Nucleolar Localization of RAG1 Modulates V(D)J Recombination Activity

Nucleolar localization of RAG1 modulates V(D)J recombination activity

Ryan M. Brechta,b, Catherine C. Liub, Helen A. Beilinsonb, Alexandra Khitunc,d, Sarah A. Slavoffa,c,d, and David G. Schatza,b,1

aDepartment of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06529; bDepartment of Immunobiology, Yale School of Medicine, New Haven, CT 06511; cDepartment of Chemistry, Yale University, New Haven, CT 06520; and dChemical Biology Institute, Yale University, West Haven, CT 06516

Contributed by David G. Schatz, January 15, 2020 (sent for review December 2, 2019; reviewed by Marcus R. Clark and Michael R. Lieber) V(D)J recombination assembles and diversifies Ig and T cell receptor interactions of RAG. RAG1, the major agent of DNA binding genes in developing B and T lymphocytes. The reaction is initiated by and cleavage, is a 1,040 amino acid (aa) protein that is largely the RAG1-RAG2 protein complex which binds and cleaves at discrete insoluble and difficult to extract from the nucleus (17, 18). As gene segments in the antigen receptor loci. To identify mechanisms such, much of the biochemical and structural characterization of that regulate V(D)J recombination, we used proximity-dependent RAG1 has been done on a truncated “core” version spanning biotin identification to analyze the interactomes of full-length and residues 384 to 1,008. While core RAG1 retains catalytic activity, truncated forms of RAG1 in pre-B cells. This revealed an association of its in vivo recombination efficiency and fidelity are reduced com- RAG1 with numerous nucleolar proteins in a manner dependent on pared to full-length RAG1 (FLRAG1) and its binding to the ge- amino acids 216 to 383 and allowed identification of a motif required nome is more promiscuous (19–24). The evolutionarily conserved for nucleolar localization. Experiments in transformed pre-B cell lines 383 aa N-terminal domain (NTD) missing from core RAG1 is and cultured primary pre-B cells reveal a strong correlation between predicted to harbor multiple zinc-binding motifs including a Really disruption of nucleoli, reduced associationofRAG1withanucleolar Interesting New Gene (RING) domain (aa 287 to 351) capable of marker, and increased V(D)J recombination activity. Mutation of the – RAG1 nucleolar localization motif boosts recombination while re- ubiquitylating multiple targets, including RAG1 itself (23, 25 27). moval of the first 215 amino acids of RAG1, required for efficient Although this ubiquitylation activity has been characterized in vitro, egress from nucleoli, reduces recombination activity. Our findings its in vivo relevance to V(D)J recombination remains unclear. Also indicate that nucleolar sequestration of RAG1 is a negative regulatory contained within the NTD is a region (aa 1 to 215) that mediates mechanism in V(D)J recombination and identify regions of the RAG1 interaction with DCAF1, causing degradation of RAG1 in a CRL4- N-terminal region that control nucleolar association and egress. dependent manner (28, 29). The NTD also contributes to chromatin binding and genomic targeting of the RAG complex (20, 24). V(D)J recombination | RAG1 | nucleolus | B cell development | Despite a growing body of evidence highlighting the importance proximity-dependent biotin identification of RAG1’s NTD, our understanding of its functional contribution to V(D)J recombination is far from complete. In addition, vast diversity of molecular specificity is needed to mediate because of its low-level expression, microscopy of FLRAG1 in a Arecognition and interaction between host and pathogen in cellular context has been extremely limited, leaving many ques- the jawed vertebrate adaptive immune system. This diversity is cre- tions unanswered regarding RAG1 localization and trafficking. ated in part by combinatorial gene rearrangements carried out in developing B and T cells during the process of V(D)J recombination, Significance in which discrete V (variable), D (diversity), and J (joining) gene segments are stochastically combined to form a functional antigen Vertebrate immune systems can respond to many infections and receptor gene (1). V(D)J recombination is initiated by Recombina- insults. This ability relies on a diverse binding repertoire of an- tion Activating Gene (RAG) proteins 1 and 2 (2, 3). Together, tigen receptors. Antigen receptor diversity is created through a RAG1/2 carry out V(D)J recombination as a heterotetramer that process called V(D)J recombination in which arrayed gene seg- binds and cleaves DNA at specific recombination signal sequences ments are shuffled to form functional receptors. This process (RSSs) flanking exon segments. After cleavage, these exon seg- introduces breaks in chromosomal DNA catalyzed by the RAG1- ments are chaperoned into the nonhomologous end joining DNA RAG2 protein complex and requires strict regulation to guard repair pathway by the RAG complex (reviewed in refs. 4–6). genome integrity. Here we demonstrate a mode of RAG1 regu- While the RAG proteins enable the generation of a diverse B and lation by nucleolar sequestration. RAG1’s nucleolar localization is T cell receptor repertoire, the DNA breaks generated during dynamically regulated and is disrupted during a B cell’s transition V(D)J recombination are inherently genotoxic and can lead to to a prorecombination state, leading to increased recombination. harmful translocations and subsequent lymphocytic malignancies (7–10). In light of this, understanding the mechanisms underlying Author contributions: R.M.B., C.C.L., H.A.B., S.A.S., and D.G.S. designed research; R.M.B., C.C.L., H.A.B., and A.K. performed research; R.M.B. contributed new reagents/analytic RAG targeting and regulation are of great interest. tools; R.M.B., C.C.L., H.A.B., A.K., and S.A.S. analyzed data; and R.M.B., C.C.L., and Regulation of RAG2 at the protein level has been well char- D.G.S. wrote the paper. acterized. Spatial regulation of RAG2 away from the nuclear pe- Reviewers: M.R.C., University of Chicago; and M.R.L., University of Southern California. riphery is thought to contribute to allelic exclusion and the ordered The authors declare no competing interest. β rearrangement of the TCR loci (11), while CDK2-dependent Published under the PNAS license. degradation of RAG2 limits V(D)J recombination to the G 1 Data deposition: The mass spectrometry proteomics data have been deposited to the phase of the cell cycle (12, 13). In contrast, little is known re- publicly accessible ProteomeXchange Consortium via the PRIDE partner repository with garding the regulation and localization of the RAG1 protein, with the dataset identifier PXD016221 (DOI: 10.6019/PXD016221). most work focusing on RAG1 transcriptional regulation (14–16). 1To whom correspondence may be addressed. Email: [email protected]. Identifying proteins involved in the targeting, regulation, and This article contains supporting information online at https://www.pnas.org/lookup/suppl/ repair of RAG-mediated DNA breaks has been hindered by the doi:10.1073/pnas.1920021117/-/DCSupplemental. lack of methodologies amenable to probing the protein–protein First published February 11, 2020.

4300–4309 | PNAS | February 25, 2020 | vol. 117 | no. 8 www.pnas.org/cgi/doi/10.1073/pnas.1920021117 Downloaded by guest on October 2, 2021 Many proteins are regulated by their localization or seques- Results tration within distinct cellular compartments. The nucleolus is a Biotin Identification Identifies Multiple Nucleolar Proteins Proximal phase-separated, nonmembrane bound nuclear organelle that is to Full-Length RAG1. To identify RAG1-associated proteins, we the site of ribosome biogenesis. However, recent efforts to map used proximity-dependent biotin identification (BioID) (37), which the nucleolar proteome have revealed a plethora of proteins with makes use of a promiscuous Escherichia coli biotin ligase (BirM) roles beyond canonical nucleolar processes, including DNA re- to biotinylate lysine residues on proximal proteins. We generated pair and apoptosis (30–32). Further work has also shown the various truncations of RAG1 fused to BirM (Fig. 1A) and tested nucleolus as a dynamic hub capable of regulating protein func- these fusion proteins for biotinylation and recombination activity tion in response to specific stimuli, including DNA double-strand in HEK293T and the commonly used pre-B cell model system, breaks (DSBs) (33–35). Abelson murine leukemia virus-transformed (vAbl) cells (SI More than 20 y ago, RAG1 was reported to localize to the Appendix, Fig. S1). vAbl cells are developmentally arrested at the nucleolus when overexpressed in a nonlymphoid cell line (36). pre-B stage via expression of a constitutively active form of the We are not aware of subsequent studies to determine whether Abelson kinase. Upon addition of the Abelson kinase inhibitor this occurs at physiological levels of RAG1 expression in its STI-571, the cells exit cell cycle in the G1 phase and activate normal cellular context or whether it might have functional RAG expression and Igκ locus recombination (38). We utilized a relevance. Here, we demonstrate that RAG1 harbors a nucle- doxycycline-inducible system to express the RAG1-BioID con- olar localization signal (NoLS) motif in its NTD and that structs in stably retrovirally transduced vAbl cells, allowing us to RAG1 function is regulated by nucleolar localization. During Ig initiate V(D)J recombination and RAG1 interactome labeling (Ig) κ-gene recombination and in response to nucleolar stress, synchronously by addition of STI-571, doxycycline, and biotin. we observe that RAG1 egresses from the nucleolus and forms After 24 h of labeling, cells were lysed and biotinylated proteins small, bright puncta in a manner dependent on aa 1 to 215. were enriched, digested, and the resulting peptides analyzed by These findings delineate a repressive function for nucleolar liquid chromatography tandem mass spectrometry (LC-MS/MS). localization of RAG1 and set the stage for further work ex- We collected interactome data on four constructs in duplicate amining the role of the nucleolus in the regulation of RAG1 (39) (Fig. 1A): BirM fusion proteins of full-length murine RAG1 and V(D)J recombination. (FLRAG1), a 215- to 1,040-aa truncation omitting the region IMMUNOLOGY AND INFLAMMATION

AB1 215 384 1040 BirM 215 ZFD Core RAG1 FLRAG1 NPM1 BirM215 ZFD Core RAG1 Δ215 Enriched in Enriched in Core RAG1 Δ215 BirM Core RAG1 Core RAG1

NLS BirM 1008 Control

Rrp1b C Pdcd11

Knop1

-Log p Rrs1

Fold Enrichment

D Merge RAG1 Fibrillarin DAPI

Δ215

HEK293T

Core

Fig. 1. BioID reveals nucleolar association of RAG1. (A) Schematic of the three BioID constructs N-terminally fused to RAG1 and the control construct fused to

aNLS.(B) Volcano plot comparing enriched proteins between core RAG1 and Δ215. P value is on a −Log10 scale. Nucleolar proteins are shown as red squares. (C) Bar graph showing the number of nucleolar proteins found enriched with each RAG1 construct compared to the control. (D) Confocal images of HEK293T cells transiently transfected with mCherry fused to either Δ215 or core RAG1, imaged 24 h after transfection, showing colocalization of Δ215 with the nucleolar marker GFP-fibrillarin. Representative of three independent experiments.

Brecht et al. PNAS | February 25, 2020 | vol. 117 | no. 8 | 4301 Downloaded by guest on October 2, 2021 responsible for RAG1 degradation (Δ215), the minimal core fibrillarin. This suggests that nucleolar egress requires RAG1 aa catalytic unit required for V(D)J recombination (core RAG1), 1 to 215. Localization of core RAG1 did not change discernibly in and a control construct (BirM with an added nuclear localization response to STI-571, remaining pannuclear. dNOL exhibited less signal [NLS]) used to assess background biotinylation. Out of overlap with GFP-fibrillarin than did FLRAG1, as predicted by its 820 proteins identified in both a RAG1 sample and the control mutated NoLS. We similarly assessed RAG2 subnuclear locali- sample, 205 were significantly enriched in one or more of the zation and observed little overlap between mCherry-RAG2 and RAG1 samples compared to the control (SI Appendix, Table S1). GFP-fibrillarin and no apparent change in RAG2 localization in A further 140 proteins were identified solely by a RAG1 con- response to STI-571 (SI Appendix,Fig.S6A and B). struct (SI Appendix, Table S2). Overlap between the proteins To quantitate the colocalization of RAG1 with fibrillarin, we identified with the three BirM-RAG1 fusion proteins is depicted developed an analysis pipeline that allowed calculation of a Pear- in SI Appendix, Fig. S2A, while the high reproducibility of the son correlation coefficient between the mCherry-RAG1 and GFP- data between biological duplicates is illustrated in SI Appendix, fibrillarin fluorescent signals in large numbers of individual cells. Fig. S2B. Several proteins known to be involved in V(D)J re- This analysis indicated that FLRAG1 colocalized with fibrillarin to combination, including RAG2 and HMGB1, were enriched in a significantly greater extent under cycling, recombination-repressed RAG1-containing constructs compared to the control. conditions than after STI-571 treatment, while Δ215 strongly Upon comparing the interactomes of different forms of RAG1, colocalized with fibrillarin under both cycling and STI-571–treated we found a striking pattern of enrichment of nucleolar proteins, conditions (Fig. 2C). In contrast, core RAG1 showed low coloc- with Δ215 and FLRAG1 exhibiting a five-fold and three-fold in- alization with fibrillarin before and after STI-571 treatment. Un- crease in nucleolar partners, respectively, compared to core RAG1 der cycling conditions, dNOL exhibited a striking absence of (Fig. 1 B and C and SI Appendix,Fig.S3). Multiple nucleolar colocalization with fibrillarin, far lower than any of the other proteins were among the most highly enriched when comparing forms of RAG1, with colocalization increasing but remaining Δ215 to core RAG1 (Fig. 1B) or when comparing FLRAG1 to low upon STI-571 treatment. This increase might reflect the core RAG1 (SI Appendix, Fig. S3A). This observation suggested dNOL protein’s combination of the egress-permitting 1 to 215 that RAG1 localizes to the nucleolus, and does so in a manner domain and a disrupted NoLS. In addition to affecting the nu- dependent on amino acids 215 to 384. As an initial test of this cleolar localization of forms of RAG1 containing aa 1 to 215, STI- idea, we cotransfected HEK293T cells with expression constructs 571 triggered a significant decrease in nucleolar size and change in for mCherry-tagged Δ215 and core RAG1 as well as a GFP- nucleolar morphology, irrespective of the form of RAG1 expressed tagged nucleolar marker, fibrillarin. Tagged RAG1 colocalized (Fig. 2D). Human FLRAG1 tagged with mCherry expressed in vAbl with fibrillarin in the nucleoli in a manner dependent on amino cells also exhibited substantial colocalization with fibrillarin that was acids 215 to 384 (Fig. 1D). reduced upon STI-571 treatment (SI Appendix,Fig.S6C), suggesting that this behavior is not restricted to mouse RAG1. Together, RAG1 Harbors a NoLS in Its NTD. RAG1’s NTD has been reported these data demonstrate that FLRAG1 localizes to nucleoli in a to influence its nuclear import via interaction with KPNA1 (40), manner dependent on a basic patch from aa 243 to 249 and dis- but its contribution to subnuclear localization has not been sociates from nucleoli upon STI-571 treatment in a manner de- carefully examined. To identify sequences that could dictate pendent on aa 1 to 215. nucleolar localization, we performed an in silico analysis of the RAG1 amino acid sequence using a NoLS prediction tool (41), Disruption of Nucleolar Function via RNA Polymerase I Inhibition which identified a large basic region from aa 211 to 260 as a Leads to RAG1 Egress, Nucleolar Contraction, and Increased V(D)J potential nucleolar localization motif (SI Appendix, Fig. S4A). A Recombination. Because the transition to a prorecombination similar region was identified in the 1995 study by Spanopoulou state induced by STI-571 led to the egress of RAG1 from the et al. as contributing to nucleolar localization of RAG1 when nucleolus, we hypothesized that the nucleolus acts as an inhibitory overexpressed in nonlymphoid cells (36). Taking into account depot for RAG1 to repress V(D)J recombination. To explore this previous mutagenesis experiments done on this region (42–45) possibility, we used actinomycin D (actD) at low concentrations to and analyzing evolutionary conservation (SI Appendix, Fig. S4), inhibit RNA polymerase I (RNAP-I) and perturb nucleolar we chose to focus on a short motif spanning amino acids 243 to function (46). We performed recombination assays using the 249. Based on this, we mutated the basic residues of this motif to chromosomally integrated fluorescent V(D)J recombination re- neutral mimetics (RRDRRKR→QQDQQIQ) in the context of porter pMGInv (47) (Fig. 3A) and vAbl cells made from WT or FLRAG1 to generate the dNOL RAG1 protein. Various mCherry- core RAG1 mice, allowing comparison of proteins that do tagged murine RAG1 proteins (Fig. 2A) were inducibly expressed in (FLRAG1) or do not (core RAG1) localize to nucleoli. Strikingly, vAbl cells. Despite roughly comparable expression levels among actD triggered a significant, dose-dependent increase in recom- the mCherry-RAG1 proteins (SI Appendix,Fig.S5), those containing bination activity in WT but not core RAG1 vAbl cells (Fig. 3B). the NoLS motif (FL and Δ215) showed strong nucleolar localization, ActD did not alter levels of RAG1 expression (Fig. 3C) or cell while those lacking a NoLS (dNOL and core RAG1) showed viability (SI Appendix,Fig.S7) in either WT or core RAG1 vAbl pannuclear localization (Fig. 2 B, Left). Quantitative analysis of cells, consistent with the idea that actD enhances RAG1 activity these experiments is described below. rather than expression. As actD has been observed to alter nucleolar morphology in HeLa cells (48), we predicted that actD STI-571 Treatment of vAbl Cells Leads to RAG1 Egress from Nucleoli in treatment would affect the nucleoli of vAbl cells. Indeed, in a a Manner Dependent on aa 1 to 215. To determine the effect of manner similar to STI-571 treatment, treatment with actD of WT inducing a prorecombination state on RAG1 localization, we vAbl cells expressing mCherry-FLRAG1 and GFP-fibrillarin led treated the mCherry construct-containing vAbl cells with STI-571 to contraction of nucleoli, RAG1 puncta formation, and a visible and doxycycline and assessed localization of mCherry-RAG1 rel- decrease in RAG1-fibrillarin colocalization (Fig. 4A). Quantifi- ative to GFP-fibrillarin. When induced with STI-571, we observed cation of these microscopy data confirmed significantly decreased that FLRAG1 egressed from nucleoli and formed small, bright RAG1-nucleolar colocalization and nucleolar size in actD-treated puncta (Fig. 2 B, Right). Puncta were observed with FLRAG1 and vAbl cells (Fig. 4 B and C). Because RAG2 is largely absent in dNOL but not Δ215 or core RAG1, arguing that their formation cycling vAbl cells, this phenomenon is likely to be RAG2 inde- in response to STI-571 depends on aa 1 to 215. Unlike FLR1, pendent. These data demonstrate that a disruption of nucleolar Δ215 showed little discernible change in nucleolar association in homeostasis can lead to decreased RAG1 localization to nucleoli response to STI-571, remaining strongly colocalized with GFP- and increased recombination activity.

4302 | www.pnas.org/cgi/doi/10.1073/pnas.1920021117 Brecht et al. Downloaded by guest on October 2, 2021 A NoLS FLR1 mCherry 215 Core RAG1

Δ215 mCherry215 Core RAG1

cR1 mCherry Core RAG1

dNOL mCherry 215 Core RAG1

Merge Merge B RAG1 Fibrillarin RAG1 Fibrillarin FLR1

Δ215

cR1 IMMUNOLOGY AND INFLAMMATION

dNOL

STI- STI+ CD

Fig. 2. Nucleolar localization of RAG1 is dynamic and dependent on the recombination state of the cell. (A) Schematic of RAG1 fusion proteins used for analysis. (B) Confocal images from vAbl cells constitutively expressing GFP-fused fibrillarin and doxycycline-inducible mCherry-fused RAG1. Cells were treated with doxycycline to induce RAG1 expression for 16 h and, when stated, treated with 5 μM STI-571 for 4 h prior to being mounted and fixed. Representative of three independent experiments. (C) Colocalization analysis between RAG1 and fibrillarin (Fbl) before and after STI-571 treatment. Pearson correlation was calculated from individual cells and plotted with whiskers at 10th to 90th percentile. Statistical significance was determined by ANOVA. ****P < 0.0001; NS, not significant. (D) Quantitation of nucleolar size by pixel area before and after STI-571 treatment. Individual nucleoli plotted with whiskers at 10th to 90th percentile. Statistical significance was determined by ANOVA. ****P < 0.0001.

Nucleolar Sequestration of RAG1 Corresponds to Reduced V(D)J The cells were then transduced with vectors constitutively express- Recombination. The hypothesis that RAG1 sequestration in the ing FLRAG1, core RAG1, Δ215, or dNOL to compare their ability nucleolus suppresses V(D)J recombination leads to the prediction to catalyze recombination in cycling cells using a common clonal that the Δ215 protein, which is trapped in the nucleolus, should be progenitor cell line. In agreement with our hypothesis, Δ215 less active than FLRAG1, while the opposite should be true of the supported the lowest level of recombination (Fig. 5A)despite dNOL protein, which is excluded from the nucleolus. To test this, being highly expressed (Fig. 5B), reflecting its strong nucleolar − − RAG1 / vAbl cells were infected with the pMGInv recombination sequestration and inability to egress. Conversely, dNOL supported substrate along with a vector driving constitutive RAG2 expression. the highest efficiency of recombination, consistent with its diminished

Brecht et al. PNAS | February 25, 2020 | vol. 117 | no. 8 | 4303 Downloaded by guest on October 2, 2021 A or a recombination event that results in Jκ2 deletion from the cell, C prevents PCR amplification. The lack of strong stimulation in the

Trxn absence of IL7 suggested the possibility that IL7 removal is suf- GFP RAG1 ficient to release nucleolar inhibition of RAG1, thereby rendering Core RAG1 actD treatment largely redundant in IL7-negative conditions. Consistent with this, removal of IL7 reduced nucleolar volume RAG1 STI571 βActin nearly to the same extent as addition of actD (Fig. 6D). In RAG2 CJ SJ STI571: --++++ agreement with our findings with vAbl cells, primary pre-B cells ActD: ----++ from core RAG1 mice showed no increase in recombination when GFP treated with actD whether in the presence or absence of IL7 (Fig. 6 B, Right). Notably, levels of RAG1 protein expression were not B affected by IL7 withdrawal or by actD treatment (SI Appendix,Fig. S8), indicating that under our culture conditions, increased RAG1 protein does not explain the enhancement of recombination caused by withdrawal of IL7 or addition of actD, and suggesting that regulated release of RAG1 from a repressive nucleolar com- partment can activate V(D)J recombination in primary pre-B cells. Discussion A 1995 study detected RAG1 in the nucleolus when overexpressed in a nonlymphoid cell line (36), but to our knowledge this observation has not been elaborated upon, nor has a functional or regulatory role been demonstrated for RAG1 nucleolar localization until now. Using BioID in a pre-B cell line, we find that RAG1 resides in proximity to numerous nucleolar proteins in a manner strongly facilitated by RAG1 aa 216 to 384. Nu- cleolar localization of RAG1 was supported by fluorescence mi- Fig. 3. Recombination efficiency is regulated by nucleolar localization of croscopy in both HEK293T and vAbl cells using mCherry-RAG1 RAG1. (A) Schematic of pMGInv inversional GFP reporter. Black and white fusion proteins. It is unlikely that the mCherry fusion partner is triangles represent 23RSS and 12RSS, respectively. (B) Recombination efficiency responsible for nucleolar localization, given the weak or negligible assay using pMGInv reporter in WT and core RAG1 vAbl cells. Cells were induced nucleolar localization seen with the mCherry-core RAG1 or for 48 h with 5 μM STI-571 with varying amounts of actD and analyzed via flow + mCherry-dNOL proteins and given that a different fusion partner cytometry for GFP cells. Statistical significance was determined by ANOVA. ****P < 0.0001; NS, not significant. (C) Western blot of RAG1 from vAbl cells treated with 5 μM STI-571 and/or 2 nM actD for 48 h. ActD does not influence RAG1 expression levels. Representative of two independent experiments. A Merge RAG1 Fibrillarin

nucleolar sequestration as compared to FLRAG1. Core RAG1 showed a diminished level of recombination compared to FLRAG1, as expected given its previously reported recombi- WT vAbl ActD - nation inefficiency in the context of extrachromosomal sub- strates and endogenous antigen receptor loci (22, 42, 45). We speculate that the recombination defect associated with the absence of all noncore regions in core RAG1 masks the boost in WT vAbl recombination expected from the lack of nucleolar localization for ActD + this protein.

Nucleolar Disruption Stimulates V(D)J Recombination in Ex Vivo Pre-B Cell Cultures. To determine whether RAG1 nucleolar sequestra- BBCC tion also suppresses V(D)J recombination in nontransformed lymphocytes, we tested the effect of nucleolar disruption in ex vivo primary pre-B cell cultures. Bone marrow was harvested from WT or core RAG1 mice and cultured for 1 wk in the presence of IL7, which expands a population of large, cycling pre-B cells in which recombination is repressed (49). Cells were then infected with the pMGInv reporter, split into IL7-positive and -negative cultures containing varying concentrations of actD, and analyzed by flow cytometry for recombination-mediated GFP expression (Fig. 6A). Removal of IL7 promotes transition to a prorecombination, small pre-B cell state in which cells un- Fig. 4. Nucleolar morphology is affected by actD treatment. (A)Confocal dergo recombination of the Igκ locus. ActD treatment of WT pre- images from vAbl cells constitutively expressing GFP-fused fibrillarin and B cells increased recombination of the reporter in a dose- doxycycline-inducible mCherry-fused RAG1. Cells were treated with doxycy- dependent manner in recombinationally repressed IL7-positive cline to induce RAG1 expression for 16 h and with 2 nM actD for 4 h prior to being mounted and fixed. Representative of three independent experiments. cultures but not in prorecombination IL7-negative cultures (Fig. κ (B) Colocalization analysis between RAG1 and fibrillarin (Fbl) before and after 6 B, Left). Similar results were obtained when cleavage of the Ig actD treatment. (C) Quantitation of nucleolar size by pixel area before and locus was assayed with droplet digital PCR (ddPCR) using primers after actD treatment. Individual nucleoli plotted with whiskers at 10th to 90th spanning Jκ2 anditsflankingRSS(Fig.6C), where cleavage at Jκ2, percentile. Statistical significance was determined by ANOVA. ****P < 0.0001.

4304 | www.pnas.org/cgi/doi/10.1073/pnas.1920021117 Brecht et al. Downloaded by guest on October 2, 2021 A potential NoLS (41). While the aa 243 to 249 motif is necessary for efficient nucleolar localization in our experiments, it might not be sufficient, with flanking basic residues potentially also contributing. Our data are consistent with the idea that the nucleolar localization of RAG1 is dictated by a mechanism similar to that of other nucleolar proteins, such as ARF or VHL, being largely driven by charge-based interactions with RNA (50). However, for many nucleolar proteins, including RAG1, a static protein-RNA interaction is not sufficient to explain the dynamic regulation of subnuclear localization seen in response to specific stimuli. Previous work has shown that transcription of specific noncoding RNAs from the intergenic region of the rDNA loci can explain stimulus-dependent nucleolar sequestration or release of target proteins (34). Because inhibition of RNAP-I by actD treatment leads to RAG1 egress from nucleoli, this is an attractive potential mechanism for RAG1 regulation, though it remains speculative. Our findings suggest that nucleolar localization and egress of RAG1 are dictated by nonoverlapping portions of the RAG1 NTD and have the potential to be regulated processes. While nucleolar localization is dictated by aa 216 to 384, likely localized l around aa 243 to 249, efficient nucleolar egress requires RAG1 aa

5 1 to 215. This region contains several conserved clusters of cysteine B and histidine residues (45) and coordinates two zinc atoms (51), 21 STI FLRAG1 cRAG1 Δ dNOL WT vAbl WT vAbl+ STI but has not been characterized structurally. The only well-defined function for aa 1 to 215 is interaction with DCAF1 (also known as VprBP) (28), which limits RAG1 protein levels and restrains V(D) J recombination activity by mediating RAG1 degradation in an RAG1 E3-ligase/proteasome-dependent manner (29). Hence, our data IMMUNOLOGY AND INFLAMMATION suggest that the aa 1 to 215 region of RAG1 serves as both a positive (nuclear egress) and negative (RAG1 degradation) regu- lator of V(D)J recombination. Whether these two functions are in any way related or make use of overlapping RAG1 residues re- βActin mains to be determined. Our finding of a positive regulatory function for aa 1 to 215 provides a potential explanation for the previous finding that deletions or point mutations in this region Fig. 5. Functional comparison of RAG1 truncations reveals distinct roles for can strongly compromise V(D)J recombination activity (45). different parts of the RAG1 NTD. (A) Recombination efficiency from a clonal − − + + Multiple lines of evidence presented here support the hypoth- RAG1 / RAG2 / vAbl cell line transduced with different forms of RAG1. At 72 + h postinfection, cells were analyzed via flow cytometry for GFP cells. Statis- esis that nucleolar sequestration of RAG1 represses V(D)J re- tical significance was determined by ANOVA. ****P < 0.0001. (B) Western blot combination: 1) treatments that disrupt nucleolar integrity (e.g., showing expression levels of RAG1 from infected RAG1-complementation actD) and reduce colocalization of RAG1 with fibrillarin result in lines. WT vAbl cells uninduced and induced with STI-571 shown as control. enhanced V(D)J recombination by FLRAG1 but not by core Representative of three independent experiments. RAG1 (which does not localize strongly to nucleoli); this is true in both vAbl cells and cultured primary pre-B cells, and in the latter wasdemonstratedwithbothanintegratedrecombinationreporter was used in the BioID analysis. We cannot exclude the possi- and at the Igκ locus; 2) activation of recombination in vAbl cells bility that overexpression of the BirM- and mCherry-RAG1 with STI-571 triggers disruption of nucleoli and reduces RAG1- fusion proteins contributes to the observed nucleolar localiza- fibrillarin colocalization; 3) withdrawal of IL7 from cultures of tion. It is clear, however, that mere overexpression of a RAG1 primary pre-B cells disrupts nucleoli and creates a prorecombination protein is not sufficient for nucleolar localization, as BirM- state that cannot be further stimulated by addition of actD; and 4) core-RAG1 and mCherry-dNOL are expressed at higher lev- deletion of the region of RAG1 that controls nuclear egress els than their FLRAG1 counterparts (SI Appendix,Figs.S1A (Δ215) reduces V(D)J recombination activity while the opposite and S5). Hence, a specific feature(s) of RAG1 contributes to is observed when NoLS function is disrupted (dNOL). Hence, we nucleolar localization. Furthermore, the functional analyses propose that RAG1 function is regulated through both its entry reported here, whose results correspond well with predictions into and exit from the nucleolus. stemming from the localization experiments, were performed in ActD is a nonspecific transcriptional inhibitor that could large part with endogenous, untagged RAG1 protein expressed at perturb multiple parameters of cell function. However, the actD levels characteristic of vAbl or primary cultured pre-B cells. We concentrations used in our experiments, which are sufficient to have not been able to detect endogenous RAG1 protein re- disrupt nucleoli, dissociate RAG1 from fibrillarin, and stimulate liably above background by immunofluorescence microscopy, V(D)J recombination, are about 1,000-fold lower than required and confirmation of nucleolar localization of endogenous RAG1 for inhibition of RNAP-II (46) and have no discernible effect on might require a more sensitive approach such as superresolution cell viability (SI Appendix, Fig. S7). This suggests that the ability microscopy. of actD to stimulate V(D)J recombination is likely mediated by Consistent with our BioID data and the prior 1995 study (36), its effects on nucleoli and RAG1. colocalization of murine RAG1 with the nucleolar protein In addition to RAG1 nucleolar egress, STI-571 treatment of fibrillarin in pre-B cells is dependent on RAG1 aa 243 to 249. vAbl cells leads to the formation of RAG1 puncta in a manner This strongly basic motif is embedded in a larger basic region dependent on the first 215 aa of RAG1. The physiological rel- from aa 211 to 260 that we identified computationally as a evance of these puncta is unclear. We cannot rule out that

