 0.020723809 -5.108728206 2.316912905 0.005340993 0.020723809 4.423705574 2.705317957 0.005340993 0.020723809 5.081850774 3.211872777 0.003405236 0.020723809 2.999921044 1.467889219 0.005340993 0.020723809 4.452774498 2.761642401 0.005340993 0.020723809 4.499980802 2.748739062 0.003405236 0.020723809 3.477829565 1.625372377 0.003405236 0.020723809 3.749303005 1.95463943 0.003405236 0.020723809 4.191129384 1.787753299 0.003405236 0.020723809 2.987720828 1.177528647 0.005340993 0.020723809 6.115000497 3.903893823 0.005340993 0.020723809 4.568296894 2.817193476 0.005340993 0.020723809 5.683809368 3.73679344 0.005340993 0.020723809 4.912587491 3.072952368 0.005340993 0.020723809 4.506745911 2.749030572 0.005340993 0.020723809 5.595454224 3.526887171 0.003405236 0.020723809 6.124868205 1.447207177 0.005340993 0.020723809 4.370868429 2.66846708 0.003405236 0.020723809 -6.164331749 2.008992492 0.005340993 0.020723809 4.500328678 2.748856297 0.005340993 0.020723809 4.502451864 2.750650598 0.005340993 0.020723809 4.500204686 2.748824571 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.426805724 2.747953454 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.571976202 2.751199041 0.005340993 0.020723809 4.500399928 2.74889988 0.005340993 0.020723809 4.495267857 2.745644995 0.005340993 0.020723809 5.808032926 3.892110549 0.005340993 0.020723809 5.808032926 3.892110549 0.005340993 0.020723809 4.570195577 2.750357008 0.005340993 0.020723809 4.500298441 2.748890416 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.448297713 2.719086696 0.005340993 0.020723809 4.515314606 2.738479101 0.003405236 0.020723809 -6.407311091 1.856142669 0.003405236 0.020723809 -4.716839494 1.7292356 Page 193 of 230 Diabetes

0.003405236 0.020723809 -4.716839494 1.7292356 0.003405236 0.020723809 9.210695788 1.511776018 0.005340993 0.020723809 4.5814324 2.822358085 0.005340993 0.020723809 3.927602524 2.348204971 0.005340993 0.020723809 5.681928363 3.73613464 0.005340993 0.020723809 4.590512941 2.805313372 0.003405236 0.020723809 9.804249874 1.542962979 0.003405236 0.020723809 2.882283662 1.162540228 0.005340993 0.020723809 4.49991545 2.748686038 0.005340993 0.020723809 4.57020717 2.750359981 0.005340993 0.020723809 4.528582503 2.792397224 0.005340993 0.020723809 4.906721704 3.048346928 0.005340993 0.020723809 4.398489013 2.679928786 0.005340993 0.020723809 4.469653661 2.748157795 0.005340993 0.020723809 4.500345866 2.748930117 0.005340993 0.020723809 4.596881453 2.806803171 0.005340993 0.020723809 4.571761085 2.750956448 0.003405236 0.020723809 2.879605396 1.162600845 0.003405236 0.020723809 2.879601368 1.161515895 0.005340993 0.020723809 4.213279886 2.556234984 0.003405236 0.020723809 3.61097959 1.253032838 0.005340993 0.020723809 4.749120692 2.807850055 0.005340993 0.020723809 4.333141398 2.668555621 0.005340993 0.020723809 4.857988194 3.034721542 0.003405236 0.020723809 7.129746216 2.068344527 0.003405236 0.020723809 6.080190209 1.415597058 0.003405236 0.020723809 6.080190209 1.415597058 0.005340993 0.020723809 4.501483431 2.749286111 0.003405236 0.020723809 4.323031976 2.216349264 0.005340993 0.020723809 4.598593337 2.833203602 0.005340993 0.020723809 5.201484238 3.081825361 0.005340993 0.020723809 4.239605502 2.590188117 0.005340993 0.020723809 4.264521235 2.612646844 0.005340993 0.020723809 5.753063542 3.826348257 0.005340993 0.020723809 4.68774098 2.848607758 0.005340993 0.020723809 4.470313102 2.688146108 0.005340993 0.020723809 5.508823956 4.815129002 0.005340993 0.020723809 5.508737074 4.815069978 0.005340993 0.020723809 5.508823956 4.815129002 0.005340993 0.020723809 5.508823956 4.815129002 0.005340993 0.020723809 4.212113413 2.449982985 0.005340993 0.020723809 3.830504829 2.157479129 0.005278155 0.020723809 Inf NA 0.005278155 0.020723809 Inf NA 0.005278155 0.020723809 8.759704065 4.083186512 0.003405236 0.020723809 3.198964482 1.181398243 0.003405236 0.020723809 3.566281511 1.380790979 0.003405236 0.020723809 6.8478106 1.743791801 0.003405236 0.020723809 6.755420569 1.67953523 0.003405236 0.020723809 6.755601663 1.67962607 Diabetes Page 194 of 230

0.005340993 0.020723809 6.079588662 3.895513583 0.005340993 0.020723809 6.047207868 3.93823789 0.005340993 0.020723809 5.971082864 3.94836657 0.005340993 0.020723809 5.311553825 3.367108634 0.005340993 0.020723809 5.739056348 3.798467066 0.005340993 0.020723809 5.671729586 3.6874935 0.005340993 0.020723809 5.63096796 3.433189571 0.005340993 0.020723809 5.773799663 3.74967252 0.005340993 0.020723809 5.926250455 3.779838002 0.005340993 0.020723809 5.928824174 3.783198057 0.005340993 0.020723809 5.915927746 3.93305523 0.005340993 0.020723809 5.012237361 3.116336532 0.005340993 0.020723809 4.605879146 2.824984248 0.005340993 0.020723809 4.605879146 2.824984248 0.005340993 0.020723809 4.608530497 2.81792333 0.005340993 0.020723809 4.267511864 2.517200001 0.005340993 0.020723809 5.918756675 3.835422686 0.005340993 0.020723809 5.919588616 3.835764531 0.005340993 0.020723809 5.902894191 3.916784554 0.005340993 0.020723809 7.767691891 3.876006949 0.005340993 0.020723809 7.76759874 3.875987323 0.005340993 0.020723809 7.76759874 3.875987323 0.005340993 0.020723809 7.604450076 3.647532419 0.003405236 0.020723809 7.038453511 3.180320326 0.003405236 0.020723809 8.347397193 2.114186578 0.005340993 0.020723809 5.054950861 3.221385345 0.005340993 0.020723809 4.553467633 2.866603658 0.005340993 0.020723809 5.696708485 3.716002387 0.005340993 0.020723809 5.717970952 3.74460764 0.005340993 0.020723809 5.566265451 3.497054608 0.005340993 0.020723809 5.741794995 3.92266447 0.005340993 0.020723809 5.742034097 3.922773236 0.005340993 0.020723809 5.815670673 3.966156415 0.005340993 0.020723809 3.544992054 2.067875278 0.005340993 0.020723809 5.9311182 4.023264057 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 4.60876736 2.816911959 0.005340993 0.020723809 4.678314393 2.818177662 0.005340993 0.020723809 4.678552761 2.818613604 0.005340993 0.020723809 4.610449515 2.817636664 0.005340993 0.020723809 4.678606372 2.818639171 0.005340993 0.020723809 4.679383178 2.819161808 0.005340993 0.020723809 4.678555233 2.818614997 0.005340993 0.020723809 4.678552761 2.818613604 0.005340993 0.020723809 -5.546566599 1.930065878 0.005340993 0.020723809 -5.546566599 1.930065878 0.005340993 0.020723809 7.137798625 4.290426674 0.003405236 0.020723809 4.735049382 1.619059215 0.003405236 0.020723809 4.240771601 2.156337835 0.003405236 0.020723809 4.240771601 2.156337835 Page 195 of 230 Diabetes

0.003405236 0.020723809 4.240771601 2.156337835 0.003405236 0.020723809 4.240771601 2.156337835 0.003405236 0.020723809 4.240771601 2.156337835 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 5.735760943 3.779872998 0.003405236 0.020723809 3.371318063 2.028642738 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 5.716527815 3.718848299 0.005340993 0.020723809 4.470544882 2.749883402 0.005340993 0.020723809 5.658645784 3.747681192 0.005340993 0.020723809 5.688771966 3.745405377 0.005340993 0.020723809 5.658645784 3.747681192 0.005340993 0.020723809 5.658645784 3.747681192 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 5.450800102 3.474939643 0.005340993 0.020723809 5.901770539 3.954048706 0.005278155 0.020723809 Inf NA 0.003405236 0.020723809 Inf NA 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 4.589072623 2.804674393 0.005340993 0.020723809 4.131647396 2.503213732 0.003405236 0.020723809 8.565965988 2.249675956 0.005340993 0.020723809 4.501784448 2.749472758 0.005340993 0.020723809 5.723563846 3.860951438 0.005340993 0.020723809 4.501130071 2.749153314 0.005340993 0.020723809 4.502761283 2.75083881 0.005340993 0.020723809 4.50207701 2.749766 0.005340993 0.020723809 4.426789323 2.747948111 0.005340993 0.020723809 4.500710232 2.749088271 0.005340993 0.020723809 4.47528966 2.787731511 0.005340993 0.020723809 4.589075087 2.804675756 0.005340993 0.020723809 4.559954023 2.782628016 0.003405236 0.020723809 4.4596603 1.589963715 0.005340993 0.020723809 3.966358517 2.417889839 0.005340993 0.020723809 4.895303497 3.055738994 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.495263165 2.747380516 0.003361339 0.020723809 Inf NA 0.003405236 0.020723809 3.487468343 1.921497061 0.003405236 0.020723809 3.752906415 1.524339783 0.005340993 0.020723809 6.716598517 3.937318723 0.005340993 0.020723809 4.01933715 2.452159765 0.003405236 0.020723809 -6.182506815 2.07613889 0.005340993 0.020723809 5.705790671 3.70400108 0.005340993 0.020723809 5.711821482 3.711192532 0.005340993 0.020723809 5.637947323 3.710372437 0.003405236 0.020723809 -5.179431796 1.654628115 0.005340993 0.020723809 5.853078457 3.670633328 0.003405236 0.020723809 4.539332087 2.454053061 0.005340993 0.020723809 4.646995353 2.818897202 Diabetes Page 196 of 230

0.005340993 0.020723809 4.621614437 2.762560972 0.005215731 0.020723809 #NAME? NA 0.004970163 0.020723809 #NAME? NA 0.005340993 0.020723809 3.015229607 1.473199437 0.005340993 0.020723809 4.503980229 2.750397628 0.003405236 0.020723809 2.905938324 1.157423501 0.003405236 0.020723809 2.987582564 1.177456852 0.003405236 0.020723809 2.987598111 1.17746156 0.003405236 0.020723809 8.99780589 1.433058996 0.005340993 0.020723809 4.501553586 2.749644625 0.003405236 0.020723809 -5.995310981 1.96627946 0.005340993 0.020723809 4.502763919 2.750840203 0.005340993 0.020723809 4.591908103 2.806906849 0.005340993 0.020723809 4.591907145 2.806906318 0.005340993 0.020723809 4.590982431 2.805520948 0.005340993 0.020723809 4.552130266 2.611331281 0.005340993 0.020723809 5.961473176 4.004079491 0.005340993 0.020723809 5.930244722 4.023067598 0.005340993 0.020723809 4.454630291 2.806812618 0.003405236 0.020723809 7.393690995 2.262661198 0.003405236 0.020723809 7.495160239 2.310975603 0.005340993 0.020723809 7.249601346 4.267366795 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.000159084 2.401322145 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.49987249 2.748618164 0.003405236 0.020723809 -4.877372047 1.889668123 0.005340993 0.020723809 4.440064603 2.735459911 0.005340993 0.020723809 4.440064603 2.735459911 0.003405236 0.020723809 7.628635694 3.776202636 0.005340993 0.020723809 4.597883808 2.790364876 0.005340993 0.020723809 5.914656127 4.005719377 0.005340993 0.020723809 5.726756038 3.781189426 0.005340993 0.020723809 5.726756038 3.781189426 0.005340993 0.020723809 5.835208794 3.824285009 0.005340993 0.020723809 5.885936393 3.904464009 0.005340993 0.020723809 5.885847885 3.904429522 0.005340993 0.020723809 5.830979535 3.822808739 0.005340993 0.020723809 5.870001877 3.902154988 0.005340993 0.020723809 5.891462078 3.952192819 0.005340993 0.020723809 5.858289022 3.772961381 0.005340993 0.020723809 5.852790913 3.770748189 0.005340993 0.020723809 5.852682366 3.770706886 0.005340993 0.020723809 5.920731508 4.016702151 0.005340993 0.020723809 5.900300824 4.006023893 Page 197 of 230 Diabetes

