DOCSLIB.ORG

Involvement of Riboflavin Kinase Expression in Cellular Sensitivity Against Cisplatin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Involvement of Riboflavin Kinase Expression in Cellular Sensitivity Against Cisplatin INTERNATIONAL JOURNAL OF ONCOLOGY 38: 893-902, 2011 Involvement of riboflavin kinase expression in cellular sensitivity against cisplatin GEN HIRANO1,3, Hiroto IZUMI1, YOSHIHIRO Yasuniwa1, SHOHEI SHIMAJIRI2, WANG KE-YONG2, YASUYUKI SASAGIRI2, HitoSHi KuSaBa3, KAORI Matsumoto4, Tetsuya Hasegawa4, Masayuki Akimoto4, KOICHI AKASHI3 and Kimitoshi KOHNO1 Departments of 1Molecular Biology and 2Pathology and Cell Biology, School of Medicine, university of occupational and Environmental Health, Kitakyushu, Fukuoka 807-8555; 3Department of Internal Medicine and Department of Biosystemic Science of Medicine, Graduate School of Medicine, Kyushu university, Fukuoka, Fukuoka 812-8582; 4Faculty of Pharmaceutical Science, Josai International University, Togane, Chiba 283-8555, Japan Received October 27, 2010; Accepted December 23, 2010 DOI: 10.3892/ijo.2011.938 Abstract. Flavin adenine dinucleotide (FAD) is an essential well with Gleason score, known as a good indicator of patient coenzyme for glutathione reductase (GR) which catalyzes the prognosis. The present study suggests that RFK expression is reduction of oxidized glutathione to regenerate the reduced involved not only in cellular protection from oxidative stress form involved in protection against oxidative stress. Riboflavin but also in malignant progression of prostate cancer. kinase (RFK) also known as flavokinase is involved in the first step of bioactivation of riboflavin (RF) to form flavin Introduction mononucleotide (FMN) which can be subsequently converted to FAD in an ATP-dependent reaction catalyzed by FAD Riboflavin, vitamin 2B (RF) is a water-soluble vitamin present synthetase (FADS). We investigated the involvement of RFK in a wide variety of foods. Riboflavin kinase (RFK) also known in cisplatin resistance using human prostate cancer PC3 cells. as flavokinase (1) is required for the conversion of riboflavin RFK overexpression renders cells resistant not only to cisplatin into its active coenzyme derivatives. Riboflavin is phosphorylated but also to hydrogen peroxide (H2O2) and diamide. by RFK to generate flavin mononucleotide (FMN), which is Furthermore, knockdown of RFK expression induced apoptosis. adenylated by FAD synthetase (FADS) to generate flavin We demonstrated that overexpression of RFK increased the adenine dinucleotide (FAD). FAD is a coenzyme for glutathione levels of FAD, FMN and total glutathione and the expression reductase (GR), which mediates the regeneration of reduced of GR and glutathione S-transferase-π (GSTπ). RFK expression glutathione; L-γ-glutamyl-L-cysteinyl-glycine (GSH). Gluta- is up-regulated in cisplatin-resistant P/CDP6 cells in addition thione is the major regulator of the intracellular thiol redox to FAD, total glutathione level, GR and GSTπ. Knockdown of status and effectively scavenges free radicals and other reactive RFK expression also sensitized both PC3 and P/CDP6 cells to oxygen species (ROS). In these reactions, glutathione is cisplatin. Moreover, cellular levels of RFK expression correlate oxidized to form glutathione disulfide (GSSG), which is then reduced to glutathione by the NADPH-dependent GR. If oxidative stress or any other factors limit the GR reaction, then GSSG will accumulate. Glutathione synthesis is primarily regulated by γ-glutamylcysteine synthetase (γ-GCS). Gluta- Correspondence to: Dr Kimitoshi Kohno, Department of Molecular thione-S-transferases (GSTs) catalyze the conjugation of Biology, School of Medicine, university of occupational and glutathione with many endogenous compounds. Environmental Health, 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushu, The total glutathione level is higher in many