Brecht et al. PNAS | February 25, 2020 | vol. 117 | no. 8 | 4305 Downloaded by guest on October 2, 2021 Fig. 6. Recombination efficiency in primary pre-B cells is altered by actinomycin D. (A) Schematic showing culture conditions during assay. (B) pMGInv re- + combination assay of homogenized pre-B cells from WT and core RAG1 mice. Cells were analyzed for GFP cells after 48 h with/without IL7 in various concentration of actD. Representative of two independent experiments. Statistical significance was determined by ANOVA. **P < 0.01; ***P < 0.001; ****P < 0.0001; NS, not significant. (C) ddPCR assay for intact Jκ2, as assessed by the decrease in PCR amplification resulting from Igκ cleavage and recombination. The signal for intact Jκ2 alleles was measured, normalized to an amplicon from the gene RPP30, and then subtracted from 2 to yield the apparent level of Jκ2 + cleavage. Genomic DNAs from kidney and B220 splenocytes were used as no cleavage and high cleavage controls, respectively. For IL7 culture data, each data point represents the mean of either two or eight technical replicates performed for two independent samples. For spleen and kidney, each data point represents the mean of four technical replicates for two independent samples. Statistical significance was determined by ANOVA. **P < 0.01; ****P < 0.0001. (D) Quantitation of nucleolar size by pixel area in pre-B cells untreated and treated with IL7 and/or 2 nM actD for 48 h. Individual nucleoli plotted with whiskers at 10th to 90th percentile. Statistical significance was determined by ANOVA. ****P < 0.0001.

puncta formation is a consequence of overexpression of forms of between V(D)J recombination and nucleolar homeostasis might RAG1 that contain aa 1 to 215, though it is clear that puncta do provide clues as to how RAG1 localization is regulated and not arise through overexpression of RAG1 proteins in general, as whether its presence in the nucleolus has a broader influence on they are not seen without STI-571 or actD treatment or with core other nucleolar processes. RAG1 and Δ215, the most highly expressed RAG1 proteins. It V(D)J recombination is tightly regulated during B and T cell remains to be determined whether these puncta represent phase- development. This requires precise activation of RAG when separated bodies and if their formation relates to the functions of appropriate (in G /G phase of the cell cycle) and rapid cessation the aa 1 to 215 region in nucleolar egress or RAG1 degradation 0 1 upon generation of DSBs by RAG. Following the resolution of a through interaction with DCAF1. We do not understand the signaling pathways that lead STI- RAG-mediated break, RAG activity often needs to be reinitiated 571–treated vAbl cells and IL7-depleted primary pre-B cells to to salvage a nonproductive rearrangement event or a developing undergo nucleolar contraction similar to that seen with actD lymphocyte expressing an autoreactive or useless antigen re- treatment. It will now be important to determine whether this ceptor (52–54). Release of RAG1 from nucleolar stores could phenomenon is recapitulated in recombinationally active B and provide a rapid mechanism for up-regulation of recombination T lineage cells in the bone marrow and thymus. Identifying links activity in these circumstances.

4306 | www.pnas.org/cgi/doi/10.1073/pnas.1920021117 Brecht et al. Downloaded by guest on October 2, 2021 While mechanisms have been described that contribute to the were lysed and enriched on streptavidin beads (Pierce Streptavidin Magnetic control of RAG activity during DSB generation and repair, they Beads, Thermo) as described by Hung et al. (58). After washing, the beads have largely focused on transcriptional regulation. For example, were subjected to an on-bead trypsin digest as described by Turriziani et al. ATM kinase activity has been shown to be important for sup- (59). Trypsinized peptides were desalted before being run on an Orbitrap- κ Elite LC-MS/MS to generate interactome datasets corresponding to each of pressing additional Ig rearrangements following a RAG-mediated the BirM-RAG1 constructs and the NLS-BirM control. Biological replicates DNA DSB (55). This has been linked to ATM-dependent down- were performed for a total of eight samples. Analysis of the LC-MS/MS data regulation of RAG transcription; however, the kinetics of this re- were performed using the MaxQuant/Perseus software packages (60, 61). pression are relatively slow with roughly 50% of RAG1 protein still MS/MS spectra were searched using the Andromeda algorithm against the present 1 h postbreak (15). Sequestration of RAG1 in the nucleolus Mus musculus proteome (UP000000589). Search parameters were for a could act in concert with transcriptional repression to quench re- trypsin digest with a maximum of two missed cleavages and a fixed carba- combination quickly following a DNA DSB, thereby helping to midomethyl modification. Methionine oxidation, lysine biotinylation, and N- protect genome integrity and enforce allelic exclusion. It will be terminal acylation were included as variable modifications. First search important to test this idea in mice expressing mutant RAG1 pro- peptide tolerance was 20 ppm while the main search was 4.5 ppm with a protein false discovery rate (FDR) of 0.01. Protein identifications required at teins with defects in nucleolar localization or egress and to de- least two unique peptides with a minimum peptide length of seven amino termine whether RAG1 from other species has the capacity to acids. The mass spectrometry proteomics data have been deposited to the undergo regulated nucleolar sequestration and release. ProteomeXchange Consortium via the PRIDE (62) partner repository with the dataset identifier PXD016221 and 10.6019/PXD016221. Materials and Methods Cell Culture. vAbl-transformed pre-B cells were generated as described pre- Confocal Microscopy. Confocal imaging was conducted with a Nikon-Ti mi- viously (56) and cultured in RPMI media supplemented with 10% (vol/vol) croscope combined with UltraVox spinning disk (PerkinElmer). Colocalization FBS (Gibco), 0.1% (vol/vol) 2-mercaptoethanol (Sigma), and penicillin- studies were performed using fixed cell imaging of vAbl pre-B cells cotrans- streptomycin-glutamine (Life Technologies). Cells were incubated at 37 °C duced with GFP-tagged fibrillarin and various doxycycline-inducible mCherry- in 5% CO2. RAG1 expression constructs. Prior to fixation, cells were induced to express their respective mCherry-RAG1 proteins with 10 ng/mL doxycycline for 24 h Primary Pre-B Cell Culture. Bone marrow cells were harvested from 4- to 6-wk- and, when noted, treated with 2 nM actD, or 5 μM STI-571 for 4 h. Cells were old Bcl2 transgenic mice, cultured in 15% FBS vAbl media supplemented then washed and resuspended in cold PBS + 1% FBS at a concentration of with 5 ng/mL IL7 (BioLegend, 577804), and grown for 5 to 7 d at a density of 1 × 106 cells/mL. The 3 × 105 cells were mounted using a Cytospin centrifuge 4to5× 106 cells/mL. For IL7 withdrawal, cells were washed twice with 15% before being fixed in 4% paraformaldehyde in PBS for 15 min at 4 °C. Slides vAbl media before being plated with varying concentrations of actD (Sigma) were then washed with PBS three times. ProLong Diamond Antifade

