Appendix 1.Xlsx
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Recruitment of Genes and Enzymes Conferring Resistance to the Nonnatural Toxin Bromoacetate
Recruitment of genes and enzymes conferring resistance to the nonnatural toxin bromoacetate Kevin K. Desai and Brian G. Miller1 Department of Chemistry and Biochemistry, Florida State University, Tallahassee, FL 32306-4390 Edited* by Richard Wolfenden, University of North Carolina, Chapel Hill, NC, and approved August 24, 2010 (received for review May 28, 2010) Microbial niches contain toxic chemicals capable of forcing organ- tance of a naïve bacterial population can play a role in combating isms into periods of intense natural selection to afford survival. the toxicity of a nonnatural small-molecule. Revealing the reser- Elucidating the mechanisms by which microbes evade environmen- voir of intrinsic resistance genes that are subject to evolutionary tal threats has direct relevance for understanding and combating recruitment promises to aid our understanding of the processes the rise of antibiotic resistance. In this study we used a toxic small- leading to the emergence of antibiotic resistant pathogens. molecule, bromoacetate, to model the selective pressures imposed We sought to identify the full spectrum of bromoacetate resis- by antibiotics and anthropogenic toxins. We report the results tance mechanisms available to the model bacterium, Escherichia of genetic selection experiments that identify nine genes from coli. The reactivity of bromoacetate is likely to mimic that of elec- Escherichia coli whose overexpression affords survival in the trophilic natural products as well as anthropogenic environmen- presence of a normally lethal concentration of bromoacetate. Eight tal contaminants that microbes may encounter. The clinically of these genes encode putative transporters or transmembrane significant natural antibiotic fosfomycin, and the fungal natural proteins, while one encodes the essential peptidoglycan biosyn- product terreic acid, are electrophilic molecules that both target N thetic enzyme, UDP- -acetylglucosamine enolpyruvoyl transferase an essential nucleophilic cysteine residue in bacteria (8, 9). -
De Novo Sequencing and Transcriptome Analysis Reveal Key Genes Regulating Steroid Metabolism in Leaves, Roots, Adventitious Roots and Calli of Periploca Sepium Bunge
ORIGINAL RESEARCH published: 21 April 2017 doi: 10.3389/fpls.2017.00594 De novo Sequencing and Transcriptome Analysis Reveal Key Genes Regulating Steroid Metabolism in Leaves, Roots, Adventitious Roots and Calli of Periploca sepium Bunge Jian Zhang 1, 2, 3, Xinglin Li 1, 3*, Fuping Lu 1, 3, Shanying Wang 1, 3, Yunhe An 4, Xiaoxing Su 4, Xiankuan Li 2, Lin Ma 2 and Guangjian Han 5 1 Key Lab of Industrial Fermentation Microbiology, Tianjin University of Science and Technology, Ministry of Education, Tianjin, China, 2 School of Traditional Chinese Materia Medica, Tianjin University of Traditional Chinese Medicine, Tianjin, China, 3 College of Bioengineering, Tianjin University of Science and Technology, Tianjin, China, 4 Beijing Center for Physical and Chemical Analysis, Beijing, China, 5 Shachuan Biotechnology, Tianjin, China Edited by: Periploca sepium Bunge is a traditional medicinal plant, whose root bark is important Peng Zhang, Institute of Plant Physiology and for Chinese herbal medicine. Its major bioactive compounds are C21 steroids and Ecology, SIBS, CAS, China periplocin, a kind of cardiac glycoside, which are derived from the steroid synthesis Reviewed by: pathway. However, research on P. sepium genome or transcriptomes and their related Kun Yu, genes has been lacking for a long time. In this study we estimated this species Hubei University of Chinese Medicine, China nuclear genome size at 170 Mb (using flow cytometry). Then, RNA sequencing of Jun Yang, four different tissue samples of P. sepium (leaves, roots, adventitious roots, and Shanghai Chenshan Plant Science Research Center (CAS), China calli) was done using the sequencing platform Illumina/Solexa Hiseq 2,500. -