0.005340993 0.020723809 5.12803129 3.273541488 0.005340993 0.020723809 5.82779624 3.894851615 0.005340993 0.020723809 5.92082901 4.009349833 0.005340993 0.020723809 5.92082901 4.009349833 0.005340993 0.020723809 5.907267255 4.004459691 0.005340993 0.020723809 6.113679624 3.903643819 0.005340993 0.020723809 6.028034338 3.958668814 0.005340993 0.020723809 6.028034338 3.958668814 0.005340993 0.020723809 5.938581752 4.004010314 0.005340993 0.020723809 5.936582722 4.0098067 0.005340993 0.020723809 5.937901411 4.010269586 0.005340993 0.020723809 5.944322591 4.011464408 0.003405236 0.020723809 5.70789344 1.508110961 0.003405236 0.020723809 4.824057461 1.520993635 0.003405236 0.020723809 4.824057461 1.520993635 0.005340993 0.020723809 5.939967023 4.013872457 0.005340993 0.020723809 5.807417144 3.83007148 0.005340993 0.020723809 5.807417144 3.83007148 0.003405236 0.020723809 6.34052534 2.466672165 0.003405236 0.020723809 3.030702191 1.14948027 0.005340993 0.020723809 5.11583996 3.159055198 0.005340993 0.020723809 5.79447895 3.864871068 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.500027498 2.748789741 0.005340993 0.020723809 4.43676724 2.735028771 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 5.756462149 3.837771843 0.005340993 0.020723809 5.763163469 3.924201194 0.005340993 0.020723809 4.51881273 2.761126914 0.005340993 0.020723809 4.588787302 2.804468415 0.005340993 0.020723809 4.42488175 2.747080616 0.005340993 0.020723809 4.49987249 2.748618164 0.005340993 0.020723809 4.588913067 2.804627108 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.502776539 2.750843827 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.589075087 2.804675756 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.501799705 2.749477786 0.003405236 0.020723809 -4.738687666 1.65587623 0.005340993 0.020723809 4.503062468 2.751025371 0.005340993 0.020723809 4.502819412 2.750865894 0.005340993 0.020723809 4.501799705 2.749477786 Diabetes Page 198 of 230

0.005340993 0.020723809 4.556752478 2.804302773 0.005340993 0.020723809 4.589810536 2.80503973 0.005340993 0.020723809 4.490309367 2.760675618 0.005340993 0.020723809 4.559926122 2.839885136 0.005340993 0.020723809 4.917472111 3.025641771 0.005340993 0.020723809 4.513362155 2.757627522 0.005340993 0.020723809 4.502287393 2.749898505 0.005340993 0.020723809 4.847711706 3.043366649 0.005340993 0.020723809 4.589075087 2.804675756 0.005340993 0.020723809 4.426805724 2.747953454 0.005340993 0.020723809 4.589090343 2.804680878 0.005340993 0.020723809 4.500157791 2.748799522 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.488058669 2.699643286 0.005340993 0.020723809 4.425228777 2.747310535 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.591923358 2.806911962 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.786628838 2.996987066 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.429364314 2.749938735 0.005340993 0.020723809 4.500212785 2.748845593 0.005340993 0.020723809 4.500520622 2.749032759 0.005340993 0.020723809 4.589090343 2.804680878 0.005340993 0.020723809 4.504343038 2.751470242 0.005340993 0.020723809 4.50895599 2.734474216 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.500221442 2.748845054 0.005340993 0.020723809 4.427785285 2.749295803 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.501451747 2.749249407 0.005340993 0.020723809 4.500220031 2.748846397 0.005340993 0.020723809 4.515916132 2.803722423 0.005340993 0.020723809 4.425212377 2.747305194 0.005340993 0.020723809 4.497975851 2.746957535 0.005340993 0.020723809 4.503068722 2.750926444 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 5.731717966 3.740763667 0.005340993 0.020723809 4.864513828 3.031473046 0.005340993 0.020723809 4.501889209 2.749647211 0.005340993 0.020723809 4.456951957 2.765774388 0.005340993 0.020723809 4.59186482 2.806889046 0.005340993 0.020723809 4.498632128 2.748215422 0.005340993 0.020723809 5.782671397 3.62190399 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 4.330829612 2.620083639 0.005340993 0.020723809 4.570319448 2.750444972 0.005340993 0.020723809 4.570192888 2.750355245 0.005340993 0.020723809 4.467840595 2.748318011 Page 199 of 230 Diabetes

0.005340993 0.020723809 4.486372262 2.623991032 0.001454092 0.020723809 #NAME? NA 0.003405236 0.020723809 -4.809909074 1.93828969 0.005340993 0.020723809 5.7060159 3.715452225 0.005340993 0.020723809 4.562738351 2.810678138 0.005340993 0.020723809 4.425897009 2.748244679 0.005340993 0.020723809 4.500684252 2.749108592 0.005340993 0.020723809 4.407441029 2.735865656 0.003405236 0.020723809 9.015099265 1.960121136 0.005340993 0.020723809 4.498805978 2.748160885 0.005340993 0.020723809 4.579457968 2.735500315 0.005340993 0.020723809 5.716244544 3.71874205 0.005340993 0.020723809 4.863396011 3.012929849 0.005340993 0.020723809 4.425212377 2.747305194 0.003405236 0.020723809 4.180436485 1.870218218 0.003405236 0.020723809 4.178012347 1.870735502 0.005340993 0.020723809 4.400359896 2.679783273 0.003405236 0.020723809 2.710592528 1.160846227 0.003405236 0.020723809 6.220559821 1.445141512 0.005340993 0.020723809 4.771004849 2.870748252 0.005340993 0.020723809 5.164831211 3.30314623 0.005340993 0.020723809 4.520269 2.822734154 0.005340993 0.020723809 4.513010183 2.779053752 0.003405236 0.020723809 3.504007212 1.541393982 0.003405236 0.020723809 3.832457385 1.282984536 0.005340993 0.020723809 5.674126812 3.777435796 0.005340993 0.020723809 4.368693079 2.68779135 0.005340993 0.020723809 5.604390836 3.712907931 0.005340993 0.020723809 4.627710307 3.010685807 0.003405236 0.020723809 3.595929454 1.158744975 0.003405236 0.020723809 3.778111652 1.785176965 0.005340993 0.020723809 4.495031039 2.76125932 0.005340993 0.020723809 3.298871182 1.698110176 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 5.692236806 3.745850443 0.003405236 0.020723809 5.426049282 2.46633999 0.005340993 0.020723809 5.69229907 3.745976778 0.003405236 0.020723809 3.469309377 1.226483793 0.005340993 0.020723809 4.108933893 2.48586169 0.003405236 0.020723809 3.017516625 1.128702894 0.005340993 0.020723809 5.766304249 3.747023494 0.005340993 0.020723809 5.73155189 3.740741035 0.005340993 0.020723809 5.810420047 3.790465686 0.005340993 0.020723809 4.380507556 2.655630486 0.005340993 0.020723809 4.498760573 2.748300737 0.005340993 0.020723809 4.498317787 2.747912191 0.005340993 0.020723809 4.47772542 2.735351405 0.004970163 0.020723809 #NAME? NA 0.003405236 0.020723809 -4.895227743 2.001823021 0.005340993 0.020723809 3.896357811 2.416438329 Diabetes Page 200 of 230

0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.397291984 2.748379758 0.005340993 0.020723809 4.389798637 2.771716001 0.005340993 0.020723809 4.428212712 2.749533473 0.003405236 0.020723809 7.479897449 2.286500627 0.003405236 0.020723809 6.304598633 2.431315232 0.005340993 0.020723809 5.720250354 3.778800983 0.003405236 0.020723809 6.87118974 1.955579252 0.005340993 0.020723809 5.676857155 3.752703823 0.005340993 0.020723809 5.754335579 3.336277664 0.005340993 0.020723809 5.794475539 3.68562941 0.005340993 0.020723809 5.9330278 4.023982055 0.005340993 0.020723809 5.966641237 4.021361648 0.005340993 0.020723809 4.508751118 2.73438628 0.005340993 0.020723809 4.255542035 2.51951011 0.005340993 0.020723809 4.346608628 2.611107784 0.005340993 0.020723809 2.179143336 1.111711606 0.005340993 0.020723809 5.719377578 3.697463304 0.005340993 0.020723809 4.589070813 2.804673236 0.005340993 0.020723809 3.671831062 1.995067189 0.005340993 0.020723809 Inf NA 0.005340993 0.020723809 2.690152733 1.461647131 0.003405236 0.020723809 6.263442404 2.090084737 0.003405236 0.020723809 3.170716651 1.18260186 0.005340993 0.020723809 2.201246826 1.023020957 0.005340993 0.020723809 5.695082396 3.708578446 0.005340993 0.020723809 3.532672651 2.073738379 0.005340993 0.020723809 4.345891488 2.698055924 0.003405236 0.020723809 4.780794874 2.20922949 0.005340993 0.020723809 4.498319917 2.747911228 0.005340993 0.020723809 4.570180966 2.750351912 0.005340993 0.020723809 4.50207701 2.749766 0.003405236 0.020723809 3.51490466 1.56893416 0.003405236 0.020723809 3.485804328 1.531724244 0.005340993 0.020723809 5.990114015 4.016168421 0.005340993 0.020723809 4.506538062 2.743316801 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.59861045 2.790725575 0.005340993 0.020723809 -4.859015627 2.602790042 0.003405236 0.020723809 -5.459718383 1.671529514 0.005340993 0.020723809 4.501784587 2.749736903 0.005340993 0.020723809 4.947246534 3.084041423 0.005340993 0.020723809 4.600450819 2.791597175 0.005340993 0.020723809 5.751750573 3.73658347 0.005340993 0.020723809 4.509409856 2.73470434 0.005340993 0.020723809 5.29013451 3.24020035 0.003405236 0.020723809 2.989820271 1.176771981 0.005340993 0.020723809 5.387987636 3.399334853 0.005340993 0.020723809 4.515425645 2.803574122 Page 201 of 230 Diabetes

0.005340993 0.020723809 4.74850007 2.892317193 0.005340993 0.020723809 4.610541645 2.818893861 0.005340993 0.020723809 4.528589094 2.791074146 0.003405236 0.020723809 -5.375578404 1.808421964 0.005340993 0.020723809 4.500200726 2.748839025 0.005340993 0.020723809 4.427767566 2.749289787 0.005340993 0.020723809 4.589090343 2.804680878 0.005340993 0.020723809 4.50271083 2.750097777 0.005340993 0.020723809 5.377390186 3.38607432 0.005340993 0.020723809 4.894158827 3.035032546 0.005340993 0.020723809 4.5003333 2.748926938 0.005340993 0.020723809 4.501212969 2.749347866 0.005340993 0.020723809 4.384051446 2.603748058 0.005340993 0.020723809 4.502761283 2.75083881 0.003405236 0.020723809 6.753323846 1.67870783 0.003405236 0.020723809 3.287871578 1.429086907 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 5.546619021 3.680700511 0.005340993 0.020723809 4.294394442 2.610735555 0.005340993 0.020723809 4.508751118 2.73438628 0.005340993 0.020723809 5.615753683 3.740621099 0.005340993 0.020723809 3.751670617 2.24807985 0.005340993 0.020723809 4.126900786 2.399598236 0.005340993 0.020723809 4.747083199 2.922005612 0.005340993 0.020723809 4.500204776 2.748841373 0.005340993 0.020723809 4.589887362 2.805101407 0.005340993 0.020723809 5.770117989 3.826856003 0.005340993 0.020723809 4.025448304 2.391419783 0.005340993 0.020723809 4.589649386 2.80496189 0.005340993 0.020723809 4.558622967 2.763227635 0.005340993 0.020723809 4.591923358 2.806911962 0.005340993 0.020723809 5.98958414 4.005122991 0.003405236 0.020723809 2.986980149 1.176127937 0.005340993 0.020723809 4.591886423 2.806291875 0.005340993 0.020723809 5.869985314 3.959203389 0.005340993 0.020723809 5.90860877 3.826246428 0.005340993 0.020723809 4.500599928 2.793181925 0.005340993 0.020723809 5.762061474 3.745410585 0.005340993 0.020723809 4.480760822 2.756910362 0.005340993 0.020723809 4.497627253 2.746849156 0.005340993 0.020723809 4.502939809 2.75087239 0.005340993 0.020723809 5.108078439 3.099990174 0.005340993 0.020723809 5.711531385 3.711882293 0.003405236 0.020723809 8.051220062 1.921157997 0.005340993 0.020723809 6.043162567 3.147762995 0.003405236 0.020723809 5.555420508 1.840917579 0.003405236 0.020723809 5.552590406 1.842139006 0.005340993 0.020723809 5.884166406 3.973280247 0.003405236 0.020723809 2.743146383 1.191259696 0.003405236 0.020723809 7.479792304 2.286414199 Diabetes Page 202 of 230