in 15% FBS vAbl media. All animal use was carried out in accordance with Mountant with DAPI (Thermo) was applied prior to coverslip sealing. The IMMUNOLOGY AND INFLAMMATION a protocol approved by the Animal Care and Use Committee of Yale slides were imaged as Z-stacks with spacing of 0.2 μm. Laser power and University. exposure time for each channel were kept consistent between slides in each dataset. Generation of Cell Lines. WT A70.2 vAbl pre-B cells (56) were retrovirally transduced to generate RAG1-fusion protein-expressing lines for BioID and Colocalization Data Analysis. The three-channel Z-stacks collected for each microscopy experiments. Retroviruses were generated in Plat-E cells (Cell image were merged into a single two-dimensional (2D) projection using the Biolabs). The core RAG1 vAbl cell line was made by infecting a bone marrow channel merge and SD Z-projection functions in Fiji/ImageJ (63) using a IL7 culture from core RAG1 × Tg(BCL2)36Wehi (002321, The Jackson Labo- custom-written macro. A pipeline was created in CellProfiler 3.0 (64) to ratory) mice with vAbl virus (21, 57). For recombination assays, WT (A70.2), identify nucleoli and RAG1 puncta in discrete cells and generate masks of core RAG1, and RAG1−/− (11-3-4) vAbl lines (56) were transduced with ret- cells containing both. Application of each image’s respective mask in Fiji/ rovirus containing an inverted GFP reporter substrate (pMGInv) as described ImageJ defined the region of interest for subsequent colocalization analysis by Hung et al. (47). RAG1 expression was induced by treatment with 5 μM of individual cells. The Coloc 2 colocalization analysis in Fiji/ImageJ was then STI-571 (Selleckchem) for 24 or 48 h and in doxycycline-inducible systems, performed using the Costes statistical significance test with 50 iterations and with 10 to 100 ng/mL doxycycline (Sigma) for 4 to 24 h. approximate point spread function of five to obtain the Pearson correlation coefficient (r) for each image (65). Statistical significance of colocalization Generation of DNA Plasmids. The full-length murine RAG1 DNA sequence was was determined by one-way ANOVA. used as the template for all subsequent RAG1 modification. BirM constructs were created by cloning the murine RAG1 open reading frame (ORF) into the Flow Cytometry Analysis. Cells were washed twice with PBS + 1% FBS and following larger fusion protein construct: V5 tag (GKPIPNPLLGLKST)-BirM-10 stained with DAPI (Thermo) and, when appropriate, anti-mouse Thy1.2 (53- aa linker sequence (GGSGGSGGSR)-RAG1. Once this larger ORF was con- 2.1; eBioscience). Cells were then washed twice, filtered, and resuspended in structed, FLRAG1 and subsequent truncations were cloned into the PBS + 1% FBS. Data were collected on either a BD Biosciences LSR II or pRetroX-TRE3G (Clontech)-inducible vector using In-Fusion cloning (Takara). Stratedigm STD-13L and analyzed in FlowJo 10 (FlowJo). mCherry constructs were generated by insertion of mouse FLR1, core RAG1, Δ215, and dNOL ORFs into the mCherry2-C1 vector (54563, AddGene) using In- vAbl Recombination Assays. RAG activity was assessed in various vAbl cell lines Fusion. The complete mCherry-RAG1 ORF was then cloned into the pRetroX-TRE3G– using pMGInv as described by Hung et al. (47). Following RAG induction by inducible vector for use in vAbl cells. RAG1 complementation constructs were 5 μM STI-571 treatment for 48 h, recombination levels were quantified via cloned by insertion of the mouse FLR1, core RAG1, Δ215, and dNOL ORFs into flow cytometry as a percentage of GFP-positive cells. In nucleolar disruption the murine stem cell virus (MSCV)-internal ribosome entry site (IRES)- experiments, cells were treated with varying concentrations of actD for 48 h dTomato vector (89716, AddGene), respectively, using In-Fusion cloning. concurrent with STI-571 treatment. In a typical experiment, a culture of vAbl The mouse RAG2 ORF was cloned into a MSCV-IRES-blasticidin (based on cells or primary pre-B cells in IL7 was divided into separate wells, each of 20672, AddGene) vector using In-Fusion cloning. which was treated as indicated in the relevant figure to generate the data points shown. Data shown are representative of two to three such independent BioID in vAbl Cells. RAG1-BirM fusion proteins (FLRAG1, cRAG1, and Δ215 experiments. − − RAG1) were inducibly expressed in RAG1 / vAbl cells. Treatment with STI- 571, doxycycline, and biotin induced RAG1 expression while initiating pro- RAG1 Complementation Assays. The pMGInv reporter and MSCV RAG2-IRES- miscuous biotinylation of RAG1-proximal proteins as described by Roux et al. blasticidin expression vector were integrated into RAG1−/− vAbl cells. With (37). A construct in which BirM was fused to the SV40 nuclear localization the complementation of RAG1 protein, this line allowed for recombination sequence was constitutively expressed in WT vAbl cells and treated in the of the integrated reporter without STI-571 treatment. These cells were same manner. Transduced cells were selected via puromycin and sub- clonally transduced with one of several constructs for constitutive expression sequently grown in bulk to a density of 7.5 × 105 cells/mL and induced with of FL or mutant RAG1 proteins with dTomato as a selection marker for in- 5 μM STI-571 for 3 h before initiating labeling with the addition of 50 μM fection. At 72 h after infection, cells were analyzed for the ratio of number + + + biotin (Sigma) and 600 ng/mL doxycycline. Labeling was carried out for 24 h of GFP dTomato cells divided by number of dTomato cells via flow under normal growth conditions. After labeling, 30 × 106 cells per sample cytometric analysis.

