DOCSLIB.ORG

Appendix 1.Xlsx

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Appendix 1.Xlsx List of 780 probable essential proteins from host-pathogen common and pathogen’s unique pathways. No Uniprot ID Entry name Protein names Gene names Length Associated metabolic pathways 1 O82884 O82884_ECO57 Type II secretion pathway related protein (Type II secretion protein)etpE ECO57PM03 L7034 501 Bacterial secretion system* 2 O82908 O82908_ECO57 Single-stranded DNA-binding protein ssb ECO57PM49 150 DNA replication Mismatch repair Homologous recombination 3 O85343 MANB_ECO57 Phosphomannomutase (PMM) (EC 5.4.2.8) manB Z3194 ECs2835 456 Fructose and mannose metabolism Amino sugar and nucleotide sugar metabolism 4 P0A3L9 KITH_ECO57 Thymidine kinase (EC 2.7.1.21) tdk Z2015 ECs1740 205 Pyrimidine metabolism 5 P0A4D1 RS6_ECO57 30S ribosomal protein S6 rpsF Z5809 ECs5176 131 Ribosome 6 P0A6A1 UBIB_ECO57 Probable ubiquinone biosynthesis protein UbiB ubiB aarF Z5357 ECs4765 546 Ubiquinone and other terpenoid-quinone biosynthesis 7 P0A6A5 ACKA_ECO57 Acetate kinase (EC 2.7.2.1) (Acetokinase) ackA ack Z3558 ECs3180 400 Taurine and hypotaurine metabolism Pyruvate metabolism Propanoate metabolism Methane metabolism* 8 P0A6B9 ISCS_ECO57 Cysteine desulfurase (EC 2.8.1.7) iscS Z3797 ECs3396 404 Thiamine metabolism Sulfur relay system 9 P0A6D9 AROK_ECO57 Shikimate kinase 1 (SK 1) (EC 2.7.1.71) aroK Z4743 ECs4232 173 Phenylalanine, tyrosine and tryptophan biosynthesis 10 P0A6E3 AROL_ECO57 Shikimate kinase 2 (SK 2) (EC 2.7.1.71) aroL Z0484 ECs0438 174 Phenylalanine, tyrosine and tryptophan biosynthesis 11 P0A6F2 CARA_ECO57 Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) (Carbamoyl-phosphatecarA pyrA Z0037 synthetase ECs0035 glutamine chain)382 Pyrimidine metabolism Alanine, aspartate and glutamate metabolism 12 P0A6F4 GLPK_ECO57 Glycerol kinase (EC 2.7.1.30) (ATP:glycerol 3-phosphotransferase)glpK (Glycerokinase) Z5471 ECs4851 (GK) 502 Glycerolipid metabolism 13 P0A6F7 CH60_ECO57 60 kDa chaperonin (GroEL protein) (Protein Cpn60) groL groEL mopA Z5748 ECs5124 548 RNA degradation 14 P0A6I2 KCY_ECO57 Cytidylate kinase (CK) (EC 2.7.4.25) (Cytidine monophosphate kinase)cmk mssA (CMP Z1256 kinase) ECs0993 227 Pyrimidine metabolism 15 P0A6I5 COAA_ECO57 Pantothenate kinase (EC 2.7.1.33) (Pantothenic acid kinase) coaA panK rts Z5545 ECs4901 316 Pantothenate and CoA biosynthesis 16 P0A6I7 COAD_ECO57 Phosphopantetheine adenylyltransferase (EC 2.7.7.3) (Dephospho-CoAcoaD kdtBpyrophosphorylase) Z5058 ECs4509 (Pantetheine-phosphate159 Pantothenate adenylyltransferase) and CoA biosynthesis (PPAT) 17 P0A6J0 COAE_ECO57 Dephospho-CoA kinase (EC 2.7.1.24) (Dephosphocoenzyme A kinase)coaE Z0113 ECs0107 206 Pantothenate and CoA biosynthesis 18 P0A6J2 CYSC_ECO57 Adenylyl-sulfate kinase (EC 2.7.1.25) (APS kinase) (ATP adenosine-5'-phosphosulfatecysC Z4058 ECs3604 3'-phosphotransferase)201 Purine(Adenosine-5'-phosphosulfate metabolism kinase) Sulfur metabolism 19 P0A6J7 DADA_ECO57 D-amino acid dehydrogenase small subunit (EC 1.4.99.1) dadA dadR Z1952 ECs1684 432 Phenylalanine metabolism 20 P0A6J9 DDLA_ECO57 D-alanine--D-alanine ligase A (EC 6.3.2.4) (D-Ala-D-Ala ligase A)ddlA (D-alanylalanine Z0477 ECs0431 synthetase A) 364 D-Alanine metabolism* Peptidoglycan biosynthesis* 21 P0A6K2 DAPF_ECO57 Diaminopimelate epimerase (DAP epimerase) (EC 5.1.1.7) dapF Z5326 ECs4739 274 Lysine biosynthesis 22 P0A6K8 DEOB_ECO57 Phosphopentomutase (EC 5.4.2.7) (Phosphodeoxyribomutase) deoB drm thyR Z5985 ECs5342 407 Pentose phosphate pathway Purine metabolism 23 P0A6Q1 ENO_ECO57 Enolase (EC 4.2.1.11) (2-phospho-D-glycerate hydro-lyase) (2-phosphoglycerateeno Z4094 ECs3639 dehydratase) 432 Glycolysis / Gluconeogenesis RNA degradation Methane metabolism* 24 P0A6Q4 FABA_ECO57 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase (EC 4.2.1.60)fabA (Beta-hydroxydecanoyl Z1304 ECs1038 thioester dehydrase)172 Fatty acid biosynthesis 25 P0A6Q8 FABZ_ECO57 (3R)-hydroxymyristoyl-[acyl-carrier-protein] dehydratase ((3R)-hydroxymyristoylfabZ Z0192 ECs0182 ACP dehydrase) (EC 4.2.1.-)151 Fatty acid biosynthesis 26 P0A6R2 FABH_ECO57 3-oxoacyl-[acyl-carrier-protein] synthase 3 (EC 2.3.1.180) (3-oxoacyl-[acyl-carrier-protein]fabH Z1730 ECs1469 synthase III) (Beta-ketoacyl-ACP317 Fatty acid biosynthesis synthase III) (KAS III) (EcFabH) 27 P0A6S9 GPDA_ECO57 Glycerol-3-phosphate dehydrogenase [NAD(P)+] (EC 1.1.1.94) (NAD(P)H-dependentgpsA Z5035 ECs4486 glycerol-3-phosphate339 dehydrogenase)Glycerophospholipid metabolism 28 P0A6T2 G6PI_ECO57 Glucose-6-phosphate isomerase (GPI) (EC 5.3.1.9) (Phosphoglucosepgi isomerase)Z5623 ECs5008 (PGI) (Phosphohexose isomerase)549 Glycolysis (PHI) / Gluconeogenesis Pentose phosphate pathway Starch and sucrose metabolism Amino sugar and nucleotide sugar metabolism 29 P0A6T7 GCH1_ECO57 GTP cyclohydrolase 1 (EC 3.5.4.16) (GTP cyclohydrolase I) (GTP-CH-I)folE Z3409 ECs3045 222 Folate biosynthesis 30 P0A6V3 GLGC_ECO57 Glucose-1-phosphate adenylyltransferase (EC 2.7.7.27) (ADP-glucoseglgC pyrophosphorylase)Z4792 ECs4275 (ADPGlc PPase)431 (ADP-glucoseStarch and sucrose synthase) metabolism Amino sugar and nucleotide sugar metabolism 31 P0A6X2 HEM1_ECO57 Glutamyl-tRNA reductase (GluTR) (EC 1.2.1.70) hemA Z1981 ECs1715 418 Porphyrin and chlorophyll metabolism 32 P0A6X5 HFQ_ECO57 Protein hfq (HF-1) (Host factor-I protein) (HF-I) hfq Z5779 ECs5148 102 RNA degradation 33 P0A6Z0 DNAK_ECO57 Chaperone protein DnaK (HSP70) (Heat shock 70 kDa protein) (HeatdnaK shock Z0014 protein ECs0014 70) 638 RNA degradation 34 P0A719 KPRS_ECO57 Ribose-phosphate pyrophosphokinase (RPPK) (EC 2.7.6.1) (Phosphoribosylprs prsA Z1978 pyrophosphate ECs1712 synthase) (P-Rib-PP315 Pentose synthase) phosphate (PRPP pathway synthase) Purine metabolism 35 P0A727 LPXC_ECO57 UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylaselpxC (EC Z01063.5.1.-) ECs0100 (UDP-3-O-acyl-GlcNAc deacetylase)305 Lipopolysaccharide biosynthesis* 36 P0A732 MGSA_ECO57 Methylglyoxal synthase (MGS) (EC 4.2.3.3) mgsA Z1314 ECs1047 152 Pyruvate metabolism 37 P0A740 MOAC_ECO57 Molybdenum cofactor biosynthesis protein C moaC chlA3 Z1002 ECs0861 161 Folate biosynthesis Sulfur relay system 38 P0A760 NAGB_ECO57 Glucosamine-6-phosphate deaminase (EC 3.5.99.6) (GlcN6P deaminase)nagB glmD (GNPDA) Z0825 (Glucosamine-6-phosphateECs0708 266 Amino isomerase) sugar and nucleotide sugar metabolism 39 P0A764 NDK_ECO57 Nucleoside diphosphate kinase (NDK) (NDP kinase) (EC 2.7.4.6)ndk (Nucleoside-2-P Z3781 ECs3380 kinase) 143 Purine metabolism Pyrimidine metabolism 40 P0A778 RPPH_ECO57 RNA pyrophosphohydrolase (EC 3.6.1.-) ((Di)nucleoside polyphosphaterppH nudH hydrolase) Z4147 ECs3687 176 RNA degradation 41 P0A795 PDXJ_ECO57 Pyridoxine 5'-phosphate synthase (PNP synthase) (EC 2.6.99.2) pdxJ Z3845 ECs3430 243 Vitamin B6 metabolism 42 P0A797 K6PF1_ECO57 6-phosphofructokinase isozyme 1 (EC 2.7.1.11) (6-phosphofructokinasepfkA Z5460 isozyme ECs4841 I) (Phosphofructokinase320 1) (PhosphohexokinaseGlycolysis / Gluconeogenesis 1) Pentose phosphate pathway Fructose and mannose metabolism Galactose metabolism Methane metabolism* 43 P0A7A3 GPMB_ECO57 Probable phosphoglycerate mutase GpmB (EC 5.4.2.1) (PGAM) (Phosphoglyceromutase)gpmB Z5997 ECs5353 215 Glycine, serine and threonine metabolism 44 P0A7B0 IPYR_ECO57 Inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho-hydrolase)ppa Z5837 ECs5204(PPase) 176 Oxidative phosphorylation 45 P0A7B7 PROB_ECO57 Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK)proB Z0303 ECs0269 367 Arginine and proline metabolism 46 P0A7D6 PURA_ECO57 Adenylosuccinate synthetase (AMPSase) (AdSS) (EC 6.3.4.4) (IMP--aspartatepurA Z5784 ECs5153 ligase) 432 Purine metabolism Alanine, aspartate and glutamate metabolism 47 P0A7D9 PUR7_ECO57 Phosphoribosylaminoimidazole-succinocarboxamide synthase (ECpurC 6.3.2.6) Z3735 (SAICAR ECs3338 synthetase) 237 Purine metabolism 48 P0A7E2 PYRD_ECO57 Dihydroorotate dehydrogenase (quinone) (EC 1.3.5.2) (DHOdehase)pyrD (DHOD) Z1294 ECs1029(DHODase) (Dihydroorotate336 oxidase)Pyrimidine metabolism 49 P0A7E7 PYRG_ECO57 CTP synthase (EC 6.3.4.2) (CTP synthetase) (UTP--ammonia ligase)pyrG Z4095 ECs3640 545 Pyrimidine metabolism 50 P0A7F1 PYRH_ECO57 Uridylate kinase (UK) (EC 2.7.4.22) (Uridine monophosphate kinase)pyrH (UMP Z0182 kinase) ECs0173 (UMPK) 241 Pyrimidine metabolism 51 P0A7F5 PYRI_ECO57 Aspartate carbamoyltransferase regulatory chain pyrI Z5855 ECs5221 153 Pyrimidine metabolism Alanine, aspartate and glutamate metabolism 52 P0A7G8 RECA_ECO57 Protein RecA (Recombinase A) recA Z4002 ECs3556 353 Homologous recombination 53 P0A7H2 RECF_ECO57 DNA replication and repair protein RecF recF uvrF Z5191 ECs4635 357 Homologous recombination 54 P0A7I8 RIBA_ECO57 GTP cyclohydrolase-2 (EC 3.5.4.25) (GTP cyclohydrolase II) ribA Z2531 ECs1850 196 Riboflavin metabolism 55 P0A7J1 RIBB_ECO57 3,4-dihydroxy-2-butanone 4-phosphate synthase (DHBP synthase)ribB (EC htrP 4.1.99.12) Z4399 ECs3929 217 Riboflavin metabolism 56 P0A7J5 RL10_ECO57 50S ribosomal protein L10 rplJ Z5558 ECs4908 165 Ribosome 57 P0A7J9 RL11_ECO57 50S ribosomal protein L11 rplK Z5556 ECs4906 142 Ribosome 58 P0A7K4 RL7_ECO57 50S ribosomal protein L7/L12 (L8) rplL Z5559 ECs4909 121 Ribosome 59 P0A7K8 RL19_ECO57 50S ribosomal protein L19 rplS Z3900 ECs3469 115 Ribosome 60 P0A7L2 RL1_ECO57 50S ribosomal protein L1 rplA Z5557 ECs4907 234 Ribosome 61 P0A7L5 RL20_ECO57 50S ribosomal protein L20 rplT Z2745 ECs2423 118 Ribosome 62 P0A7M0 RL27_ECO57 50S ribosomal protein L27 rpmA Z4547 ECs4064 85 Ribosome 63 P0A7M4 RL28_ECO57 50S ribosomal protein L28 rpmB Z5061 ECs4512 78 Ribosome 64 P0A7M8 RL29_ECO57 50S ribosomal protein L29 rpmC
Load more

Recommended publications
  • Recruitment of Genes and Enzymes Conferring Resistance to the Nonnatural Toxin Bromoacetate
    Recruitment of genes and enzymes conferring resistance to the nonnatural toxin bromoacetate Kevin K. Desai and Brian G. Miller1 Department of Chemistry and Biochemistry, Florida State University, Tallahassee, FL 32306-4390 Edited* by Richard Wolfenden, University of North Carolina, Chapel Hill, NC, and approved August 24, 2010 (received for review May 28, 2010) Microbial niches contain toxic chemicals capable of forcing organ- tance of a naïve bacterial population can play a role in combating isms into periods of intense natural selection to afford survival. the toxicity of a nonnatural small-molecule. Revealing the reser- Elucidating the mechanisms by which microbes evade environmen- voir of intrinsic resistance genes that are subject to evolutionary tal threats has direct relevance for understanding and combating recruitment promises to aid our understanding of the processes the rise of antibiotic resistance. In this study we used a toxic small- leading to the emergence of antibiotic resistant pathogens. molecule, bromoacetate, to model the selective pressures imposed We sought to identify the full spectrum of bromoacetate resis- by antibiotics and anthropogenic toxins. We report the results tance mechanisms available to the model bacterium, Escherichia of genetic selection experiments that identify nine genes from coli. The reactivity of bromoacetate is likely to mimic that of elec- Escherichia coli whose overexpression affords survival in the trophilic natural products as well as anthropogenic environmen- presence of a normally lethal concentration of bromoacetate. Eight tal contaminants that microbes may encounter. The clinically of these genes encode putative transporters or transmembrane significant natural antibiotic fosfomycin, and the fungal natural proteins, while one encodes the essential peptidoglycan biosyn- product terreic acid, are electrophilic molecules that both target N thetic enzyme, UDP- -acetylglucosamine enolpyruvoyl transferase an essential nucleophilic cysteine residue in bacteria (8, 9).
    [Show full text]
  • De Novo Sequencing and Transcriptome Analysis Reveal Key Genes Regulating Steroid Metabolism in Leaves, Roots, Adventitious Roots and Calli of Periploca Sepium Bunge
    ORIGINAL RESEARCH published: 21 April 2017 doi: 10.3389/fpls.2017.00594 De novo Sequencing and Transcriptome Analysis Reveal Key Genes Regulating Steroid Metabolism in Leaves, Roots, Adventitious Roots and Calli of Periploca sepium Bunge Jian Zhang 1, 2, 3, Xinglin Li 1, 3*, Fuping Lu 1, 3, Shanying Wang 1, 3, Yunhe An 4, Xiaoxing Su 4, Xiankuan Li 2, Lin Ma 2 and Guangjian Han 5 1 Key Lab of Industrial Fermentation Microbiology, Tianjin University of Science and Technology, Ministry of Education, Tianjin, China, 2 School of Traditional Chinese Materia Medica, Tianjin University of Traditional Chinese Medicine, Tianjin, China, 3 College of Bioengineering, Tianjin University of Science and Technology, Tianjin, China, 4 Beijing Center for Physical and Chemical Analysis, Beijing, China, 5 Shachuan Biotechnology, Tianjin, China Edited by: Periploca sepium Bunge is a traditional medicinal plant, whose root bark is important Peng Zhang, Institute of Plant Physiology and for Chinese herbal medicine. Its major bioactive compounds are C21 steroids and Ecology, SIBS, CAS, China periplocin, a kind of cardiac glycoside, which are derived from the steroid synthesis Reviewed by: pathway. However, research on P. sepium genome or transcriptomes and their related Kun Yu, genes has been lacking for a long time. In this study we estimated this species Hubei University of Chinese Medicine, China nuclear genome size at 170 Mb (using flow cytometry). Then, RNA sequencing of Jun Yang, four different tissue samples of P. sepium (leaves, roots, adventitious roots, and Shanghai Chenshan Plant Science Research Center (CAS), China calli) was done using the sequencing platform Illumina/Solexa Hiseq 2,500.
    [Show full text]
  • Control Engineering Perspective on Genome-Scale Metabolic Modeling
    Control Engineering Perspective on Genome-Scale Metabolic Modeling by Andrew Louis Damiani A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama December 12, 2015 Key words: Scheffersomyces stipitis, Flux Balance Analysis, Genome-scale metabolic models, System Identification Framework, Model Validation, Phenotype Phase Plane Analysis Copyright 2015 by Andrew Damiani Approved by Jin Wang, Chair, Associate Professor of Chemical Engineering Q. Peter He, Associate Professor of Chemical Engineering, Tuskegee University Thomas W. Jeffries, Professor of Bacteriology, Emeritus; University of Wisconsin-Madison Allan E. David, Assistant Professor of Chemical Engineering Yoon Y. Lee, Professor of Chemical Engineering Abstract Fossil fuels impart major problems on the global economy and have detrimental effects to the environment, which has caused a world-wide initiative of producing renewable fuels. Lignocellulosic bioethanol for renewable energy has recently gained attention, because it can overcome the limitations that first generation biofuels impose. Nonetheless, in order to have this process commercialized, the biological conversion of pentose sugars, mainly xylose, needs to be improved. Scheffersomyces stipitis has a physiology that makes it a valuable candidate for lignocellulosic bioethanol production, and lately has provided genes for designing recombinant Saccharomyces cerevisiae. In this study, a system biology approach was taken to understand the relationship of the genotype to phenotype, whereby genome-scale metabolic models (GSMMs) are used in conjunction with constraint-based modeling. The major restriction of GSMMs is having an accurate methodology for validation and evaluation. This is due to the size and complexity of the models.
    [Show full text]
  • WO 2017/014762 Al 26 January 2017 (26.01.2017) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/014762 Al 26 January 2017 (26.01.2017) P O P C T (51) International Patent Classification: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12Q 1/68 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, (21) International Application Number: MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PCT/US201 5/0414 15 PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 2 1 July 20 15 (21 .07.2015) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (71) Applicant: OMNIOME, INC. [US/US]; 4225 Executive TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, Square, Suite 440, La Jolla, California 92037 (US). TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, (72) Inventors: VIJAYAN, Kandaswamy; 4465 Vision Drive, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Unit 6, San Diego, California 92121 (US).
    [Show full text]
  • | Hai Lui a Un Acutul Luniit Moonhiti
    |HAI LUI AUN ACUTULUS010006055B2 LUNIIT MOONHITI (12 ) United States Patent (10 ) Patent No. : US 10 , 006 , 055 B2 Burk et al. (45 ) Date of Patent: Jun . 26 , 2018 ( 54 ) MICROORGANISMS FOR PRODUCING 2002/ 0168654 A1 11/ 2002 Maranas et al. 2003 / 0059792 Al 3 /2003 Palsson et al . BUTADIENE AND METHODS RELATED 2003 /0087381 A1 5 / 2003 Gokarn THERETO 2003 / 0224363 Al 12 /2003 Park et al . 2003 / 0233218 Al 12 /2003 Schilling (71 ) Applicant: Genomatica , Inc. , San Diego , CA (US ) 2004 / 0009466 AL 1 /2004 Maranas et al. 2004 / 0029149 Al 2 /2004 Palsson et al. ( 72 ) Inventors : Mark J . Burk , San Diego , CA (US ) ; 2004 / 0072723 A1 4 /2004 Palsson et al. Anthony P . Burgard , Bellefonte , PA 2004 / 0152159 Al 8 / 2004 Causey et al . 2005 /0042736 A1 2 / 2005 San et al . (US ) ; Robin E . Osterhout , San Diego , 2005 / 0079482 A1 4 / 2005 Maranas et al . CA (US ) ; Jun Sun , San Diego , CA 2006 / 0046288 Al 3 / 2006 Ka - Yiu et al. ( US ) ; Priti Pharkya , San Diego , CA 2006 / 0073577 A1 4 / 2006 Ka - Yiu et al . (US ) 2007 /0184539 Al 8 / 2007 San et al . 2009 / 0047718 Al 2 / 2009 Blaschek et al . 2009 / 0047719 Al 2 / 2009 Burgard et al . (73 ) Assignee : Genomatica , Inc ., San Diego , CA (US ) 2009 /0191593 A1 7 / 2009 Burk et al . 2010 / 0003716 A1 1 / 2010 Cervin et al. ( * ) Notice : Subject to any disclaimer , the term of this 2010 /0184171 Al 7 /2010 Jantama et al. patent is extended or adjusted under 35 2010 /0304453 Al 12 / 2010 Trawick et al .
    [Show full text]
  • Structural and Biochemical Characterizations of Three Potential Drug Targets from Pathogens
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 2020 Structural and Biochemical Characterizations of Three Potential Drug Targets from Pathogens LU LU ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6214 ISBN 978-91-513-1148-7 UPPSALA urn:nbn:se:uu:diva-435815 2021 Dissertation presented at Uppsala University to be publicly examined in Room A1:111a, BMC, Husargatan 3, Uppsala, Friday, 16 April 2021 at 13:15 for the degree of Doctor of Philosophy. The examination will be conducted in English. Faculty examiner: Christian Cambillau. Abstract Lu, L. 2021. Structural and Biochemical Characterizations of Three Potential Drug Targets from Pathogens. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 2020. 91 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-513-1148-7. As antibiotic resistance of various pathogens emerged globally, the need for new effective drugs with novel modes of action became urgent. In this thesis, we focus on infectious diseases, e.g. tuberculosis, malaria, and nosocomial infections, and the corresponding causative pathogens, Mycobacterium tuberculosis, Plasmodium falciparum, and the Gram-negative ESKAPE pathogens that underlie so many healthcare-acquired diseases. Following the same- target-other-pathogen (STOP) strategy, we attempted to comprehensively explore the properties of three promising drug targets. Signal peptidase I (SPase I), existing both in Gram-negative and Gram-positive bacteria, as well as in parasites, is vital for cell viability, due to its critical role in signal peptide cleavage, thus, protein maturation, and secreted protein transport. Three factors, comprising essentiality, a unique mode of action, and easy accessibility, make it an attractive drug target.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • A Little Sugar Goes a Long Way: the Cell Biology of O-Glcnac
    Published March 30, 2015 JCB: Review A little sugar goes a long way: The cell biology of O-GlcNAc Michelle R. Bond and John A. Hanover Unlike the complex glycans decorating the cell surface, the to nucleocytoplasmic kinases and phosphatases. In fact, there are O-linked -N-acetyl glucosamine (O-GlcNAc) modifica- many parallels between phosphorylation and O-GlcNAcylation: O-GlcNAc is added to Ser and Thr residues; the modification tion is a simple intracellular Ser/Thr-linked monosaccha- rapidly cycles on and off modified proteins at a rate faster than ride that is important for disease-relevant signaling and protein turnover; and like kinases and phosphatases, OGT and enzyme regulation. O-GlcNAcylation requires uridine OGA are phosphorylated (Fig. 1 B; Butkinaree et al., 2010; diphosphate–GlcNAc, a precursor responsive to nutrient Hanover et al., 2010). Many target proteins are modified by both status and other environmental cues. Alternative splicing O-GlcNAc and phosphate at exposed regions, suggesting the of the genes encoding the O-GlcNAc cycling enzymes presence of shared or coexisting recognition motifs. However, although the sites of protein phosphorylation can often be identified Downloaded from O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) by primary sequence alone, O-GlcNAcylation is not associated yields isoforms targeted to discrete sites in the nucleus, cy- with a clear consensus motif. toplasm, and mitochondria. OGT and OGA also partner OGT uses UDP-GlcNAc, a nucleotide sugar derived from with cellular effectors and act in tandem with other post- the nutrient-dependent hexosamine biosynthetic pathway (HBP), translational modifications. The enzymes of O-GlcNAc to catalyze O-GlcNAc addition (Fig.
    [Show full text]
  • Promiscuity in the Part-Phosphorylative Entner–Doudoroff Pathway of the Archaeon Sulfolobus Solfataricus
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS 30191 FEBS Letters 579 (2005) 6865–6869 Promiscuity in the part-phosphorylative Entner–Doudoroff pathway of the archaeon Sulfolobus solfataricus Henry J. Lamblea, Alex Theodossisb, Christine C. Milburnb, Garry L. Taylorb, Steven D. Bullc, David W. Hougha, Michael J. Dansona,* a Centre for Extremophile Research, Department of Biology and Biochemistry, University of Bath, Bath BA2 7AY, UK b Centre for Biomolecular Sciences, University of St. Andrews, North Haugh, St. Andrews, Fife KY16 9ST, UK c Department of Chemistry, University of Bath, Bath BA2 7AY, UK Received 19 September 2005; revised 3 November 2005; accepted 3 November 2005 Available online 1 December 2005 Edited by Stuart Ferguson dation of both glucose and galactose, producing gluconate or Abstract The hyperthermophilic archaeon Sulfolobus solfatari- cus metabolises glucose and galactose by a ÔpromiscuousÕ non- galactonate, respectively [6]. Gluconate dehydratase then phosphorylative variant of the Entner–Doudoroff pathway, in catalyses the dehydration of gluconate to D-2-keto-3-deoxyg- which a series of enzymes have sufficient substrate promiscuity luconate (KDG) and galactonate to D-2-keto-3-deoxygalacto- to permit the metabolism of both sugars. Recently, it has been nate (KDGal) [7]. Both these compounds are cleaved by KDG proposed that the part-phosphorylative Entner–Doudoroff path- aldolase to yield pyruvate and glyceraldehyde [6]. Glyceralde- way occurs in parallel in S. solfataricus as an alternative route hyde dehydrogenase is then thought to oxidise glyceraldehyde for glucose metabolism. In this report we demonstrate, by to glycerate, which is phosphorylated by glycerate kinase to in vitro kinetic studies of D-2-keto-3-deoxygluconate (KDG) ki- give 2-phosphoglycerate.
    [Show full text]
  • <I>Lactobacillus Reuteri</I>
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in Food Science and Food Science and Technology Department Technology 2014 From prediction to function using evolutionary genomics: Human-specific ecotypes of Lactobacillus reuteri have diverse probiotic functions Jennifer K. Spinler Texas Children’s Hospital, [email protected] Amrita Sontakke Baylor College of Medicine Emily B. Hollister Baylor College of Medicine Susan F. Venable Baylor College of Medicine Phaik Lyn Oh University of Nebraska, Lincoln See next page for additional authors Follow this and additional works at: http://digitalcommons.unl.edu/foodsciefacpub Spinler, Jennifer K.; Sontakke, Amrita; Hollister, Emily B.; Venable, Susan F.; Oh, Phaik Lyn; Balderas, Miriam A.; Saulnier, Delphine M.A.; Mistretta, Toni-Ann; Devaraj, Sridevi; Walter, Jens; Versalovic, James; and Highlander, Sarah K., "From prediction to function using evolutionary genomics: Human-specific ce otypes of Lactobacillus reuteri have diverse probiotic functions" (2014). Faculty Publications in Food Science and Technology. 132. http://digitalcommons.unl.edu/foodsciefacpub/132 This Article is brought to you for free and open access by the Food Science and Technology Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications in Food Science and Technology by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Jennifer K. Spinler, Amrita Sontakke, Emily B. Hollister,
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]