0.003405236 0.020723809 -6.405939134 1.882835131 0.003405236 0.020723809 -4.73933083 1.381122855 0.005340993 0.020723809 5.763251021 3.74588417 0.005340993 0.020723809 4.500783515 2.748855264 0.005340993 0.020723809 5.897335229 4.00390093 0.003231673 0.020723809 Inf NA 0.005340993 0.020723809 4.417910371 2.780820946 0.005340993 0.020723809 4.643297262 2.741823576 0.003405236 0.020723809 3.524954765 1.510426777 0.005340993 0.020723809 5.69229907 3.745976778 0.005340993 0.020723809 5.69229907 3.745976778 0.003405236 0.020723809 5.649370557 1.864627867 0.005340993 0.020723809 -4.494821243 1.445449194 0.003405236 0.020723809 -5.694054 1.856306033 0.005340993 0.020723809 4.331165841 2.673630869 0.005340993 0.020723809 5.517571733 3.683057524 0.005340993 0.020723809 5.865928144 3.714509268 0.005340993 0.020723809 6.536266492 3.495276173 0.005340993 0.020723809 4.640014854 2.828071258 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 4.223730476 2.65609344 0.003405236 0.020723809 5.118298029 1.524305088 0.005340993 0.020723809 5.986019435 3.808199056 0.005340993 0.020723809 5.772989643 3.708587065 0.005340993 0.020723809 6.452976213 6.016749835 0.005340993 0.020723809 3.634796561 2.207404143 0.005340993 0.020723809 4.57084848 2.750495338 0.005340993 0.020723809 5.278448317 3.404737966 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.49090246 2.749673948 0.005340993 0.020723809 4.539822263 2.818562296 0.005340993 0.020723809 5.372599796 3.464580714 0.003405236 0.020723809 2.945728373 1.190787562 0.005340993 0.020723809 Inf NA 0.005340993 0.020723809 4.676115232 2.618651043 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 3.606946492 1.91136147 0.003405236 0.020723809 5.819739469 2.438656826 0.003405236 0.020723809 -6.301442467 2.073835971 0.005340993 0.020723809 4.485953343 2.828575306 0.003405236 0.020723809 9.834363176 1.557938885 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 4.776721967 2.99919066 0.005340993 0.020723809 4.5146325 2.736363565 0.005340993 0.020723809 4.589075087 2.804675756 0.005340993 0.020723809 4.511137164 2.73555906 0.005340993 0.020723809 4.500204776 2.748841373 0.003405236 0.020723809 3.41927391 1.820870769 0.005340993 0.020723809 5.743944816 3.740244918 0.005340993 0.020723809 4.587282708 2.803910385 Page 203 of 230 Diabetes

0.005340993 0.020723809 4.527076363 2.810191497 0.003405236 0.020723809 9.523248462 1.485644517 0.005340993 0.020723809 4.425212377 2.747305194 0.005340993 0.020723809 4.162065567 2.524826468 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 5.763969229 3.857261746 0.005340993 0.020723809 5.684948453 3.744098331 0.005340993 0.020723809 4.501884701 2.749518533 0.003202438 0.020723809 Inf NA 0.005340993 0.020723809 4.499054686 2.748080583 0.005340993 0.020723809 4.59191718 2.806909731 0.005340993 0.020723809 5.726950126 3.705278876 0.005340993 0.020723809 5.805919854 3.783498941 0.005340993 0.020723809 5.676653401 3.724576827 0.005340993 0.020723809 4.3882447 2.746834007 0.003361339 0.020723809 7.016243815 2.588775801 0.003405236 0.020723809 -4.919358612 1.903604362 0.005340993 0.020723809 4.423367893 2.746386782 0.003405236 0.020723809 4.104726535 1.668911845 0.005340993 0.020723809 5.721715751 3.72116576 0.005340993 0.020723809 5.699857236 3.691383272 0.003405236 0.020723809 4.824731182 1.731809661 0.005340993 0.020723809 4.502705704 2.750007157 0.003405236 0.020723809 7.147673911 1.177443461 0.003405236 0.020723809 7.170407262 1.187008744 0.003405236 0.020723809 5.229716813 1.571750913 0.003405236 0.020723809 3.831747015 1.211925241 0.003405236 0.020723809 6.841816561 2.735009008 0.003405236 0.020723809 3.437845763 1.055132926 0.005340993 0.020723809 4.484306683 2.731541785 0.005340993 0.020723809 5.781384458 3.837789785 0.003405236 0.020723809 7.465002477 2.273643851 0.005340993 0.020723809 4.359804897 2.701019142 0.003405236 0.020723809 #NAME? NA 0.003405236 0.020723809 3.690357069 1.072898248 0.005340993 0.020723809 6.436923949 5.801341226 0.003405236 0.020723809 9.242155946 1.668198139 0.005340993 0.020723809 4.510078315 2.735001003 0.005340993 0.020723809 4.51472502 2.736816692 0.005340993 0.020723809 3.53413649 1.858234144 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 -4.635926176 1.894928585 0.003405236 0.020723809 3.09759429 1.522426216 0.005340993 0.020723809 5.809596282 3.951511612 0.005340993 0.020723809 5.783668941 3.864991977 0.005340993 0.020723809 5.894399254 3.910692136 0.005340993 0.020723809 5.894399254 3.910692136 0.005340993 0.020723809 4.409398494 2.666553326 Diabetes Page 204 of 230

0.005340993 0.020723809 5.513489989 3.549184564 0.005340993 0.020723809 5.394686941 3.48535017 0.005340993 0.020723809 5.588347312 3.629640271 0.003405236 0.020723809 4.664924241 1.895523292 0.003405236 0.020723809 4.751189476 1.939220269 0.005340993 0.020723809 5.727943549 3.707221024 0.005340993 0.020723809 5.93474868 4.024124972 0.005278155 0.020723809 Inf NA 0.004970163 0.020723809 #NAME? NA 0.005340993 0.020723809 4.709768534 2.856512348 0.003405236 0.020723809 9.211337599 1.512107318 0.005340993 0.020723809 3.187600462 1.981445398 0.005340993 0.020723809 5.690237199 3.74594272 0.005340993 0.020723809 5.730287957 3.706513651 0.005340993 0.020723809 5.749854075 3.737451353 0.005340993 0.020723809 4.609710551 2.811198849 0.005340993 0.020723809 4.610575647 2.69680535 0.005340993 0.020723809 6.071488527 3.888440388 0.003405236 0.020723809 3.52261736 1.093873372 0.005340993 0.020723809 4.089993842 2.414644679 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.498472715 2.74817036 0.003405236 0.020723809 -6.102345946 1.846210932 0.005340993 0.020723809 4.427660716 2.747386579 0.005340993 0.020723809 4.503281575 2.752853367 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 5.905505967 3.824994899 0.005340993 0.020723809 4.500204776 2.748841373 0.003405236 0.020723809 -3.482596563 1.8120991 0.005340993 0.020723809 4.773383031 2.56464205 0.003405236 0.020723809 7.048384398 2.078885432 0.003405236 0.020723809 4.004623371 2.121795018 0.005340993 0.020723809 5.692325102 3.745876446 0.005340993 0.020723809 4.781830758 3.056048935 0.003405236 0.020723809 8.157169301 3.740897644 0.005340993 0.020723809 3.038024511 1.645704667 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 4.593008563 2.806397507 0.003405236 0.020723809 5.650567445 2.931362572 0.005340993 0.020723809 5.933230578 4.02399882 0.005340993 0.020723809 4.501403371 2.748348239 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 Inf NA 0.003405236 0.020723809 5.834327518 2.586827499 0.005340993 0.020723809 5.757748398 3.855015069 0.003361339 0.020723809 Inf NA Page 205 of 230 Diabetes

0.003405236 0.020723809 3.584653149 1.806466411 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 5.696272147 3.75310399 0.003405236 0.020723809 7.528336944 2.122944099 0.003405236 0.020723809 -6.156494618 2.296399695 0.003405236 0.020723809 3.854409804 1.871477907 0.005340993 0.020723809 5.68380399 3.736812952 0.005340993 0.020723809 4.58290845 2.738078081 0.005340993 0.020723809 4.567362617 2.816649306 0.005340993 0.020723809 4.187551591 2.581096534 0.005340993 0.020723809 5.700541906 3.81359728 0.003405236 0.020723809 7.528401712 2.122987983 0.005340993 0.020723809 5.825742179 3.910628773 0.005340993 0.020723809 3.422640108 2.074044312 0.00331778 0.020723809 #NAME? NA 0.005340993 0.020723809 5.696105747 3.884341342 0.003405236 0.020723809 5.655012544 1.730466257 0.00331778 0.020723809 #NAME? NA 0.005340993 0.020723809 4.500204776 2.748841373 0.003405236 0.020723809 9.025100157 1.435295484 0.003405236 0.020723809 9.162176284 1.156244952 0.005340993 0.020723809 2.4499564 1.210420665 0.005340993 0.020723809 4.589090343 2.804680878 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 4.604319191 2.794470793 0.005340993 0.020723809 4.202751464 2.551103237 0.005340993 0.020723809 5.771793672 3.835920091 0.005340993 0.020723809 5.711208041 3.711768342 0.003405236 0.020723809 3.395736793 1.801565427 0.003405236 0.020723809 5.703728846 2.391810766 0.005340993 0.020723809 4.198150592 2.611354249 0.005340993 0.020723809 5.735273811 3.713631798 0.003405236 0.020723809 3.892273552 1.65895183 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 4.505119288 2.769404789 0.003405236 0.020723809 10.24790029 1.565460985 0.005340993 0.020723809 5.673909229 3.718780474 0.003405236 0.020723809 3.019906483 1.186148594 0.003405236 0.020723809 4.071638101 1.949430767 0.005340993 0.020723809 5.906377772 4.019179114 0.003405236 0.020723809 5.97031277 1.246591272 0.005340993 0.020723809 5.650402416 3.720689783 0.005340993 0.020723809 5.750160365 3.902757514 0.003405236 0.020723809 -6.164979435 1.515693839 0.005340993 0.020723809 5.741400701 3.715126871 0.005340993 0.020723809 5.332075945 3.404597993 0.005340993 0.020723809 5.248760683 3.289399136 0.005340993 0.020723809 4.02980228 2.385734561 0.005340993 0.020723809 4.432663795 2.673133584 0.005340993 0.020723809 4.590678618 2.775803308 Diabetes Page 206 of 230

0.005340993 0.020723809 5.695642949 3.710860818 0.003405236 0.020723809 7.348174885 2.196240702 0.005340993 0.020723809 5.673567528 3.718543277 0.005340993 0.020723809 5.666766434 3.748830159 0.005340993 0.020723809 5.70916871 3.711006366 0.005340993 0.020723809 5.81753569 3.865390446 0.005340993 0.020723809 8.589030002 4.385159183 0.005340993 0.020723809 4.922086679 2.897797997 0.003405236 0.020723809 4.026285742 1.690516957 0.005340993 0.020723809 4.050892152 2.450880357 0.005340993 0.020723809 4.72343774 2.879154046 0.003361339 0.020723809 Inf NA 0.003405236 0.020723809 3.631184703 1.73080956 0.005340993 0.020723809 4.572779876 2.794848753 0.005340993 0.020723809 5.71737495 3.747302102 0.005340993 0.020723809 5.548244916 3.51931514 0.003405236 0.020723809 3.880642855 1.475858012 0.003405236 0.020723809 5.293292507 2.444210642 0.005340993 0.020723809 8.63818693 3.995146401 0.005340993 0.020723809 4.498928422 2.7695759 0.005340993 0.020723809 5.042977912 3.157890273 0.005340993 0.020723809 5.680734563 3.698599073 0.003405236 0.020723809 4.574203483 1.847036914 0.003405236 0.020723809 2.711109063 1.038726184 0.003405236 0.020723809 4.144758171 1.662666062 0.003405236 0.020723809 3.390327104 1.488219398 0.003405236 0.020723809 7.36558995 2.185871832 0.005340993 0.020723809 3.717566808 2.350121602 0.003405236 0.020723809 5.848557387 2.588225124 0.005340993 0.020723809 4.613053568 2.841287363 0.005340993 0.020723809 5.701616419 3.684093723 0.005340993 0.020723809 4.910545075 3.028715637 0.005340993 0.020723809 5.801212596 3.90675942 0.005340993 0.020723809 3.214682233 1.476328454 0.003361339 0.020723809 #NAME? NA 0.003405236 0.020723809 4.851193445 1.508737668 0.003405236 0.020723809 -5.721992986 2.602084552 0.005340993 0.020723809 5.730600344 3.655924519 0.003405236 0.020723809 -6.079250018 1.892669372 0.003405236 0.020723809 7.851963681 1.82389907 0.003405236 0.020723809 4.33979806 1.469544097 0.003405236 0.020723809 8.653241612 3.211930969 0.005340993 0.020723809 5.861641832 3.785205969 0.005340993 0.020723809 5.573065444 3.543911522 0.005340993 0.020723809 5.687965381 3.743230064 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA Page 207 of 230 Diabetes