Brecht et al. PNAS | February 25, 2020 | vol. 117 | no. 8 | 4307 Downloaded by guest on October 2, 2021 ddPCR Jκ2 Loss Assay. To quantify presence of intact Jκ2 alleles, primers were culture ddPCR data points for Fig. 6C derive from two independent experiments designed to amplify the intact 23RSS of IGκJ2 where a FAM-labeled IGκJ2- with two or eight technical replicates. The kidney and splenocyte data were specific probe lies within the amplified region (forward [F] primer: 5′- collected using two biological replicates with four technical replicates collected ′ GCCTGCCCTAGACAAACCTT; reverse [R] primer: 5 -GCTTGGTCCCCCCTCCGAAC; for each. probe: 5′-FAM-CTCGGTGCTCAGACCATGCTCAGTTTTTGT). Murine RPP30 served as an internal standard reference gene with a HEX-labeled probe (F primer: ACKNOWLEDGMENTS. We would like to thank Elizabeth Corbett for help ′ ′ 5 -CCAGCTCCGTTTGTGATAGT; R primer: 5 -CAAGGCAGAGATGCCCATAA; with mouse genotyping and breeding; Bo-Ruei Chen, Chun-Chin Chen, and ′ probe: 5 -HEX-CTGTGCACACATGCATTTGAGAGGT). ddPCR primers and probes Barry Sleckman for technical advice and for providing the pMGInv plasmid were designed and ordered through Bio-Rad. Genomic DNA samples were and vAbl cell lines; Rahul Arya and Craig Bassing for advice on IL7 pre-B cell obtained using phenol-chloroform extraction of whole cell lysates. A total of 25 cultures; Abigail Jarret for advice on flow cytometry and microscopy; Susan ng genomic DNA was used per 20 μL ddPCR reaction, in which both Jκ2 and Baserga for insights into nucleolar biology; and the R. Flavell laboratory for RPP30 reactions occurred simultaneously. Probe-based ddPCR mixes were made use of their confocal microscope and cytospin centrifuge. This work was funded and droplets were generated as previously described (66). Copy number of in part by NIH research grants R01GM122984 (S.A.S.) and R01AI032524 (D.G.S.). intact Jκ2 loci was determined by calculating the ratio of the Jκ2 copy number H.A.B. was supported in part by NIH training grant T32AI007019. R.M.B. was to the RPP30 copy number. The normalized copy number for intact Jκ2 alleles supported in part by NIH training grant T32GM007223. A.K. was supported in was subtracted from 2 to yield the apparent level of Jκ2 cleavage. The IL7 part by NIH training grant T32GM06754.

1. S. Tonegawa, Somatic generation of antibody diversity. Nature 302, 575–581 (1983). 29. N. M. Schabla, G. A. Perry, V. L. Palmer, P. C. Swanson, VprBP (DCAF1) regulates RAG1 2. D. G. Schatz, M. A. Oettinger, D. Baltimore, The V(D)J recombination activating gene, expression independently of dicer by mediating RAG1 degradation. J. Immunol. 201, RAG-1. Cell 59, 1035–1048 (1989). 930–939 (2018). 3. M. A. Oettinger, D. G. Schatz, C. Gorka, D. Baltimore, RAG-1 and RAG-2, adjacent 30. L. M. Ogawa, S. J. Baserga, Crosstalk between the nucleolus and the DNA damage genes that synergistically activate V(D)J recombination. Science 248, 1517–1523 response. Mol. Biosyst. 13, 443–455 (2017). (1990). 31. M. S. Lindström et al., Nucleolus as an emerging hub in maintenance of genome 4. D. G. Schatz, Y. Ji, Recombination centres and the orchestration of V(D)J re- stability and cancer pathogenesis. Oncogene 37, 2351–2366 (2018). – combination. Nat. Rev. Immunol. 11, 251 263 (2011). 32. M. A. Jarboui, K. Wynne, G. Elia, W. W. Hall, V. W. Gautier, Proteomic profiling of the 5. M. Gellert, V(D)J recombination: RAG proteins, repair factors, and regulation. Annu. human T-cell nucleolus. Mol. Immunol. 49, 441–452 (2011). – Rev. Biochem. 71, 101 132 (2002). 33. D. H. Larsen, M. Stucki, Nucleolar responses to DNA double-strand breaks. Nucleic 6. M. R. Lieber, The mechanism of double-strand DNA break repair by the non- Acids Res. 44, 538–544 (2016). – homologous DNA end-joining pathway. Annu. Rev. Biochem. 79, 181 211 (2010). 34. T. E. Audas, M. D. Jacob, S. Lee, Immobilization of proteins in the nucleolus by ri- 7. C. Zhu et al., Unrepaired DNA breaks in p53-deficient cells lead to oncogenic gene bosomal intergenic spacer noncoding RNA. Mol. Cell 45, 147–157 (2012). amplification subsequent to translocations. Cell 109, 811–821 (2002). 35. M. van Sluis, B. McStay, Nucleolar DNA double-strand break responses underpinning 8. Y. Gao et al., Interplay of p53 and DNA-repair protein XRCC4 in tumorigenesis, ge- rDNA genomic stability. Trends Genet. 35, 743–753 (2019). nomic stability and development. Nature 404, 897–900 (2000). 36. E. Spanopoulou et al., Localization, interaction, and RNA binding properties of the 9. M. J. Difilippantonio et al., DNA repair protein Ku80 suppresses chromosomal aber- V(D)J recombination-activating proteins RAG1 and RAG2. Immunity 3, 715–726 rations and malignant transformation. Nature 404, 510–514 (2000). (1995). 10. M. R. Lieber, Mechanisms of human lymphoid chromosomal translocations. Nat. Rev. 37. K. J. Roux, D. I. Kim, M. Raida, B. Burke, A promiscuous biotin ligase fusion protein Cancer 16, 387–398 (2016). identifies proximal and interacting proteins in mammalian cells. J. Cell Biol. 196, 801– 11. E. A. W. Chan et al., Peripheral subnuclear positioning suppresses Tcrb recombination and segregates Tcrb alleles from RAG2. Proc. Natl. Acad. Sci. U.S.A. 110, E4628–E4637 810 (2012). (2013). 38. S. A. Muljo, M. S. Schlissel, A small molecule Abl kinase inhibitor induces differenti- – 12. L. Zhang, T. L. Reynolds, X. Shan, S. Desiderio, Coupling of V(D)J recombination to the ation of Abelson virus-transformed pre-B cell lines. Nat. Immunol. 4,31 37 (2003). cell cycle suppresses genomic instability and lymphoid tumorigenesis. Immunity 34, 39. R. M. Brecht et al, RAG1 vAbl BioID LC-MS/MS. ProteomeXchange. http://proteomecentral. 163–174 (2011). proteomexchange.org/cgi/GetDataset?ID=PXD016221. Deposited 9 November 2019. 13. H. Jiang et al., Ubiquitylation of RAG-2 by Skp2-SCF links destruction of the V(D)J 40. P. Cortes, Z. S. Ye, D. Baltimore, RAG-1 interacts with the repeated amino acid motif recombinase to the cell cycle. Mol. Cell 18, 699 –709 (2005). of the human homologue of the yeast protein SRP1. Proc. Natl. Acad. Sci. U.S.A. 91, 14. U. Grawunder et al., Down-regulation of RAG1 and RAG2 gene expression in preB 7633–7637 (1994). cells after functional immunoglobulin heavy chain rearrangement. Immunity 3, 601– 41. M. S. Scott, P. V. Troshin, G. J. Barton, NoD: A nucleolar localization sequence detector 608 (1995). for eukaryotic and viral proteins. BMC Bioinformatics 12, 317 (2011). 15. M. R. Fisher, A. Rivera-Reyes, N. B. Bloch, D. G. Schatz, C. H. Bassing, Immature lym- 42. C. J. McMahan, M. J. Difilippantonio, N. Rao, E. Spanopoulou, D. G. Schatz, A basic phocytes inhibit Rag1 and Rag2 transcription and V(D)J recombination in response to motif in the N-terminal region of RAG1 enhances V(D)J recombination activity. Mol. DNA double-strand breaks. J. Immunol. 198, 2943–2956 (2017). Cell. Biol. 17, 4544–4552 (1997). 16. B. S. Lee et al., The BCL11A transcription factor directly activates RAG gene expression 43. D. P. Silver, E. Spanopoulou, R. C. Mulligan, D. Baltimore, Dispensable sequence motifs and V(D)J recombination. Mol. Cell. Biol. 33, 1768–1781 (2013). in the RAG-1 and RAG-2 genes for plasmid V(D)J recombination. Proc. Natl. Acad. Sci. 17. D. C. van Gent et al., Initiation of V(D)J recombination in a cell-free system. Cell 81, U.S.A. 90, 6100–6104 (1993). 925–934 (1995). 44. J. M. Jones, C. Simkus, The roles of the RAG1 and RAG2 “non-core” regions in V(D)J 18. T. M. Leu, D. G. Schatz, rag-1 and rag-2 are components of a high-molecular-weight recombination and lymphocyte development. Arch. Immunol. Ther. Exp. (Warsz.) 57, complex, and association of rag-2 with this complex is rag-1 dependent. Mol. Cell. 105–116 (2009). – Biol. 15, 5657 5670 (1995). 45. C. A. J. Roman, S. R. Cherry, D. Baltimore, Complementation of V(D)J recombination 19. S. R. Talukder, D. D. Dudley, F. W. Alt, Y. Takahama, Y. Akamatsu, Increased fre- deficiency in RAG-1(-/-) B cells reveals a requirement for novel elements in the N- quency of aberrant V(D)J recombination products in core RAG-expressing mice. Nu- terminus of RAG-1. Immunity 7,13–24 (1997). – cleic Acids Res. 32, 4539 4549 (2004). 46. O. Bensaude, Inhibiting eukaryotic transcription: Which compound to choose? How 20. Y. Maman, G. Teng, R. Seth, S. H. Kleinstein, D. G. Schatz, RAG1 targeting in the to evaluate its activity? Transcription 2, 103–108 (2011). genome is dominated by chromatin interactions mediated by the non-core regions of 47. P. J. Hung et al., MRI is a DNA damage response adaptor during classical non- RAG1 and RAG2. Nucleic Acids Res. 44, 9624–9637 (2016). homologous end joining. Mol. Cell 71, 332–342.e8 (2018). 21. D. D. Dudley et al., Impaired V(D)J recombination and lymphocyte development in 48. Y. Shav-Tal et al., Dynamic sorting of nuclear components into distinct nucleolar caps core RAG1-expressing mice. J. Exp. Med. 198, 1439–1450 (2003). during transcriptional inhibition. Mol. Biol. Cell 16, 2395–2413 (2005). 22. M. J. Sadofsky, J. E. Hesse, J. F. McBlane, M. Gellert, Expression and V(D)J re- 49. M. R. Clark, M. Mandal, K. Ochiai, H. Singh, Orchestrating B cell lymphopoiesis combination activity of mutated RAG-1 proteins. Nucleic Acids Res. 21, 5644–5650 through interplay of IL-7 receptor and pre-B cell receptor signalling. Nat. Rev. Im- (1993). munol. 14,69–80 (2014). 23. Z. Deng, H. Liu, X. Liu, RAG1-mediated ubiquitylation of histone H3 is required for 50. R. M. Martin et al., Principles of protein targeting to the nucleolus. Nucleus 6, 314–325 chromosomal V(D)J recombination. Cell Res. 25, 181–192 (2015). 24. G. Teng et al., RAG represents a widespread threat to the lymphocyte genome. Cell (2015). 162, 751–765 (2015). 51. J. L. Arbuckle, N. S. Rahman, S. Zhao, W. Rodgers, K. K. Rodgers, Elucidating the 25. J. M. Jones, M. Gellert, Autoubiquitylation of the V(D)J recombinase protein RAG1. domain architecture and functions of non-core RAG1: The capacity of a non-core zinc- Proc. Natl. Acad. Sci. U.S.A. 100, 15446–15451 (2003). binding domain to function in nuclear import and nucleic acid binding. BMC Biochem. 26. G. J. Grundy, W. Yang, M. Gellert, Autoinhibition of DNA cleavage mediated by RAG1 12, 23 (2011). and RAG2 is overcome by an epigenetic signal in V(D)J recombination. Proc. Natl. 52. M. S. Krangel, Mechanics of T cell receptor gene rearrangement. Curr. Opin. Immunol. Acad. Sci. U.S.A. 107, 22487–22492 (2010). 21, 133–139 (2009). 27. V. Yurchenko, Z. Xue, M. Sadofsky, The RAG1 N-terminal domain is an E3 ubiquitin 53. D. Nemazee, Receptor editing in lymphocyte development and central tolerance. Nat. ligase. Genes Dev. 17, 581–585 (2003). Rev. Immunol. 6, 728–740 (2006). 28. M. D. Kassmeier et al., VprBP binds full-length RAG1 and is required for B-cell de- 54. K. Rajewsky, Clonal selection and learning in the antibody system. Nature 381, 751– velopment and V(D)J recombination fidelity. EMBO J. 31, 945–958 (2012). 758 (1996).