multidrug Fukuoka 807-8555, Japan and radiation resistant tumors than in normal tissues (2,3). E-mail: [email protected] Elevated levels of γ-GCS have also been identified in different Abbreviations: 5-FU, 5-fluorouracil; cDNA, complementary DNA; human cancer tissues (2). There are seven known classes of FAD, flavin adenine dinucleotide; FADS, FAD synthetase; FMN, human GSTs. One, GSTπ, is highly expressed in many cancers flavin mononucleotide; GF, galactoflavin; GR, glutathione reductase; and appears to be involved in drug resistance (4-6). However, GSSG, glutathione disulfide; GST, glutathione S-transferase; there are very few studies on the role of RFK expression in H2O2, hydrogen peroxide; RF, riboflavin; RFK, riboflavin kinase; cancer. Cisplatin is widely used at the initial anticancer agent WST-8, water-soluble tetrazolium salt; γ-GCS, γ-glutamylcysteine because of its activity against many human solid tumors (7,8). synthetase Its anticancer effect is obtained by several mechanisms, including formation of DNA adducts and production of reactive oxygen Key words: RFK, B2-vitamers, cisplatin, oxidative stress, prostate species (9,10). Multiple mechanisms for cisplatin resistance cancer have been proposed such as reduced drug accumulation and 894 HIRANO et al: RiBoFlaviN KiNaSe and CisplatiN ReSiStance transport (11-13) and enhanced DNA repair (14,15). Another indicates the start codon and stop codon): 5'-ATGCCCCGAGCG mechanism for cisplatin resistance is the up-regulation of GACTGCATTATG-3' and 5'-TCAGTGGCCATTCATTATTT the detoxification system via glutathione biosynthesis and TGCTTTTAG-3'. This PCR product was cloned into the conjugation (1,3,16,17). In fact, once inside the cell, cisplatin pGEM-T easy vector (Promega, Madison, WI, USA). To has to be activated through aquation reactions before being construct a plasmid expressing Flag-tagged RFK, N-terminal able to interact with DNA. The formation of aquated cisplatin Flag-tagged RFK cDNA were ligated into pcDNA3 vector is rate limited by its interaction with many endogenous (Invitrogen). detoxification molecules, among which glutathione is the most important and effective (5,18). On the other hand, it is Cloning of stable transfectants. The cloning of stable transfectant unknown whether the glutathione recycling system is involved has been described (21). Briefly, PC3 cells were transfected in cisplatin resistance. with pcDNA3-Flag RFK with Superfect reagent and cultured The present studies were designed to determine whether with 500 µg/ml neomycin for 15-20 days. The resulting colonies RFK is involved in the glutathione-dependent antioxidant were isolated and the cellular expression level of Flag-RFK in system. These initial studies indicate that RFK expression is each clone was investigated by Western blot analysis with involved in the cellular sensitivity against cisplatin or oxidative anti-Flag (M2) antibody. stress and malignant progression of cancer. Western blot analysis. Whole-cell lysates were prepared as Materials and methods previously described (22,23). The indicated amounts of whole-cell lysates were separated by sodium dodecyl sulfate- Cell culture. Human epidermoid cancer HeLa cells and prostate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred cancer PC3 cells were cultured in Eagle's minimal essential to polyvinylidene difluoride (PvDF) microporous membranes medium. Human lung cancer A549 and H1299 cells, liver (Millipore, Billerica, Ma, uSa) using a semi-dry blotter. the cancer HepG2 cells and colon cancer DLD1 and CaCo-2 cells blotted membranes were treated with 5% (w/v) skimmed milk were cultured in RPMI-1640 medium. Human pancreatic in 10 mM Tris, 150 mM NaCl and 0.2% (v/v) Tween-20, and cancer MIA PaCa and Panc2 cells were cultured in Dulbecco's incubated for 1 h at room temperature with the primary antibody. modified eagle's medium. Media were purchased from Nissui The following antibodies and dilutions were used: 1:1,000 Seiyaku (Tokyo, Japan) and contained 10% fetal bovine serum. dilution of anti-RFK, 1:1,000 dilution of anti-GSTπ, 1:1,000 The cisplatin-resistant P/CDP6 cells were derived from PC3 dilution of anti-γ-GCSc, 1:1,000 dilution of anti-glutathione cells as described previously (19,20). All cell lines were reductase, 1:1,000 dilution of anti-caspase 3, 1:10,000 dilution maintained in a 5% CO2 atmosphere at 37˚C. of anti-Flag, and 1:5,000 dilution of anti-β-actin. The membranes were then incubated for 45 min at room temperature with a Antibodies and drugs. To generate the polyclonal anti-RFK peroxidase-conjugated secondary antibody and were developed antibody, the synthetic peptide CNFFQvSKSKiMNGH was using chemiluminescence (Amersham, Piscataway, NJ, USA). used as an immunogen and the antisera were obtained from The images were obtained by image analyzer (LAS-4000 mini, New Zealand white rabbits after multiple immunization. Fujifilm,t okyo, Japan). to induce cleaved caspase 3 expression, Anti-GSTπ antibody (610719) was purchased from BD PC3 cells were incubated with 1 µM vP16 for 24 h. Bioscience (San Jose, Ca, uSa). antibodies against γ-GCSc (sc-22755) and glutathione reductase (sc-32886) were purchased Knockdown analysis using siRNAs. The following double- from Santa Cruz Biotechnology (Santa Cruz, Ca, uSa). anti- stranded RNA 25-bp oligonucleotides were commercially caspase-3 (no. 9662) antibody was purchased from Cell generated (Invitrogen): 5'-AAGUAAGGCAGGUGCCUCA Signaling Technology (Danvers, MA, USA). Anti-β-actin UAAUGC-3' (sense) and 5'-GCAUUAUGAGGCACCUGCCU (AC-15) and anti-Flag (M2) (F3165) antibodies were purchased UACUU-3' (antisense); RFK siRNA #1, 5'-AAGAUUAUCUAC from Sigma (St. Louis, MO, USA). Cisplatin, paclitaxel, CACUUGCUCAGGA-3' (sense) and 5'-UCCUGAGCAAGUG 5-fluorouracil (5-Fu) and etoposide (vP16) were purchased GUAGAUAAUCUU-3' (antisense); RFK siRNA no. 2, 5'-UUC from Sigma. Adriamycin
Load more

Recommended publications
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Annotation Guidelines for Experimental Procedures
    Annotation Guidelines for Experimental Procedures Developed By Mohammed Alliheedi Robert Mercer Version 1 April 14th, 2018 1- Introduction and background information What is rhetorical move? A rhetorical move can be defined as a text fragment that conveys a distinct communicative goal, in other words, a sentence that implies an author’s specific purpose to readers. What are the types of rhetorical moves? There are several types of rhetorical moves. However, we are interested in 4 rhetorical moves that are common in the method section of a scientific article that follows the Introduction Methods Results and Discussion (IMRaD) structure. 1- Description of a method: It is concerned with a sentence(s) that describes experimental events (e.g., “Beads with bound proteins were washed six times (for 10 min under rotation at 4°C) with pulldown buffer and proteins harvested in SDS-sample buffer, separated by SDS-PAGE, and analyzed by autoradiography.” (Ester & Uetz, 2008)). 2- Appeal to authority: It is concerned with a sentence(s) that discusses the use of standard methods, protocols, and procedures. There are two types of this move: - A reference to a well-established “standard” method (e.g., the use of a method like “PCR” or “electrophoresis”). - A reference to a method that was previously described in the literature (e.g., “Protein was determined using fluorescamine assay [41].” (Larsen, Frandesn and Treiman, 2001)). 3- Source of materials: It is concerned with a sentence(s) that lists the source of biological materials that are used in the experiment (e.g., “All microalgal strains used in this study are available at the Elizabeth Aidar Microalgae Culture Collection, Department of Marine Biology, Federal Fluminense University, Brazil.” (Larsen, Frandesn and Treiman, 2001)).
    [Show full text]
  • Nicotinamide Adenine Dinucleotide Is Transported Into Mammalian
    RESEARCH ARTICLE Nicotinamide adenine dinucleotide is transported into mammalian mitochondria Antonio Davila1,2†, Ling Liu3†, Karthikeyani Chellappa1, Philip Redpath4, Eiko Nakamaru-Ogiso5, Lauren M Paolella1, Zhigang Zhang6, Marie E Migaud4,7, Joshua D Rabinowitz3, Joseph A Baur1* 1Department of Physiology, Institute for Diabetes, Obesity, and Metabolism, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 2PARC, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 3Lewis-Sigler Institute for Integrative Genomics, Department of Chemistry, Princeton University, Princeton, United States; 4School of Pharmacy, Queen’s University Belfast, Belfast, United Kingdom; 5Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 6College of Veterinary Medicine, Northeast Agricultural University, Harbin, China; 7Mitchell Cancer Institute, University of South Alabama, Mobile, United States Abstract Mitochondrial NAD levels influence fuel selection, circadian rhythms, and cell survival under stress. It has alternately been argued that NAD in mammalian mitochondria arises from import of cytosolic nicotinamide (NAM), nicotinamide mononucleotide (NMN), or NAD itself. We provide evidence that murine and human mitochondria take up intact NAD. Isolated mitochondria preparations cannot make NAD from NAM, and while NAD is synthesized from NMN, it does not localize to the mitochondrial matrix or effectively support oxidative phosphorylation. Treating cells *For correspondence: with nicotinamide riboside that is isotopically labeled on the nicotinamide and ribose moieties [email protected] results in the appearance of doubly labeled NAD within mitochondria. Analogous experiments with †These authors contributed doubly labeled nicotinic acid riboside (labeling cytosolic NAD without labeling NMN) demonstrate equally to this work that NAD(H) is the imported species.
    [Show full text]
  • Chapter 7. "Coenzymes and Vitamins" Reading Assignment
    Chapter 7. "Coenzymes and Vitamins" Reading Assignment: pp. 192-202, 207-208, 212-214 Problem Assignment: 3, 4, & 7 I. Introduction Many complex metabolic reactions cannot be carried out using only the chemical mechanisms available to the side-chains of the 20 standard amino acids. To perform these reactions, enzymes must rely on other chemical species known broadly as cofactors that bind to the active site and assist in the reaction mechanism. An enzyme lacking its cofactor is referred to as an apoenzyme whereas the enzyme with its cofactor is referred to as a holoenzyme. Cofactors are subdivided into essential ions and organic molecules known as coenzymes (Fig. 7.1). Essential ions, commonly metal ions, may participate in substrate binding or directly in the catalytic mechanism. Coenzymes typically act as group transfer agents, carrying electrons and chemical groups such as acyl groups, methyl groups, etc., depending on the coenzyme. Many of the coenzymes are derived from vitamins which are essential for metabolism, growth, and development. We will use this chapter to introduce all of the vitamins and coenzymes. In a few cases--NAD+, FAD, coenzyme A--the mechanisms of action will be covered. For the remainder of the water-soluble vitamins, discussion of function will be delayed until we encounter them in metabolism. We also will discuss the biochemistry of the fat-soluble vitamins here. II. Inorganic cation cofactors Many enzymes require metal cations for activity. Metal-activated enzymes require or are stimulated by cations such as K+, Ca2+, or Mg2+. Often the metal ion is not tightly bound and may even be carried into the active site attached to a substrate, as occurs in the case of kinases whose actual substrate is a magnesium-ATP complex.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Letters to Nature
    letters to nature Received 7 July; accepted 21 September 1998. 26. Tronrud, D. E. Conjugate-direction minimization: an improved method for the re®nement of macromolecules. Acta Crystallogr. A 48, 912±916 (1992). 1. Dalbey, R. E., Lively, M. O., Bron, S. & van Dijl, J. M. The chemistry and enzymology of the type 1 27. Wolfe, P. B., Wickner, W. & Goodman, J. M. Sequence of the leader peptidase gene of Escherichia coli signal peptidases. Protein Sci. 6, 1129±1138 (1997). and the orientation of leader peptidase in the bacterial envelope. J. Biol. Chem. 258, 12073±12080 2. Kuo, D. W. et al. Escherichia coli leader peptidase: production of an active form lacking a requirement (1983). for detergent and development of peptide substrates. Arch. Biochem. Biophys. 303, 274±280 (1993). 28. Kraulis, P.G. Molscript: a program to produce both detailed and schematic plots of protein structures. 3. Tschantz, W. R. et al. Characterization of a soluble, catalytically active form of Escherichia coli leader J. Appl. Crystallogr. 24, 946±950 (1991). peptidase: requirement of detergent or phospholipid for optimal activity. Biochemistry 34, 3935±3941 29. Nicholls, A., Sharp, K. A. & Honig, B. Protein folding and association: insights from the interfacial and (1995). the thermodynamic properties of hydrocarbons. Proteins Struct. Funct. Genet. 11, 281±296 (1991). 4. Allsop, A. E. et al.inAnti-Infectives, Recent Advances in Chemistry and Structure-Activity Relationships 30. Meritt, E. A. & Bacon, D. J. Raster3D: photorealistic molecular graphics. Methods Enzymol. 277, 505± (eds Bently, P. H. & O'Hanlon, P. J.) 61±72 (R. Soc. Chem., Cambridge, 1997).
    [Show full text]
  • Tetrahydrobiopterin Enhances Forearm Vascular Response to Acetylcholine in Both Normotensive and Hypertensive Individuals
    AJH 2002; 15:326–332 Tetrahydrobiopterin Enhances Forearm Vascular Response to Acetylcholine in Both Normotensive and Hypertensive Individuals Yukihito Higashi, Shota Sasaki, Keigo Nakagawa, Yukihiro Fukuda, Hideo Matsuura, Tetsuya Oshima, and Kazuaki Chayama Downloaded from https://academic.oup.com/ajh/article/15/4/326/217588 by guest on 29 September 2021 Background: A deficiency of tetrahydrobiopterin subjects (n ϭ 8). There was no significant difference in (BH4), an essential cofactor for nitric oxide (NO) syn- FBF response to ISDN in the two groups. During coinfu- thase, decreases NO synthesis and increases superoxide sion of BH4 (500 mg/min), the FBF response to ACh in Ϯ production. Supplementation of BH4 has been postulated hypertensive patients increased significantly (14.8 4.6 to improve endothelial function in atherosclerotic patients. to 25.6 Ϯ 7.3 mL/min/100 mL tissue, P Ͻ .05) to the level The purpose of this study was to determine whether BH4 of normal control subjects. In the control subjects, also, Ϯ restores endothelium-dependent vasodilation in patients BH4 augmented the FBF response to ACh (27.8 8.7 to with essential hypertension. 36.1 Ϯ 9.6 mL/min/100 mL tissue, P Ͻ .05). The increase Methods: We evaluated the effects of BH on forearm in FBF after ISDN was not altered by BH4 in either group 4 ϭ vascular responses to acetylcholine (ACh), an endotheli- (each group, n 6). um-dependent vasodilator, and isosorbide dinitrate Conclusion: Supplementation of BH4 augments endo- (ISDN), an endothelium-independent vasodilator, both in thelium-dependent vasodilation in both normotensive and patients with essential hypertension and in age- and sex- hypertensive individuals.
    [Show full text]
  • Product Sheet Info
    Master Clone List for NR-19279 ® Vibrio cholerae Gateway Clone Set, Recombinant in Escherichia coli, Plates 1-46 Catalog No. NR-19279 Table 1: Vibrio cholerae Gateway® Clones, Plate 1 (NR-19679) Clone ID Well ORF Locus ID Symbol Product Accession Position Length Number 174071 A02 367 VC2271 ribD riboflavin-specific deaminase NP_231902.1 174346 A03 336 VC1877 lpxK tetraacyldisaccharide 4`-kinase NP_231511.1 174354 A04 342 VC0953 holA DNA polymerase III, delta subunit NP_230600.1 174115 A05 388 VC2085 sucC succinyl-CoA synthase, beta subunit NP_231717.1 174310 A06 506 VC2400 murC UDP-N-acetylmuramate--alanine ligase NP_232030.1 174523 A07 132 VC0644 rbfA ribosome-binding factor A NP_230293.2 174632 A08 322 VC0681 ribF riboflavin kinase-FMN adenylyltransferase NP_230330.1 174930 A09 433 VC0720 phoR histidine protein kinase PhoR NP_230369.1 174953 A10 206 VC1178 conserved hypothetical protein NP_230823.1 174976 A11 213 VC2358 hypothetical protein NP_231988.1 174898 A12 369 VC0154 trmA tRNA (uracil-5-)-methyltransferase NP_229811.1 174059 B01 73 VC2098 hypothetical protein NP_231730.1 174075 B02 82 VC0561 rpsP ribosomal protein S16 NP_230212.1 174087 B03 378 VC1843 cydB-1 cytochrome d ubiquinol oxidase, subunit II NP_231477.1 174099 B04 383 VC1798 eha eha protein NP_231433.1 174294 B05 494 VC0763 GTP-binding protein NP_230412.1 174311 B06 314 VC2183 prsA ribose-phosphate pyrophosphokinase NP_231814.1 174603 B07 108 VC0675 thyA thymidylate synthase NP_230324.1 174474 B08 466 VC1297 asnS asparaginyl-tRNA synthetase NP_230942.2 174933 B09 198
    [Show full text]
  • Supplementary Material Computational Prediction of SARS
    Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE.
    [Show full text]
  • The Metabolic Building Blocks of a Minimal Cell Supplementary
    The metabolic building blocks of a minimal cell Mariana Reyes-Prieto, Rosario Gil, Mercè Llabrés, Pere Palmer and Andrés Moya Supplementary material. Table S1. List of enzymes and reactions modified from Gabaldon et. al. (2007). n.i.: non identified. E.C. Name Reaction Gil et. al. 2004 Glass et. al. 2006 number 2.7.1.69 phosphotransferase system glc + pep → g6p + pyr PTS MG041, 069, 429 5.3.1.9 glucose-6-phosphate isomerase g6p ↔ f6p PGI MG111 2.7.1.11 6-phosphofructokinase f6p + atp → fbp + adp PFK MG215 4.1.2.13 fructose-1,6-bisphosphate aldolase fbp ↔ gdp + dhp FBA MG023 5.3.1.1 triose-phosphate isomerase gdp ↔ dhp TPI MG431 glyceraldehyde-3-phosphate gdp + nad + p ↔ bpg + 1.2.1.12 GAP MG301 dehydrogenase nadh 2.7.2.3 phosphoglycerate kinase bpg + adp ↔ 3pg + atp PGK MG300 5.4.2.1 phosphoglycerate mutase 3pg ↔ 2pg GPM MG430 4.2.1.11 enolase 2pg ↔ pep ENO MG407 2.7.1.40 pyruvate kinase pep + adp → pyr + atp PYK MG216 1.1.1.27 lactate dehydrogenase pyr + nadh ↔ lac + nad LDH MG460 1.1.1.94 sn-glycerol-3-phosphate dehydrogenase dhp + nadh → g3p + nad GPS n.i. 2.3.1.15 sn-glycerol-3-phosphate acyltransferase g3p + pal → mag PLSb n.i. 2.3.1.51 1-acyl-sn-glycerol-3-phosphate mag + pal → dag PLSc MG212 acyltransferase 2.7.7.41 phosphatidate cytidyltransferase dag + ctp → cdp-dag + pp CDS MG437 cdp-dag + ser → pser + 2.7.8.8 phosphatidylserine synthase PSS n.i. cmp 4.1.1.65 phosphatidylserine decarboxylase pser → peta PSD n.i.
    [Show full text]
  • Free Radicals in Biology and Medicine Page 0
    77:222 Spring 2003 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2003) offered by the Free Radical and Radiation Biology Program B-180 Med Labs The University of Iowa Iowa City, IA 52242-1181 Spring 2003 Term Instructors: GARRY R. BUETTNER, Ph.D. LARRY W. OBERLEY, Ph.D. with guest lectures from: Drs. Freya Q . Schafer, Douglas R. Spitz, and Frederick E. Domann The Fine Print: Because this is a paper written by a beginning student as an assignment, there are no guarantees that everything is absolutely correct and accurate. In view of the possibility of human error or changes in our knowledge due to continued research, neither the author nor The University of Iowa nor any other party who has been involved in the preparation or publication of this work warrants that the information contained herein is in every respect accurate or complete, and they are not responsible for any errors or omissions or for the results obtained from the use of such information. Readers are encouraged to confirm the information contained herein with other sources. All material contained in this paper is copyright of the author, or the owner of the source that the material was taken from. This work is not intended as a threat to the ownership of said copyrights. RN Rodionov NOS III page 1 of 10 Endothelial Nitric Oxide Synthase by Roman N Rodionov 3150ML Department of Internal Medicine The University of Iowa Iowa City, IA 52242 For 77:222
    [Show full text]