0.003405236 0.020723809 7.679188942 1.871335518 0.005340993 0.020723809 4.685269606 2.905718743 0.003405236 0.020723809 -6.269412998 1.953189706 0.005340993 0.020723809 2.869652748 1.776033348 0.005340993 0.020723809 6.077387409 3.935694535 0.005340993 0.020723809 4.966249538 3.124627009 0.003405236 0.020723809 8.087942947 1.635711047 0.005340993 0.020723809 5.903918414 3.920139519 0.005340993 0.020723809 3.749777371 2.169804993 0.003405236 0.020723809 3.424537128 2.149007007 0.005340993 0.020723809 4.624521268 2.806159433 0.005340993 0.020723809 4.589211705 2.804763308 0.003231673 0.020723809 Inf NA 0.005340993 0.020723809 4.66981606 2.793267259 0.003405236 0.020723809 -6.181168207 1.935397814 0.005340993 0.020723809 5.376589412 3.45660389 0.005340993 0.020723809 4.510634626 2.73531493 0.003405236 0.020723809 -6.44153474 1.835433802 0.005340993 0.020723809 Inf NA 0.005340993 0.020723809 5.926581435 3.98702632 0.005340993 0.020723809 6.023951309 4.005156707 0.005340993 0.020723809 4.863944537 3.031198601 0.003405236 0.020723809 9.432476742 1.946464191 0.003405236 0.020723809 9.759902961 1.814679819 0.005340993 0.020723809 4.703538185 3.236678741 0.003231673 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 3.286193102 1.54066399 0.005340993 0.020723809 5.856259264 3.745098679 0.005340993 0.020723809 4.516573528 2.80313985 0.005340993 0.020723809 4.529264287 2.749793929 0.005340993 0.020723809 5.956098541 4.007362612 0.003405236 0.020723809 5.35742824 2.08708602 0.005340993 0.020723809 5.873052089 3.795352769 0.005340993 0.020723809 5.841680426 3.826278265 0.005340993 0.020723809 5.692236806 3.745850443 0.003361339 0.020723809 4.468206458 1.299220354 0.005340993 0.020723809 -6.335347706 3.062635496 0.005340993 0.020723809 5.692426396 3.745873306 0.005340993 0.020723809 5.833677054 3.899560231 0.005340993 0.020723809 5.859118529 3.930382157 0.003405236 0.020723809 7.333224506 2.141461838 0.003405236 0.020723809 3.12638181 1.516774511 0.003405236 0.020723809 7.242398095 1.950096043 0.005340993 0.020723809 6.404064673 5.731062245 0.005340993 0.020723809 5.712509431 3.711420747 0.003231673 0.020723809 Inf NA 0.005340993 0.020723809 5.627591937 3.658644071 0.005340993 0.020723809 5.729416795 3.706273215 Diabetes Page 208 of 230

0.005340993 0.020723809 5.728830328 3.904426424 0.005340993 0.020723809 5.815367541 3.90622015 0.003405236 0.020723809 5.865936477 3.155831972 0.003405236 0.020723809 9.684706573 1.397285634 0.003361339 0.020723809 Inf NA 0.003405236 0.020723809 5.242166288 1.577563797 0.005340993 0.020723809 5.878148364 3.969267649 0.003405236 0.020723809 4.825232725 1.867839015 0.005340993 0.020723809 3.527948219 2.192931688 0.003405236 0.020723809 9.648800908 1.466000755 0.003405236 0.020723809 -6.690263613 1.703013974 0.003405236 0.020723809 2.709480308 1.173395997 0.003405236 0.020723809 9.314458333 1.355527731 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 5.623731468 3.863072742 0.005340993 0.020723809 7.709323624 4.152641424 0.001454092 0.020723809 #NAME? NA 0.003231673 0.020723809 Inf NA 0.005340993 0.020723809 5.832020579 3.964900548 0.005340993 0.020723809 5.654434561 3.550563557 0.003405236 0.020723809 -5.1420268 1.57267599 0.005340993 0.020723809 5.438635441 3.375573261 0.003405236 0.020723809 8.125686821 1.940778484 0.005340993 0.020723809 5.931833295 3.815372814 0.005340993 0.020723809 -5.317568685 1.722558288 0.005340993 0.020723809 5.803353628 3.932328139 0.003405236 0.020723809 7.495052151 2.31090416 0.003405236 0.020723809 5.65082401 2.931429131 0.005340993 0.020723809 5.762987841 3.924142329 0.005340993 0.020723809 5.001219237 3.456061628 0.005340993 0.020723809 5.711356482 3.680594388 0.003405236 0.020723809 7.359706762 1.242201694 0.003405236 0.020723809 -4.528131387 1.320005362 0.005340993 0.020723809 5.834297185 3.903346041 0.005340993 0.020723809 5.664433114 3.75480255 0.005340993 0.020723809 4.550714396 2.813143943 0.005340993 0.020723809 4.426297527 2.69024758 0.005340993 0.020723809 4.425805899 2.690537693 0.005340993 0.020723809 4.343666438 2.688744897 0.003202438 0.020723809 Inf NA 0.005340993 0.020723809 4.468666159 2.75035791 0.003405236 0.020723809 7.48328544 2.094359922 0.003405236 0.020723809 -5.10855793 1.896284299 0.005340993 0.020723809 5.916122727 4.005483592 0.003274558 0.020723809 Inf NA 0.00331778 0.020723809 Inf NA 0.005340993 0.020723809 5.338851796 3.39936757 0.003405236 0.020723809 5.717669131 2.393958477 0.005340993 0.020723809 5.833346111 3.967750923 0.003405236 0.020723809 3.320033514 1.516594809 Page 209 of 230 Diabetes

0.004970163 0.020723809 #NAME? NA 0.003405236 0.020723809 -5.27433112 1.674678618 0.005340993 0.020723809 5.692182714 3.745816098 0.003361339 0.020723809 6.572625148 2.384295115 0.003405236 0.020723809 7.335470776 2.253032833 0.005340993 0.020723809 5.692369305 3.745897256 0.003405236 0.020723809 3.686170219 1.223828654 0.005340993 0.020723809 4.501105051 2.748287924 0.005340993 0.020723809 5.725378498 3.704765195 0.005340993 0.020723809 4.514842959 2.737970555 0.005340993 0.020723809 5.719945978 3.720098244 0.003405236 0.020723809 4.534281515 1.642462781 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 5.719945978 3.720098244 0.005340993 0.020723809 5.670919333 3.717525053 0.003361339 0.020723809 9.674633706 1.727648016 0.005340993 0.020723809 Inf NA 0.005340993 0.020723809 5.662495349 3.713066626 0.003405236 0.020723809 10.16023582 1.420322562 0.003405236 0.020723809 8.062814241 1.783676508 0.003405236 0.020723809 3.013381433 1.142479269 0.003405236 0.020723809 3.011997178 1.141663737 0.005340993 0.020723809 4.386684994 2.748003564 0.005340993 0.020723809 4.500220031 2.748846397 0.003361339 0.020723809 8.924630091 1.384028082 0.003405236 0.020723809 6.933242885 2.005241566 0.005340993 0.020723809 5.25475345 3.354961629 0.003405236 0.020723809 9.66338621 1.544685369 0.005340993 0.020723809 5.91514446 3.913115367 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 5.839080727 3.965207679 0.005340993 0.020723809 5.753976388 3.912236825 0.005340993 0.020723809 5.753862265 3.911996042 0.005340993 0.020723809 5.952842842 3.965572615 0.005340993 0.020723809 7.096157126 4.475454958 0.005340993 0.020723809 5.850649681 3.868536745 0.005340993 0.020723809 5.9330278 4.023982055 0.005340993 0.020723809 4.944304616 3.009205796 0.003405236 0.020723809 7.583723236 1.986655632 0.003405236 0.020723809 8.260384334 2.016660581 0.003405236 0.020723809 9.735424998 1.99831813 0.005340993 0.020723809 5.533398325 3.579407917 0.005340993 0.020723809 4.833558669 3.051880576 0.005340993 0.020723809 4.499055046 2.748275193 0.003405236 0.020723809 8.206919051 1.996130504 0.005340993 0.020723809 Inf NA 0.003405236 0.020723809 3.435980355 1.755584855 0.003405236 0.020723809 8.606255502 2.406928232 0.005340993 0.020723809 5.727716186 3.897122462 0.005340993 0.020723809 5.727716186 3.897122462 Diabetes Page 210 of 230

0.005340993 0.020723809 4.415816646 2.708588528 0.005340993 0.020723809 4.495507362 2.763006047 0.005340993 0.020723809 4.622339804 2.805568591 0.005340993 0.020723809 4.622337193 2.805567174 0.005340993 0.020723809 4.622339804 2.805568591 0.005340993 0.020723809 4.622339804 2.805568591 0.005340993 0.020723809 5.720978066 3.779257381 0.005340993 0.020723809 5.736442829 3.71403135 0.003405236 0.020723809 3.477059811 1.775726004 0.005340993 0.020723809 5.893425366 3.679099625 0.003405236 0.020723809 Inf NA 0.003405236 0.020723809 #NAME? NA 0.003405236 0.020723809 9.742131446 1.562700578 0.003405236 0.020723809 6.60410806 2.321132013 0.003405236 0.020723809 7.481107983 2.279009046 0.003405236 0.020723809 7.481107983 2.279009046 0.005340993 0.020723809 4.34498227 2.690565638 0.003405236 0.020723809 5.726455464 1.985563505 0.003405236 0.020723809 4.647883394 1.592366982 0.005340993 0.020723809 4.604882815 2.794519977 0.003405236 0.020723809 3.335047528 1.940391626 0.005340993 0.020723809 4.502761283 2.75083881 0.005340993 0.020723809 4.446313726 2.717063333 0.003405236 0.020723809 3.721408304 2.003833431 0.003405236 0.020723809 6.116287943 1.923440424 0.005340993 0.020723809 5.748261952 3.751691685 0.003231673 0.020723809 Inf NA 0.003231673 0.020723809 Inf NA 0.003231673 0.020723809 Inf NA 0.003405236 0.020723809 #NAME? NA 0.005340993 0.020723809 5.932820489 4.023903951 0.005340993 0.020723809 5.932820489 4.023903951 0.005340993 0.020723809 5.932820489 4.023903951 0.003361339 0.020723809 9.985900911 1.332607611 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.51244177 2.759108344 0.005340993 0.020723809 4.773044046 2.990027389 0.004970163 0.020723809 #NAME? NA 0.004222063 0.020723809 #NAME? NA 0.003361339 0.020723809 Inf NA 0.003405236 0.020723809 Inf NA 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 5.821766137 3.907462843 0.003405236 0.020723809 9.804144557 1.542891351 0.005340993 0.020723809 4.575570687 2.73830157 0.005340993 0.020723809 5.535202399 3.568707802 0.005340993 0.020723809 5.67622939 3.772162872 0.003405236 0.020723809 -5.519733608 1.91569145 0.003405236 0.020723809 4.711614228 1.448747404 0.003361339 0.020723809 9.985900911 1.332607611 Page 211 of 230 Diabetes

0.003361339 0.020723809 10.01224728 1.339093005 0.004970163 0.020723809 #NAME? NA 0.001454092 0.020723809 #NAME? NA 0.005340993 0.020723809 4.539113085 2.792921094 0.003405236 0.020723809 -6.067712588 1.552441201 0.005340993 0.020723809 5.552667553 3.35364268 0.003361339 0.020723809 9.097116563 1.625405294 0.005340993 0.020723809 5.820590323 3.904829164 0.003231673 0.020723809 Inf NA 0.005340993 0.020723809 5.725547429 3.704827949 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 5.933007376 4.023928347 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 5.762987841 3.924142329 0.005340993 0.020723809 5.981228871 4.020583365 0.005340993 0.020723809 4.510237003 2.735151912 0.003405236 0.020723809 5.367253625 2.334740656 0.005340993 0.020723809 3.773889035 2.34050333 0.003231673 0.020723809 Inf NA 0.005340993 0.020723809 4.053088911 2.418904205 0.005340993 0.020723809 6.072559564 5.49256109 0.005340993 0.020723809 5.69229907 3.745976778 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 3.991430558 2.339694182 0.005340993 0.020723809 4.728877356 2.872327042 0.005340993 0.020723809 5.182034382 3.241954303 0.005340993 0.020723809 4.756119339 2.910999251 0.005340993 0.020723809 4.952130201 3.009033555 0.005340993 0.020723809 5.203605252 3.295881376 0.005340993 0.020723809 5.203024063 3.284142416 0.005340993 0.020723809 4.690508761 2.861918369 0.005340993 0.020723809 4.78082153 2.955332981 0.005340993 0.020723809 4.434735116 2.744781742 0.005340993 0.020723809 4.920223717 3.003978291 0.005340993 0.020723809 4.90288813 2.98518909 0.005340993 0.020723809 5.078371302 3.146931369 0.005340993 0.020723809 4.944959137 3.056684061 0.005340993 0.020723809 4.566030322 2.783485954 0.005340993 0.020723809 4.88206374 3.007396042 0.005340993 0.020723809 4.975013975 3.09114742 0.005340993 0.020723809 4.729054704 2.90877237 0.005340993 0.020723809 4.943949656 3.071903186 0.005340993 0.020723809 4.781223334 2.910319021 0.005340993 0.020723809 6.904643845 3.727758554 0.005340993 0.020723809 Inf NA 0.005340993 0.020723809 5.736050253 3.713895624 0.003405236 0.020723809 -6.64035789 1.579167636 0.005340993 0.020723809 3.141264442 1.937264791 0.003361339 0.020723809 10.01224728 1.339093005 0.005340993 0.020723809 5.601573306 3.624590988 Diabetes Page 212 of 230

0.005340993 0.020723809 5.887718596 3.960772983 0.003361339 0.020723809 Inf NA 0.003405236 0.020723809 7.27840362 3.302884737 0.005340993 0.020723809 5.944218033 3.15551453 0.003405236 0.020723809 6.957668326 3.154586221 0.003405236 0.020723809 8.175649614 1.9878876 0.005340993 0.020723809 5.293818488 3.372793752 0.004970163 0.020723809 #NAME? NA 0.003405236 0.020723809 3.585230321 1.745407513 0.005340993 0.020723809 6.099049606 3.902123453 0.005340993 0.020723809 6.00042192 3.946191003 0.005340993 0.020723809 6.069142148 3.947684204 0.003361339 0.020723809 Inf NA 0.003361339 0.020723809 Inf NA 0.003274558 0.020723809 #NAME? NA 0.005340993 0.020723809 5.75468812 3.736852153 0.005340993 0.020723809 5.697423038 3.752720679 0.005340993 0.020723809 5.697423038 3.752720679 0.003405236 0.020723809 9.075454253 1.624904323 0.005340993 0.020723809 5.698655501 3.753174073 0.005340993 0.020723809 5.732150705 3.8997089 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 4.423342843 2.77454799 0.003361339 0.020723809 Inf NA 0.005340993 0.020723809 4.853530249 3.048427607 0.004970163 0.020723809 #NAME? NA 0.005340993 0.020723809 5.815065719 3.735529499 0.005340993 0.020723809 5.830982421 3.74646238 0.005340993 0.020723809 5.711886398 3.756927838 0.005340993 0.020723809 5.701641889 3.744678356 0.005340993 0.020723809 5.693615363 3.734274471 0.003405236 0.020723809 9.778526182 1.526616144 0.003405236 0.020723809 9.006476267 2.057063432 0.005340993 0.020723809 5.736442829 3.71403135 0.005340993 0.020723809 5.736442829 3.71403135 0.005278155 0.020723809 Inf NA 0.005340993 0.020723809 5.998477558 4.001329092 0.005340993 0.020723809 5.597544437 3.765531576 0.005340993 0.020723809 5.922096768 4.009810782 0.005340993 0.020723809 5.922096768 4.009810782 0.005340993 0.020723809 5.922096768 4.009810782 0.003405236 0.020723809 Inf NA 0.003405236 0.020723809 Inf NA 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 3.699748882 2.208191063 0.005340993 0.020723809 5.71132281 3.711775247 0.005340993 0.020723809 5.831158863 3.91978681 0.003405236 0.020723809 2.920255363 1.136684745 0.005340993 0.020723809 5.022022103 3.178938765 0.001454092 0.020723809 #NAME? NA Page 213 of 230 Diabetes

0.005340993 0.020723809 5.731061666 3.819888494 0.001454092 0.020723809 #NAME? NA 0.001454092 0.020723809 #NAME? NA 0.001454092 0.020723809 #NAME? NA 0.003405236 0.020723809 Inf NA 0.005340993 0.020723809 5.690240118 3.745943686 0.005340993 0.020723809 4.528418405 2.791419812 0.005340993 0.020723809 5.692236806 3.745850443 0.005340993 0.020723809 5.931882792 4.023557684 0.003361339 0.020723809 7.531168113 2.127480235 0.003361339 0.020723809 Inf NA 0.006419629 0.024856184 #NAME? NA 0.006419629 0.024856184 #NAME? NA 0.006477844 0.025063851 #NAME? NA 0.006493265 0.02508803 Inf NA 0.006493265 0.02508803 Inf NA 0.006567351 0.025320631 #NAME? NA 0.006567351 0.025320631 Inf NA 0.006567351 0.025320631 -5.151594907 2.708113227 0.008220971 0.029609568 3.241528579 2.491152673 0.008220971 0.029609568 Inf NA 0.008220971 0.029609568 Inf NA 0.008220971 0.029609568 2.633964304 1.36957079 0.008220971 0.029609568 3.413713973 1.642639063 0.008220971 0.029609568 6.958508451 4.137892657 0.008133072 0.029609568 -6.533569804 2.574049908 0.008220971 0.029609568 1.995354304 1.110278834 0.008220971 0.029609568 -5.47088099 2.500523431 0.008220971 0.029609568 2.695755843 1.70372835 0.008220971 0.029609568 2.223242193 1.237615286 0.008220971 0.029609568 2.228340806 1.293360677 0.008220971 0.029609568 2.585623327 1.367064221 0.008220971 0.029609568 -6.670616306 2.65976747 0.008220971 0.029609568 1.931566425 1.029253712 0.00778632 0.029609568 #NAME? NA 0.008220971 0.029609568 2.540297112 1.371630203 0.008220971 0.029609568 -4.73825388 1.95366816 0.008220971 0.029609568 2.36669774 1.293588173 0.008220971 0.029609568 -6.348791994 2.564425023 0.008133072 0.029609568 -6.928921107 2.879461124 0.008133072 0.029609568 -6.98003088 2.840616139 0.008220971 0.029609568 Inf NA 0.008133072 0.029609568 -6.675842624 2.601496536 0.008220971 0.029609568 2.573611268 1.31371596 0.008220971 0.029609568 5.858685378 3.700831722 0.008220971 0.029609568 2.075315671 1.09530333 0.008133072 0.029609568 -6.703797795 2.641985651 0.008220971 0.029609568 1.995495589 1.113997201 0.008220971 0.029609568 5.203069255 5.00529314 0.008220971 0.029609568 2.455154468 1.526611434 Diabetes Page 214 of 230

0.008220971 0.029609568 4.288462177 2.527590669 0.008220971 0.029609568 6.070827695 3.366028971 0.008220971 0.029609568 6.774898238 3.621948632 0.008220971 0.029609568 7.548571317 4.600007974 0.008220971 0.029609568 Inf NA 0.008220971 0.029609568 8.128519691 4.112529023 0.008220971 0.029609568 7.217061615 4.33681648 0.008220971 0.029609568 7.148211105 4.372235952 0.008220971 0.029609568 7.279887535 4.456123135 0.008220971 0.029609568 7.003601516 4.298919544 0.008220971 0.029609568 5.758196752 5.822718301 0.008133072 0.029609568 #NAME? NA 0.008220971 0.029609568 6.345507786 3.864146557 0.008220971 0.029609568 6.345507786 3.864146557 0.008220971 0.029609568 -3.973441545 2.196742306 0.008220971 0.029609568 2.515246121 1.284743112 0.008220971 0.029609568 6.681002377 3.873959054 0.008220971 0.029609568 7.441853314 4.623817964 0.008220971 0.029609568 7.169130842 4.037153555 0.008220971 0.029609568 2.507016743 1.434547868 0.008220971 0.029609568 -6.914739748 2.779154168 0.008220971 0.029609568 Inf NA 0.008220971 0.029609568 7.467680946 4.410316958 0.008220971 0.029609568 Inf NA 0.008220971 0.029609568 -5.413455467 2.478180822 0.008220971 0.029609568 2.005877931 1.11513752 0.008220971 0.029609568 -3.865350826 1.747883746 0.008220971 0.029609568 2.23327907 1.257398521 0.008220971 0.029609568 -6.472463096 2.275654507 0.008220971 0.029609568 2.923667409 1.911096163 0.008220971 0.029609568 7.95640954 3.960218484 0.008220971 0.029609568 1.985263131 1.105129636 0.008133072 0.029609568 Inf NA 0.008220971 0.029609568 5.506992601 3.531019283 0.00778632 0.029609568 #NAME? NA 0.008220971 0.029609568 3.264005488 1.788779738 0.008220971 0.029609568 7.372686908 3.771468339 0.008220971 0.029609568 -4.043323516 2.053999989 0.008133072 0.029609568 #NAME? NA 0.00778632 0.029609568 #NAME? NA 0.008220971 0.029609568 #NAME? NA 0.008133072 0.029609568 Inf NA 0.008220971 0.029609568 7.572477169 4.480479569 0.008220971 0.029609568 Inf NA 0.008133072 0.029609568 -6.57038173 2.576011968 0.008220971 0.029609568 -6.338168442 2.383494016 0.008133072 0.029609568 -6.533569804 2.574049908 0.008220971 0.029609568 2.550018142 1.74728329 0.008220971 0.029609568 7.159757317 4.397201793 0.008220971 0.029609568 2.408831391 1.400965974 Page 215 of 230 Diabetes

0.008220971 0.029609568 #NAME? NA 0.008220971 0.029609568 6.547270274 6.469411209 0.008220971 0.029609568 2.759607479 1.645157859 0.008045657 0.029609568 #NAME? NA 0.008220971 0.029609568 Inf NA 0.008220971 0.029609568 2.660661161 1.628581467 0.008133072 0.029609568 -6.675842624 2.601496536 0.008220971 0.029609568 7.485611228 3.667271681 0.008220971 0.029609568 -5.445031154 2.961095768 0.008045657 0.029609568 #NAME? NA 0.008045657 0.029609568 #NAME? NA 0.008220971 0.029609568 -6.788048643 2.660050321 0.008133072 0.029609568 -6.051127653 2.335003335 0.008133072 0.029609568 -6.60727705 2.606887997 0.00778632 0.029609568 #NAME? NA 0.008045657 0.029609568 #NAME? NA 0.008220971 0.029609568 -3.21133901 2.001810552 0.00778632 0.029609568 #NAME? NA 0.008220971 0.029609568 2.51872027 1.3281015 0.009022881 0.032455084 Inf NA 0.009022881 0.032455084 Inf NA 0.009820367 0.035300411 Inf NA 0.009922393 0.035596991 Inf NA 0.009922393 0.035596991 Inf NA 0.009922393 0.035596991 Inf NA 0.010024935 0.035894252 -5.464482655 2.160289439 0.010024935 0.035894252 Inf NA 0.010024935 0.035894252 #NAME? NA 0.011128012 0.039739788 #NAME? NA 0.012419331 0.0403615 -3.004489019 2.709709858 0.012419331 0.0403615 -5.93790958 2.219805237 0.012419331 0.0403615 -6.343481173 2.867608581 0.012419331 0.0403615 -6.343481173 2.867608581 0.012419331 0.0403615 -6.343481173 2.867608581 0.012419331 0.0403615 -6.343481173 2.867608581 0.012419331 0.0403615 -6.226436801 2.840517694 0.012419331 0.0403615 -6.226436801 2.840517694 0.012419331 0.0403615 -5.267925342 2.540809345 0.012299213 0.0403615 -6.813412639 2.473127148 0.012419331 0.0403615 -6.490055773 2.573336493 0.012419331 0.0403615 2.772633304 1.713469235 0.012419331 0.0403615 -6.409445933 2.582485993 0.012419331 0.0403615 -6.280476536 2.389190573 0.012419331 0.0403615 -6.299268237 2.481048673 0.012419331 0.0403615 -6.327791236 2.535678054 0.012419331 0.0403615 -3.420977138 2.074400932 0.012419331 0.0403615 #NAME? NA 0.012419331 0.0403615 -6.097605019 2.48184536 0.012419331 0.0403615 -6.319575725 2.413934872 0.012299213 0.0403615 #NAME? NA Diabetes Page 216 of 230

0.012419331 0.0403615 #NAME? NA 0.012419331 0.0403615 6.8750257 4.227790459 0.012419331 0.0403615 6.875011213 4.22778303 0.012419331 0.0403615 6.875011213 4.22778303 0.012419331 0.0403615 6.716576902 4.176613513 0.012299213 0.0403615 -2.708712572 1.491769817 0.012419331 0.0403615 6.902414454 4.303149847 0.012299213 0.0403615 Inf NA 0.012419331 0.0403615 6.875040187 4.227797887 0.012419331 0.0403615 6.874986469 4.227783619 0.012419331 0.0403615 6.875011213 4.22778303 0.012419331 0.0403615 8.176762956 5.279603569 0.012419331 0.0403615 6.875011213 4.22778303 0.012419331 0.0403615 6.875011213 4.22778303 0.012419331 0.0403615 6.641955494 4.588267501 0.011942104 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.012419331 0.0403615 3.323002351 2.041713136 0.012419331 0.0403615 -5.81446464 2.452267666 0.012419331 0.0403615 7.24290986 4.472981202 0.012419331 0.0403615 Inf NA 0.012419331 0.0403615 -6.435671622 2.430052241 0.012419331 0.0403615 -5.413598611 2.563134304 0.012419331 0.0403615 2.440212201 1.36556091 0.012419331 0.0403615 -5.069566271 2.328059989 0.012419331 0.0403615 -6.402940972 2.589378991 0.012419331 0.0403615 -5.572554316 2.543970762 0.012419331 0.0403615 -6.767907948 2.829237309 0.012419331 0.0403615 8.847476281 4.788271504 0.012419331 0.0403615 8.847476281 4.788271504 0.012419331 0.0403615 -5.884741901 2.125159289 0.012419331 0.0403615 -5.714915135 2.474238222 0.012419331 0.0403615 -6.622349614 2.648119826 0.012299213 0.0403615 Inf NA 0.012419331 0.0403615 #NAME? NA 0.012299213 0.0403615 Inf NA 0.012299213 0.0403615 Inf NA 0.012299213 0.0403615 2.148579585 2.023693466 0.012419331 0.0403615 2.248520206 2.050591603 0.012419331 0.0403615 2.248520206 2.050591603 0.012419331 0.0403615 2.248520206 2.050591603 0.012419331 0.0403615 -6.513564499 2.573358427 0.012419331 0.0403615 -6.057734156 2.344592507 0.012299213 0.0403615 Inf NA 0.012419331 0.0403615 -5.505033331 2.037543786 0.012419331 0.0403615 6.708542126 4.100885811 0.012419331 0.0403615 6.428220203 4.211900428 0.012299213 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.012419331 0.0403615 7.090500883 4.412230308 Page 217 of 230 Diabetes

