DOCSLIB.ORG

Generate Metabolic Map Poster

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Generate Metabolic Map Poster Authors: Ingrid Keseler Anamika Kothari Ron Caspi Carol A Fulcher An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Markus Krummenacker Amanda Mackie Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. BsubCyc: Bacillus subtilis subtilis 168 Cellular Overview Connections between pathways are omitted for legibility. Pallavi Subhraveti β-D-GlcA- (1->4)-β- D-GlcA- (1->3)-α- D-GalNAc- (1->6)-α- L-carnitine D-methionine D-GalNAc- [(2-Glc)-Gro-P] -Gro-P-ManNAc-GlcNAc-PP-undecaprenol choline sulfate n arsenite a proteinogenic glycine glycine betaine pro glu L-methionine S-oxide PP-Und a polyisoprenyl-minor wall teichoic acid (B. subtilis 168) choline D-glucopyranose myo-inositol 2-oxoglutarate D-sorbitol pro phosphate maltose amino acid a dipeptide a maltodextrin met betaine choline D-mannitol 4-aminobutanoate N-acetyl-D- glycine pro muramate betaine/ methionine wall teichoic carnitine/ choline ABC phosphotransferase phosphate dipeptide maltodextrin TmrB YhzF FtsY YobW YdhB YufS YjgA YfjD YddI EpsL YvkA AraN YbaS NarK YndK YhaL YqhP YhjO ComEC YkoI LevR YclH YhjB YcnJ RsgI TlpC ABC YuiF YfkF YqbC PbuO YtvB ResA GtcA YvcA TuaB YczM HbuT FtsW AppF PbpB YxeB YtbD GerD YfkR YfjE YvrP acid ABC TnrA YkcC TseB YozV YobI ArsB YfhA LnrJ OpuA choline/ transporter YdbK YfiU PtsG YfkC LepA YpmS CstA YxeR YerH YybF IolT YflS YitP system (PTS) GutP NdhF GabP PutP OpuE GltP SteT YfmO YabM YvoD YdfP YvgL IolF YvjA BsrG YtrD FlhB AlsT ABC MalP YbgF Mdr FliP ABC YtwI ABC YhdT YvfR MurP YwzB GlcP YxlC YoyD YdbI LytA YosE YocA YcbM YfhP SdpB SeaA YczC FliR YttA XhlA YpbE YoaT NorM RocC YvfS YmaG TetB SpmA FadF YnxB YtjA YteU YncB PsiE 02585 YotH YwcB YciB YndF YddM YocR YwbA YvzJ CcdA YubA YtrE BsrE transporter transporter choline OpuB mannitol-specific transporter transporter transporter YycB sulfate ABC YlqH β-D-GlcA- transporter (1->4)-β- [(2-Glc)-Gro-P] -Gro-P-ManNAc-GlcNAc-PP-undecaprenol arsenite glycine D-glucopyranose 4-aminobutanoate α-maltose 6'- N-acetyl-D- n myo-inositol 2-oxoglutarate D-sorbitol a proteinogenic D-methionine a polyisoprenyl-minor wall teichoic acid (B. subtilis 168) betaine 6-phosphate D-mannitol pro pro pro glu phosphate muramate 6- D-GlcA- choline amino acid a dipeptide a maltodextrin L-methionine S-oxide (1->3)-α- 1-phosphate phosphate phosphate YvaC YvgM met D-GalNAc- L-carnitine (1->6)-α- choline sulfate D-GalNAc- glycine betaine L-alanyl-γ-D- PP-Und YhcC choline glutamyl-meso-2,6- YdeJ diaminopimeloyl- Amino Acid Degradation Cofactor, Carrier, and Vitamin Biosynthesis Detoxification D-alanine superpathway of glycolysis and the Entner-Doudoroff pathway di-trans,octa-cis a UDP-N- a glycopeptide- N-acetyl-D- a (3R)-3- a (3R)-3- β arbutin 6- (R)-S- a nucleoside a [release factor]- β L-valine degradation I a -D-galactoside 4 monochlorobimane bacillithiol carbonic acid a -lactam superpathway of menaquinol-7 biosynthesis Tetrapyrrole Biosynthesis L-leucine degradation I L-histidine degradation I superoxide -undecaprenyl acetylmuramoyl- D-mannosyl-N a purine phosphate lactoylglutathione muramate 6- hydroxyoctadecanoyl- RNA hydroxyicosanoyl- L-glutamine YwbF superpathway of tetrahydrofolate biosynthesis and salvage superpathway of tetrahydrofolate biosynthesis superpathway of coenzyme A biosynthesis I (bacteria) flavin biosynthesis I (bacteria and plants) base-degraded L-cysteine biosynthesis thiamine diphosphate salvage II NAD de novo biosynthesis folate transformations III (E.