4308 | www.pnas.org/cgi/doi/10.1073/pnas.1920021117 Brecht et al. Downloaded by guest on October 2, 2021 55. N. C. Steinel et al., The ataxia telangiectasia mutated kinase controls Igκ allelic ex- 61. S. Tyanova et al., The Perseus computational platform for comprehensive analysis of clusion by inhibiting secondary Vκ-to-Jκ rearrangements. J. Exp. Med. 210, 233–239 (prote)omics data. Nat. Methods 13, 731–740 (2016). (2013). 62. Y. Perez-Riverol et al., The PRIDE database and related tools and resources in 2019: – 56. A. L. Bredemeyer et al., ATM stabilizes DNA double-strand-break complexes during Improving support for quantification data. Nucleic Acids Res. 47,D442D450 (2019). V(D)J recombination. Nature 442, 466–470 (2006). 63. J. Schindelin et al., Fiji: An open-source platform for biological-image analysis. Nat. 57. N. Rosenberg, D. Baltimore, C. D. Scher, In vitro transformation of lymphoid cells by Methods 9, 676–682 (2012). Abelson murine leukemia virus. Proc. Natl. Acad. Sci. U.S.A. 72, 1932–1936 (1975). 64. C. McQuin et al., CellProfiler 3.0: Next-generation image processing for biology. PLoS 58. V. Hung et al., Spatially resolved proteomic mapping in living cells with the en- Biol. 16, e2005970 (2018). – gineered peroxidase APEX2. Nat. Protoc. 11, 456 475 (2016). 65. S. V. Costes et al., Automatic and quantitative measurement of protein-protein co- 59. B. Turriziani et al., On-beads digestion in conjunction with data-dependent mass localization in live cells. Biophys. J. 86, 3993–4003 (2004). spectrometry: A shortcut to quantitative and dynamic interaction proteomics. Biology 66. S. C. Taylor, J. Carbonneau, D. N. Shelton, G. Boivin, Optimization of Droplet Digital (Basel) 3, 320–332 (2014). PCR from RNA and DNA extracts with direct comparison to RT-qPCR: Clinical impli- 60. S. Tyanova, T. Temu, J. Cox, The MaxQuant computational platform for mass spec- cations for quantification of Oseltamivir-resistant subpopulations. J. Virol. Methods trometry-based shotgun proteomics. Nat. Protoc. 11, 2301–2319 (2016). 224,58–66 (2015). IMMUNOLOGY AND INFLAMMATION

Brecht et al. PNAS | February 25, 2020 | vol. 117 | no. 8 | 4309 Downloaded by guest on October 2, 2021