0.011942104 0.0403615 Inf NA 0.012299213 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.012299213 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.012419331 0.0403615 7.185855261 4.406401274 0.012179635 0.0403615 #NAME? NA 0.012419331 0.0403615 -5.451528989 1.988055754 0.012419331 0.0403615 2.610714059 1.798374181 0.012419331 0.0403615 7.554632127 3.862284596 0.012419331 0.0403615 #NAME? NA 0.012419331 0.0403615 -7.207829776 2.702455711 0.011942104 0.0403615 Inf NA 0.012419331 0.0403615 -6.053338286 2.317254662 0.012419331 0.0403615 2.718787407 1.933681551 0.012419331 0.0403615 Inf NA 0.012419331 0.0403615 -6.033565907 2.4677905 0.012419331 0.0403615 Inf NA 0.012419331 0.0403615 Inf NA 0.012419331 0.0403615 2.213329467 2.074485464 0.012419331 0.0403615 -6.331569791 2.405604374 0.012419331 0.0403615 -6.214405428 2.61595451 0.012419331 0.0403615 -6.146799245 2.283249176 0.011824155 0.0403615 Inf NA 0.012299213 0.0403615 Inf NA 0.012299213 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.012419331 0.0403615 -6.189649822 2.837471896 0.012419331 0.0403615 -5.875542159 2.431719212 0.012419331 0.0403615 -5.782906316 2.480563377 0.011942104 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.012419331 0.0403615 Inf NA 0.012419331 0.0403615 Inf NA 0.012419331 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.012419331 0.0403615 6.420487763 4.242974698 0.012419331 0.0403615 2.511031287 1.805006508 0.012299213 0.0403615 #NAME? NA 0.012299213 0.0403615 #NAME? NA 0.012419331 0.0403615 -6.327605929 2.64242672 0.012419331 0.0403615 -6.150298402 2.290558613 0.012419331 0.0403615 -5.901226562 2.214016022 0.012419331 0.0403615 #NAME? NA 0.012419331 0.0403615 -6.757463803 2.750498483 0.012419331 0.0403615 -6.214521071 2.383267626 0.012299213 0.0403615 -4.828557928 1.904125627 0.012419331 0.0403615 -5.904718462 2.607253955 Diabetes Page 218 of 230

0.012299213 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.011942104 0.0403615 Inf NA 0.012419331 0.0403615 -6.124808966 2.283697005 0.012419331 0.0403615 -4.680107599 1.836696468 0.012299213 0.0403615 #NAME? NA 0.012299213 0.0403615 Inf NA 0.014468153 0.046616765 #NAME? NA 0.014742583 0.047445101 Inf NA 0.014742583 0.047445101 #NAME? NA 0.014880642 0.047833134 Inf NA 0.014880642 0.047833134 Inf NA 0.015019262 0.048250371 2.225334734 2.032137038 0.000760306 0.008300504 5.643051326 1.1546918 0.000760306 0.008300504 5.687625494 2.170519327 0.000760306 0.008300504 8.437035992 1.68660124 0.000760306 0.008300504 8.623224384 1.773870262 0.000748989 0.008300504 Inf NA 0.000726701 0.008300504 Inf NA 0.000760306 0.008300504 7.729918833 1.639316643 0.000760306 0.008300504 8.898430421 1.935158236 0.000760306 0.008300504 5.508072998 2.131909594 0.000760306 0.008300504 5.66188286 2.123457875 0.000760306 0.008300504 4.977922944 2.327408802 0.000760306 0.008300504 4.98455329 2.329521181 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 6.845224705 1.834193961 0.000760306 0.008300504 4.654905391 2.149667338 0.000760306 0.008300504 7.481415504 1.712517015 0.000760306 0.008300504 7.67890164 1.653026614 0.000760306 0.008300504 7.179301915 1.929747659 0.000760306 0.008300504 4.853513656 1.833191567 0.000760306 0.008300504 7.751247489 1.776636911 0.000760306 0.008300504 8.485432243 1.811295789 0.000760306 0.008300504 8.096368026 1.67471501 0.000760306 0.008300504 7.985471289 1.703680714 0.000760306 0.008300504 7.994097281 1.699026296 0.000760306 0.008300504 7.985471289 1.703680714 0.000760306 0.008300504 7.636503073 1.69488803 0.000760306 0.008300504 7.994097281 1.699026296 0.000760306 0.008300504 8.08666206 1.831670771 0.000760306 0.008300504 7.994097281 1.699026296 0.000760306 0.008300504 7.985471289 1.703680714 0.000760306 0.008300504 7.627027657 1.699662939 0.000760306 0.008300504 9.147552681 1.743396078 0.000760306 0.008300504 9.147552681 1.743396078 0.000760306 0.008300504 9.147552681 1.743396078 0.000760306 0.008300504 9.147552681 1.743396078 0.000760306 0.008300504 8.824197527 1.713883458 Page 219 of 230 Diabetes

0.000760306 0.008300504 8.824197527 1.713883458 0.000754633 0.008300504 8.257305838 1.117404263 0.000754633 0.008300504 7.850267483 1.435740259 0.000754633 0.008300504 8.257305838 1.117404263 0.000754633 0.008300504 7.850267483 1.435740259 0.000760306 0.008300504 -4.192142953 1.90575186 0.000754633 0.008300504 8.448030928 2.165937434 0.000760306 0.008300504 7.789414227 1.832739496 0.000760306 0.008300504 5.865416318 1.019016476 0.000748989 0.008300504 8.968881897 1.518522013 0.000760306 0.008300504 7.603311691 1.904644585 0.000754633 0.008300504 9.088437492 1.704861974 0.000760306 0.008300504 7.651796706 1.663670689 0.000754633 0.008300504 9.494402673 1.455867309 0.000760306 0.008300504 4.605646896 1.921851968 0.000760306 0.008300504 7.968703794 1.586673636 0.000760306 0.008300504 8.239494957 1.637983352 0.000760306 0.008300504 6.340694417 1.727891466 0.000760306 0.008300504 8.105604427 1.606841965 0.000760306 0.008300504 7.660891991 1.629371719 0.000760306 0.008300504 7.459085043 1.597282202 0.000760306 0.008300504 8.658289516 1.664383137 0.000760306 0.008300504 7.239836522 1.561859099 0.000760306 0.008300504 7.905150856 0.922088209 0.000760306 0.008300504 7.896386536 1.750741142 0.000760306 0.008300504 8.066717637 1.667218197 0.000760306 0.008300504 6.450096044 1.524301415 0.000760306 0.008300504 8.531763687 1.847908333 0.000760306 0.008300504 6.505976334 1.626502622 0.000760306 0.008300504 7.491894133 1.409188131 0.000743374 0.008300504 Inf NA 0.000760306 0.008300504 4.001977866 1.375644459 0.000760306 0.008300504 7.676997499 1.588919475 0.000760306 0.008300504 9.027678708 1.749139687 0.000760306 0.008300504 8.416319957 1.686947115 0.000760306 0.008300504 7.596384452 1.884284993 0.000760306 0.008300504 4.744553772 1.876164071 0.000760306 0.008300504 8.755872863 1.72329229 0.000760306 0.008300504 5.707246268 1.987316151 0.000760306 0.008300504 9.357356885 1.843164269 0.000760306 0.008300504 7.897471648 1.595009092 0.000760306 0.008300504 6.958909581 1.692306328 0.000726701 0.008300504 Inf NA 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 7.826485033 2.005802685 0.000760306 0.008300504 8.638182944 1.807730942 0.000760306 0.008300504 9.208486215 1.534325711 0.000760306 0.008300504 7.697698667 1.600739209 0.000760306 0.008300504 6.810326177 1.884553208 0.000760306 0.008300504 5.578730481 1.491131806 Diabetes Page 220 of 230

0.000760306 0.008300504 4.862529907 2.246664857 0.000760306 0.008300504 8.497765483 1.889070528 0.000760306 0.008300504 9.093552501 1.909476998 0.000754633 0.008300504 9.557243859 1.770204006 0.000737787 0.008300504 6.446186256 1.298578304 0.000760306 0.008300504 8.944749662 1.781721416 0.000760306 0.008300504 6.275339357 1.57326735 0.000754633 0.008300504 9.761004537 1.719928548 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 8.42017923 1.768706436 0.000760306 0.008300504 8.266925233 1.763127112 0.000754633 0.008300504 10.14095307 1.143800796 0.000754633 0.008300504 9.507102009 1.718811909 0.000760306 0.008300504 8.743000492 1.750115731 0.000760306 0.008300504 8.997746045 1.706427305 0.000760306 0.008300504 8.280923861 1.523705871 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 7.138482833 1.569278871 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 4.173361592 1.693737577 0.000760306 0.008300504 4.33277929 1.651287481 0.000760306 0.008300504 4.33277929 1.651287481 0.000760306 0.008300504 6.635557486 1.753730414 0.000760306 0.008300504 6.477161252 1.685991386 0.000760306 0.008300504 8.099787134 1.708412938 0.000754633 0.008300504 6.623519725 1.677589392 0.000760306 0.008300504 6.165628817 1.543602091 0.000760306 0.008300504 6.688878445 1.679666608 0.000754633 0.008300504 7.129846243 1.740196353 0.000760306 0.008300504 4.588269069 2.144726601 0.000760306 0.008300504 4.588269069 2.144726601 0.000760306 0.008300504 4.588269069 2.144726601 0.000754633 0.008300504 8.50602243 1.709980039 0.000760306 0.008300504 8.422614442 1.687600057 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 6.939598532 1.583246602 0.000760306 0.008300504 9.305796451 1.549449649 0.000760306 0.008300504 8.495123925 1.655660029 0.000760306 0.008300504 8.090656805 1.517705149 0.000760306 0.008300504 7.019041697 1.505600251 0.000760306 0.008300504 7.503341501 1.825487458 0.000754633 0.008300504 9.167413581 1.446551525 0.000760306 0.008300504 8.574435693 1.488921508 0.000760306 0.008300504 6.192163836 1.343401168 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 9.622152355 1.731804089 0.000760306 0.008300504 8.021870118 1.69415578 0.000760306 0.008300504 7.218616954 1.683750701 0.000760306 0.008300504 8.163576984 1.541866344 0.000760306 0.008300504 7.634211446 1.455211478 Page 221 of 230 Diabetes

0.000760306 0.008300504 8.19367655 1.690137782 0.000760306 0.008300504 6.585626126 1.398915441 0.000760306 0.008300504 5.839499966 2.142966758 0.000748989 0.008300504 Inf NA 0.000754633 0.008300504 9.676514755 1.749109572 0.000760306 0.008300504 6.73293768 2.011723902 0.000760306 0.008300504 8.663571122 1.588405332 0.000760306 0.008300504 7.526093488 2.091272492 0.000760306 0.008300504 8.974336557 1.96549541 0.000754633 0.008300504 6.277774906 1.295026843 0.000760306 0.008300504 9.057499118 1.925194178 0.000760306 0.008300504 7.653343327 1.934718117 0.000760306 0.008300504 8.200468488 1.795207448 0.000760306 0.008300504 6.027727422 1.593762847 0.000760306 0.008300504 6.027727422 1.593762847 0.000760306 0.008300504 4.434879849 1.930366687 0.000760306 0.008300504 5.219295032 2.254252973 0.000754633 0.008300504 9.226218851 1.706105032 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 8.668724788 1.71830758 0.000760306 0.008300504 8.998756464 1.572137745 0.000760306 0.008300504 8.435883478 1.555200389 0.000760306 0.008300504 8.434781912 1.724884553 0.000760306 0.008300504 8.155912281 1.816146138 0.000760306 0.008300504 7.854633519 2.019064513 0.000760306 0.008300504 7.844665524 2.027723358 0.000754633 0.008300504 6.635966029 1.707088737 0.000699486 0.008300504 3.792187299 1.740042028 0.000760306 0.008300504 7.833795598 2.073292641 0.000760306 0.008300504 7.833795598 2.073292641 0.000760306 0.008300504 8.152220939 1.633051021 0.000760306 0.008300504 9.366566712 1.30231426 0.000760306 0.008300504 9.315252399 1.228227671 0.000760306 0.008300504 5.627918257 2.150731443 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 6.879364616 1.206177836 0.000760306 0.008300504 8.47994519 1.708670448 0.000760306 0.008300504 8.42188801 1.688225156 0.000760306 0.008300504 8.509108677 1.605786353 0.000760306 0.008300504 8.824820333 1.473621842 0.000760306 0.008300504 7.456901465 1.573845366 0.000760306 0.008300504 7.706082752 1.647873209 0.000748989 0.008300504 Inf NA 0.000754633 0.008300504 Inf NA 0.000760306 0.008300504 8.74871271 1.565126539 0.000743374 0.008300504 Inf NA 0.000760306 0.008300504 3.598564328 2.040243966 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 7.890108483 1.817373881 0.000760306 0.008300504 8.197150788 1.607899868 Diabetes Page 222 of 230