Control Engineering Perspective on Genome-Scale Metabolic Modeling
Control Engineering Perspective on Genome-Scale Metabolic Modeling by Andrew Louis Damiani A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama December 12, 2015 Key words: Scheffersomyces stipitis, Flux Balance Analysis, Genome-scale metabolic models, System Identification Framework, Model Validation, Phenotype Phase Plane Analysis Copyright 2015 by Andrew Damiani Approved by Jin Wang, Chair, Associate Professor of Chemical Engineering Q. Peter He, Associate Professor of Chemical Engineering, Tuskegee University Thomas W. Jeffries, Professor of Bacteriology, Emeritus; University of Wisconsin-Madison Allan E. David, Assistant Professor of Chemical Engineering Yoon Y. Lee, Professor of Chemical Engineering Abstract Fossil fuels impart major problems on the global economy and have detrimental effects to the environment, which has caused a world-wide initiative of producing renewable fuels. Lignocellulosic bioethanol for renewable energy has recently gained attention, because it can overcome the limitations that first generation biofuels impose. Nonetheless, in order to have this process commercialized, the biological conversion of pentose sugars, mainly xylose, needs to be improved. Scheffersomyces stipitis has a physiology that makes it a valuable candidate for lignocellulosic bioethanol production, and lately has provided genes for designing recombinant Saccharomyces cerevisiae. In this study, a system biology approach was taken to understand the relationship of the genotype to phenotype, whereby genome-scale metabolic models (GSMMs) are used in conjunction with constraint-based modeling. The major restriction of GSMMs is having an accurate methodology for validation and evaluation. This is due to the size and complexity of the models. -
WO 2017/014762 Al 26 January 2017 (26.01.2017) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/014762 Al 26 January 2017 (26.01.2017) P O P C T (51) International Patent Classification: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12Q 1/68 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, (21) International Application Number: MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PCT/US201 5/0414 15 PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 2 1 July 20 15 (21 .07.2015) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (71) Applicant: OMNIOME, INC. [US/US]; 4225 Executive TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, Square, Suite 440, La Jolla, California 92037 (US). TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, (72) Inventors: VIJAYAN, Kandaswamy; 4465 Vision Drive, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Unit 6, San Diego, California 92121 (US). -
| Hai Lui a Un Acutul Luniit Moonhiti
|HAI LUI AUN ACUTULUS010006055B2 LUNIIT MOONHITI (12 ) United States Patent (10 ) Patent No. : US 10 , 006 , 055 B2 Burk et al. (45 ) Date of Patent: Jun . 26 , 2018 ( 54 ) MICROORGANISMS FOR PRODUCING 2002/ 0168654 A1 11/ 2002 Maranas et al. 2003 / 0059792 Al 3 /2003 Palsson et al . BUTADIENE AND METHODS RELATED 2003 /0087381 A1 5 / 2003 Gokarn THERETO 2003 / 0224363 Al 12 /2003 Park et al . 2003 / 0233218 Al 12 /2003 Schilling (71 ) Applicant: Genomatica , Inc. , San Diego , CA (US ) 2004 / 0009466 AL 1 /2004 Maranas et al. 2004 / 0029149 Al 2 /2004 Palsson et al. ( 72 ) Inventors : Mark J . Burk , San Diego , CA (US ) ; 2004 / 0072723 A1 4 /2004 Palsson et al. Anthony P . Burgard , Bellefonte , PA 2004 / 0152159 Al 8 / 2004 Causey et al . 2005 /0042736 A1 2 / 2005 San et al . (US ) ; Robin E . Osterhout , San Diego , 2005 / 0079482 A1 4 / 2005 Maranas et al . CA (US ) ; Jun Sun , San Diego , CA 2006 / 0046288 Al 3 / 2006 Ka - Yiu et al. ( US ) ; Priti Pharkya , San Diego , CA 2006 / 0073577 A1 4 / 2006 Ka - Yiu et al . (US ) 2007 /0184539 Al 8 / 2007 San et al . 2009 / 0047718 Al 2 / 2009 Blaschek et al . 2009 / 0047719 Al 2 / 2009 Burgard et al . (73 ) Assignee : Genomatica , Inc ., San Diego , CA (US ) 2009 /0191593 A1 7 / 2009 Burk et al . 2010 / 0003716 A1 1 / 2010 Cervin et al. ( * ) Notice : Subject to any disclaimer , the term of this 2010 /0184171 Al 7 /2010 Jantama et al. patent is extended or adjusted under 35 2010 /0304453 Al 12 / 2010 Trawick et al . -