Load more

Recommended publications
  • Joosten, Han M.L.J.; Herst, Patricia M.; Drift, Chris Van Der
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of Groningen University of Groningen Characterization of Glutamine-Requiring Mutants of Pseudomonas aeruginosa Janssen, Dick B.; Joosten, Han M.L.J.; Herst, Patricia M.; Drift, Chris van der Published in: Archives of Microbiology IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 1982 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Janssen, D. B., Joosten, H. M. L. J., Herst, P. M., & Drift, C. V. D. (1982). Characterization of Glutamine- Requiring Mutants of Pseudomonas aeruginosa. Archives of Microbiology, 131(4). Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 12-11-2019 JOURNAL OF BACTERIOLOGY, Sept. 1982, p. 1176-1183 Vol. 151, No.
    [Show full text]
  • HEAT INACTIVATION of THIAMINASE in WHOLE FISH by R
    August 1966 COMMERCIAL FISHERIES REVIEW 11 HEAT INACTIVATION OF THIAMINASE IN WHOLE FISH By R. H. Gnaedinger and R. A. Krzeczkowskil,c ABSTRACT The time required at various temperatures to inactivate all of the thiam inase in several species of whole fish was studied. Some effects of pH and enzyme concentra ­ tion on the time-temperature inactivation were also determined. Whole raw fish were ground! sealed in spec~ally-constructed m etal cans, heated a t various tempera ­ tures .for. varIOUS length.s <;>f tune! and analyzed for residual thiaminase a ct ivity. Re ­ sul~ md.lcate that a m~un .um tune -tempe.rature of 5 minutes a t 1800 F. is required t<;> mac.tlvate all the .thl~mma s e of who.le hsh. Enzyme concentrations, pH, a nd pos­ slbly 011 c ontent of flsh mfluence the tune required to destroy thiaminase. INTRODUCTION The heating conditions employed b y commercial mink-food producers and mink ranchers ;0 destroy thiaminase in whole fish are empiri cal. The conditions are not based on predeter­ nined time-temperature relations for the thermal inactivation of this antimetabolite. A com­ mon practice, for example, is to cook the fish at 1800 -2000 F. for 15 minutes (Bor gstrom 1962). Most of the specific data available on the time -temperature r e la tion is found in various research publications dealing with the occurrence of thiamina s e in fish , or with studies on the chemistry of the enzyme. Deutsch and Hasler (1943) used 15 m i nutes at 100 0 C .
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2013/0089535 A1 Yamashiro Et Al
    US 2013 0089535A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0089535 A1 Yamashiro et al. (43) Pub. Date: Apr. 11, 2013 (54) AGENT FOR REDUCING ACETALDEHYDE Publication Classification NORAL CAVITY (51) Int. Cl. (75) Inventors: Kan Yamashiro, Kakamigahara-shi (JP); A68/66 (2006.01) Takahumi Koyama, Kakamigahara-shi A638/51 (2006.01) (JP) A61O 11/00 (2006.01) A638/44 (2006.01) Assignee: AMANOENZYME INC., Nagoya-shi (52) U.S. Cl. (73) CPC. A61K 8/66 (2013.01); A61K 38/44 (2013.01); (JP) A61 K38/51 (2013.01); A61O II/00 (2013.01) (21) Appl. No.: 13/703,451 USPC .......... 424/94.4; 424/94.5; 435/191: 435/232 (22) PCT Fled: Jun. 7, 2011 (57) ABSTRACT Disclosed herein is a novel enzymatic agent effective in (86) PCT NO.: PCT/UP2011/062991 reducing acetaldehyde in the oral cavity. It has been found S371 (c)(1), that an aldehyde dehydrogenase derived from a microorgan (2), (4) Date: Dec. 11, 2012 ism belonging to the genus Saccharomyces and a threonine aldolase derived from Escherichia coli are effective in reduc (30) Foreign Application Priority Data ing low concentrations of acetaldehyde. Therefore, an agent for reducing acetaldehyde in the oral cavity is provided, Jun. 19, 2010 (JP) ................................. 2010-140O26 which contains these enzymes as active ingredients. Patent Application Publication Apr. 11, 2013 Sheet 1 of 2 US 2013/0089535 A1 FIG 1) 10.5 1 0 9.9.5 8. 5 CONTROL TA AD (BSA) ENZYME Patent Application Publication Apr. 11, 2013 Sheet 2 of 2 US 2013/0089535 A1 FIG 2) 110 the CONTROL (BSA) 100 354.
    [Show full text]
  • ATP-Citrate Lyase Has an Essential Role in Cytosolic Acetyl-Coa Production in Arabidopsis Beth Leann Fatland Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2002 ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis Beth LeAnn Fatland Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Molecular Biology Commons, and the Plant Sciences Commons Recommended Citation Fatland, Beth LeAnn, "ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis " (2002). Retrospective Theses and Dissertations. 1218. https://lib.dr.iastate.edu/rtd/1218 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis by Beth LeAnn Fatland A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Plant Physiology Program of Study Committee: Eve Syrkin Wurtele (Major Professor) James Colbert Harry Homer Basil Nikolau Martin Spalding Iowa State University Ames, Iowa 2002 UMI Number: 3158393 INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted.
    [Show full text]
  • 35 Disorders of Purine and Pyrimidine Metabolism
    35 Disorders of Purine and Pyrimidine Metabolism Georges van den Berghe, M.- Françoise Vincent, Sandrine Marie 35.1 Inborn Errors of Purine Metabolism – 435 35.1.1 Phosphoribosyl Pyrophosphate Synthetase Superactivity – 435 35.1.2 Adenylosuccinase Deficiency – 436 35.1.3 AICA-Ribosiduria – 437 35.1.4 Muscle AMP Deaminase Deficiency – 437 35.1.5 Adenosine Deaminase Deficiency – 438 35.1.6 Adenosine Deaminase Superactivity – 439 35.1.7 Purine Nucleoside Phosphorylase Deficiency – 440 35.1.8 Xanthine Oxidase Deficiency – 440 35.1.9 Hypoxanthine-Guanine Phosphoribosyltransferase Deficiency – 441 35.1.10 Adenine Phosphoribosyltransferase Deficiency – 442 35.1.11 Deoxyguanosine Kinase Deficiency – 442 35.2 Inborn Errors of Pyrimidine Metabolism – 445 35.2.1 UMP Synthase Deficiency (Hereditary Orotic Aciduria) – 445 35.2.2 Dihydropyrimidine Dehydrogenase Deficiency – 445 35.2.3 Dihydropyrimidinase Deficiency – 446 35.2.4 Ureidopropionase Deficiency – 446 35.2.5 Pyrimidine 5’-Nucleotidase Deficiency – 446 35.2.6 Cytosolic 5’-Nucleotidase Superactivity – 447 35.2.7 Thymidine Phosphorylase Deficiency – 447 35.2.8 Thymidine Kinase Deficiency – 447 References – 447 434 Chapter 35 · Disorders of Purine and Pyrimidine Metabolism Purine Metabolism Purine nucleotides are essential cellular constituents 4 The catabolic pathway starts from GMP, IMP and which intervene in energy transfer, metabolic regula- AMP, and produces uric acid, a poorly soluble tion, and synthesis of DNA and RNA. Purine metabo- compound, which tends to crystallize once its lism can be divided into three pathways: plasma concentration surpasses 6.5–7 mg/dl (0.38– 4 The biosynthetic pathway, often termed de novo, 0.47 mmol/l). starts with the formation of phosphoribosyl pyro- 4 The salvage pathway utilizes the purine bases, gua- phosphate (PRPP) and leads to the synthesis of nine, hypoxanthine and adenine, which are pro- inosine monophosphate (IMP).
    [Show full text]
  • Control Engineering Perspective on Genome-Scale Metabolic Modeling
    Control Engineering Perspective on Genome-Scale Metabolic Modeling by Andrew Louis Damiani A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama December 12, 2015 Key words: Scheffersomyces stipitis, Flux Balance Analysis, Genome-scale metabolic models, System Identification Framework, Model Validation, Phenotype Phase Plane Analysis Copyright 2015 by Andrew Damiani Approved by Jin Wang, Chair, Associate Professor of Chemical Engineering Q. Peter He, Associate Professor of Chemical Engineering, Tuskegee University Thomas W. Jeffries, Professor of Bacteriology, Emeritus; University of Wisconsin-Madison Allan E. David, Assistant Professor of Chemical Engineering Yoon Y. Lee, Professor of Chemical Engineering Abstract Fossil fuels impart major problems on the global economy and have detrimental effects to the environment, which has caused a world-wide initiative of producing renewable fuels. Lignocellulosic bioethanol for renewable energy has recently gained attention, because it can overcome the limitations that first generation biofuels impose. Nonetheless, in order to have this process commercialized, the biological conversion of pentose sugars, mainly xylose, needs to be improved. Scheffersomyces stipitis has a physiology that makes it a valuable candidate for lignocellulosic bioethanol production, and lately has provided genes for designing recombinant Saccharomyces cerevisiae. In this study, a system biology approach was taken to understand the relationship of the genotype to phenotype, whereby genome-scale metabolic models (GSMMs) are used in conjunction with constraint-based modeling. The major restriction of GSMMs is having an accurate methodology for validation and evaluation. This is due to the size and complexity of the models.
    [Show full text]
  • Posters A.Pdf
    INVESTIGATING THE COUPLING MECHANISM IN THE E. COLI MULTIDRUG TRANSPORTER, MdfA, BY FLUORESCENCE SPECTROSCOPY N. Fluman, D. Cohen-Karni, E. Bibi Department of Biological Chemistry, Weizmann Institute of Science, Rehovot, Israel In bacteria, multidrug transporters couple the energetically favored import of protons to export of chemically-dissimilar drugs (substrates) from the cell. By this function, they render bacteria resistant against multiple drugs. In this work, fluorescence spectroscopy of purified protein is used to unravel the mechanism of coupling between protons and substrates in MdfA, an E. coli multidrug transporter. Intrinsic fluorescence of MdfA revealed that binding of an MdfA substrate, tetraphenylphosphonium (TPP), induced a conformational change in this transporter. The measured affinity of MdfA-TPP was increased in basic pH, raising a possibility that TPP might bind tighter to the deprotonated state of MdfA. Similar increases in affinity of TPP also occurred (1) in the presence of the substrate chloramphenicol, or (2) when MdfA is covalently labeled by the fluorophore monobromobimane at a putative chloramphenicol interacting site. We favor a mechanism by which basic pH, chloramphenicol binding, or labeling with monobromobimane, all induce a conformational change in MdfA, which results in deprotonation of the transporter and increase in the affinity of TPP. PHENOTYPE CHARACTERIZATION OF AZOSPIRILLUM BRASILENSE Sp7 ABC TRANSPORTER (wzm) MUTANT A. Lerner1,2, S. Burdman1, Y. Okon1,2 1Department of Plant Pathology and Microbiology, Faculty of Agricultural, Food and Environmental Quality Sciences, Hebrew University of Jerusalem, Rehovot, Israel, 2The Otto Warburg Center for Agricultural Biotechnology, Faculty of Agricultural, Food and Environmental Quality Sciences, Hebrew University of Jerusalem, Rehovot, Israel Azospirillum, a free-living nitrogen fixer, belongs to the plant growth promoting rhizobacteria (PGPR), living in close association with plant roots.
    [Show full text]
  • Comparative Chloroplast Genomes of Four Lycoris Species (Amaryllidaceae) Provides New Insight Into Interspecific Relationship and Phylogeny
    biology Article Comparative Chloroplast Genomes of Four Lycoris Species (Amaryllidaceae) Provides New Insight into Interspecific Relationship and Phylogeny Fengjiao Zhang 1,2, Ning Wang 1,2, Guanghao Cheng 1,2, Xiaochun Shu 1,2, Tao Wang 1,2 , Weibing Zhuang 1,2, Ruisen Lu 1,2,* and Zhong Wang 1,2,* 1 Jiangsu Key Laboratory for the Research and Utilization of Plant Resources, Institute of Botany, Jiangsu Province and Chinese Academy of Sciences (Nanjing Botanical Garden Mem. Sun Yat-Sen), Nanjing 210014, China; [email protected] (F.Z.); [email protected] (N.W.); [email protected] (G.C.); [email protected] (X.S.); [email protected] (T.W.); [email protected] (W.Z.) 2 The Jiangsu Provincial Platform for Conservation and Utilization of Agricultural Germplasm, Institute of Botany, Jiangsu Province and Chinese Academy of Sciences (Nanjing Botanical Garden Mem. Sun Yat-Sen), Nanjing 210014, China * Correspondence: [email protected] (R.L.); [email protected] (Z.W.) Simple Summary: The genus Lycoris (Amaryllidaceae) comprises about 20 species with high orna- mental and medicinal value. However, germplasm identification is still difficult due to frequent interspecific hybridization and intraspecific morphological variation within this genus. Plastid genome sequencing has been proven to be a useful tool to identify closely related species and is widely used in the field of plant evolution and phylogeny. In the present study, we provided four Citation: Zhang, F.; Wang, N.; chloroplast genomes of Lycoris and retrieved seven published species in the genus for comparative Cheng, G.; Shu, X.; Wang, T.; Zhuang, genomics and phylogenetic analyses. All these chloroplast genomes possess the typical quadripartite W.; Lu, R.; Wang, Z.
    [Show full text]
  • Complete Chloroplast Genomes Shed Light on Phylogenetic
    www.nature.com/scientificreports OPEN Complete chloroplast genomes shed light on phylogenetic relationships, divergence time, and biogeography of Allioideae (Amaryllidaceae) Ju Namgung1,4, Hoang Dang Khoa Do1,2,4, Changkyun Kim1, Hyeok Jae Choi3 & Joo‑Hwan Kim1* Allioideae includes economically important bulb crops such as garlic, onion, leeks, and some ornamental plants in Amaryllidaceae. Here, we reported the complete chloroplast genome (cpDNA) sequences of 17 species of Allioideae, fve of Amaryllidoideae, and one of Agapanthoideae. These cpDNA sequences represent 80 protein‑coding, 30 tRNA, and four rRNA genes, and range from 151,808 to 159,998 bp in length. Loss and pseudogenization of multiple genes (i.e., rps2, infA, and rpl22) appear to have occurred multiple times during the evolution of Alloideae. Additionally, eight mutation hotspots, including rps15-ycf1, rps16-trnQ-UUG, petG-trnW-CCA , psbA upstream, rpl32- trnL-UAG , ycf1, rpl22, matK, and ndhF, were identifed in the studied Allium species. Additionally, we present the frst phylogenomic analysis among the four tribes of Allioideae based on 74 cpDNA coding regions of 21 species of Allioideae, fve species of Amaryllidoideae, one species of Agapanthoideae, and fve species representing selected members of Asparagales. Our molecular phylogenomic results strongly support the monophyly of Allioideae, which is sister to Amaryllioideae. Within Allioideae, Tulbaghieae was sister to Gilliesieae‑Leucocoryneae whereas Allieae was sister to the clade of Tulbaghieae‑ Gilliesieae‑Leucocoryneae. Molecular dating analyses revealed the crown age of Allioideae in the Eocene (40.1 mya) followed by diferentiation of Allieae in the early Miocene (21.3 mya). The split of Gilliesieae from Leucocoryneae was estimated at 16.5 mya.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Two Pectate Lyases from Caldicellulosiruptor Bescii with the Same CALG Domain Had
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.16.910000; this version posted January 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Two pectate lyases from Caldicellulosiruptor bescii with the same CALG domain had 2 distinct properties on plant biomass degradation 3 Hamed I. Hamoudaa,b,c, Nasir Alia, Hang Sua,b, Jie Fenga, Ming Lua,†and Fu-Li Li a,† 4 a Shandong Provincial Key Laboratory of Energy Genetics, Key Laboratory of Biofuel, 5 Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, 6 Qingdao 266101, China 7 b University of Chinese Academy of Sciences, Beijing 100039, China. 8 c Egyptian Petroleum Research Institute, Nasr City 11727, Cairo, Egypt. 9 †Corresponding authors: Dr. Ming Lu (E-mail: [email protected]) and Dr. Fu-Li Li 10 (E-mail: [email protected]), Qingdao Institute of Bioenergy and Bioprocess Technology, 11 Chinese Academy of Sciences, Qingdao 266101, China 12 13 Keywords: Caldicellulosiruptor, Pectin, Pectate lyase, Polysaccharide lyase, Concanavalin 14 A-like lectin/glucanase (CALG) 15 16 17 18 19 20 21 22 23 24 25 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.16.910000; this version posted January 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 26 Abstract 27 Pectin deconstruction is the initial step in breaking the recalcitrance of plant biomass by using 28 selected microorganisms that carry pectinolytic enzymes.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]