0.000754633 0.008300504 Inf NA 0.000760306 0.008300504 8.267312128 1.753638965 0.000760306 0.008300504 8.313979923 1.561689713 0.000737787 0.008300504 8.880954801 1.990413772 0.000760306 0.008300504 7.231619129 1.095082146 0.000760306 0.008300504 6.93632294 1.546654939 0.000748989 0.008300504 Inf NA 0.000704872 0.008300504 7.688618746 1.223419903 0.000754633 0.008300504 9.437811459 1.454031591 0.000754633 0.008300504 Inf NA 0.000760306 0.008300504 8.105266914 1.58300036 0.000760306 0.008300504 7.890818169 1.494259727 0.000760306 0.008300504 6.561772716 1.680187567 0.000760306 0.008300504 9.378382619 1.556729962 0.000760306 0.008300504 6.225202114 1.679738579 0.000760306 0.008300504 9.059085636 1.574451465 0.000760306 0.008300504 5.410365187 2.234474709 0.000485389 0.008300504 Inf NA 0.000760306 0.008300504 6.918055536 1.512489548 0.000760306 0.008300504 4.911742431 1.681265052 0.000760306 0.008300504 4.104248851 1.730365529 0.000760306 0.008300504 4.173361592 1.693737577 0.000760306 0.008300504 4.069787077 1.775888948 0.000760306 0.008300504 4.079479815 1.770773965 0.000760306 0.008300504 8.60905982 1.625522167 0.000760306 0.008300504 8.60905982 1.625522167 0.000760306 0.008300504 6.762288565 1.619233781 0.000760306 0.008300504 8.891758654 1.464370892 0.000760306 0.008300504 5.324832154 1.593832555 0.000760306 0.008300504 6.558079348 1.424930466 0.000760306 0.008300504 4.91568975 2.197906846 0.000760306 0.008300504 4.891291383 2.245780422 0.000760306 0.008300504 8.550974769 1.671232392 0.00071573 0.008300504 Inf NA 0.000683497 0.008300504 Inf NA 0.00071573 0.008300504 Inf NA 0.000760306 0.008300504 9.002989918 1.42802765 0.000760306 0.008300504 9.301804075 1.229688039 0.000760306 0.008300504 9.03851232 1.568237874 0.000743374 0.008300504 Inf NA 0.000760306 0.008300504 7.99900948 1.674735402 0.000760306 0.008300504 7.205358356 1.233464895 0.000760306 0.008300504 7.444701497 1.446029577 0.000760306 0.008300504 9.208465475 1.534320109 0.000760306 0.008300504 8.37793401 1.70665764 0.000760306 0.008300504 8.835720588 1.495567878 0.000760306 0.008300504 4.724949152 2.194503722 0.000760306 0.008300504 5.209866788 2.141268658 0.000760306 0.008300504 7.450162862 1.573515355 0.000760306 0.008300504 7.247935362 1.709384682 Page 223 of 230 Diabetes

0.000760306 0.008300504 7.894525392 1.931511167 0.000760306 0.008300504 8.696750496 1.765587095 0.000760306 0.008300504 7.305702461 1.692495781 0.000760306 0.008300504 9.169318313 1.751888147 0.000760306 0.008300504 5.340127597 2.222807192 0.000760306 0.008300504 6.994898557 1.737249161 0.000760306 0.008300504 8.231536837 1.753202387 0.000760306 0.008300504 9.632071986 1.58385711 0.000760306 0.008300504 8.072885587 1.556062669 0.000760306 0.008300504 5.913109596 1.57291999 0.000760306 0.008300504 6.240684774 1.388769345 0.000760306 0.008300504 6.443572446 1.280466568 0.000760306 0.008300504 7.684612897 1.648267985 0.000754633 0.008300504 9.809351542 1.513076158 0.000748989 0.008300504 6.307273093 1.524424609 0.000760306 0.008300504 3.709721926 2.140442323 0.000760306 0.008300504 7.074716646 1.629465111 0.000760306 0.008300504 8.739433626 1.577546144 0.000760306 0.008300504 7.09263971 1.209075175 0.000760306 0.008300504 7.669073086 1.462888148 0.000760306 0.008300504 7.592808763 1.782704559 0.000760306 0.008300504 8.651095676 1.539021138 0.000760306 0.008300504 6.245328345 1.265803346 0.000760306 0.008300504 7.477838487 1.63974916 0.000760306 0.008300504 8.345789209 1.719082759 0.000760306 0.008300504 8.546529925 1.653544523 0.000760306 0.008300504 9.145712587 1.453924194 0.000760306 0.008300504 9.407433833 1.60979693 0.000760306 0.008300504 8.510449498 1.651873635 0.000760306 0.008300504 6.047908656 1.941481983 0.000760306 0.008300504 4.892183344 2.261136023 0.000760306 0.008300504 8.289488494 1.762333804 0.000760306 0.008300504 8.451220209 1.548299946 0.000760306 0.008300504 8.170638329 1.665200718 0.000760306 0.008300504 8.12035027 1.547424188 0.000760306 0.008300504 6.989029159 1.85202237 0.000704872 0.008300504 7.400638676 1.52356045 0.000760306 0.008300504 8.932345553 1.763616291 0.000760306 0.008300504 9.364953635 1.6863661 0.000760306 0.008300504 8.056492816 1.861865532 0.000748989 0.008300504 6.175134341 1.584103622 0.000760306 0.008300504 7.298515953 1.905697371 0.000578562 0.008300504 Inf NA 0.000754633 0.008300504 10.0320242 1.094813695 0.000760306 0.008300504 9.291883956 1.264975301 0.000760306 0.008300504 7.035317313 1.774184659 0.000760306 0.008300504 7.035317313 1.774184659 0.000760306 0.008300504 8.749060387 1.565218855 0.000760306 0.008300504 8.157372656 0.950524543 0.000760306 0.008300504 6.95994242 1.546539689 Diabetes Page 224 of 230

0.000760306 0.008300504 6.832415846 1.640817949 0.000760306 0.008300504 9.072904814 1.874812215 0.000760306 0.008300504 8.493455558 1.697657529 0.000760306 0.008300504 4.804861767 2.192275846 0.000760306 0.008300504 9.059790466 1.72549807 0.000760306 0.008300504 6.294728674 1.500089185 0.000760306 0.008300504 6.294728674 1.500089185 0.000760306 0.008300504 Inf NA 0.000754633 0.008300504 Inf NA 0.000760306 0.008300504 9.402616667 1.616055568 0.000760306 0.008300504 4.930761346 2.280446611 0.000760306 0.008300504 8.667220061 1.693248439 0.000760306 0.008300504 4.93000493 2.434849485 0.000760306 0.008300504 8.606910221 1.597608418 0.000699486 0.008300504 3.792187299 1.740042028 0.000760306 0.008300504 6.72283179 1.955166613 0.000760306 0.008300504 7.887741056 1.65135554 0.000760306 0.008300504 8.37795472 1.706660327 0.000704872 0.008300504 7.688618746 1.223419903 0.000760306 0.008300504 8.21973177 1.750424938 0.000743374 0.008300504 Inf NA 0.000760306 0.008300504 8.232157429 1.589212381 0.000760306 0.008300504 8.478769047 1.578640633 0.000760306 0.008300504 8.396440075 1.574185952 0.000760306 0.008300504 8.163589817 1.541870522 0.000760306 0.008300504 9.189757654 1.641290536 0.000699486 0.008300504 3.792187299 1.740042028 0.000760306 0.008300504 7.675926276 1.949741877 0.000760306 0.008300504 7.704042151 1.731068922 0.000760306 0.008300504 4.32644399 1.815547428 0.000760306 0.008300504 7.570163453 1.520275436 0.000760306 0.008300504 4.302822785 1.306733495 0.000760306 0.008300504 6.400512687 1.255941139 0.000760306 0.008300504 8.294520517 1.738211006 0.000760306 0.008300504 8.611046663 1.506833666 0.000760306 0.008300504 6.901156792 1.734130394 0.000760306 0.008300504 8.042456222 1.459255648 0.000748989 0.008300504 Inf NA 0.00073223 0.008300504 3.751097127 1.688698629 0.00073223 0.008300504 3.749991608 1.687769232 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 8.322845596 1.566059696 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 6.909518777 1.477346085 0.000754633 0.008300504 9.467473159 1.474621679 0.000760306 0.008300504 8.24236207 1.831548868 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 6.604962407 1.239504753 0.000760306 0.008300504 6.177034684 1.916474663 0.000760306 0.008300504 7.749386972 1.561901407 Page 225 of 230 Diabetes

0.000760306 0.008300504 6.935285619 1.542657293 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 6.892937875 1.609411342 0.000760306 0.008300504 9.099845423 1.521259095 0.000760306 0.008300504 8.153955764 1.609630847 0.000704872 0.008300504 9.840264691 1.558904887 0.000760306 0.008300504 5.9093158 2.200421421 0.000760306 0.008300504 10.23177881 1.55224599 0.000760306 0.008300504 8.656807547 1.622655603 0.000760306 0.008300504 4.939870251 2.293350991 0.000754633 0.008300504 Inf NA 0.000748989 0.008300504 3.351613336 1.538256884 0.000754633 0.008300504 Inf NA 0.000760306 0.008300504 9.001778266 1.750415126 0.000760306 0.008300504 9.510125129 1.328716206 0.000760306 0.008300504 7.988358144 1.953748447 0.000760306 0.008300504 6.937701996 1.490329201 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 7.648689675 1.811253548 0.000760306 0.008300504 8.851902445 1.822243406 0.000760306 0.008300504 8.37795472 1.706660327 0.000760306 0.008300504 7.261775274 1.607760105 0.000760306 0.008300504 7.572732199 1.314759285 0.000760306 0.008300504 8.71565005 1.520750579 0.000760306 0.008300504 8.650136709 1.438691141 0.000760306 0.008300504 7.960861919 1.453241995 0.000754633 0.008300504 7.09947828 1.750335953 0.000760306 0.008300504 7.275818193 1.585026122 0.000760306 0.008300504 4.75879943 2.205388848 0.000760306 0.008300504 8.58283155 1.6506893 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 8.209690682 1.921233214 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 7.055457305 1.544538536 0.000760306 0.008300504 6.509166746 1.654201178 0.000760306 0.008300504 8.610345969 2.134141488 0.000754633 0.008300504 6.022919115 1.589184077 0.000760306 0.008300504 8.838852741 1.775042659 0.000726701 0.008300504 Inf NA 0.000726701 0.008300504 Inf NA 0.000760306 0.008300504 3.481489132 1.951256622 0.000760306 0.008300504 6.248877542 1.462740141 0.000754633 0.008300504 Inf NA 0.000760306 0.008300504 7.826744816 1.767289981 0.000737787 0.008300504 7.278376219 1.382571944 0.000704872 0.008300504 11.48989956 2.022101925 0.000760306 0.008300504 8.261197661 1.739051392 0.000760306 0.008300504 8.24729079 1.780594202 0.000699486 0.008300504 3.796404245 1.743026889 0.000754633 0.008300504 9.249941703 1.559173992 Diabetes Page 226 of 230

0.000760306 0.008300504 -4.380733611 1.895910536 0.000754633 0.008300504 9.199955976 1.681522551 0.000760306 0.008300504 9.144881894 1.585487273 0.000760306 0.008300504 8.778460242 1.542766263 0.000760306 0.008300504 8.926435517 1.597630889 0.000760306 0.008300504 9.019197808 1.701289322 0.000760306 0.008300504 8.52570437 1.781162424 0.000760306 0.008300504 8.60905982 1.625522167 0.000485389 0.008300504 Inf NA 0.000760306 0.008300504 9.135060656 1.590929092 0.000760306 0.008300504 7.929471534 1.107478547 0.000760306 0.008300504 -4.630903302 2.330087972 0.000760306 0.008300504 7.452219855 1.946470294 0.000754633 0.008300504 9.088463301 1.704866538 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 8.3912312 1.485318146 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 3.574293308 2.034466866 0.000760306 0.008300504 6.272206253 1.447405452 0.000754633 0.008300504 9.336379624 1.779334104 0.000760306 0.008300504 7.199550075 1.676116826 0.000760306 0.008300504 8.604061258 1.579598291 0.000760306 0.008300504 Inf NA 0.000743374 0.008300504 Inf NA 0.000754633 0.008300504 8.50602243 1.709980039 0.000760306 0.008300504 7.258991525 1.605210702 0.000760306 0.008300504 8.71272501 1.736018297 0.000760306 0.008300504 7.767265867 1.564861089 0.000754633 0.008300504 8.50602243 1.709980039 0.000760306 0.008300504 8.4085382 1.675250759 0.000760306 0.008300504 8.46176054 1.591198129 0.000760306 0.008300504 8.522500669 1.663660345 0.000760306 0.008300504 Inf NA 0.000754633 0.008300504 Inf NA 0.000760306 0.008300504 9.240747082 1.815504097 0.000760306 0.008300504 7.665893273 1.611599797 0.000704872 0.008300504 7.688618746 1.223419903 0.000760306 0.008300504 6.517999211 1.148248336 0.000760306 0.008300504 8.675689532 1.680900105 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 7.474765593 1.538292739 0.000760306 0.008300504 7.422046502 1.077344786 0.000760306 0.008300504 8.594931681 1.633606461 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 8.078828944 1.481949359 0.000760306 0.008300504 9.13182892 1.572634215 0.000760306 0.008300504 8.153955764 1.609630847 0.000754633 0.008300504 Inf NA 0.000737787 0.008300504 Inf NA 0.000754633 0.008300504 Inf NA Page 227 of 230 Diabetes