Structural and Biochemical Characterizations of Three Potential Drug Targets from Pathogens
Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 2020 Structural and Biochemical Characterizations of Three Potential Drug Targets from Pathogens LU LU ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6214 ISBN 978-91-513-1148-7 UPPSALA urn:nbn:se:uu:diva-435815 2021 Dissertation presented at Uppsala University to be publicly examined in Room A1:111a, BMC, Husargatan 3, Uppsala, Friday, 16 April 2021 at 13:15 for the degree of Doctor of Philosophy. The examination will be conducted in English. Faculty examiner: Christian Cambillau. Abstract Lu, L. 2021. Structural and Biochemical Characterizations of Three Potential Drug Targets from Pathogens. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 2020. 91 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-513-1148-7. As antibiotic resistance of various pathogens emerged globally, the need for new effective drugs with novel modes of action became urgent. In this thesis, we focus on infectious diseases, e.g. tuberculosis, malaria, and nosocomial infections, and the corresponding causative pathogens, Mycobacterium tuberculosis, Plasmodium falciparum, and the Gram-negative ESKAPE pathogens that underlie so many healthcare-acquired diseases. Following the same- target-other-pathogen (STOP) strategy, we attempted to comprehensively explore the properties of three promising drug targets. Signal peptidase I (SPase I), existing both in Gram-negative and Gram-positive bacteria, as well as in parasites, is vital for cell viability, due to its critical role in signal peptide cleavage, thus, protein maturation, and secreted protein transport. Three factors, comprising essentiality, a unique mode of action, and easy accessibility, make it an attractive drug target. -
Supplementary Materials
Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16 -
(12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun. -
A Little Sugar Goes a Long Way: the Cell Biology of O-Glcnac
Published March 30, 2015 JCB: Review A little sugar goes a long way: The cell biology of O-GlcNAc Michelle R. Bond and John A. Hanover Unlike the complex glycans decorating the cell surface, the to nucleocytoplasmic kinases and phosphatases. In fact, there are O-linked -N-acetyl glucosamine (O-GlcNAc) modifica- many parallels between phosphorylation and O-GlcNAcylation: O-GlcNAc is added to Ser and Thr residues; the modification tion is a simple intracellular Ser/Thr-linked monosaccha- rapidly cycles on and off modified proteins at a rate faster than ride that is important for disease-relevant signaling and protein turnover; and like kinases and phosphatases, OGT and enzyme regulation. O-GlcNAcylation requires uridine OGA are phosphorylated (Fig. 1 B; Butkinaree et al., 2010; diphosphate–GlcNAc, a precursor responsive to nutrient Hanover et al., 2010). Many target proteins are modified by both status and other environmental cues. Alternative splicing O-GlcNAc and phosphate at exposed regions, suggesting the of the genes encoding the O-GlcNAc cycling enzymes presence of shared or coexisting recognition motifs. However, although the sites of protein phosphorylation can often be identified Downloaded from O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) by primary sequence alone, O-GlcNAcylation is not associated yields isoforms targeted to discrete sites in the nucleus, cy- with a clear consensus motif. toplasm, and mitochondria. OGT and OGA also partner OGT uses UDP-GlcNAc, a nucleotide sugar derived from with cellular effectors and act in tandem with other post- the nutrient-dependent hexosamine biosynthetic pathway (HBP), translational modifications. The enzymes of O-GlcNAc to catalyze O-GlcNAc addition (Fig. -