0.000760306 0.008300504 7.451205608 1.43210418 0.000760306 0.008300504 Inf NA 0.000737787 0.008300504 9.151496118 1.853889556 0.000760306 0.008300504 8.896401354 1.681713947 0.000760306 0.008300504 4.083476166 1.557383184 0.000743374 0.008300504 Inf NA 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 8.775740383 1.54127423 0.000760306 0.008300504 7.666016597 1.60843012 0.000743374 0.008300504 Inf NA 0.000485389 0.008300504 Inf NA 0.000754633 0.008300504 9.507081257 1.718809665 0.000760306 0.008300504 8.060944803 1.589021215 0.000760306 0.008300504 8.939772444 1.639398043 0.000760306 0.008300504 7.591704116 1.556491852 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 8.764939616 1.548417774 0.000760306 0.008300504 8.598387539 1.806968874 0.000760306 0.008300504 7.099504331 1.801692605 0.000748989 0.008300504 Inf NA 0.000754633 0.008300504 Inf NA 0.000743374 0.008300504 Inf NA 0.000760306 0.008300504 Inf NA 0.000743374 0.008300504 Inf NA 0.000578562 0.008300504 Inf NA 0.000760306 0.008300504 6.343731637 1.635979149 0.000760306 0.008300504 8.319747253 1.629806681 0.000760306 0.008300504 9.049229406 1.525024968 0.000760306 0.008300504 8.218193827 1.487813032 0.000760306 0.008300504 9.204124063 1.537071267 0.000760306 0.008300504 7.793791943 1.920674325 0.000743374 0.008300504 Inf NA 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 Inf NA 0.000748989 0.008300504 Inf NA 0.000743374 0.008300504 Inf NA 0.000760306 0.008300504 7.375371861 1.969033729 0.000760306 0.008300504 9.355668407 1.757558236 0.000760306 0.008300504 7.060725648 1.731378197 0.000760306 0.008300504 9.130498053 1.590768017 0.000754633 0.008300504 6.166971591 1.694217059 0.000760306 0.008300504 9.722184689 1.583260923 0.000754633 0.008300504 8.523917577 1.699075014 0.000760306 0.008300504 8.847020949 1.578953138 0.000760306 0.008300504 7.411710756 2.218254358 0.000754633 0.008300504 8.118031005 1.694669629 0.000485389 0.008300504 Inf NA 0.000760306 0.008300504 7.722686369 1.150989156 0.000754633 0.008300504 7.972550992 1.220952494 0.000760306 0.008300504 8.455821999 1.568259879 Diabetes Page 228 of 230

0.000754633 0.008300504 9.441652697 1.73904434 0.000743374 0.008300504 Inf NA 0.000748989 0.008300504 Inf NA 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 7.791831002 1.764237807 0.000760306 0.008300504 8.489663612 1.72152789 0.000760306 0.008300504 8.337233758 1.594745108 0.000760306 0.008300504 8.044555556 1.591063935 0.000760306 0.008300504 7.590713954 1.309249219 0.000578562 0.008300504 Inf NA 0.000485389 0.008300504 Inf NA 0.000760306 0.008300504 8.876338133 1.678094498 0.000760306 0.008300504 Inf NA 0.000760306 0.008300504 8.076763148 1.407877642 0.000754633 0.008300504 Inf NA 0.000485389 0.008300504 Inf NA 0.000485389 0.008300504 Inf NA 0.000485389 0.008300504 Inf NA 0.000748989 0.008300504 Inf NA 0.000760306 0.008300504 9.208486215 1.534325711 0.000754633 0.008300504 7.848101371 1.348953351 0.001078272 0.010774946 -4.689401216 2.451422833 0.001078272 0.010774946 -4.689401216 2.451422833 0.001078272 0.010774946 4.236713145 2.254883794 0.001078272 0.010774946 -3.098259973 1.219079226 0.001078272 0.010774946 -4.23701483 2.056341872 0.001078272 0.010774946 -4.370216052 2.146268392 0.001078272 0.010774946 4.121682682 2.151709874 0.001078272 0.010774946 -4.767772575 2.579993644 0.001078272 0.010774946 -4.767772575 2.579993644 0.001078272 0.010774946 4.168703037 2.075433465 0.001078272 0.010774946 -4.390189064 2.131942302 0.001078272 0.010774946 -4.374626421 2.120639976 0.001078272 0.010774946 -4.365019525 2.115649568 0.001078272 0.010774946 -4.994868149 2.810352711 0.001078272 0.010774946 4.442096325 2.332781343 0.001078272 0.010774946 4.585011585 2.349165667 0.001078272 0.010774946 4.469459948 2.385149893 0.001078272 0.010774946 -4.750576383 2.468744516 0.001078272 0.010774946 -4.369014798 2.114931435 0.001078272 0.010774946 -4.980065014 2.793546437 0.001078272 0.010774946 -4.25171352 2.048122389 0.001078272 0.010774946 -4.262354643 2.054757814 0.001078272 0.010774946 4.486828982 2.372006274 0.001078272 0.010774946 4.204405568 2.195922881 0.001078272 0.010774946 -4.907352949 2.708778886 0.001078272 0.010774946 -4.457220616 2.208525665 0.001078272 0.010774946 -4.713710518 2.476456655 0.001078272 0.010774946 -4.713801193 2.476489972 Page 229 of 230 Diabetes

0.001078272 0.010774946 4.148203421 2.154601958 0.001078272 0.010774946 -4.793929286 2.606057256 0.001078272 0.010774946 4.205137835 2.264253226 0.001078272 0.010774946 4.340756827 2.392123514 0.001078272 0.010774946 4.063893521 2.235890055 0.001078272 0.010774946 -4.551557843 2.334003251 0.001078272 0.010774946 -4.442815516 2.193924415 0.001078272 0.010774946 -4.354551969 2.138808013 0.001078272 0.010774946 4.511535416 2.390290966 0.001078272 0.010774946 -4.711549407 2.467401524 0.001078272 0.010774946 4.186179405 2.176681321 0.001078272 0.010774946 4.257488821 2.2135257 0.001078272 0.010774946 3.422045599 1.937497744 0.001078272 0.010774946 -4.715785668 2.506188183 0.001078272 0.010774946 4.14448503 2.285780786 0.001078272 0.010774946 4.619446312 2.356152421 0.001078272 0.010774946 -4.397823395 2.145185157 0.001078272 0.010774946 -4.542009984 2.276979042 0.001078272 0.010774946 -4.764448373 2.52323259 0.001312227 0.013089228 Inf NA 0.001465463 0.014384877 3.350541627 1.833641457 0.001515624 0.014746755 4.114208681 2.416876314 0.001515624 0.014746755 3.833649606 2.252209035 0.001515624 0.014746755 3.993629234 2.421071456 0.001515624 0.014746755 4.17319294 2.382271542 0.001515624 0.014746755 3.734059622 2.217126177 0.001968016 0.019114915 Inf NA 0.002111491 0.020260085 3.742351246 2.446352881 0.002111491 0.020260085 2.678842449 2.254601662 0.002111491 0.020260085 3.313246415 2.408305267 0.002111491 0.020260085 3.395841709 2.154225584 0.002111491 0.020260085 1.55887255 1.300345732 0.002111491 0.020260085 -4.445546894 2.279985794 0.002111491 0.020260085 -4.85432366 2.762535281 0.002678932 0.025660376 Inf NA 0.002915636 0.027360607 1.699502891 1.402310938 0.002915636 0.027360607 1.66989726 1.345927062 0.002915636 0.027360607 1.603078764 1.399850733 0.002915636 0.027360607 1.707412133 1.516019052 0.002915636 0.027360607 1.575631562 1.292500202 0.002915636 0.027360607 1.613725158 1.489385526 0.002915636 0.027360607 1.841331284 1.503217506 0.002915636 0.027360607 1.507794137 1.400260969 0.002915636 0.027360607 1.503319315 1.371685397 0.002915636 0.027360607 1.505219342 1.372343636 0.002915636 0.027360607 2.021477762 1.518220488 0.002915636 0.027360607 1.610394905 1.489761557 0.003946086 0.034580892 -3.998543994 2.65854441 0.003946086 0.034580892 -3.997925401 2.658284946 0.003990583 0.034580892 -3.554546202 2.370157061 Diabetes Page 230 of 230

0.003946086 0.034580892 -4.000104492 2.65920714 0.003946086 0.034580892 -3.967911682 2.686740768 0.003990583 0.034580892 -4.921546386 2.894612178 0.003990583 0.034580892 -3.546633896 2.339844405 0.003968298 0.034580892 2.53317765 1.915009856 0.003990583 0.034580892 -3.58469186 2.32967333 0.003990583 0.034580892 -3.58469186 2.32967333 0.003990583 0.034580892 -3.58469186 2.32967333 0.003990583 0.034580892 -3.890911752 2.552892022 0.003990583 0.034580892 -3.907681096 2.568321467 0.003990583 0.034580892 -4.910349049 2.870494723 0.003990583 0.034580892 -4.737115176 2.634146664 0.003990583 0.034580892 -3.586041684 2.328571818 0.003990583 0.034580892 -3.465593212 2.39916468 0.003990583 0.034580892 -3.465593212 2.39916468 0.003968298 0.034580892 -3.876624451 2.51856243 0.003990583 0.034580892 -3.469255735 2.39579247 0.003990583 0.034580892 -3.465593212 2.39916468 0.003990583 0.034580892 -3.465593212 2.39916468 0.003990583 0.034580892 -3.465593212 2.39916468 0.003990583 0.034580892 -3.465593212 2.39916468 0.003990583 0.034580892 -3.531448033 2.326559963 0.003968298 0.034580892 -3.690742319 2.487713661 0.003990583 0.034580892 -3.920584097 2.56457791 0.003990583 0.034580892 -3.919966044 2.579820844 0.003990583 0.034580892 -3.942779523 2.601630242 0.003990583 0.034580892 -3.929358235 2.588727055 0.003990583 0.034580892 -3.828184231 2.49776265 0.003990583 0.034580892 -3.581029337 2.332698825 0.003968298 0.034580892 -3.980839984 2.626508061 0.003946086 0.034580892 -3.777237939 2.442652774 0.003990583 0.034580892 -3.44600216 2.276318213 0.003946086 0.034580892 -4.000104492 2.65920714 0.003968298 0.034580892 -3.262677282 2.301210914 0.003990583 0.034580892 -3.430911966 2.075859062 0.003968298 0.034580892 -3.980839984 2.626508061 0.003946086 0.034580892 -4.000104492 2.65920714 0.003990583 0.034580892 3.304375544 2.438229093 0.003990583 0.034580892 3.304375544 2.438229093 0.003968298 0.034580892 -3.980839984 2.626508061 0.003990583 0.034580892 -3.581029337 2.332698825 0.003990583 0.034580892 -3.757645318 2.440224226 0.003946086 0.034580892 -4.000104492 2.65920714 0.003990583 0.034580892 -3.487101595 2.301950448 0.003990583 0.034580892 -3.581029337 2.332698825 0.003990583 0.034580892 -2.217930113 1.142399912 0.004478541 0.038748815 -3.58228441 2.439716374 0.00457788 0.039546608 -3.442188215 2.374684986 0.005300879 0.045721116 Inf NA 0.005413914 0.045770684 -3.11505943 2.290641137 Page 231 of 230 Diabetes

0.005413914 0.045770684 1.383684225 1.496334311 0.005413914 0.045770684 1.343347694 1.359769722 0.005413914 0.045770684 -3.295040663 2.34495391 0.005413914 0.045770684 -3.295040663 2.34495391 0.005385532 0.045770684 2.361642314 1.815688811 0.005413914 0.045770684 2.386247974 1.89075218 0.005413914 0.045770684 -3.356474623 2.405760129 0.005413914 0.045770684 2.576026172 2.093204959 0.005413914 0.045770684 2.953136644 2.292488786 0.005413914 0.045770684 -1.894497081 1.038993404 0.005413914 0.045770684 -1.899714608 1.036772772 0.005413914 0.045770684 -1.899640026 1.036652689