Promiscuity in the Part-Phosphorylative Entner–Doudoroff Pathway of the Archaeon Sulfolobus Solfataricus
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS 30191 FEBS Letters 579 (2005) 6865–6869 Promiscuity in the part-phosphorylative Entner–Doudoroff pathway of the archaeon Sulfolobus solfataricus Henry J. Lamblea, Alex Theodossisb, Christine C. Milburnb, Garry L. Taylorb, Steven D. Bullc, David W. Hougha, Michael J. Dansona,* a Centre for Extremophile Research, Department of Biology and Biochemistry, University of Bath, Bath BA2 7AY, UK b Centre for Biomolecular Sciences, University of St. Andrews, North Haugh, St. Andrews, Fife KY16 9ST, UK c Department of Chemistry, University of Bath, Bath BA2 7AY, UK Received 19 September 2005; revised 3 November 2005; accepted 3 November 2005 Available online 1 December 2005 Edited by Stuart Ferguson dation of both glucose and galactose, producing gluconate or Abstract The hyperthermophilic archaeon Sulfolobus solfatari- cus metabolises glucose and galactose by a ÔpromiscuousÕ non- galactonate, respectively [6]. Gluconate dehydratase then phosphorylative variant of the Entner–Doudoroff pathway, in catalyses the dehydration of gluconate to D-2-keto-3-deoxyg- which a series of enzymes have sufficient substrate promiscuity luconate (KDG) and galactonate to D-2-keto-3-deoxygalacto- to permit the metabolism of both sugars. Recently, it has been nate (KDGal) [7]. Both these compounds are cleaved by KDG proposed that the part-phosphorylative Entner–Doudoroff path- aldolase to yield pyruvate and glyceraldehyde [6]. Glyceralde- way occurs in parallel in S. solfataricus as an alternative route hyde dehydrogenase is then thought to oxidise glyceraldehyde for glucose metabolism. In this report we demonstrate, by to glycerate, which is phosphorylated by glycerate kinase to in vitro kinetic studies of D-2-keto-3-deoxygluconate (KDG) ki- give 2-phosphoglycerate. -
<I>Lactobacillus Reuteri</I>
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in Food Science and Food Science and Technology Department Technology 2014 From prediction to function using evolutionary genomics: Human-specific ecotypes of Lactobacillus reuteri have diverse probiotic functions Jennifer K. Spinler Texas Children’s Hospital, [email protected] Amrita Sontakke Baylor College of Medicine Emily B. Hollister Baylor College of Medicine Susan F. Venable Baylor College of Medicine Phaik Lyn Oh University of Nebraska, Lincoln See next page for additional authors Follow this and additional works at: http://digitalcommons.unl.edu/foodsciefacpub Spinler, Jennifer K.; Sontakke, Amrita; Hollister, Emily B.; Venable, Susan F.; Oh, Phaik Lyn; Balderas, Miriam A.; Saulnier, Delphine M.A.; Mistretta, Toni-Ann; Devaraj, Sridevi; Walter, Jens; Versalovic, James; and Highlander, Sarah K., "From prediction to function using evolutionary genomics: Human-specific ce otypes of Lactobacillus reuteri have diverse probiotic functions" (2014). Faculty Publications in Food Science and Technology. 132. http://digitalcommons.unl.edu/foodsciefacpub/132 This Article is brought to you for free and open access by the Food Science and Technology Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications in Food Science and Technology by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Jennifer K. Spinler, Amrita Sontakke, Emily B. Hollister, -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG