Effet De La Cryptorchidie Sur Le Transcriptome Testiculaire Humain

MARIE EVE BERGERON

EFFET DE LA CRYPTORCHIDIE SUR LE TRANSCRIPTOME TESTICULAIRE HUMAIN

Mémoire présenté à la Faculté des études supérieures et postdoctorales de l’Université Laval dans le cadre du programme de maîtrise en Physiologie-Endocrinologie pour l’obtention du grade de Maître ès sciences (M.Sc.)

DÉPARTEMENT D’OBSTÉTRIQUE ET DE GYNÉCOLOGIE FACULTÉ DE MÉDECINE UNIVERSITÉ LAVAL QUÉBEC

2012

Résumé

Les niveaux d’expression de nombreux gènes peuvent être affectés par l’environnement et mener au développement de la cryptorchidie. Cette malformation congénitale est la plus commune dont une des conséquences majeures est l’infertilité masculine due au testicule non-descendu, auquel un risque plus élevé de cancer testiculaire est associé. L’expression des ARN totaux isolés à partir de biopsies testiculaires ont été analysés par micropuces, puis par une analyse bio-informatique et une validation par RT-qPCR de plusieurs gènes sélectionnés. Ces analyses m’ont permis d’identifier plus de deux milles candidats montrant une expression différente entre des sujets cryptorchides et normaux. Certains de ces gènes sélectionnés peuvent être associés à la descente testiculaire, d’autres au cancer testiculaire ou encore aux divers types cellulaires retrouvés dans cet organe. Les différences dans le transcriptome dues à la cryptorchidie vont nous aider à comprendre la cause génétique de cette maladie.

Abstract

Expression level of numerous genes may be affected by environmental condition and lead to development of cryptorchidism. The most common congenital malformation in male is cryptorchidism. One major consequence of this anomaly is infertility due to undescended testis, to which an increased risk of testicular cancer is associated. Expression of total RNAs isolated from testicular biopsies were analysed with microarray. This was followed by subsequent bioinformatic analysis and RT-qPCR validation of many highlighted genes. Those analyses allowed me to identified more than two thousand genes that showed a differential expression between normal and cryptorchid subjects. Among these highlighted and validated genes, some can be either associated to testicular descent, to testicular cancer, or to specific cell types in testes. Differences in transcriptome due to cryptorchidism should give us clues to identify the genetic causes of this malformation.

Avant-Propos

Cet ouvrage est rédigé sous forme de mémoire-article et contient trois chapitres. Le premier chapitre est une introduction au sujet traité, le deuxième est constitué d’un article (qui a été soumis à la revue Human Reproduction) et le troisième est une discussion complémentaire à celle de l’article et une conclusion.

Les auteurs de l’article contenu au chapitre 2 sont : • moi-même, Marie Eve Bergeron : expérimentations, analyse et traitement des résultats et rédaction de l’article; • Marc Simard, étudiant au doctorat dans le laboratoire d’Yves Tremblay : conseils pour l’élaboration des protocoles expérimentaux du PCR quantitatif en temps réel et conseils sur la rédaction et la révision de l’article; • Christine Légaré, professionnelle de recherche du laboratoire : conseils pour l’élaboration des protocoles expérimentaux et révision de l’article; • Luc Boudreau : début des expérimentations; • Ezequiel Calvo, responsable de la plateforme de Biopuces du CRCHUL (Centre de Recherche du Centre Hospitalier de l’Université Laval) : traitement des résultats de micro-puces par bio-informatique; • Michel Thabet, médecin en andrologie au Département de chirugie, division urologie de l’Université Laval : extraction des tissus cryptorchides; • et Robert Sullivan, professeur au Département d’Obstétrique et Gynécologie de l’Université Laval, directeur de l’axe reproduction, santé périnatale et santé de l’enfant du CRCHUL et mon directeur de recherche : conseils pour l’élaboration des protocoles expérimentaux et révision de l’article.

Remerciements :

Tout d’abord, j’aimerais remercier Dr Robert Sullivan, mon directeur de maitrise, de m’avoir choisie pour ce projet de même que toutes les personnes du laboratoire qui m’ont aidées : Gilles Frenette, Christine Légaré et Louis-Jean Bordeleau, professionnels de recherche et les étudiants du laboratoire : Julieta, Clémence, Olivier et Akin. Je me dois de remercier les personnes des laboratoires aux alentours pour leur support moral et leur humour : Catherine, Francis, Raifish, Caroline, Houssein, Amélie, Gabriel, Aurélie, Hélène et autres. Je tiens également à remercier tout spécialement Marc, Jérôme et Éric qui ont su m’orienter, m’écouter et m’épauler à divers moments.

À toute personne qui m’a aidé à apprendre et qui m’a ainsi permis de grandir.

Table des matières

Résumé ...... i Abstract ...... ii Avant-Propos ...... iii Remerciements : ...... iv Table des matières ...... vi Liste des tableaux ...... vii Liste des figures ...... viii Liste des abréviations ...... ix Chapitre 1 : Revue de littérature ...... 1 1.0 Introduction ...... 1 1.1 Différenciation du testicule ...... 1 1.2 Testicules ...... 4 1.2.1 Fluide des tubules séminifères ...... 4 1.2.2 Spermatogenèse ...... 5 1.2.3 Efficacité de la spermatogenèse ...... 13 1.2.4 Effets de la FSH et de la testostérone ...... 14 1.2.5 Barrière hémato-testiculaire ...... 16 1.2.6 Descente testiculaire ...... 18 1.3 Cryptorchidie ...... 21 1.3.1 Définition, étiologie et fréquence ...... 21 1.3.2 Dégénérescence tubulaire ...... 23 1.3.3 Effet de la température ...... 25 1.3.4 Conséquences et traitement ...... 26 1.4 Cancer testiculaire ...... 27 1.4.1 Étiologie, incidence et pathogenèse ...... 27 1.4.2 Diagnostic et traitement ...... 28 1.5 Technique de micropuces à ADN ...... 29 1.6 Objectif du projet de recherche ...... 30 Chapitre 2 : Effect of cryptorchidism on human testicular transcriptome ...... 31 Figures ...... 53 Chapitre 3 : Discussion complémentaire et conclusions ...... 69 3.1 Discussion complémentaire ...... 69 3.1.1 Gènes associés à la descente testiculaire ...... 69 3.1.2 Gènes associés au cancer testiculaire ...... 70 3.1.3 Gènes associés aux différents types cellulaires ...... 70 3.1.4 Autres aspects à considérer ...... 75 3.2 Conclusion ...... 79 Bibliographie ...... 80 Annexe - Données supplémentaires reliées à l’article ...... 88

Liste des tableaux

Tables de l’article (chapitre 2)

Table I. Oligonucleotide primers used in PCR assays. 59 Table II. Top 25 genes more expressed in normal (fold change > 2) and in cryptorchid (fold change < 0.5) with p-value < 0.0005, sorted by fold change. 61 Table III. Concise table of gene ontology highest score in normal and cryptorchid testes.63 viii

Liste des figures

Figures du mémoire (chapitre 1) Figure 1. Spermatogenèse. 7 Figure 2. Barrière hémato-testiculaire. 17 Figure 3. Théorie de la descente testiculaire à deux phases, les phases transabdominale et inguinoscrotale de la descente testiculaire et des gènes associés. 19

Figures de l’article (chapitre 2)

Figure 1. Venn diagram and Cluster representation of the microarray results. 54 Figure 2. Gene ontology of microarray results. 55 Figure 3. Cell cycle pathway from PathVisio2. 56 Figure 4. Cluster of possible testis descent genes, of Germ, Sertoli and Leydig cell markers, and of cancer-related genes, selected from literature. 57 Figure 5. Selected gene expression of testis descent markers, of different testicular cell types, and of testicular cancer markers of normal and cryptorchid donors. 58 ix

Liste des abréviations

Ad : adult dark (adulte sombre), en parlant des spermatogonies de type A ADAM : a disintegrin and metalloprotease (désintégrine et métalloprotéase) ADN : acide désoxyribonucléique AMH : hormone anti-müllerienne AMPc : AMP cyclique ARN : acide ribonucléique ARNm : acide ribonucléique messager CALCRL : calcitonin receptor-like (récepteur de la calcitonine) CALR : calréticuline CCND : cycline CGRP : calcitonin gene-related peptide (peptide relié à la calcitonine) CIS: carcinoma in situ CYP17A1 : cytochrome P450, famille 17, sous-famille A, polypeptide 1 FGF : fibroblast growth factor (facteur de croissance des fibroblastes) FSH: hormone folliculo-stimulante GATA : facteur de transcription GATA h: heure hCG : hormone choriogonadotropine HSD17B3 : hydroxystéroïde (17-bêta) déshydrogénase 3 INHA: inhibine, chaine alpha INHBA: inhibine, chaine bêta-A INSL : insulin-like KITLG : Kit ligand LH: hormone lutéinisante LHCGR : récepteur de la LH et de la hCG mM : millimolaire ng : nanogramme pb : paires de bases PCR : polymerase chain reaction (réaction de polymérisation en chaîne) PIWIL : piwi-like PRM : protamine RNase : acide ribonucléase RT-qPCR : real-time quantitative PCR (PCR quantitatif en temps réel) RXFP: relaxin/insulin-like family peptide receptor (récepteur de INSL) sec : secondes TGCT : testicular germ cell tumor (tumeur des cellules germinales testiculaires) TNP : protéine de transition U : unités µl : microlitres µM : micromolaire °C : degrés Celsius % : pourcentage 1

Chapitre 1 : Revue de littérature

1.0 Introduction

Le but de mon projet de maitrise consiste en l’étude de l’effet de la cryptorchidie sur le transcriptome testiculaire humain. Une revue de littérature précèdera le sujet de recherche pour bien comprendre le but de cette étude ainsi que les implications qui en découlent.

L’appareil génital se différencie selon une chronologie précise variable selon les espèces, mais qui passe, dans tous les cas, par une phase initiale de développement identique dans les deux sexes (stade indifférencié), avant l’établissement du dimorphisme sexuel. Celui-ci est composé des gonades ou glandes génitales, qui produisent les gamètes et les hormones sexuelles, et du tractus génital (voies génitales et organes génitaux externes) qui véhicule les gamètes et permet l’accouplement et la nidation. Le tractus génital mâle est composé de deux testicules, deux vas efferens, deux épididymes, deux vas deferens, l’urètre, du pénis et des glandes accessoires. Celles-ci comprennent les vésicules séminales, la prostate et les glandes bulbo-urétrales [1].

Les gonades sont d’origine mésodermique, elles se forment sur la face médio-ventrale des mésonéphros, reins embryonnaires transitoires chez les mammifères, dégénérant pour laisser place aux reins définitifs : les métanéphros [1].

1.1 Différenciation du testicule

Chez l’humain, le développement du testicule est un processus continu, de la naissance à la puberté. Le diamètre du tubule séminifère augmente progressivement jusqu’à la 12e année. C’est seulement avec l’apparition du lumen qu’une augmentation rapide et soudaine du diamètre prend place [2]. Le testicule est composé de trois principaux éléments : les cellules germinales, de Sertoli et de Leydig. Une mention des cellules péritubulaires sera faite dans ce document, alors que l’innervation, les vaisseaux sanguins et les vaisseaux lymphatiques du testicule ne seront pas traités. 2

La différenciation du testicule fœtal est le premier événement morphologique de la différenciation sexuelle. Celle-ci est caractérisée par la formation des cordons testiculaires (séminifères), composés de cellules germinales entourées de cellules de Sertoli, qui deviendront les tubules séminifères dans le testicule mature [3]. La morphogenèse de ces cordons s’accompagne de la différenciation de la tunique albuginée (assise de tissu conjonctif se développant sous l’épithélium cœlomique) séparant les cordons séminifères de la surface du testicule [1]. Des études morphologiques détaillées chez le rat, le lapin et la souris ont montré que la différenciation des cellules de Sertoli était le premier événement de l’organogenèse testiculaire [4]. Progressivement, ces cellules s’associent les unes aux autres par des inter-digitations et des jonctions de type adherens, englobent les cellules germinales et forment ainsi l’ébauche des cordons séminifères délimités par une membrane basale continue [1]. Tôt durant la période prénatale, les cellules germinales primordiales (PGC) migrent à la crête gonadique et s’associent aux cellules de Sertoli pour former les cordons testiculaires primitifs. Ces cellules souches sont nommées gonocytes suite à la différenciation gonadique, lors de la formation des cordons séminifères. Elles seront appelées spermatogonies après leur migration à la périphérie du tubule séminifère [5].

L’hormone anti-müllerienne (AMH) est le premier facteur endocrinien sécrété par le testicule fœtal en formation et est produite par les cellules de Sertoli dès le début de la différenciation testiculaire, vers la 8e semaine de gestation chez l’humain, avant même la formation des cordons séminifères. Plusieurs facteurs de transcription impliqués dans la détermination sexuelle primaire (SF1, SOX9 et GATA4) sont d’importants régulateurs de l’expression de l’AMH [3]. Les cellules de Sertoli sécrétant l’AMH apparaissent comme des cellules isolées, se différenciant à partir des cellules du blastème gonadique exprimant SOX9, un facteur de transcription impliqué dans le contrôle de l’expression du gène de l’AMH. Par la suite, l’ensemble des cellules de Sertoli incluses dans les cordons séminifères exprimeront SOX9 et l’AMH [1].

Les cellules de Leydig, ou cellules interstitielles responsables de la fonction androgénique du testicule, apparaissent à la différenciation des cellules de Sertoli et à leur organisation en cordons séminifères. Elles se différencient au sein du tissu mésenchymateux présent entre les cordons séminifères et sont caractérisées par l’abondance de gouttelettes lipidiques et de 3 réticulum endoplasmique lisse. L’origine embryologique des cellules de Leydig de même que les mécanismes responsables de leur différenciation sont encore méconnus [6]. Par contre, les hormones gonadotropes ne sont pas nécessaires à la différenciation initiale des cellules de Leydig. En effet, le contrôle par les hormones gonadotropes hypophysaires ou chorioniques de l’activité androgénique du testicule s’établit en fin de gestation [1]. Après la naissance, les cellules de Leydig fœtales disparaissent et une deuxième population se différencie, les cellules de Leydig adultes [6].

Après une phase intense de multiplications, les cellules germinales subissent un arrêt mitotique (en phase G0 ou G1) et se différencient en pro-spermatogonies ou PGC et la mitose continue après la naissance [7]. Le contrôle de l’entrée en méiose de ces cellules est encore mal compris. Il semble que les cellules germinales soient programmées pour entrer spontanément en méiose et que, chez les mâles, c’est l’environnement testiculaire qui bloque ce processus jusqu’à la puberté [8]. Les mouvements des PGC suggèrent qu’elles répondent à un attractant qui émane des crêtes génitales, possiblement la chimiokine CXCL12 (C-X-C motif chemokine 12) et/ou le facteur de croissance KITLG (Kit ligand). Les PGC changent alors leur forme, deviennent moins mobiles et continuent de proliférer pour un ou deux jours, ainsi près de 26 000 cellules germinales résident dans les gonades au jour 13,5 post-coïtum chez la souris. Les spermatocytes primaires complètent ensuite les divisions méiotiques rapidement pour générer les spermatides, qui deviendront les gamètes fonctionnels matures nommés spermatozoïdes. Ces vagues de méiose continuent tout au long de la vie, permettant un apport continue de spermatozoïdes à partir des cellules souches, spermatogonies, à la périphérie des cordons testiculaires [7]. 4

1.2 Testicules

Les testicules sont des organes pairs doués d’une double fonction : gamétogène et endocrine. La fonction gamétogène, ou spermatogenèse chez le mâle, est assurée par les tubules séminifères qui sont engagés à partir de la puberté dans la production généralement continue d’un grand nombre de spermatozoïdes [1]. Les 600 à 800 tubules séminifères contournés constituent la plus grande partie du parenchyme du testicule; celui-ci est compartimenté en plus de 300 lobules incomplètement septés. Comme un seul tubule séminifère mesure environ 50 à 60 centimètres, le calcul nous apprend qu'un testicule abrite une longueur totale d'environ 300 mètres de canalicules testiculaires [9].

Les cellules de la lignée germinales (spermatogonies, spermatocytes et spermatides) sont associées aux cellules de Sertoli avec lesquelles elles constituent l’épithélium séminal. Au sein de celui-ci, elles se groupent en associations cellulaires distinctes [1].

1.2.1 Fluide des tubules séminifères

Le liquide contenu dans les tubules séminifères assure le transport des spermatozoïdes relâchés dans la lumière [10]. Le liquide du rete testis (débit de 4 à 20 µl par gramme de testicule par heure) véhicule des spermatozoïdes immobiles dont la concentration se situe entre 30 et 300 millions par ml selon les espèces. Ce liquide ne serait qu’une sécrétion tubulaire remaniée, probablement du fait d’échanges avec les veines testiculaires superficielles [1]. Il contient environ à dix fois plus de potassium que le sang [10], mais la concentration en protéines, sécrétées principalement par les cellules de Sertoli, est nettement plus basse que celle du sang et du liquide interstitiel [1, 10], à l’exception d’une protéine spécifique présente à forte concentration, l’ABP (androgen binding protein). La production du fluide des tubules séminifères débute lorsque le premier spermatozoïde est relâché par les cellules de Sertoli. Après la dégénérescence des cellules germinales, la sécrétion de ce fluide continue à un taux plus lent et la concentration en potassium chute 5 pour être semblable à celle du plasma. La production normale de fluide dépend de la basse température du scrotum et de l’apport continu en glucose [10] et est détectable lors de la formation des jonctions serrées, montrée par l’apparence du lumen [11]. Ce fluide est modifié lors de la dégénérescence des cellules germinales, est détactable lors de la formation de la barrière hémato-testiculaire et est important pour le transport des spermatozoïdes, suite à la spermatogenèse.

1.2.2 Spermatogenèse

Mise en place à la puberté, la spermatogenèse (figure 1) est le processus de différenciation cellulaire qui aboutit à la production des spermatozoïdes à partir des spermatogonies souches, les cellules germinales primordiales (PGC) [1]. Ce processus est remarquablement similaire entre les différents mammifères puisque les événements régulateurs clés sont conservés entre les espèces, mais il y a des différences dans le détail de ces événements [11]. Regardons comment cela fonctionne chez l’humain.

1.2.2.1 Transformation des cordons séminifères en tubules séminifères

Les cordons sexuels se perméabilisent au début de la puberté et se transforment en tubules séminifères contournés. Ceux-ci sont constitués d’un épithélium germinal composé de deux différentes populations cellulaires : les cellules de soutien, les cellules de Sertoli, et les différents stades des cellules germinales en division et en différenciation [9].

La succession des différents stades dans le temps à un point donné dans l’épithélium tubulaire est nommé « cycle spermatogénique » [10]. Les cellules de Sertoli sont de grandes cellules et forment une couche uni-stratifiée qui s'étend de la membrane basale à la lumière des tubules [9]. Quatre à cinq générations différentes de cellules germinales sont disposées en couches superposées : les générations des cellules les plus jeunes le long de la membrane basale des tubules séminifères et les générations plus matures en bordure de la lumière. De plus, les différentes générations de cellules germinales sont disposées dans les tubules séminifères selon des hélices concentriques [spirales], ainsi trois à quatre stades du cycle de l’épithélium séminal peuvent coexister dans la section transversale d’un tubule [1], dans un même cycle spermatogénique. 6

Ainsi, dans les 16 cycles spermatogéniques de l’épithélium séminal [12], on retrouve quatre à cinq cycles successifs [de cellules germinales] pour passer de l’état de spermatogonie [au niveau de la membrane basale] à celui de spermatozoïde [1] au niveau de la lumière.

1.2.2.2 Les cellules germinales dans la spermatogenèse

Sur la base de leurs caractéristiques nucléaires, on distingue plusieurs types de spermatogonies issus de divisions successives, vers la lumière du tubule séminifère. Chez l’homme, les cellules de type A sombres (adult dark (Ad)) sont considérées comme des cellules souches de réserve qui, par mitose, produiraient une nouvelle partie de cellules souches (Ad) ou à certains moments une paire de spermatogonies de type A pâle (Ap) plus différenciées à partir desquelles prendraient naissance les spermatogonies de type B [1, 12], par intervalles de 16 jours [5]. Les spermatogonies de type Ad sont caractérisées par une coloration dense de la chromatine contenant normalement une aire centrale plus pâle. Les spermatogonies de type Ap contiennent un noyau ovoïde avec une chromatine d’apparence pâle et granulaire et exposent un ou deux nucléoles reposants près de la membrane nucléaire. Pour leur part, les spermatogonies de type B ressemblent aux spermatogonies de type Ap quoique plus petites et ayant moins de contact avec la membrane basale [13]. Dans un groupe homogène de cellules souches de la même génération, les spermatogonies restent connectées par des ponts intercellulaires après leurs divisions [1, 5].

Issus de la dernière division des spermatogonies de type B, les spermatocytes deviennent de grandes cellules ovalaires au noyau arrondi, contenant plusieurs nucléoles. Au début de la prophase méiotique, les spermatocytes primaires, dénommées préleptotènes, synthétisent l’ADN nécessaire à la réplication des chromosomes. La prophase méiotique comprend cinq stades successifs (leptotène, zygotène, pachytène, diplotène, diacinèse), caractérisés par la présence dans le noyau de chromosomes appariés à diverses étapes du processus de spiralisation [1]. Au stade leptotène, il y a condensation des chromosomes; au stade zygotène, c’est la synapse chromosomique ou la reconnaissance des chromosomes homologues. C’est au long stade pachytène que la complétion de la synapse s’effectue, de même que l’échange de matériel chromosomique, aussi nommé « crossing-over ». Cette phase est caractérisée par la croissance nucléaire et cytoplasmique faisant de celles-ci les 7

Figure 1. Spermatogenèse. Sur la membrane basale des tubules séminifères contournés se trouve la population des cellules souches des cellules germinales, les spermatogonies de type A. Elles se divisent par mitose : une des cellules filles renouvelle le stock des spermatogonies de type A, l'autre devient une spermatogonie de type B. Elles se divisent et leurs cellules filles migrent en direction de la lumière. Durant leur migration jusqu'à la surface de l'épithélium, elles se différencient par méiose en spermatocytes, puis en spermatozoïdes. (Lors des divisions cellulaires susmentionnées, la division du cytoplasme n'est pas complète. Les cellules filles restent attachées par des ponts cytoplasmiques. Dans la dernière génération, des spermatides notamment, beaucoup plus de cellules sont attachées les unes aux autres que celles représentées ici). Tirée du site Internet : http://www.embryology.ch/francais/cgametogen/spermato03.html[9]

8 plus grosses cellules de la lignée germinale. Au stade diplotène, c’est la désynapse, ou le dépairage des chromosomes tout en étant encore liés par le chiasmata. Lors de la diacinèse, les chromosomes se détachent de la membrane nucléaire et chaque chromosome est composé de deux chromatides. La diacinèse est rapidement suivie de la dissolution de la membrane nucléaire, menant à la métaphase. La cytocinèse est incomplète et les spermatocytes secondaires restent liés par des ponts intercellulaires [13].

Ces ponts sont observés entre toutes les classes de cellules germinales tout au long de la spermatogenèse et peuvent être importants pour la synchronisation de la prolifération et différenciation cellulaires et possiblement pour la régulation de l’expression de gènes. Ainsi, les spermatogonies du testicule adulte sont essentielles tant pour le renouvellement des cellules germinales que pour la différenciation en spermatozoïde [5].

1.2.2.3 Méiose

Le mécanisme moléculaire impliqué de l’entrée en méiose (transition G2-M du cycle cellulaire) n’est pas élucidé. Plusieurs membres de la famille des CDK (kinases dépendantes des cyclines) sont exprimés dans les spermatogonies, les spermatocytes et les spermatides, suggérant leurs interventions à la fois durant les divisions cellulaires et la différenciation [14]. La première division méiotique conduit à la séparation des chromosomes homologues et à la formation de spermatocytes secondaires qui restent peu de temps en interphase. À ce stade, chaque chromosome homologue est formé de deux chromatides. Comme il n'y a ni duplication d'ADN, ni recombinaison du matériel héréditaire, la deuxième division progresse rapidement [9] et aboutit à la répartition des chromatides de chaque chromosome homologue dans des cellules haploïdes séparées, dénommées spermatides [1]. Ce sont les plus petites cellules de l’épithélium germinal avec les spermatozoïdes [9]. La métamorphose des spermatides en spermatozoïdes constitue la spermiogenèse. Les spermatides se différencient des cellules rondes avec un noyau rond en cellules qui ont une tête enlignée avec un noyau condensé, contenant des enzymes pénétrantes et le génome mâle, et une queue nécessaire à la motilité cellulaire [15]. La séquence des modifications morphologiques a été subdivisée en différents stades successifs dont le nombre varie selon les espèces (chez l’homme : 8, le rat : 19). Trois stades 9 principaux surviennent : la réorganisation du noyau, le développement du système acrosomique et l’assemblage des structures du flagelle [1], mais nous ne nous y attarderons pas dans ce document. Au final, les spermatozoïdes sont relâchés par les cellules de Sertoli.

1.2.2.4 Les cellules de Sertoli dans la spermatogenèse

Seules les cellules de Sertoli immatures prolifèrent et donc le nombre final de ces cellules est déterminé avant l’âge adulte [16]. Le nombre de cellules de Sertoli n’affecte pas la spermatogenèse ni la qualité des spermatozoïdes produits, mais seulement le nombre de spermatozoïdes produits, puisque chaque cellule de Sertoli peut supporter un nombre fini de cellules germinales à travers leur développement en spermatozoïdes [11]. Ainsi, il est important que le bon nombre de ces cellules soit généré pour permettre la bonne quantité de spermatozoïdes produits par jour.

Vers le début de la puberté, les cellules de Sertoli subissent un changement radical dans leur morphologie et fonction, annonçant le passage de la forme immature, état prolifératif, à la forme mature, état non-prolifératif. Ces cellules matures forment alors des jonctions serrées entre elles pour former le compartiment adluminal dans lequel les étapes méiotiques et post-méiotiques de la spermatogenèse peuvent se dérouler, permettant au lumen de se remplir de fluide [16]. Ces jonctions serrées forment la barrière hémato-testiculaire (voir la section 1.2.5). On s’attend à ce que plusieurs fonctions différentes soient exprimées par les cellules de Sertoli matures comparativement à celles fœtales, mais il manque d’études comparatives à ce sujet, bien que certaines fonctions immatures des cellules de Sertoli montrent clairement un changement à la puberté (comme l’expression de l’aromatase), d’autres ne montrent pas une telle démarcation (comme l’expression de l’AMH). Un candidat évident de cette modification est l’influence des cellules germinales nouvellement différenciées, mais leur absence ne résulte pas de facto à l’échec de la maturation des cellules de Sertoli, quoiqu’il puisse y avoir un délai, comme dans la formation des jonctions serrées [16]. Effectivement, la nature des cellules germinales entourant les cellules de Sertoli peut influencer significativement les activités métaboliques des cellules de Sertoli, puisque la morphologie des cellules de Sertoli varie le long du tubule séminifère en conjonction avec les changements des cellules germinales, coordonnés avec le cycle 10 spermatogénique [10], montrant une plasticité de ces cellules [1]. De plus, des changements de la fonction sécrétrice, secondaires à l’absence de ces cellules germinales, peuvent subvenir, de même qu’une dédifférenciation des cellules de Sertoli, tel le retour aux fonctions immatures. Il est cependant important de reconnaitre que l’absence des cellules germinales peut refléter des anomalies sous-jacentes des cellules de Sertoli, comme un échec de leur maturation [16].

De plus, une seule exposition à la chaleur, menant à une disparition des spermatides, rend la fonction cellulaire des cellules de Sertoli anormale jusqu’au retour des spermatides [13]. La persistance des cellules de Sertoli immatures dans le testicule adulte semble incohérente avec la spermatogenèse complète, même si en théorie ces cellules sont capables de supporter les cellules germinales fœtales survivantes normales ou transformées (carcinoma in situ (CIS)) ou les spermatogonies. Dans les tubules contenant seulement des cellules de Sertoli, la perte des cellules germinales semblait plutôt affecter les cellules de Sertoli morphologiquement, avec la persistance d’un petit noyau fusiforme en palissade et sans évidence de la formation de la lumière du tubule. Ces tubules séminifères sont fréquemment décrits dans les testicules cryptorchides, mais aussi dans les testicules scrotaux de patients avec le syndrome de Klinefelter, de problèmes de spermatogenèse ou de cancer des cellules germinales testiculaires [16].

Les cellules de Sertoli matures ont plusieurs fonctions : elles sécrètent près de cent protéines, phagocytent et digèrent les cellules germinales dégénérées, synthétisent des stéroïdes, forment le cycle spermatogénique et protègent via les jonctions serrées en formant la barrière hémato-testiculaire. Toutes les fonctions de ces cellules sont inter- reliées puisque les produits sécrétés par celles-ci assure aux cellules germinales en développement un environnement unique maintenu par cette barrière [10].

Certaines hormones peuvent jouer un rôle dans la prolifération des cellules de Sertoli. En effet, la FSH augmente le taux de prolifération de ces cellules, alors que les hormones thyroïdiennes altèrent la période durant laquelle la prolifération peut se faire en régulant leur maturation [16]. En outre, la FSH rend les cellules de Sertoli capables de lier les spermatides rondes [17]. 11

Même si la FSH joue un rôle majeur dans l’initiation, le maintien et le rétablissement de la spermatogenèse chez les primates, il semble que chez la majorité des mammifères la testostérone a un rôle important dans le maintien quantitatif de la spermatogenèse normale, alors que la FSH joue un rôle qualitatif et n’est pas uniquement nécessaire pour la fertilité [11].

1.2.2.5 Les cellules de Leydig dans la spermatogenèse

Les cellules de Leydig se situent dans le tissu conjonctif lâche des espaces intertubulaires. Ce sont des cellules endocrines qui sécrètent surtout l'hormone sexuelle mâle, la testostérone, qui diffuse dans le sang ainsi que dans le voisinage immédiat. Cette hormone est responsable (avec les hormones corticosurrénales) du déclenchement de la puberté et de la maturation des spermatozoïdes [9]. La production de testostérone est commandée par la LH hypophysaire et il existe un mécanisme de rétrocontrôle négatif incluant l'hypothalamus. La FSH hypophysaire agit sur les cellules de Sertoli en provoquant la synthèse d'une protéine liant la testostérone (androgen binding protein, ABP). De cette façon, la testostérone peut être transportée par les cellules de Sertoli dans la zone luminale et y être concentrée. La testostérone est essentielle pour la spermatogenèse. Elle est aussi transportée ailleurs par le sang et la lymphe. Elle agit apparemment sur tous les tissus, en particulier sur le cerveau et sur les organes génitaux eux-mêmes [9]. D’après des études chez le rat, les cellules souches de Leydig, desquelles la population adulte dérive, sont des petites cellules fusiformes du mésenchyme relativement indifférenciées qui sont attachées à la surface externe des tubules séminifères. Avec l’établissement d’un axe hypothalamo- hypophyso-testiculaire fonctionnel durant la puberté, la LH induit la prolifération initiale et ainsi la différenciation post-mitotique des cellules de Leydig. Il est important de noter que le nombre de cellules de Leydig final atteint à la puberté reste en grande partie inchangé tout au long de la vie, sans division ou mort cellulaire apparente. Ceci fait des cellules de Leydig adultes parmi les plus vieilles cellules du corps [18]. Les cellules de Leydig contiennent des gouttelettes lipidiques liées à la membrane qui entreposent le cholestérol estérifié pour la synthèse de stéroïdes. Leur contenu varie d’une cellule à l’autre d’un même testicule et la LH cause la réduction de ces gouttelettes pouvant refléter les cycles de l’activité synthétique. Les contributions fonctionnelles du cytoplasme des cellules de 12

Leydig incluent la synthèse de nouvelles protéines, l’entreposage du cholestérol et la mobilisation de ce substrat. Chez l’humain uniquement, on retrouve les cristaux de Reinke dont leur fonction demeure inconnue [19], mais dont leur présence peut indiquer un signe d’activité fonctionnelle [1]. Le nombre de cellules de Leydig change en proportion du nombre de cellules de Sertoli et la FSH peut réguler leur développement via son effet sur les cellules de Sertoli [11].

1.2.2.6 Les cellules péritubulaires dans la spermatogenèse

Aussi nommées myofibroblastes, les cellules péritubulaires entourent les tubules séminifères, en formant une couche ou plus [20]. Dans le testicule humain, ces cellules possèdent les caractéristiques des fibroblastes, puisqu’elles dérivent des cellules du mésenchyme, tout comme les cellules de Leydig [21]. Les contractions de ces cellules myoïdes peuvent contribuer au mouvement des spermatozoïdes et du fluide à travers la lumière des tubules séminifères, de même que dans la signalisation paracrine [20]. Les cellules péritubulaires sont impliquées dans le contrôle et le maintien de la fonction des cellules de Sertoli, et donc, peuvent influencer indirectement la spermatogenèse [21]. En effet, elles interagissent avec les cellules de Sertoli via la membrane basale de ces dernières et via des facteurs paracriniens, pouvant donc amplifier la sécrétion cyclique des protéines des cellules de Sertoli entrainées dans le cycle spermatogénique [10]. De plus, ces cellules ne possèdent pas les récepteurs pour la LH ou la FSH et donc les activités de celles-ci ne sont pas directement régulées par les gonadotropines [22], même si elles sont influencées par les facteurs de croissance testiculaire. Ainsi, ces cellules maintiennent l’intégrité des tubules séminifères et peuvent aider aux mouvements propulsifs des spermatozoïdes et du fluide des tubules séminifères [15].

1.2.2.7 Quelques chiffres

La durée du cycle de l’épithélium séminal, ou de la spermatogenèse, est une constante biologique indépendante de toute action hormonale et est déterminée par l’intervalle de temps qui rythme l’entrée des spermatogonies dans la spermatogenèse. Ainsi, la durée de vie moyenne est de 16 à 18 jours pour les spermatogonies de type Ap, de 7,5 à 9 jours pour les spermatogonies de type B, de 23 jours pour les spermatocytes primaires, de 1 jour pour 13 les spermatocytes secondaires et de 22,5 à 23 jours pour les spermatides [1]. Ainsi, pour passer à travers tous les cycles, la spermatogenèse dure 64 [12] à 74 jours [15].

Ce processus est soumis à des variations individuelles considérables, influencées en partie des facteurs psychiques. Environ 100 millions de spermatozoïdes sont produits par jour. En moyenne 50 à 200 millions de spermatozoïdes sont libérés par éjaculation (norme Organisation Mondiale de la Santé de plus de 40 millions) [9].

1.2.2.8 Dégénérescence normale

Le nombre de gonocytes et de spermatogonies diminue durant la vie fœtale résultant d’un processus dégénératif qui a été estimé à une diminution de 30 à 40 % [23]. Les cellules dégénérescentes sont phagocytées par les cellules de Sertoli immatures. De plus, pendant la spermatogenèse, un nombre significatif de cellules germinales dégénèrent, minant l’efficacité de ce processus qui est mesurée par la production spermatique par gramme de testicule [13].

1.2.3 Efficacité de la spermatogenèse

L’efficacité de la spermatogenèse varie entre les espèces. L’humain est parmi les espèces ayant la spermatogenèse la moins efficace. Elle est mesurée par la production journalière de spermatozoïdes par gramme de testicule [11, 15] ou par le ratio spermatides allongées sur cellules de Sertoli [11]. Lorsqu’un tubule séminifère humain est coupé longitudinalement, les stades forment une séquence ordonnée orientée sur un plan oblique par rapport à l’axe longitudinal du tubule. L’examen de sections consécutives et un modelage par ordinateur des positions des cellules germinales ont révélé que leur développement suit un patron hélicoïdal, semblable à la géométrie des spirales d’Archimède. La spirale est représentée comme une hélice longitudinale dont le diamètre de la spirale diminue graduellement vers la lumière, permettant à des spirales multiples de tourner dans un patron concentrique [24]. Il n’est pas clair si l’inefficacité vient ou mène à l’arrangement hélicoïdal des stades de la spermatogenèse. Une autre raison possible à cette faible efficacité est que les réserves de spermatogonies de type B prêtes à entrer en méiose sont plus limitées que chez les autres 14 espèces. Ce ne sont pas tous les spermatocytes préleptotènes qui se développent en une méiose complète pour devenir des spermatides et ensuite être relâchées en tant que spermatozoïde, car certaines dégénèrent durant la méiose ou, plus rarement, durant la spermiogenèse. L’étape la plus critique est durant la métaphase à la fin de la méiose. Celle- ci représente une sorte de processus de sélection qui prévient les cellules aberrantes de progresser plus loin dans la spermatogenèse. Ce processus ne semble pas être si efficace chez l’homme et il a été suggéré que les divisions méiotiques fautives sont une des causes du fort pourcentage de spermatozoïdes morphologiquement anormaux dans l’éjaculat d’hommes normaux (ou infertiles). La dégénérescence des cellules germinales en métaphase est une caractéristique commune chez la majorité des mammifères. Toutefois, ce qui cause ou contrôle la dégénérescence des spermatocytes méiotiques n’est pas connu [11]. Le nombre de spermatogonies de type B est affecté par la FSH, stimulant le nombre de spermatogonies de type Ap chez le singe. Par contre, durant le vieillissement chez l’homme, il y a une réduction du nombre de spermatogonies de type Ap [25], malgré l’augmentation des niveaux de FSH. L’inhibine peut, elle aussi, réguler négativement les réserves de spermatogonies en différenciation. Ainsi chez les rongeurs adultes, via la FSH et l’inhibine, la cellule de Sertoli peut réguler le nombre de spermatogonies de type B disponibles pour l’entrée en méiose [11].

1.2.4 Effets de la FSH et de la testostérone

La réceptivité des cellules de Sertoli à la FSH décline très tôt à la puberté, alors que celle à la testostérone augmente. Ceci est basé sur leurs effets sur la sécrétion du fluide des tubules séminifères, l’ABP et aux protéines régulées par l’androgène. Ces changements peuvent résulter partiellement de l’augmentation des niveaux de récepteurs aux androgènes des cellules de Sertoli, ce qui peut être induit par la FSH, mais aussi par la présence des spermatides allongées. Ainsi, la FSH ou la testostérone peuvent supporter qualitativement la spermatogenèse puisque ces hormones semblent contrôler plusieurs des mêmes fonctions métaboliques basales des cellules de Sertoli qui sont essentielles à la spermatogenèse. Par contre, la mesure quantitative est probablement déterminée par les rôles de ces hormones 15 qui ne se chevauchent pas. Ainsi, deux systèmes de contrôle séparés sont requis pour que la maturation développementale et comportementale puisse être divisée de la spermatogenèse durant le long processus de son initiation et expansion (i.e. phase modulée par la FSH), mais liée de près à la spermatogenèse lorsque les gamètes établis et matures sont disponibles pour transmettre les gènes (i.e. phase modulée par la testostérone). Par contre, on ne sait pas comment la spermatogenèse est régulée au niveau cellulaire ou moléculaire par ces hormones. La FSH joue un rôle important dans la régulation du développement du nombre approprié de cellules de Leydig pour que les hauts niveaux de testostérone soient produits lorsque requis, même si ce rôle semble être indirect chez l’humain [11]. En effet, bien que la spermatogenèse puisse être maintenue qualitativement dans le testicule par la testostérone seule, la FSH est requise pour l’initiation de la spermatogenèse. Le site primaire d’action de la FSH dans l’épithélium séminifère est les cellules de Sertoli. La FSH se rend dans le milieu interstitiel du testicule via de petites artérioles, diffuse à travers la membrane basale des tubules séminifères et se lie spécifiquement à des récepteurs de la membrane plasmique sur les cellules de Sertoli. L’activation des récepteurs de la FSH résulte en la synthèse intracellulaire des récepteurs aux androgènes et de l’ABP. Cette protéine, sécrétée par les cellules de Sertoli, lie les androgènes produits par les cellules de Leydig et diffusent de leur site de production interstitiel au tubule séminifère. L’ABP transfère ces androgènes aux cellules germinales. À cet endroit, les androgènes sont retenus dans les cellules germinales proméiotiques qui contiennent des récepteurs aux androgènes. Une fois que la FSH initie la spermatogenèse, le processus se poursuivra tant que la réserve de testostérone disponible sera adéquate et ininterrompue [26]. 16

1.2.5 Barrière hémato-testiculaire

Les jonctions serrées des cellules de Sertoli permettent d'établir une barrière hémato- testiculaire (figure 2) dans le tubule séminifère. Cela signifie qu'à l'extérieur de cette barrière, dans la zone basale, les éléments et les hormones du sang ont un accès libre. La barrière est perméable sélectivement et contrôle l'accès des substances dans la zone adluminale du tubule. Ceci a son importance puisque les cellules haploïdes présentent descaractéristiques antigéniques et doivent, de ce fait, être séparées du reste de l'organisme par une barrière [9]. Celle-ci permet donc de conserver un gradient d’ions, de petites molécules et des protéines entre le sang et le fluide tubulaire. Cette habileté d’exclure de petites molécules lui permet de protéger les cellules germinales en développement des agents mutagènes. Les spermatozoïdes étant immunogènes, la barrière sert aussi à séquestrer cette population de cellules du système immunitaire [10]. Les facteurs contrôlant la formation de la barrière hémato-testiculaire sont encore inconnus. Puisque les spermatocytes primaires de type pachytène sont formés avant l’établissement réel de cette barrière, il semble que le processus de maturation méiotique durant l’initiation de la spermatogenèse n’est pas dépendant de la formation du compartiment épithélial adluminal, ni de la spermatogenèse étant donné que l’élimination des cellules germinales du testicule ne peut prévenir le développement de ces jonctions [13]. Ainsi, les cellules germinales du côté adluminal sont isolées et n’ont pas d’accès direct aux nutriments, hormones, etc. dérivés de la circulation sanguine et du fluide interstitiel; elles sont donc dépendantes des cellules de Sertoli pour leurs besoins [27].

L’échange de substances entre le fluide extra-tubulaire et le fluide intra-tubulaire peut varier grandement, des entrées presque instantanées (comme l’eau tritiée et l’éthanol) à exclusion presque complète (comme l’albumine et l’inuline). Le taux d’entrée ne dépend pas seulement du poids moléculaire, même si généralement les grosses molécules entrent plus lentement; les substances avec une grande liposolubilité entrent plus rapidement que celles hydrophiles. La barrière a été localisée au niveau des jonctions spécialisées qui se développent à la puberté entre les cellules de Sertoli. Une substance perméable peut être 17 transformée dans les tubules séminifères en un métabolite non-perméable, toxique. Parce que ce métabolite ne peut plus sortir des tubules, il va s’y accumuler en concentration beaucoup plus forte que si ce métabolite toxique était donné directement à l’animal. Des effets mutagènes importants peuvent donc résulter à de faibles doses comparativement au précurseur [28].

Figure 2. Barrière hémato-testiculaire. Les différences dans l’arrangement spatial des jonctions serrées (TJ; tight junctions) et des jonctions adhérentes (AJ; adherens junctions) dans l’épithélium versus l’épithélium séminifère des testicules de mammifères adultes. (A) Dans la majorité des épithéliums, les TJ sont restreintes à la région apicale des cellules épithéliales adjacentes, sous lesquelles se situent les AJ, une jonction de type cellule-cellule dont l’ancre est basé sur l’actine. La membrane basale est le plus loin des TJ. Dans une autre barrière hémato-tissu, les TJ seules confèrent la fonction de la barrière, comme dans la barrière hémato-encéphalique et hémato-rétinale. (B) Dans les testicules de mammifères, la barrière hémato-testiculaire est plus près de la membrane basale au lieu de la région apicale de la cellule de Sertoli. Aussi, cette barrière est composée de TJ et de spécialisation ectoplasmique basale (un type de AJ atypique dans le testicule). Cette spécialisation apicale, toutefois, est restreinte à l’interface cellules de Sertoli et spermatides en élongation. La présence de cette barrière sépare l’épithélium séminifère en compartiments basal et adluminal. Image tirée de l’article de Wong et al. [29] ©.

1.2.6 Descente testiculaire

Chez la plupart des mammifères, les testicules sont localisés dans le scrotum dont la température est de 3 à 5 °C inférieure à celle du corps. La spermatogenèse ne peut se dérouler complètement qu’à cette température [1], car les cellules germinales différenciées montrent une sensibilité à la température lors de synthèse d’ADN, ce qui n’est pas le cas des spermatogonies de type A et des cellules non-germinales [30].

Le gubernaculum, un cordon ligamentaire, joue un rôle décisif dans la descente testiculaire. Il apparaît au cours de la 7e semaine, suite à la dégénérescence du mésonéphros en substitution au ligament inguinal. L'extrémité céphalique du gubernaculum se fixe au testicule, alors que son extrémité caudale s'attache dans la région des bourrelets labio- scrotaux (futur scrotum). Au même moment apparaît une petite évagination du péritoine appelée processus vaginal, le long duquel le testicule va glisser à travers le canal inguinal, dans sa position définitive. En s'allongeant en direction caudale, le processus vaginal repousse les différentes couches de la paroi abdominale pour former une évagination en forme de doigt de gant. Le processus vaginal franchit, avec le testicule, la partie supérieure du canal inguinal. Celui-ci s'allonge alors que le gubernaculum se raccourcit davantage entraînant les testicules, leurs canaux déférents et leurs vaisseaux vers le bas. Les testicules restent dans le voisinage de la partie supérieure du canal inguinal du 3e au 7e mois de gestation, puis passent dans ce dernier. Les testicules pénètrent dans le scrotum autour du 9e mois, parfois après la naissance. L'action de la testostérone et des androgènes semble favoriser cette dernière phase de la descente testiculaire. Le processus vaginal forme maintenant une tunique séreuse à double feuillet à la partie antérieure du testicule [9]. Le processus vaginal se resserre et le canal inguinal est normalement fermé après que le testicule soit descendu [31]. 19

Figure 3. Théorie de la descente testiculaire à deux phases, les phases transabdominale et inguinoscrotale de la descente testiculaire et des gènes associés. Illustration schématique de chaque phase de descente testiculaire et des gènes et hormones associés. Une perturbation de chaque phase peut mener à la cryptorchidie. Tirée de Kojima et al. [32] ©.

Le contrôle de la descente testiculaire est encore controversé, puisqu’elle est multifactorielle. C’est un processus complexe à plusieurs étapes requérant l’interaction de facteurs anatomiques et hormonaux en plus de plusieurs facteurs génétiques et endocriniens, comme INSL3 (insulin-like 3) et son récepteur RXFP2 (relaxin/insulin-like family peptide receptor 2), les androgènes, les gonadotropines, CGRP (calcitonin gene- related peptide), AMH (hormone anti-müllerienne) [31, 33]. Généralement, la théorie à deux phases a été acceptée pour la descente du testicule (figure 3). La première phase est celle transabdominale (8e à 15e semaine [32], complétée à la 21e semaine [33]) et est contrôlée par un épaississement du gubernaculum (ligament génito-inguinal caudal) et la régression du ligament suspenseur (cranial suspensory ligament (CSL)). La deuxième phase est celle inguinoscrotale (25 à 35e semaine) et mène à la migration du gubernaculum de l’aine au scrotum [32].

Il est possible de prévenir la descente testiculaire en sectionnant le nerf génito-fémoral. Ce nerf contient CGRP qui peut stimuler les contractions du gubernaculum in vitro chez la souris [31]. En outre, le traitement de porcs cryptorchides néonataux avec CGRP a stimulé la migration du testicule au niveau inguinal, mais pas au niveau abdominal. Par contre, ce 20 traitement chez la souris n’affecte pas la deuxième phase de descente qui se fait après la naissance. L’implication du nerf génito-fémoral est supporté par la coupure du gubernaculum près du mur abdominal chez les ratons nouveaux-nés qui prévient la descente subséquente du testicule, alors que la coupure près de l’épididyme n’a pas d’effet [31].

La descente testiculaire normale est dépendante de l’axe hypothalamo-hypophyso- testiculaire. Des malformations du système nerveux central et un hypogonadisme hypogonadotropique congénital peuvent être associés à la cryptorchidie [34]. 21

1.3 Cryptorchidie

1.3.1 Définition, étiologie et fréquence

Le terme cryptorchidie vient du grec « kryptos » qui signifie « caché » et « orchis » signifiant « testicule ». La cryptorchidie est donc l’échec d’un ou des deux testicules à descendre au niveau scrotal [35]. La persistance anormale du testicule (inguinal et abdominal) survient chez un bon nombre d’espèces, en particulier le verrat, le cheval et l’homme entrainant une spermatogenèse anormale [31]. Chez l’humain, les cas de cryptorchidie sont normalement détectés à la naissance ou dans la jeune enfance. Le moment de la descente testiculaire, comme plusieurs autres événements biologiques, suit une distribution normale, ainsi pour plusieurs enfants cryptorchides à la naissance, une grande proportion (environ 50 %) peuvent spontanément corriger par eux-mêmes (descente spontanée) jusqu’à trois mois [36]. La cryptorchidie est le désordre congénital le plus commun chez les garçons avec une incidence d’environ 30 % des nouveaux nés prématurés [9], de 2 à 4 % chez les garçons nés à terme [35] et d’environ 1 % à un an [33, 37].

L’étiologie de la cryptorchidie est surtout idiopathique, puisque controversée, et multifactorielle [36], implicant tant des composantes génétiques et non-génétiques [38]. En effet, plusieurs cas de cryptorchidie peuvent être attribués à des perturbations dans l’équilibre du développement [36]. Même si certains cas isolés peuvent être attribués à des défauts génétiques, comme des mutations en INSL3 ou son récepteur, la cause de la cryptorchidie reste inconnue chez la majorité des patients [38]. Cette malformation semble toutefois liée à insuffisante production d'androgènes et/ou d’INSL3 [38], probablement en relation à une altération au niveau de l'axe hypothalamo-hypophysaire [9].

Les testicules restent dans la cavité abdominale, ou n'importe où sur leur trajet de migration normale, le plus souvent dans le canal inguinal (60 % des cas). Si ces testicules sont en général d’apparence normale à la naissance, des altérations histologiques apparaissent fréquemment au cours de la première année de vie [9]. Les cas de cryptorchidie sont principalement unilatéraux, même si près de 20 % des cas sont bilatéraux [33]. Il n’existe 22 pas d’explication pour éclairer cette proportion [31]. Le testicule non-descendu est, ou devient, endommagé de manière permanente, ainsi 60 à 85 % des cryptorchides unilatéraux et 91 à 100 % des cryptorchides bilatéraux sont sous-fertiles ou stériles [2]. Déjà en 1971, Hedinger notait qu’à aussi tôt que trois ans il y a une diminution considérable dans le nombre de spermatogonies chez les cryptorchides, comparativement aux testicules normaux [2]. Raynaud [39], chez le lézard, et Jean [40], chez la souris, sont arrivés à la conclusion que l’estrogène, plus précisément le 17β-estradiol [41], bloque la production d’androgènes en exerçant une influence directe sur les cellules de Leydig, menant à la cryptorchidie. Ces expériences montrent un facteur endocrinien dans l’étiologie de la cryptorchidie. À ce propos, Hayashi et Harrison [42] ont été incapables de trouver au microscope des cellules de Leydig dans l’interstice d’individus cryptorchides d’un an. Ils ont aussi observé un développement retardé des cellules de Leydig chez les cryptorchides d’âge pubère. Ces conclusions ont aussi été confirmées sur une base endocrine par Raboch et Zachor [43], qui ont découvert une sécrétion réduite des androgènes dans les cellules de Leydig de jeunes adultes cryptorchides. Ceci menant à la théorie qu’une perturbation endocrinienne durant le développement intra-utérin est à la base de la cryptorchidie. Un autre groupe a attribué l’occurrence de la cryptorchidie à une perturbation congénitale des spermatogonies [44]. Selon Farrington [2], la cryptorchidie et le haut taux d’infertilité est le résultat de spermatogonies de « faible qualité ». Une troisième cause possible est la malformation du passage inguinal. Cette dernière théorie que l’étiologie de la cryptorchidie est d’une nature mécanique a été mise de l’avant plusieurs fois, particulièrement par les chirurgiens et les pathologistes [2]. Trente ans plus tard, on ne sait pas exactement ce qui cause la cryptorchidie et ces théories sont encore plausibles.

Un poids à la naissance de moins de 2,5 kilogrammes et une taille plus petite que la normale pour un âge donné gestationnel et prématuré sont des risques associés à la cryptorchidie. L’insuffisance placentaire avec une sécrétion de hCG diminuée peut être un facteur sous-jacent, tout comme les faibles niveaux d’estrogènes maternels. Des évidences émergent quant au rôle des facteurs environnementaux dans l’augmentation du risque de cryptorchidie chez les humains. L’exposition par exemple à des organochlorés persistants, des phtalates monoesters et le tabagisme a récemment été liée aux effets néfastes du 23 développement reproducteur infantile. Le diabète maternel, incluant le diabète de grossesse, semble aussi être un facteur de risque à la cryptorchidie. De plus, durant la grossesse, hCG peut remplacer la fonction manquante de la LH, pouvant expliquer pourquoi ce ne sont pas tous les garçons avec l’hypogonadisme hypogonadotropique qui naissent cryptorchides [33].

1.3.2 Dégénérescence tubulaire

Selon Amat et ses collègues [45], deux types de tubules, l’un avec une dégénérescence centrale et l’autre avec une dégénérescence totale, peuvent être identifiés à partir de cinq ans tant dans les testicules cryptorchides que ceux contra-latéraux scrotaux, tous montrant une hyperplasie des cellules de Sertoli (tubules avec plus de 30 cellules de Sertoli par section tubulaire transverse). La dégénérescence centrale a été observée dans 10 à 30 % des tubules des testicules cryptorchides (17 %) et ceux contra-latéraux (8 %). L’épithélium du tubule séminifère de ces tubules consiste en des cellules de Sertoli et germinales résidantes à la membrane basale, plus un groupe de cellules dégénérescentes occupant le centre du tubule. La majorité des cellules de Sertoli reposant sur la membrane basale montre une apparence normale avec des organelles bien conservées. Pour sa part, la dégénérescente totale a été observée dans 5 à 20 % des tubules : 14 % des 15 testicules cryptorchides et 5 % des deux contra-latéraux. Ce second type de dégénérescence affecte les testicules avec une hypoplasie germinale sévère. Quelques tubules montrent seulement une zone de cellules dégénérescentes, même si le processus dégénératif affectait tout le tubule séminifère dans la majorité des cas. Dans quelques tubules, les cellules de Sertoli dégénérescentes gardent une distribution pseudo-stratifiée. Dans d’autres tubules, montrant une dégénérescence plus avancée, plusieurs cellules de Sertoli ont perdu leur contact avec la membrane basale et forment des amas irréguliers. Seule la présence de la membrane basale, plus épaisse que celle trouvée dans la dégénérescence centrale des tubules, suggère la nature des tubules séminifères des amas de cellules de Sertoli. Des tubules partiellement désintégrés avec une destruction des cellules de Sertoli ont aussi été observés. La dégénérescence totale était occasionnellement observée dans les tubules avec les cellules 24 germinales et de Sertoli. Des cellules désintégrées étaient souvent observées dans les stades les plus avancés de dégénérescence tubulaire, ce qui suggère que la dernière étape de la dégénérescence tubulaire complète est la disparition de l’épithélium séminifère. Il en résulte un tubule complètement sclérosé ou une cicatrice fibreuse, qui est fréquemment trouvée dans les testicules de cryptorchides adultes [45].

Ces deux types de dégénérescence peuvent coexister dans le même testicule. Aucune différence n’a été trouvée entre la cryptorchidie unilatérale et celle bilatérale. Le mécanisme menant à la dégénérescence n’est pas clair, mais peut être relié à l’épaississement de la membrane basale [augmentation du nombre des cellules péritubulaires] qui est souvent trouvée dans les testicules cryptorchides [2, 46, 47]. Une membrane basale épaissie est particulièrement évidente dans les tubules dégénérescents. Ces tubules ont une membrane basale qui est plus épaisse que celle des tubules non- dégénérescents. Ainsi, la membrane basale des tubules avec une dégénérescence totale est encore plus épaisse que celle avec une dégénérescence centrale. La membrane basale épaissie peut gêner les échanges métaboliques normaux entre l’épithélium séminifère et l’interstice, causant une dégénérescence tubulaire [2]. La cellule de Sertoli est le type cellulaire le plus résistant de l’épithélium séminifère [48]. Si l’épaississement de la membrane basale n’est pas très marqué, seules les cellules germinales peuvent être affectées, menant à une dégénérescence tubulaire centrale. Par contre, si l’épaississement de la membrane basale est plus prononcé, les cellules de Sertoli seront aussi affectées, menant à une dégénérescence tubulaire complète. L’épaississement de la membrane basale a été apparenté soit à une déficience en gonadotropines [2] ou à l’influence des fibres nerveuses dans la tunica propria [49]. De telles lésions peuvent être trouvées dans les testicules atrophiques avec une étiologie différente, dans laquelle l’altération du tissu conjonctif, incluant celui de la membrane basale et des vaisseaux sanguins, est fréquemment trouvée [45]. Ainsi, dans plusieurs désordres testiculaires associés à la baisse de cellules germinales, le diamètre tubulaire diminue alors que la lamina propria tubulaire subit un épaississement qui se termine en une sclérose tubulaire complète, dans laquelle les cellules de Sertoli et germinales sont complètement disparues [50, 51]. 25

1.3.3 Effet de la température

La descente physiologique du testicule est associée à un refroidissement marqué de son environnement thermique, soit d’environ 4 à 5 °C plus bas que la température abdominale. Lorsque ce processus est interrompu, la température du testicule cryptorchide augmente significativement. Cette hausse de température peut être un facteur concomitant ou principal à l’altération des fonctions testiculaires associées à la cryptorchidie [52]. En effet, la température influence la fonction reproductive masculine en différents points majeurs [53]. Premièrement, l’étape de différenciation des cellules souches (gonocytes) en spermatogonies adultes sombres (Ad) est la plus importante. Cette réserve de cellules souches est essentielle pour que la spermatogenèse puisse avoir lieu à la puberté. Il a été montré qu’un délai d’orchidopexie à 1 ou 2 ans peut drastiquement réduire le nombre de spermatogonies Ad disponibles pour la future spermatogenèse [54, 55]. Une perturbation de cette première étape de différenciation est aussi associée à la transformation des gonocytes en carcinoma in situ (CIS), pouvant mener au cancer testiculaire. La deuxième étape sensible à la chaleur dans la spermatogenèse est la transition des spermatocytes pachytènes en spermatides rondes. Ceci semble peu pertinent pour la cryptorchidie humaine, mais cela a été démontré chez plusieurs modèles expérimentaux, et pourrait être pertinent lorsque la surchauffe testiculaire est possible due à des raisons professionnelles. Une augmentation de la température augmente le risque de dommages oxydatifs à l’ADN des spermatozoïdes en développement, impliqués aussi dans la survie embryonnaire de la progéniture future des mâles affectés [53]. Finalement, la région la plus froide du scrotum est en fait celle de la queue de l’épididyme. Il n’y a pas d’information si la fonction épididymaire et la future maturation des spermatozoïdes est irréversiblement compromise chez l’humain adulte qui a été traité pour la cryptorchidie étant jeune [36].

Les cellules de Sertoli semblent être sensibles à la température, mais les mécanismes impliqués ne sont pas clairs [53]. En fait, la chaleur n’affecte pas directement la synthèse d’ADN des cellules de Leydig et de Sertoli [30], mais les affecte indirectement, via les effets sur les cellules germinales [53]. 26

1.3.4 Conséquences et traitement

Le testicule cryptorchide a un plus grand risque de développer un carcinoma in situ (CIS) ou ultérieurement un cancer testiculaire (séminome) (74 %) [56] et les risques relatifs moyens du testicule ipsi-latéral et contra-latéral pour le cancer testiculaire sont de 6,33 et 1,74, respectivement [57]. Une autre conséquence de cette anomalie est le très grand risque de développer une infertilité irréversible. Tous ces symptômes peuvent être améliorés, en rétablissant la spermatogenèse par des traitements hormonaux ou chirurgicaux [31], comme une orchidopexie peu après la naissance, idéalement dans les six premiers mois de vie [9]. L’orchidopexie est une correction chirurgicale qui consiste à procéder à l'abaissement du testicule à l'intérieur des bourses [9]. C’est l’opération la plus commune chez tous les mâles (jeunes et vieux) [36]. 27

1.4 Cancer testiculaire

1.4.1 Étiologie, incidence et pathogenèse

L’incidence de cancer testiculaire est en augmentation dans la majorité des pays depuis plus de quarante ans et reste une malignité rare, comptant en tout pour 1 à 2 % de toutes les tumeurs chez les hommes, mais le cancer testiculaire est la malignité la plus commune chez les jeunes hommes [58]. Il y a une variation géographique marquée du cancer testiculaire avec la plus grande incidence chez les hommes des pays nordiques et la plus basse chez les hommes du moyen orient et de l’Asie (9,2/100 000 au Danemark; 0,5/100 000 en Égypte) [58, 59]. De toutes les tumeurs testiculaires primaires, 95 % sont des tumeurs des cellules germinales, alors que les autres sont des néoplasmes non-germinales, comme des tumeurs des cellules de Leydig, de Sertoli ou des lymphomes [60]. Pour la majorité des populations, l’incidence de séminome représente à lui seul approximativement la moitié de tous les cancers du testicule [61]. Le séminome a des caractéristiques morphologique et immunologique similaires aux cellules germinales primordiales [62]. Typiquement, l’âge des hommes avec le séminome est de 35 ans [58, 63]. La pathogenèse du cancer testiculaire reste inconnue, mais le facteur de risque le plus fermement établi est la cryptorchidie [60]. Le mécanisme par lequel la cryptorchidie contribue au développement de la malignité n’est pas clair [58], mais statistiquement, 5 % des cancers testiculaires sont associés à cette anomalie [59]. Le risque de développement du cancer dans un testicule cryptorchide n’est pas éliminé par l’orchidopexie, mais semble diminuer ce risque [59].

Une susceptibilité génétique au cancer testiculaire existe [64]. Les tumeurs testiculaires peuvent avoir un nombre de chromosomes triploïde et être caractérisées par des gains spécifiques des chromosomes 7, 8, 12, 21 et X et des pertes spécifiques des chromosomes 11, 13 et 18. Des études ont montré que 80 % des ces tumeurs ont une ou plusieurs copies de l’isochromosome 12p et il semble que celui-ci soit une anormalité structurale chromosomique récurrente de ces tumeurs [64]. Plusieurs autres facteurs de risque ont été identifiés pour les tumeurs des cellules germinales testiculaires (TGCT), plusieurs 28 desquelles ont des influences environnementales ou de style de vie tôt dans le développement. Parmi les conditions associées aux TGCT sont cette tumeur contra-latérale (risque relatif 25), la cryptorchidie (risque relatif 4,8), le cancer testiculaire familial (risque relatif 3-10) et la dysgénésie gonadique. D’autres facteurs sont l’exposition aux hormones maternelles, la première naissance et le faible poids à la naissance [65].

1.4.2 Diagnostic et traitement

L’examen diagnostique obligatoire inclut la palpation testiculaire, ultrasonographie des testicules et la détermination des niveaux des marqueurs sériques alpha-fétoprotéine, beta- hCG et la déshydrogénase lactique [60]. Selon le stade de la tumeur, plusieurs avenues de traitement peuvent être envisagées, mais ne seront pas décrites dans ce document. Malencontreusement, plusieurs études [66, 67] ont démontré que les survivants des TGCT à long terme sont à risque de développer dans des effets toxiques cliniques ou sous- cliniques, comme une malignité secondaire, une maladie cardiovasculaire, le syndrome métabolique, l’hypogonadisme irréversible et une fertilité réduite, une détresse mentale, une augmentation des niveaux d’anxiété et une augmentation de la prévalence des désordres anxieux, des problèmes de fatigue et sexuels. Tout ceci dépend de l’âge du patient au diagnostique, du type de traitement et de la durée du suivi. Avant même que la tumeur maligne soit diagnostiquée, près de 20 % des patients avec TGCT ont déjà de l’hypogonadisme et une fertilité réduite. Grâce au traitement, 70 à 80 % des survivants réussissent à devenir père [60]. 29

1.5 Technique de micropuces à ADN

Pour étudier le transcriptome, le profil d’expresssion des gènes d’un individu, il est possible d’utiliser une micropuce à ADN. Suite à l’extraction de l’ARN total à partir d’un tissu, on effectue une réverse-transcription pour obtenir l’ADNc. Ce dernier est alors marqué d’un fluorochrome, puis hybridé sur la puce d’ADN. Chaque extraction d’ARN de tissu d’un individu doit être placée sur une puce distincte.

Pour cette étude, la puce utilisée est la GeneChip Human Gene 1.0 ST, provenant d’Affymetrix et contenant 28 869 gènes. 30

1.6 Objectif du projet de recherche

Le testicule cryptorchide est caractérisé par un arrêt de la spermatogenèse au stade de spermatogonie adulte sombre (Ad) [68] et par le fait que les cellules germinales y soient pratiquement absentes. L’hypothèse soutenant cette étude est que le transcriptome est différent entre les testicules humains normaux et ceux cryptorchides. Les objectifs étaient de comparer le transcriptome testiculaire humain de ces deux groupes par rapport aux gènes associés au cancer testiculaire, ceux associés aux différents types cellulaires et ceux associés à la descente testiculaire. Avec les ARN des testicules non-descendus retrouvés au niveau inguinal et ceux des testicules normalement descendus, nous avons analysé les changements d’expression globale des gènes par micropuces d’ADN et les voies de signalisation sous-jacentes à l’aide d’une analyse bio-informatique, le tout validé par RT- qPCR. D’autre part, les ARN de séminomes, étant le cancer testiculaire le plus fréquent, ont été aussi étudiés comme points de contrôle pour les transcrits sélectionnés pour être associés au cancer testiculaire ou à la descente testiculaire. D’autres transcrits ont été sélectionnés comme étant reliés à la descente testiculaire.

Chapitre 2 : Effect of cryptorchidism on human testicular transcriptome

Chapitre soumis à la revue Human Reproduction en août 2011.

Résumé de l’article (en français) La cryptorchidie est la malformation congénitale la plus commune chez les nouveaux-nés. Une des conséquences majeures de cette anomalie est l’infertilité masculine due au testicule non-descendu, auquel un risque plus élevé de cancer testiculaire est associé. La signature de l’expression globale des gènes de cette pathologie reste à être élucidée. L’objectif de cette étude était de comparer le transcriptome testiculaire humain normal avec celui cryptorchide. L’ARN total a été extrait de cinq testicules normaux et quatre cryptorchides et utilisés sur les micropuces GeneChip Human Gene 1.0ST d'Affymetrix, qui incluent 28869 gènes. Dans les tissus normaux et cryptorchides, 1801 et 397 gènes étaient surexprimés, respectivement. La catégorie principale d’ontologie génique identifiée est la « spermatogenèse » dans le « processus reproducteur » qui fait partie du « processus biologique », alors que la principale voie identifiée est le cycle cellulaire. Les marqueurs de la descente testiculaire étaient plus exprimés dans les tissus cryptorchides que normaux. Les transcrits connus pour être associés à la spermatogenèse et aux cellules germinales caractérisent les tissus normaux, alors que, dans ceux cryptorchides, les transcrits des cellules de Leydig et de Sertoli étaient en plus grande quantité. Le PCR quantitatif sur les tissus normaux, cryptorchides et séminomes confirme et évalue les niveaux d’expression de plusieurs gènes, incluant ceux étant associés au cancer testiculaire comme PIWIL1 (normal > seminome > cryptorchide), CALR3 (normal > cryptorchide > seminome), KITLG (cryptorchide > normal > seminome), and CCND2 (seminome > cryptorchide > normal). Les différences dans le transcriptome dues à la cryptorchidie vont nous aider à comprendre la cause génétique de cette maladie.

Effect of cryptorchidism on human testicular transcriptome

Marie Eve Bergeron1, Marc Simard1, Christine Légaré1, Luc Boudreau1, Ezequiel Calvo1, Michel Thabet2, and Robert Sullivan1*.

1 Centre de Recherche en Biologie de la Reproduction, Centre de Recherche du CHUQ and Département d'Obstétrique-Gynécologie, and 2Département de chirugie, division urologie, Faculté de Médecine, Université Laval, Sainte-Foy, Québec, Canada G1V 4G2.

Keywords: cryptorchidism; microarray; testicular cancer; testis descent; spermatogenesis.

Running title: Cryptorchidism on human testicular transcriptome

*corresponding author: Centre de Recherche du Centre Hospitalier de l’Université Laval (CHUQ) 2705 Boul. Laurier, T1-49 Quebec City, QC, Canada G1V 4G2 Tel.: (418) 525-4444, ext 46104 Fax: (418) 654-2765 E-mail: [email protected] 33

Abstract BACKGROUND Cryptorchidism is the commonest congenital malformation in newborn boys. One major consequence of this anomaly is male infertility due to undescended testis to which an increased risk of testicular cancer is associated. Global gene expression signature of this pathology remains to be elucidated. The objective of this study was to compare the transcriptome of human normal and cryptorchid testis. METHODS Total RNA was extracted from five normal and four cryptorchid testes and used to probe Affymetrix GeneChip Human Gene 1.0 ST arrays, which include 28,869 genes. RESULTS In normal and cryptorchid tissues 1801 and 397 genes were up-regulated, respectively. The main gene ontology category identified is “spermatogenesis”, in “reproductive process” from “biological process”, whereas the main pathway identified is “cell cycle”. Markers for testicular descent were more expressed in cryptorchid than normal testes, as expected. Transcripts known to be associated with spermatogenesis and germ cells characterized the normal tissues whereas, in cryptorchid testes, transcripts characterizing Leydig and Sertoli cells were found in higher amount. Quantitative PCR was performed on normal, cryptorchid, and seminoma tissues to validate and further evaluate expression levels of several selected genes, including some known to be associated with testicular cancer, such as PIWIL1 (normal > seminoma > cryptorchid), CALR3 (normal > cryptorchid > seminoma), KITLG (cryptorchid > normal > seminoma), and CCND2 (seminoma > cryptorchid > normal). CONCLUSION Differences in transcriptome due to cryptorchidism will give us a clue to find the genetic cause of this disease. 34

Introduction Cryptorchidism is the most common congenital disorder in boys with an incidence of about 1% at 1 year of age [33]. One major consequence of this anomaly is infertility due to the undescended testis. The aetiology of cryptorchidism is mostly idiopathic [36]. Regulation of prenatal testicular descent in humans is not fully understood, but numerous genetic and endocrine factors are involved, such as INSL3 (insulin-like 3) and its receptor RXFP2 (relaxin/insulin-like family peptide receptor 2), androgens, gonadotropins, CGRP (calcitonin gene-related peptide), and AMH (anti-müllerian hormone) [33]. Persistently cryptorchid (inguinal and abdominal) testes are at higher risk for seminoma (74%)[56] and the pooled relative risks in the ipsilateral and contralateral testis for testicular cancer are 6.33 and 1.74, respectively [57].

While testicular cancer remains an uncommon malignancy accounting for 1-2% of all tumours in men, it is the most common malignancy in young men and its incidence has been increasing in most countries over the past four decades [58]. There is marked geographical variation of testicular cancer with the highest incidence among men in Nordic countries and lowest incidence among men in the Middle East and Asia. For most populations, the incidence of seminoma is slightly higher than that of nonseminoma cancers. Typically, the peak age of men with seminoma is 35 years [58, 63]. Pure seminoma represent approximately half of all the testicular cancers [61]. The most firmly established risk factor associated with testicular cancer is cryptorchidism, but the mechanism by which cryptorchidism contributes to the development of malignancy is unclear [58]. Moreover, there is strong evidence to support a genetic susceptibility to testicular cancer because it can be family-related [64].

The hypothesis of this study was that there are differences between the transcriptome of human normal and cryptorchid testes. Using samples from inguinal undescended testes and normal testes, we analysed the global gene expression changes and the underlying biological pathways using microarray technology and bioinformatic tools followed by RT- qPCR to confirm same microarray results. Seminoma testes were also included in RT- qPCR analysis as comparison point for transcripts selected to be associated with testicular 35 cancer. Cryptorchid testis is being characterized by an arrest in spermatogenesis at the adult dark spermatogonia stage [68] and the near absence of germ cells. Therefore, among the genes that are expressed at a higher level in normal than in cryptorchid testis, most of them could be related to germ cells.

Material and methods

Biological material and RNA extraction Normal tissues were obtained with collaboration of our local organ transplantation program after obtaining family consent; the five donors were from 23, 47, 48, 50, and 53 years of age with no medical pathologies that could affect reproductive function. Cryptorchid testes were obtained by surgical orchidectomy performed on 4 patients from 29, 31, 39, and 43 years of age presenting an inguinal testis. Donors of seminoma tissues were 22 and two from 34 years of age and were obtained through the pathological tissues bank of our institution. Tissues samples were kept on ice, dissected on optimal conditions, snap frozen immediately upon arrival in the research lab, and stored at -80°C until used for RNA extraction. Total RNA was extracted from the tissues by TRIzol reagent (Invitrogen, Burlington, ON, Canada) according to manufacturer’s instructions. Total RNA was further purified using RNeasy Mini Kit column (QIAGEN, Mississauga, ON, Canada). RNA integrity was assessed by denatured agarose gel electrophoresis, and purity was determined by an Agilent Bioanalyzer (Agilent Technologies, Mississauga, ON, Canada).

Microarray processing and analysis DNA microarray analyses were carried out with Affymetrix Human Gene 1.0 ST arrays according to the Affymetrix standard protocol. Briefly, total RNA (200 ng per sample) was labeled using the Affymetrix GeneChip® WT cDNA Synthesis and Amplification Kit protocol, and hybridized to the arrays as described by the manufacturer (Affymetrix, Santa Clara, CA). The cRNA hybridization cocktail was incubated at 45°C overnight while rotating in a hybridization oven. After 16 h of hybridization, the cocktail was removed and the arrays were washed and stained in an Affymetrix GeneChip fluidics station 450, according to the Affymetrix-recommended protocol 36

(http://media.affymetrix.com/support/downloads/manuals/wt_sensetarget_label_manual.pdf ). The arrays were scanned using the Affymetrix GCS 3000 7G. To produce the intensity files the Gene-Chip Operating Software was used. Microarray hybridization was carried out at the Microarrays Facility of the Research Center of Laval University CRCHUL. Background subtraction and normalization of probe set intensities were performed using the method of Robust Multiarray Analysis [69] and gene expression intensity was compared using a moderated t-test and a Bayes smoothing approach (developed for a low number of replicates) to identify differentially expressed genes [70]. The false discovery rate (FDR) was estimated from p-values derived from the moderated t-test statistics to correct for the effect of multiple testing [71]. The analysis was performed using the affylmGUI Graphical User Interface for the Limma microarray package [72] and gene ontology analysis was performed using the GO enrichment functionality of Partek Genomics Suite software (version 6.5). To search for pathways, two analyses were made with the software GO-Elite 1.20 Beta [73] and PathVisio [74] (version 2.0.9 Database used: Hs_Derby_20100601).

Real-Time Quantitative PCR and housekeeping genes stability evaluation Four micrograms of total RNA of each testis tissue were used for first-strand cDNA synthesis, using 100 U of Superscript II (Invitrogen), 10 µM hexameric random primer pd[N]6 (Roche Diagnostics, Laval, QC, Canada), RT buffer (50 mM Tris, pH 8.3, 75 mM

KCl, 3 mM MgCl2), 10 mM DTT, and 200 µM deoxynucleoside triphosphate in a final volume of 20 µl. The cDNA was diluted 10X in sterile water and used as the template in the quantitative PCR mixture. Real-time PCR reactions were performed on a LightCycler Instrument (Roche Diagnostics) using Light Cycler FastStart DNA Master SYBR Green I Kits (Roche Diagnostics). PCR primers used are described in Table 1. Reactions were performed in 20 µl containing a final concentration of 0.5 µM of each primer, 3 mM

MgCl2, 2 µl of ready-to-use LightCycler FastStart DNA master SRBR Green I (10X, containing TaqDNA polymerase, reaction buffer, deoxynucleoside triphosphate mix with dUTP instead of dTTP, SYBR Green I dye and 10 mM MgCl2; Roche Diagnostics) and an amount of cDNA sample corresponding to 100 ng of total RNA. The amplification efficiency of PCR reactions was evaluated for each gene. The reaction conditions were as 37 follows: initial denaturation at 95°C for 10 min followed by the indicated cycles (40 cycles if not indicated in Table 1) of denaturation at 95°C for 5 sec, annealing at the temperature indicated in Table 1 for 5 sec, elongation at 72°C for 20 sec, and 5 sec at the indicated temperature for acquisition (Table 1). Fluorescence of each sample was measured to allow quantification of the RNA, followed by a melting curve which was obtained by heating at 20°C/sec to 95°C, with fluorescence data collected at 0.2°C intervals to construct dissociation curves. The last stage is a cool down to 40°C for 30 sec. A standard curve for real-time PCR was prepared for each gene from amplicons diluted in 0.1× reverse transcriptase buffer, i.e. the same concentration as the cDNA samples, as reported in [75], previously obtained by PCR, purified, and sequenced. One dilution used for the corresponding standard curve was included in duplicates in each PCR run. The LightCycler Software version 3.5 (Roche Diagnostics) was used to import standard curves and calculate the amount of PCR products. To ensure an accurate evaluation of the relative gene expression, three housekeeping genes were used (HPRT1, SDHA, and YWHAZ [75, 76], Table 1), based on the approach proposed by Vandesompele et al. [77].

Results Global gene expression analysis in cryptorchid versus normal testes Analysis of microarray hybridization data revealed that among all 33297 probe sets, representing 28869 genes, 1801 and 397 genes were up-regulated in normal and cryptorchid tissues, respectively, by using a stringent p-value threshold of < 0.0005 (Figure 1A). Of note, differential expression results obtained by using a p-value threshold of < 0.05 were also considered and they include information on some genes that are especially relevant in our study, such as INSL3 and CYP17A1. The Figure 1B presents a clustering of the genes that are differentially expressed between normal and cryptorchid individuals. The expression level, represented by the colors, is similar for each gene from individuals of the same group (normal or cryptorchid), thus suggesting homogeneity between individuals from the same group. The 25 genes showing the highest fold change in each group are shown in Table 2. Complete list of genes up-regulated in normal or cryptorchid testes with a p-value < 0.0005 are shown in supplemental data. 38

Gene Ontology and pathways The Gene Ontology (GO) database was used to determine the functions and processes that are represented by the genes differentially expressed in normal and cryptorchid tissues. The categories with the highest enrichment scores in the three main GO domains, namely biological process (BP), molecular function (MF), and cellular component (CC) are presented in Figure 2A, B, and C, respectively. Each category found in either normal or cryptorchid testes are shown.

As shown in Table 3, panel A, “reproductive process” is the main GO category found in the biological process ontology in the normal testes, with “spermatogenesis” showing the highest enrichment score. The second highest category found in the normal testes is “cellular process”, in which “cell cycle process” has the second position for the highest score. In the cryptorchid testes, we found that “metabolic process” is the main category represented, in which “translational elongation” has the highest score, followed by “biological regulation” which includes “positive regulation of transcription from RNA polymerase II promoter”. In the molecular function ontology, shown in Table 3, panel B, the main category found in the normal testes is “binding”, in which there is “unfolded protein binding”, followed by “catalytic activity”, in which “microtubule motor activity” has the highest score. In cryptorchid tissues, “catalytic activity” is the main category in which “oxidoreductase activity” has the highest enrichment score, followed by “transcription regulator activity”. In the cellular component ontology, shown in Table 3, panel C, the main category found in normal testes is “cell part”, which includes “intracellular part”, while the second category is “macromolecular complex”. In cryptorchid testes, the main category is also “cell part”, in which “cytosolic part” has the highest enrichment score, followed by “extracellular region part".

Both analyses on differentially expressed genes (both up- and down-regulated) using GO- Elite and PathVisio revealed three major pathways (with a p-value < 0.0005): “Cell cycle” (Figure 3), “G1 to S cell cycle control”, and “DNA damage response”. For instance, the most represented pathway, cell cycle, includes 34 modulated genes on 87 measured genes, on a total of 94 genes, using PathVisio. Among genes associated to “cell cycle” and “G1 to S phase” pathways, SMAD3 and CCND2 were found to be up-regulated in cryptorchid 39 testes, whereas others encoding some cyclins, M-phase inducer phosphatases (CDC25A and CDC25C), mitotic checkpoint serine/threonine-protein kinases (BUB1 and BUB1B), CDK1 (CDC2), CDC20, and CHEK1, which is required for checkpoint-mediated cell cycle arrest in response to DNA damage or presence of unreplicated DNA, were found to be up- regulated in normal testes. The function of the genes related to these pathways, up- regulated in normal testes, suggests that there is an arrest of cell cycle at the M/G1 phase in cryptorchid testes. In the “DNA damage response” pathway, cyclins of the B and E types, CHEK1, CDC25A, CDC25C, RAD17, RAD51, FANCD2, and BRCA1 are required for DNA repair and maintenance of chromosomal stability and they are expressed at higher levels in normal testes, and only the cyclin D2 is found significantly expressed in cryptorchid testes.

Expression profiles of selected genes As mentioned, the cryptorchid testis is not descended in the scrotum, presents aberrant cell type proportions and is a risk factor for testicular cancer. To address these specific aspects, we selected some genes related to testis descent, to the different testicular cell types, and to testis cancer following an extensive search in the literature and we looked at their expression profiles in the microarray data (Figure 4). Generally, the expression level for each gene is similar in individuals of the same group (normal or cryptorchid). Genes related to testis descent (Figure 4A), to Sertoli and Leydig cells (Figure 4B), and to testis cancer (some of them) (Figure 4C) are expressed at higher levels in cryptorchid than in normal testes whereas genes related to germ cells (Figure 4B) and to testis cancer (several of them) (Figure 4C) are expressed at higher levels in normal than cryptorchid testes. Testis cancer genes are not specifically expressed in either normal or cryptorchid testes, as shown in Figure 4C.

RT-qPCR validations of selected modulated genes in human testis

Testis descent markers Among the selected testis descent markers, we chose those who showed a differential expression level between normal and cryptorchid tissues in microarray data, namely CALCRL (p < 0.0005), FGF10 (p < 0.0005), and INSL3 (p < 0.05) (see Table 1). Other 40 genes were considered but not retained because they not specifically expressed in our microarray results, such as HOXA10, HOXA11, RXFP2, CYP19A1, AR, ESR, GnRHR, ARID5B, AMH [32, 78]. As expected by the microarray results, mRNA levels of the selected genes were found to be higher in cryptorchid than in normal tissues by using RT- qPCR (Figure 5A).

Different testicular cell types TNP1, PRM1, and ADAM2 transcripts were selected to represent germ cells, which are associated with spermatogenesis. These transcripts were found in higher quantity in normal than cryptorchid testes (Figure 5B). While CYP17A1 (p < 0.05), LHCGR, and HSD17B3 transcripts characterizing Leydig cells, GATA4, INHA, and INHBA are expressed by Sertoli cells. In cryptorchid testes, these transcripts were found in higher amount than in normal testes (Figure 5B).

Testicular cancer markers From the 114 markers for testicular cancer identified from an exhaustive literature search, only 21 were significantly different (p < 0.0005) between normal and cryptorchid testes in microarray results (Figure 4C). Among those, PIWIL1 and CALR3, who showed the greater fold change in normal testes, and CCND2 and KITLG, that showed the greater fold change in cryptorchid testes (see Table 1), were selected for RT-qPCR confirmations. The microarray and RT-qPCR results showed that the transcript levels of PIWIL1 and CALR3 were up-regulated in normal tissues whereas KITLG and CCND2 were more expressed in cryptorchid testes (Figure 5C). The PIWIL1, CALR3, and KITLG transcripts were detected at lower levels in seminoma tissues, used as positive control for those genes, than in other tissues, whereas CCND2 was much more expressed in cancer tissues (inset panel of Figure 5C).

Discussion

The present work is the first one to report the consequences of cryptorchidism on the global testicular transcriptome in human. However, other studies addressed specific aspects of gene transcription in the context of cryptorchidism in human and in animal models. Indeed, Nguyen et al. [68] published data about genes that are differentially expressed between 41 normal and cryptorchid ejaculates. Thirteen out of the 42 genes identified in Nguyen’s study were detected at higher levels in normal than in cryptorchid testes in our datasets, and are all related to germ cells. About a hundred genes identified in studies from Matzuk and Lamb on the regulation of fertility in mouse [79] were also found to be differentially expressed in our datasets. In a report from von Kopylow et al. [80] in which markers of spermatogonia were investigated in human, about half of the 339 identified genes were also found to be expressed at higher levels in normal than in cryptorchid testis in our study. In another study, Kogo et al. [81] screened 726 genes related to meiosis of which 230 were also found to be differentially expressed in our study (227 in normal, 3 in cryptorchid). Several other studies also investigated the expression of genes that have or may have a role in cryptorchidism and male infertility [82-84]. Our study presents differential gene expression between normal and cryptorchid testes in human, thus adding significantly to the field by confirming results obtained by others and by presenting new genes and pathways that may be related to testicular descent, to the germ cells and to testicular cancer.

Analysis of the 397 genes expressed at higher levels in cryptorchid testes and of the 1801 genes expressed at higher levels in normal testes revealed that “spermatogenesis” is the GO category with the highest score. Indeed, this specific category includes 292 genes and 47 of them were identified in our datasets, including CCND2, TNP1, PRM1, and PIWIL1. Also, pathway analyses revealed that “cell cycle” is the most represented pathway among differentially expressed genes. The germ cells are the only cells in adult testis that pass through cell cycle by mitosis and meiosis. Indeed, the final number of Leydig cells achieved during puberty remains largely unchanged throughout life with subsequently no detectable cell division or cell death [18], whereas only immature Sertoli cells proliferate, in fetal or neonatal life and in the peripubertal period, so the final number of Sertoli cells is determined before adulthood [16]. Therefore, several genes that are upregulated in the normal testis could be associated to the germ cells and are candidates for further studies on gene expression of this crucial cell type.

Several markers of testis descent, including CALCRL, FGF10 and INSL3, were expressed at very low levels in normal and seminoma testes (data not shown), but showed higher expression levels in cryptorchid testes. Interestingly, this could mean that the adult inguinal 42 testis still “tries to pull down” the testis to the scrotum, without success. The genitofemoral nerve releases CGRP, the ligand of CALCRL, and has been proposed to be implicated in the inguinoscrotal descent of the testis by acting on the gubernaculum [85]. CGRP is likely to be essential for the growth, direction, and migration of the rat gubernaculum [86]. However, this may not be the case in human where the gubernaculum almost completely lacks the muscle cells that are the very site of CGRP activity [87]. The peak of cell proliferation of the rodent gubernaculum is both CGRP- and androgen-dependent, thus suggesting that a precise interplay between CGRP and androgens may be crucial for correct inguinoscrotal testicular descent [86]. In addition, exogenous CGRP is able to prevent apoptosis of the mesenchymal cells in the tip of the rat gubernaculum, an effect that is potentially aided by androgen [88]. Moreover, for most tissues expressing CALCRL, the exact physiological significance of the receptor is not clear. However, in the testis, no CALCRL could be detected within the seminiferous tubules, but Leydig cells displayed moderate staining [89]. The protein encoded by FGF10 gene is a member of the fibroblast growth factor (FGF) family. Those family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumour growth and invasion. Studies of the mouse homolog suggested that this gene is required for embryonic epidermal morphogenesis including initiation of limb bud formation [85]. Some regulatory factors involved in development of the limb bud are present in the developing male gubernaculum. The finding of a putative “progress zone” in the gubernacular tip supports the notion that elongation of the gubernaculum to the scrotum may be similar to limb bud elongation [90]. Hoxa10 and Fgf10 may be required in the gubernaculum to stimulate the free subcutaneous migration after dissolution of surrounding extracellular matrix and of the gubernaculum as observed in humans by Heyns [91], but how Fgf10 and Hoxa10 are involved in the inguinoscrotal descent remains to be determined [85]. Recent studies showing a direct role for androgenic “preprogramming” of the gubernaculum [86] is consistent with expression of the limb bud regulators in the gubernaculum of male fetuses [85]. In the testis, the persistence of stem cell populations through adulthood probably depends on the survival of quiescent cells, as well as on the ability of cycling cells to self- renew. Evidences indicate that FGF10 plays a role in stem cell survival and stimulates cell- 43 proliferation [92]. For instance, FGF10 maintains the stem-cell compartment in the developing incisor tooth germ [92] and may exert a similar role in the developing testis. The protein encoded by the INSL3 gene, which has a higher expression in cryptorchid than normal testes, is an insulin-like hormone produced mainly by gonadal tissues in males and females. Studies in mice suggest that this gene may be involved in the development of the urogenital tract and in female fertility [93]. It may also regulate growth and differentiation of the gubernaculum, and thus mediate intra-abdominal testicular descent. Mutations in this gene or its receptor may lead to cryptorchidism, although it is not a frequent cause with less than 2% [94]. In the testis, INSL3 expression is restricted to Leydig cells [33]. An interesting feature of INSL3 expression is that it appears to be independent of acute regulation by hormonal factors, and is thus independent of the feedback regulation by the hypothalamic-pituitary-gonadal axis. It is important to differentiate this acute situation from longer term regulation that involves, for instance, differentiation or dedifferentiation processes [18]. Also, even if most male germ cells undergo apoptosis, INSL3 is a survival factor for these cells by interacting with the RXFP2 receptor expressed in meiotic germ cells [95].

An important aspect to consider in the interpretation of our data is that the normal testis comprises three main cell types (Leydig, Sertoli and germ cells) while the cryptorchid testis has mainly two cell types (Leydig and Sertoli), with very few germ cells that are not fully differentiated. Peritubular cells are also found in normal and cryptorchid testes, but are not well characterized [96]. There is a negative correlation between the thickness of the lamina propria and the degree of achievement of spermatogenesis. Indeed, in many testicular disorders associated with germ cell depletion, the tubular diameter decreases while the tubular lamina propria undergoes a progressive enlargement that ends in a complete tubular sclerosis [50], leading to the complete loss of germ and Sertoli cells [51]. Consequently, one has to consider these different cell proportions and structural differences between normal and cryptorchid testes and be cautious in the interpretation of expression results. Messenger RNAs detected at higher levels in cryptorchid testes may indeed be expressed at higher levels in this tissue, or they may be expressed at a similar level by the same cell population(s) and be detected as differentially expressed between normal and cryptorchid 44 testes because of the lack of differentiated germ cells in the latter. For instance, transcripts expressed by Leydig and Sertoli cells, such as CYP17A1, LHCGR, HSD17B3, GATA4, INHA, and INHBA, are expressed in both normal and cryptorchid testes, but results obtained by microarray and RT-qPCR suggest that they are expressed at higher levels in cryptorchid testes. A similar situation was observed for LHCGR, which is known to be expressed by somatic cells in the gonads, but not by germ cells [95]. Also, transcripts associated to germ cells, such as TNP1, PRM1, and ADAM2, were found at much higher levels in normal than cryptorchid testes. Thus, these differential transcript levels could be explained by the different ratios of cell types between the studied tissues.

Testicular cancer being a potential consequence of cryptorchidism, we looked at the expression levels of some selected testicular cancer markers in our expression datasets from normal and cryptorchid testes. PIWIL1 and CALR3 transcripts showed higher expression in normal testes, and CCND2 and KITLG showed higher expression in cryptorchid testes. The PIWIL1 gene encodes a member of the PIWI subfamily of Argonaute proteins that play important roles in stem cell self-renewal, RNA silencing, and translational regulation in diverse organisms. The encoded protein may play a role as an intrinsic regulator of the germline stem cell maintenance and meiosis. However, neither the biochemical function of Piwi proteins nor the nature of their small RNA guides is known [97]. Different isoforms have been found for this gene and mutation in any of the piwi genes causes loss of germ cells due to increased apoptosis [98]. Increased expression of PIWIL1 was observed in testicular tumours originating from embryonic germ cells with retention of germ cells phenotype and no expression of PIWIL1 was found in testicular tumours of somatic origin, such as Sertoli cell and Leydig cell tumours [99]. Moreover, a Chinese epidemiologic study supports the involvement of genetic polymorphisms in Piwi genes in spermatogenic failure [100]. The testicular cancer marker, Crt isoform 2 (formerly CRT2, newly symbolized as CALR3) was identified in human and mouse and shows testis-specific expression [101], more precisely in elongate spermatids from normal testis [102]. Calreticulins, such as CALR3, are Ca2+-binding chaperones localized mainly in the endoplasmic/sarcoplasmic reticulum [101]. Because these genes are implicated in germline regulation and differentiation, we expected and confirmed that PIWIL1 and CALR3 transcripts are 45 expressed at higher levels in normal than in cryptorchid testes, as shown in Figure 5C. The KITLG gene encodes the ligand of the tyrosine-kinase receptor c-KIT, and both are involved in haematopoiesis, melanogenesis, and gametogenesis. In the testis, KITLG is expressed by Sertoli cells and its receptor is expressed by spermatogonia and Leydig cells [103]. Indeed, KITLG plays an important role in migration, adhesion, proliferation, and survival of primordial germ cells and spermatogonia during testicular development [104] whereas KIT, a proto-oncogene, is involved in migration and differentiation of primordial germ cells. The pathogenesis of carcinoma in situ (CIS) development may be tightly connected to, among others, the expression of the KIT receptor, which is not detectable in the adult testis [105]. There is no difference between the normal and cryptorchid expression levels of the KIT receptor in our microarray results, as the tissues used in this study were from adult men. The two transcript variants encoding different isoforms of the ligand were considered as one in our microarray and RT-qPCR experiments and were found in higher levels in cryptorchid testes. As for KITLG transcripts, cryptorchid testes show elevated levels of cyclin D2 (CCND2) transcripts. The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. Cyclin D2 forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumour suppressor protein Rb. D-type cyclins are proto-oncogenic components of the 'RB pathway', a G1/S regulatory mechanism centred around the retinoblastoma tumour suppressor (pRB) implicated in key cellular decisions that control cell proliferation, cell-cycle arrest, quiescence, and differentiation [106].

The expression patterns of these four testicular cancer-related genes were investigated by quantitative real-time PCR in normal, cryptorchid, and seminoma testis samples (Figure 5ABC). Between normal and seminoma tissues, only the cyclin D2 was found to be expressed at higher levels in the seminoma tissues (upper panel of Figure 5C). High levels of cyclin D2 were previously observed in testicular tumours and its involvement in the 46 early stages of testicular oncogenesis was suggested [106]. These results may be explained by the fact that markers for cancer are not universal and/or by the heterogeneity of the seminoma samples, which were obtained from only three individuals with different age: one of 22 and two of 34 years old. A genetic susceptibility to testicular cancer is evidenced by an increased risk in brothers, fathers, and twin brothers of testicular cancer cases [64]. Testicular tumours have a chromosome number in the triploid range and are characterized by specific chromosomal gains at chromosomes 7, 8, 12, 21 and X, and by specific chromosomal losses at chromosomes 11, 13 and 18. Studies have shown that 80% of testicular tumours have one or more copies of isochromosome 12p (i(12p)) and it seems that i(12p) is the recurrent structural chromosomal abnormality of these tumours [64]. The i(12p) is mainly represented in the amplified 12p11.2-12.1 region [107]. Cyclin D2, which is located on the chromosome 12p13, is the only transcript from our microarray results that reflect the theory of the i(12p) [108]. Moreover, in our results, transcripts over-expressed in normal testes on chromosome 12 are located from 12p11.21 to 12p13.33, whereas transcripts over-expressed in cryptorchid testes are located on 12p11.2, 12p11.23-p12.1, 12p13, and 12p13.31. Further research is needed into the emerging role of the cyclin D proteins in the establishment and/or maintenance of the differentiated phenotypes [106]. 47

Conclusion

Transcript expression patterns from the microarrays were confirmed by quantitative real- time PCR with different kind of genes selected: some related to testis descent markers, the different testicular cell types, or testicular cancer markers. Testicular descent markers mRNAs are still expressed in adult cryptorchid testes whereas less expression was detected in both normal and seminoma testes, meaning that adult inguinal testis still “tries to pull down” the testis to the scrotum without success. The genes involved in this process may also play a role in the survival of germ cells. The subtractive bank analysis of normal versus cryptorchid transcriptome allows us to identify genes specifically expressed in the testicular germ cell line, more precisely in differentiated germ cells. Some transcripts known to be associated with testicular cancer, such as CALR3 and PIWIL1, were up- regulated in normal testes whereas KITLG and CCND2 were more expressed in cryptorchid testes, whereas only the CCND2 transcript was more expressed in cancer tissue than in other tissues. The effect of cryptorchidism on testicular transcriptome gives us clues of the genetic causes of this disease. Further studies assisted with our data should identify interesting genes to understand what is going on genetically to explain the cause of cryptorchidism and the management during germ cells development. 48

Acknowledgements

The collaboration of Québec Transplant nurses and coordinator as well as of associated surgeons is acknowledged. Dr. Bernard Têtu and Michelle Orain for providing the seminoma samples are also acknowledged.

Conflict of interests

None to declare.

Funding

This work was supported by Canadian Institute of Health Research grant to Robert Sullivan.

Author’s roles

Marie Eve Bergeron : execution, analysis, manuscript drafting, and critical discussion Marc Simard : help in manuscript drafting and critical discussion Christine Légaré : participation in study design and critical discussion Luc Boudreau: execution Ezequiel Calvo : treatment of microarray results Michel Thabet : extraction of cryptorchid tissues Robert Sullivan : participation in study design and critical discussion

References

Akre, O., Pettersson, A. and Richiardi, L. Risk of contralateral testicular cancer among men with unilaterally undescended testis: a meta analysis. International journal of cancer 2009, 124, 687-689. Albrecht, M. Insights into the nature of human testicular peritubular cells. Ann Anat 2009, 191, 532-540. Bartkova, J., Rajpert-de Meyts, E., Skakkebaek, N. E. and Bartek, J. D-type cyclins in adult human testis and testicular cancer: relation to cell type, proliferation, differentiation, and malignancy. The Journal of pathology 1999, 187, 573-581. Benjamini, Y., Drai, D., Elmer, G., Kafkafi, N. and Golani, I. Controlling the false discovery rate in behavior genetics research. Behavioural brain research 2001, 125, 279-284. Chan, J. J., Farmer, P. J., Southwell, B. R., Sourial, M. and Hutson, J. M. Calcitonin gene- related peptide is a survival factor, inhibiting apoptosis in neonatal rat gubernaculum in vitro. Journal of pediatric surgery 2009, 44, 1497-1501. Eble J.N., S. G., Epstein J.I., Sesterhenn I.A. Pathology and Genetics of Tumours of the Urinary System and Male Genital Organs. 2004. IARC Press, Lyon. Ferlin, A., Zuccarello, D., Garolla, A., Selice, R., Vinanzi, C., Ganz, F., Zanon, G. F., Zuccarello, B. and Foresta, C. Mutations in INSL3 and RXFP2 genes in cryptorchid boys. Annals of the New York Academy of Sciences 2009, 1160, 213-214. Figueroa, J. D., Sakoda, L. C., Graubard, B. I., Chanock, S., Rubertone, M. V., Erickson, R. L. and McGlynn, K. A. Genetic variation in hormone metabolizing genes and risk of testicular germ cell tumors. Cancer Causes Control 2008, 19, 917-929. Garner, M. J., Turner, M. C., Ghadirian, P. and Krewski, D. Epidemiology of testicular cancer: an overview. International journal of cancer 2005, 116, 331-339. Girard, A., Sachidanandam, R., Hannon, G. J. and Carmell, M. A. A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 2006, 442, 199-202. Gu, A., Ji, G., Shi, X., Long, Y., Xia, Y., Song, L., Wang, S. and Wang, X. Genetic variants in Piwi-interacting RNA pathway genes confer susceptibility to spermatogenic failure in a Chinese population. Human reproduction (Oxford, England) 2010, 25, 2955-2961. Hagner, S., Stahl, U., Knoblauch, B., McGregor, G. P. and Lang, R. E. Calcitonin receptor- like receptor: identification and distribution in human peripheral tissues. Cell and tissue research 2002, 310, 41-50. Haider, S. G., Talati, J. and Servos, G. Ultrastructure of peritubular tissue in association with tubular hyalinization in human testis. Tissue & cell 1999, 31, 90-98. Harada, H., Toyono, T., Toyoshima, K., Yamasaki, M., Itoh, N., Kato, S., Sekine, K. and Ohuchi, H. FGF10 maintains stem cell compartment in developing mouse incisors. Development (Cambridge, England) 2002, 129, 1533-1541. Hayashi, E., Matsuzaki, Y., Hasegawa, G., Yaguchi, T., Kurihara, S., Fujita, T., Kageshita, T., Sano, M. and Kawakami, Y. Identification of a novel cancer-testis antigen CRT2 frequently expressed in various cancers using representational differential analysis. Clin Cancer Res 2007, 13, 6267-6274. 50

Heyns, C. F. The gubernaculum during testicular descent in the human fetus. Journal of anatomy 1987, 153, 93-112. Hughes, I. A. and Acerini, C. L. Factors controlling testis descent. European journal of endocrinology / European Federation of Endocrine Societies 2008, 159 Suppl 1, S75-82. Irizarry, R. A., Hobbs, B., Collin, F., Beazer-Barclay, Y. D., Antonellis, K. J., Scherf, U. and Speed, T. P. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics (Oxford, England) 2003, 4, 249- 264. Ivell, R. and Anand-Ivell, R. Biology of insulin-like factor 3 in human reproduction. Human reproduction update 2009, 15, 463-476. Ivell, R. and Hartung, S. The molecular basis of cryptorchidism. Molecular human reproduction 2003, 9, 175-181. Kawamura, K., Kumagai, J., Sudo, S., Chun, S. Y., Pisarska, M., Morita, H., Toppari, J., Fu, P., Wade, J. D., Bathgate, R. A. et al. Paracrine regulation of mammalian oocyte maturation and male germ cell survival. Proceedings of the National Academy of Sciences of the United States of America 2004, 101, 7323-7328. Khurana, J. and Theurkauf, W. piRNA function in germline development. 2008, Melton D, Girard L, editors. StemBook [Internet]. Cambridge (MA): Harvard Stem Cell Institute. Kogo, H., Kowa-Sugiyama, H., Yamada, K., Bolor, H., Tsutsumi, M., Ohye, T., Inagaki, H., Taniguchi, M., Toda, T. and Kurahashi, H. Screening of genes involved in chromosome segregation during meiosis I: toward the identification of genes responsible for infertility in humans. Journal of human genetics 2010, 55, 293-299. Kojima, Y., Mizuno, K., Kohri, K. and Hayashi, Y. Advances in molecular genetics of cryptorchidism. Urology 2009, 74, 571-578. Kurpisz, M., Havryluk, A., Nakonechnyj, A., Chopyak, V. and Kamieniczna, M. Cryptorchidism and long-term consequences. Reproductive biology 2010, 10, 19-35. Levy, J. B. and Husmann, D. A. The hormonal control of testicular descent. Journal of andrology 1995, 16, 459-463. Manecksha, R. P. and Fitzpatrick, J. M. Epidemiology of testicular cancer. BJU international 2009, 104, 1329-1333. Matzuk, M. M. and Lamb, D. J. The biology of infertility: research advances and clinical challenges. Nature medicine 2008, 14, 1197-1213. Na, A. F., Harnaen, E. J., Farmer, P. J., Sourial, M., Southwell, B. R. and Hutson, J. M. Cell membrane and mitotic markers show that the neonatal rat gubernaculum grows in a similar way to an embryonic limb bud. Journal of pediatric surgery 2007, 42, 1566-1573. Nef, S. and Parada, L. F. Cryptorchidism in mice mutant for Insl3. Nature genetics 1999, 22, 295-299. Nguyen, M. T., Delaney, D. P. and Kolon, T. F. Gene expression alterations in cryptorchid males using spermatozoal microarray analysis. Fertility and sterility 2009, 92, 182- 187. Nightingale, S. S., Western, P. and Hutson, J. M. The migrating gubernaculum grows like a "limb bud". Journal of pediatric surgery 2008, 43, 387-390. 51

Ohl, F., Jung, M., Xu, C., Stephan, C., Rabien, A., Burkhardt, M., Nitsche, A., Kristiansen, G., Loening, S. A., Radonic, A. et al. Gene expression studies in prostate cancer tissue: which reference gene should be selected for normalization? Journal of molecular medicine (Berlin, Germany) 2005, 83, 1014-1024. Orwig, K. E., Ryu, B. Y., Master, S. R., Phillips, B. T., Mack, M., Avarbock, M. R., Chodosh, L. and Brinster, R. L. Genes involved in post-transcriptional regulation are overrepresented in stem/progenitor spermatogonia of cryptorchid mouse testes. Stem cells (Dayton, Ohio) 2008, 26, 927-938. Patel, S. R., Kvols, L. K. and Richardson, R. L. Familial testicular cancer: report of six cases and review of the literature. Mayo Clinic proceedings 1990, 65, 804-808. Persson, S., Rosenquist, M. and Sommarin, M. Identification of a novel calreticulin isoform (Crt2) in human and mouse. Gene 2002, 297, 151-158. Qiao, D., Zeeman, A. M., Deng, W., Looijenga, L. H. and Lin, H. Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas. Oncogene 2002, 21, 3988-3999. Reuter, V. E. Origins and molecular biology of testicular germ cell tumors. Mod Pathol 2005, 18 Suppl 2, S51-60. Rothschild, G., Sottas, C. M., Kissel, H., Agosti, V., Manova, K., Hardy, M. P. and Besmer, P. A role for kit receptor signaling in Leydig cell steroidogenesis. Biology of reproduction 2003, 69, 925-932. Salomonis, N., Hanspers, K., Zambon, A. C., Vranizan, K., Lawlor, S. C., Dahlquist, K. D., Doniger, S. W., Stuart, J., Conklin, B. R. and Pico, A. R. GenMAPP 2: new features and resources for pathway analysis. BMC bioinformatics 2007, 8, 217. Sato, Y., Nozawa, S. and Iwamoto, T. Study of spermatogenesis and thickening of lamina propria in the human seminiferous tubules. Fertility and sterility 2008, 90, 1310- 1312. Sharpe, R. M., McKinnell, C., Kivlin, C. and Fisher, J. S. Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction (Cambridge, England) 2003, 125, 769-784. Shenker, N. S., Huynh, J., Farmer, P. J. and Hutson, J. M. A new role for androgen in testicular descent: permitting gubernacular cell proliferation in response to the neuropeptide, calcitonin gene-related peptide. Journal of pediatric surgery 2006, 41, 407-412. Simard, M., Boucher, E., Provost, P. R. and Tremblay, Y. Minimization of PCR efficiency differences between standards and samples through dilution of PCR amplicons in reverse transcription buffer. Analytical biochemistry 2007, 362, 142-144. Smyth, G. K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical applications in genetics and molecular biology 2004, 3, Article3. Unni, S. K., Modi, D. N., Pathak, S. G., Dhabalia, J. V. and Bhartiya, D. Stage-specific localization and expression of c-kit in the adult human testis. J Histochem Cytochem 2009, 57, 861-869. van Iersel, M. P., Kelder, T., Pico, A. R., Hanspers, K., Coort, S., Conklin, B. R. and Evelo, C. Presenting and exploring biological pathways with PathVisio. BMC bioinformatics 2008, 9, 399. 52

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. and Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome biology 2002, 3, RESEARCH0034. von Kopylow, K., Kirchhoff, C., Jezek, D., Schulze, W., Feig, C., Primig, M., Steinkraus, V. and Spiess, A. N. Screening for biomarkers of spermatogonia within the human testis: a whole genome approach. Human reproduction (Oxford, England) 2010, 25, 1104-1112. Wettenhall, J. M., Simpson, K. M., Satterley, K. and Smyth, G. K. affylmGUI: a graphical user interface for linear modeling of single channel microarray data. Bioinformatics (Oxford, England) 2006, 22, 897-899. Wood, H. M. and Elder, J. S. Cryptorchidism and testicular cancer: separating fact from fiction. The Journal of urology 2009, 181, 452-461. Wu, X., Schmidt, J. A., Avarbock, M. R., Tobias, J. W., Carlson, C. A., Kolon, T. F., Ginsberg, J. P. and Brinster, R. L. Prepubertal human spermatogonia and mouse gonocytes share conserved gene expression of germline stem cell regulatory molecules. Proceedings of the National Academy of Sciences of the United States of America 2009, 106, 21672-21677. Yan, W. Male infertility caused by spermiogenic defects: lessons from gene knockouts. Molecular and cellular endocrinology 2009, 306, 24-32. Yan, W., Suominen, J. and Toppari, J. Stem cell factor protects germ cells from apoptosis in vitro. Journal of cell science 2000, 113 (Pt 1), 161-168.

Figures

Figure 1. (A) Venn diagram. Comparison between clusters of genes differentially expressed in normal and cryptorchid testes at p-value < 0.0005. (B) Cluster representation of the microarray results from each normal and cryptorchid testes analyzed by ANOVA (analysis of variance) and FDR (false discovery rate) with p-value < 0.0005. The red color represents a higher different expression of a gene while the gray represents the mid expression and the blue the lesser expression. Each row represents an individual from the normal or cryptorchid group, with their respective age in parenthesis, and each column represents a gene.

Figure 2. Gene ontology of microarray results with p-value < 0.0005 of the 397 genes overexpressed in cryptorchid testis and the 1801 genes overexpressed in normal testis with the enrichment score for each category: (A) in biological processes, (B) in molecular functions, and (C) in cellular components.

Figure 3. Cell cycle pathway from PathVisio2. In blue, genes more expressed in normal testes with a fold change > 2; in red, genes more expressed in cryptorchid testes with a fold change < 0.5; in yellow, other genes found in microarray results, with fold change < 2 and > 0.5; in gray, genes not included or not recognized in microarray. Pathway from WikiPathway (Hs_Cell_cycle_WP1749_34663.gpml) was last modified on 10/02/2002 in GenMAPP 2.0, used with Hs_Derby_20100601.bridge as gene database in PathVisio 2.0.9.

Figure 4. The clusters represent the disposition of the microarray results related to the genes (vertically), and the groups (horizontally), from normal and cryptorchid individuals with their age. (A) Cluster of possible testis descent genes selected from literature with a p-value < 0.05. (B) Cluster of Germ, Sertoli and Leydig cell markers selected from literature with a p-value < 0.015. (C) Cluster of cancer-related genes selected from literature with p-value < 0.0005.

Figure 5. (A) Selected gene expression of testis descent markers of normal and cryptorchid donors. (B) Gene expression of different testicular cell types (germ, Leydig and Sertoli cells) of normal and cryptorchid donors. (C) Selected gene expression of testicular cancer markers of normal and cryptorchid donors. Gene expression is quantified as normalized fold change determined by microarray analysis (blue bars) and relative mRNA levels by RT-qPCR (red bars) performed on the same total RNA extracts. Transcript levels were normalized by a factor generated from the expression levels of the three most stable housekeeping genes studied (HPRT1, SDHA, and YWHAZ) using the geNorm software. Mean ± SEM values of duplicate data using testicular tissues from five normal and four cryptorchid donors are shown. 54

Table I: Oligonucleotide primers used in PCR assays. GenBank Tm1 Other Symbol GenBank Name no Sequences Amplicon (°C) condition hypoxanthine phosphoribosyltransferase NM_000194 forward: TGACACTGGCAAAACAATGCA 94 bp 59 Tacq2: 78 °C HPRT1 1 reverse: GGTCCTTTTCACCAGCAAGCT House- tyrosine 3-monooxygenase/tryptophan NM_003406 forward: AGACGGAAGGTGCTGAGAAA 127 bp 59 Tacq2: 76 °C keeping YWHAZ 5-monooxygenase activation protein, genes zeta polypeptide reverse: GAAGCATTGGGGATCAAGAA succinate dehydrogenase complex, NM_004168 forward: TACAAGGTGCGGATTGATGA 175 bp 59 Tacq2: 83 °C SDHA subunit A, flavoprotein (Fp) reverse: CACAGTCAGCCTCGTTCAAA forward: CALCRL calcitonin receptor-like NM_005795 CAGAGAAGCAACATTTAATGTGG 259 bp 60 - reverse: TTCATGTACAGATTGGATTCCG Testis 38 cycles, 8 descent 3 FGF10 fibroblast growth factor 10 NM_004465 forward: GCGGGAAGGCATGTGCGGA 150 bp 62 sec markers reverse: ACTGCCCGTACAGCATCCTGGAG NM_005543 forward: CCCAGAGATGCGTGAGAA 278 bp 62 4% DMSO INSL3 insulin-like 3 (Leydig cell) reverse: CACTGAGGCAGCAGTAG transition protein 1 (during histone to NM_003284 forward: ACCATGTCGACCAGCCGCAA 181 bp 65 - TNP1 protamine replacement) reverse: CCACTTGTGAGCCCCCAGCG Germ NM_002761 forward: GCAGCCAGAGCCGGAGCAGA 119 bp 60 - PRM1 protamine 1 cells reverse: TCGCGGTCTGTACCTGGGGC NM_001464 forward: TGCCAGTGCTCAGGAGCTGTCT 454 bp 60 - ADAM2 ADAM metallopeptidase domain 2 reverse: TCAGTCCACACGGATGCCCAGT cytochrome P450, family 17, subfamily NM_000102 forward: TGGCGTGGAGACCACCACCT 325 bp 60 - CYP17A1 Leydig A, polypeptide 1 reverse: ATCCGGCTGGTGCCACTCCT cells luteinizing hormone/choriogonadotropin NM_000233 forward: GGCCACAGGGCCGAAAACCT 183 bp 63 15 sec3 LHCGR receptor reverse: GCACAGCAGTGGCTGGGGTA 60

hydroxysteroid (17-beta) dehydrogenase NM_000197 forward: CTGCCTGGCGAAGTGCGTGA 386 bp 60 - HSD17B3 3 reverse: CCGGTGCGTTCAGGAAATGGCT 15 sec3, 4% GATA4 GATA binding protein 4 NM_002052 forward: AACCGGCCGCTCATCAAGCC 296 bp 63 DMSO reverse: TTGCTGGAAGCACCGCTGGC Sertoli NM_002191 forward: TGGAGCTGGCCCGGGAACTT 311 bp 58 - cells INHA inhibin, alpha reverse: CTGGCGGCTGCGTGTATGCT NM_002192 forward: TGTCACCCAGCCGGTACCCA 346 bp 65 - INHBA inhibin, beta A reverse: TGTGTCCAAGCTGCCCTGCG NM_004764 forward: ACGTGATGAAAGACTTAGCC 251 bp 57 - PIWIL1 piwi-like 1 (Drosophila) reverse: ACCTCTTGTTTCTTTGGACC NM_145046 forward: GCTTCAAACCGTTCAGCAA 264 bp 55 - Testicular CALR3 calreticulin 3 reverse: AGCCATCAACCTTACACC cancer NM_000899 forward: GGGATCTGCAGGAATCG 259 bp 57 - markers KITLG KIT ligand, transcript variant a and b NM_003994 reverse: CCACAAGGTCATCCACTAT NM_001759 forward: CATGAATTACCTGGACCGT 255 bp 57 - CCND2 cyclin D2 reverse: CGCAAGATGTGCTCAATG *All pair of primers were verified with the blast tool from NCBI to bind the exact transcript wanted. 1Tm: annealing temperature (melting tempertaure) 2Tacq: acquisition temperature 3sec: secondes in elongation 61

Table II: Top 25 genes more expressed in normal (fold change > 2) and in cryptorchid (fold change < 0.5) with p-value < 0.0005, sorted by fold change. AffyID ACC SYMBOL CYTOBAND DESCRIPTION PVALUE FOLD CHANGE 8058866 NM_003284 TNP1 2q35-q36 Spermatid nuclear transition protein 1 3,56E-09 64,28467743 7999440 NM_002761 PRM1 16p13.2 protamine 1 4,27E-09 44,3443225 7905530 NM_030663 SMCP 1q21.3 sperm mitochondria-associated cysteine-rich protein 8,11E-09 43,7325631 8147717 NM_024410 ODF1 8q22.3 outer dense fiber of sperm tails 1 4,27E-09 41,61839719 7999435 NM_002762 PRM2 16p13.2 protamine 2 1,47E-09 40,94457762 7922737 NM_030933 C1orf14 1q25.3 chromosome 1 open reading frame 14 1,01E-05 39,74176386 cyclin-dependent kinase inhibitor 3 (CDK2-associated 7974404 NM_005192 CDKN3 14q22 dual specificity phosphatase) 2,18E-07 38,50857947 11p15.5- 7938788 NM_002301 LDHC p15.3 lactate dehydrogenase C 1,57E-05 35,93628825 8090152 NM_017578 ROPN1 3q21.1 Ropporin-1A 3,17E-08 35,83296452 8126916 NM_138733 PGK2 6p12.3 phosphoglycerate kinase 2 1,19E-08 34,41328001 8104492 NM_031916 ROPN1L 5p15.2 ropporin 1-like 3,95E-07 34,0301711 7906154 NM_144627 C1orf182 1q22 chromosome 1 open reading frame 182 3,12E-07 33,74990415 8150395 NM_001464 ADAM2 8p11.2 ADAM metallopeptidase domain 2 (fertilin beta) 3,73E-07 30,71771506 8172660 NM_003886 AKAP4 Xp11.2 A kinase (PRKA) anchor protein 4 4,41E-09 30,26324951 8126891 NM_003296 CRISP2 6p21-qter cysteine-rich secretory protein 2 9,91E-09 29,70999588 7959856 NM_004764 PIWIL1 12q24.33 piwi-like 1 (Drosophila) 7,02E-06 29,01250578 7982552 NM_152453 TMCO5 15q14 transmembrane and coiled-coil domains 5 8,77E-09 28,71267819 8025011 NM_030924 ACSBG2 19p13.3 acyl-CoA synthetase bubblegum family member 2 4,27E-09 26,91472911 8066384 NM_176791 GTSF1L 20q13.12 gametocyte specific factor 1-like 1,70E-08 25,68334133 7902934 NM_207189 BRDT 1p22.1 bromodomain, testis-specific 4,26E-06 25,39361703 8101256 NM_033214 GK2 4q13 glycerol kinase 2 7,13E-08 25,36061805 7996313 NM_144673 CMTM2 16q21 CKLF-like MARVEL transmembrane domain containing 2 2,00E-07 25,34148213 7959484 NM_201435 CCDC62 12q24.31 coiled-coil domain containing 62 2,18E-07 25,26924229 62

8092187 NM_031955 SPATA16 3q26.31 spermatogenesis associated 16 4,35E-08 24,51719457 8104014 NM_152775 CCDC110 4q35.1 coiled-coil domain containing 110 2,57E-07 24,33471545 cartilage intermediate layer protein, nucleotide 7989750 NM_003613 CILP 15q22 pyrophosphohydrolase 5,47E-06 0,300288785 7938225 NM_198474 OLFML1 11p15.4 olfactomedin-like 1 1,93E-06 0,297865203 8097692 NM_001957 EDNRA 4q31.23 endothelin receptor type A 6,04E-07 0,295425548 7953200 NM_001759 CCND2 12p13 cyclin D2 7,02E-06 0,295353784 8147573 NM_053001 OSR2 8q22.2 odd-skipped related 2 (Drosophila) 1,09E-05 0,294212103 7990333 NM_000781 CYP11A1 15q23-q24 cytochrome P450, family 11, subfamily A, polypeptide 1 1,74E-05 0,293480489 8063444 ENST00000371497 TSHZ2 20q13.2 teashirt zinc finger homeobox 2 1,99E-06 0,292564677 7922598 NM_004673 ANGPTL1 1q25.2 angiopoietin-like 1 3,06E-05 0,290561307 8091078 NM_002899 RBP1 3q23 retinol binding protein 1, cellular 6,00E-05 0,28974597 8112333 NM_000524 HTR1A 5q11.2-q13 5-hydroxytryptamine (serotonin) receptor 1A 7,82E-06 0,285752495 8150698 NM_003068 SNAI2 8q11 snail homolog 2 (Drosophila) 3,38E-06 0,28215347 7916609 NM_002228 JUN 1p32-p31 Transcription factor AP-1 1,24E-04 0,273282124 gi|17981852|ref|NC_001807.4|:5513-5580; gene=TRNW; 7896748 NC_001807 NA NA product=tRNA-Trp 5,43E-05 0,270698913 7976783 NM_003836 DLK1 14q32 delta-like 1 homolog (Drosophila) 2,50E-05 0,269290082 8092726 NM_021101 CLDN1 3q28-q29 claudin 1 9,11E-05 0,266973231 8111864 NM_001115131 C6 5p13 complement component 6 4,54E-06 0,262901905 pleckstrin homology domain containing, family H (with 8041644 NM_172069 PLEKHH2 2p21 MyTH4 domain) member 2 5,41E-07 0,250419098 7922130 NM_001937 DPT 1q12-q23 dermatopontin 9,83E-07 0,219804755 8102831 NM_032623 C4orf49 4q31.1 Uncharacterized protein C4orf49 1,57E-05 0,197770959 8162584 ENST00000384546 NA NA U6 spliceosomal RNA; ncrna:snRNA 5,66E-06 0,197416571 8121916 NM_032784 RSPO3 6q22.33 R-spondin 3 homolog (Xenopus laevis) 5,25E-08 0,182117126 8052058 NM_000233 LHCGR 2p21 luteinizing hormone/choriogonadotropin receptor 1,07E-04 0,179584968 7903777 NM_000851 GSTM5 1p13.3 glutathione S-transferase M5 1,91E-06 0,1795597 8058857 NM_000599 IGFBP5 2q33-q36 insulin-like growth factor binding protein 5 7,15E-05 0,152864414 7937148 NR_030170 MIR202 10q26.3 microRNA 202 3,03E-05 0,136463261 63

Table III: Concise table of GO highest score in normal and cryptorchid testes. Table A - Biological Process

ES1 in ES 1 in N2 C3 GO ID GO category gene symbols (N2 / C3) N2 C3 all (sign) sign sign ADAM29, ADC, AKAP3, AKAP4, CCNA1, CCT6B, DNALI1, ELL3, MAK, MEA1, Reproductive 22414 49.30 0.00 159 (26) 24 2 MTL5, MYCBPAP, OAZ3, PKDREJ, PRM1, PRM2, PTTG1, ROPN1B, RPL10L, process RPL39L, SPATA3, SPATA4, TCFL5, YBX2 / NFIA, USP9Y. ADAM29, ADC, CCNA1, CCT6B, ELL3, MAK, MEA1, MTL5, MYCBPAP, OAZ3, 7283 -> Spermatogenesis 60.90 - 93 (21) 20 1 PRM1, PRM2, PTTG1, ROPN1B, RPL10L, RPL39L, SPATA3, SPATA4, TCFL5, YBX2 / USP9Y. ACR, ACSBG2, AKAP3, AKAP4, AP4M1, BAP1, BIRC5, BOLL, BRD1, BRD8, BTG4, CAMK4, CCNA1, CCR6, CCT6B, CDC25C, CDCA5, CDKN3, CETN1, CIT, CLTCL1, CNTROB, CRAT, DBF4, DDX39, DNAH17, DNAH2, DNALI1, ELL3, FAAH, FBXO25, FBXO31, FOXM1, GALNT3, GEMIN4, GPX4, IGHMBP2, IL13, KIF2C, LAMP3, 3149 MYST2, NEK2, NEK4, PABPC3, PBK, PCYT2, PGAM2, PGK2, PHKG2, PINK1, PLK1, 9987 Cellular process 10.78 1.00 75 21 (95) POMT1, PPEF1, PPM1G, PRKCZ, PTTG1, ROPN1B, RUVBL2, SENP1, SLC7A7, SMPD2, SMURF1, SPTBN2, SYCE2, TBP, TCFL5, TEX2, THOC4, TNP1, TUBG1, WBP2NL, YBX1, YBX2, ZNF259 / AKR1C3, ATRX, CAMKK2, CKMT2, ECE1, EDNRA, EMP2, GSN, HLF, INHBA, KDM4A, LTBP4, NOTCH2, NT5E, OBSL1, PDGFRB, PGCP, PLA2G4A, PLAGL1, PPAP2B, PRKACB. BIRC5, BOLL, BTG4, CCNA1, CDCA5, CDKN3, CETN1, CIT, CNTROB, DBF4, KIF2C, 22402 -> Cell cycle process 32.06 - 221 (18) 15 3 PBK, PLK1, PPM1G, SYCE2 / INHBA, NOTCH2, PLAGL1. APH1B, CDC25C, CYB5R2, DBF4, GALNT3, GK2, GPX4, IGHMBP2, MYST2, NME5, 8152 Metabolic process 0.14 10.53 926 (26) 20 6 NUP98, PDE3B, POLB, POLG2, POLH, POMT1, SENP1, SLC2A5, SMURF1, TYMS / AKR1C3, ATRX, ECE1, MMP2, PGCP, PPAP2B. RPL26L1 / EEF1A1, EEF1D, EEF2K, RPL10, RPL10A, RPL11, RPL12, RPL13A, RPL14, -> Translational RPL15, RPL18, RPL18A, RPL21, RPL22, RPL23, RPL23A, RPL24, RPL26, RPL27, 6414 0.00 19.09 105 (47) 1 46 elongation RPL27A, RPL31, RPL34,RPL35A, , RPL36A, RPL39, RPL41, RPL5, RPL6, RPL9, RPLP1, RPS11, RPS14, RPS15, RPS16, RPS17, RPS19, RPS2, RPS21, RPS25, RPS27, 64

RPS27A, RPS29, RPS3, RPS3A, RPS4X, RPS4Y1.

ACR, AKAP4, ALDH1A2, ALS2CR12, BAP1, BIRC5, BOLL, BRD8, BTG4, CAMK4, CCR6, CDC25C, CDC42EP3, CDKL2, CDKN3, CSDA, DLEC1, EIF4G3, ELL3, FBXO31, FOXM1, GAPDHS, GRK4, HCFC2, IL13, KDM5B, MTL5, MYST2, NEK2, NPY5R, 3594 NSUN7, PDE3B, PIK3CG, PINK1, PLK1, POLH, PRKCZ, ROPN1B, SAMD4A, SENP1, 65007 Biological regulation 0.00 4.64 53 20 (73) SH3GL3, SMURF1, STAT4, TCFL5, TEX2, THOC4, TNP1, TUBG1, TYMS, UBN1, YBX2, ZBTB32, ZNF259 / ADCYAP1R1, ATRX, CAMKK2, CSRNP3, ECE1, EDNRA, F10, FGF10, GSN, HEXIM1, IGFBP6, INHBA, ITPR1, LTBP4, NFIA, NOTCH2, PDGFRB, PLAGL1, PRKACB, PRKCA.

-> Positive regulation of transcription from 45817 0.06 6.27 106 (4) 1 3 ELL3 / CSRNP3, INHBA, PLAGL1. RNA polymerase II promoter

1ES: Enrichment score; 2N: normal testis; 3C: cryptorchid testis

Table B - Molecular Function ES1 in ES1 in N2 C3 GO ID GO category gene symbols (N2 / C3) N2 C3 all (sign) sign sign

ACR, ADAM2, ADAM30, AGFG1, AKAP1, AKAP3, ALS2CR12, APH1B, ASAP2, ATP1A3, BAP1, BAT3, BIRC5, BOLL, CCDC136, CCHCR1, CCNA1, CCT6B, CDC25C, CDC42EP3, CDCA5, CDKN3, CDR2, CETN1, CNTROB, COIL, CSDA, CSNK2A2, DBF4, DDX20, DDX39, DKKL1, DPCD, EIF4G3, ELL3, ERO1LB, FAM3B, FBXO31, FBXW5, FOXM1, GAPDHS, GEMIN4, GGA1, GLE1, GMCL1L, HMOX2, HOOK1, HSPA4L, ICA1, IGHMBP2, IL13, IPO4, KDM5B, KIF2C, LRRC50, LYAR, MAST2, MEA1, MKRN1, MTL5, MYCBPAP, MYO9A, MYST2, NEK2, NSUN7, NUP188, 5930 NUP98, ODF2, PABPC3, PBK, PDE3B, PFKP, PIK3CG, PINK1, PLK1, POLB, POLG2, 5488 Binding 5.23 0.87 116 36 (153) POLH, PRKCZ, PRM1, PRM2, PSMG1, PTTG1, RAB11FIP5, RFX2, ROPN1B, RUVBL2, SENP1, SEPT12, SH3GL3, SLC26A8, SMURF1, SOCS7, SPIRE1, SPTBN2, SRRT, STAT4, SYCE2, TBP, TCFL5, TDP1, THOC4, TNP1, TOPBP1, TPD52L3, TTC25, TUBA3C, TUBG1, USP2, VRK3, WBP2NL, WDR16, YBX1, ZBTB32, ZMYND10, ZNF165 / ATP10D, ATRX, CAMKK2, CDH11, DPT, EBF1, ECE1, ERGIC1, F10, FGF10, FLRT2, GSN, HEXIM1, HLF, INHBA, ISLR, ITPR1, KDM4A, LTBP4, MMP2, NFIA, NID2, NOTCH2, OBSL1, PDGFRB, PHACTR2, PLAGL1, PRKACB, PRKCA, PYGM, SVIL, TRIM2, USP9Y, WBP5, ZFPM2, ZMYM3.

-> unfolded protein 51082 8.60 1.86 59 (3) 3 0 CCT6B, ERO1LB, RUVBL2 /. binding 66

ACR, ACSBG2, ADCY10, APH1B, ATP1A3, ATP8B3, BAP1, CAPN11, CDC25C, CDKN3, CIT, CYB5R2, DDX20, DNAH17, DNAH2, DNAI1, DNAI2, DNALI1, ERO1LB, FAAH, FBXO25, GALNT3, GAPDHS, GK, GK2, GPX4, HMOX2, IGHMBP2, KIF2C, NEK2, NEK4, NME5, PBK, PCYT2, PDE3B, PDHA2, PFKP, PGAM2, PGK2, PHKG2, 3824 Catalytic activity 2.65 11.10 2318 (73) 54 19 PIK3CG, PINK1, PLK1, POLB, POLH, PPEF1, PPM1G, RUVBL2, SENP1, SMPD2, SMURF1, TDP1, TYMS, USP2 / AKR1C3, ATP10D, ATRX, CAMKK2, CKMT2, EDNRA, F10, GSTA4, IDS, KDM4A, MMP2, NT5E, PGCP, PLA2G4A, PAP2B, PRKACB, PYGM, RHOBTB3, USP9Y. -> Microtubule 3777 22.87 0.07 30 (5) 5 0 DNAH17, DNAH2, DNAI2, DNALI1, KIF2C /. motor activity -> oxidoreductase 16491 0.00 11.78 332 (7) 6 1 CYB5R2, ERO1LB, GAPDHS, GPX4, HMOX2, PDHA2 / AKR1C3. activity BRD8, CSDA, ELL3, FOXM1, HCFC2, KDM5B, PHTF1, PTTG1, STAT4, TBP, TCFL5, transcription 30528 0.13 7.54 892 (24) 16 8 THOC4, TUBG1, UBN1, YBX1, ZBTB32 / CSRNP3, KDM4A, LDB2, MAF, NFIA, regulator activity NOTCH2, PRRX1, ZFPM2. 1ES: Enrichment score; 2N: normal testis; 3C: cryptorchid testis

Table C - Cellular Component ES1 in ES1 in N2 C3 GO ID GO category gene symbols (N2 / C3) N2 C3 all (sign) sign sign ABHD1, ACR, ACSBG2, ACTL7A, ADAM2, ADAM29, ADAM30, ADCY10, AGBL2, AGFG1, AKAP1, AKAP4, ALDH1A2, AP4M1, APH1B, ATP1A3, ATP8B3, BAP1, BIRC5, BOLL, BRD1, BRD8, BSCL2, C1orf49, C21orf59, CAMK4, CCDC104, CCDC135, CCNA1, CCR6, CDC25C, CDC42EP3, CDCA5, CDKN3, CETN1, CETN3, CNTROB, COIL, COX6B2, CRAT, CSDA, CYB5R2, CYLD, DBF4, DDX20, DDX39, DLEC1, DNAH17, DNAH2, DNAI1, DNAI2, DNALI1, EIF4G3, ELL3, ERO1LB, FBXO25, FBXO31, FSCN3, GALNT3, GEMIN4, GK, GLE1, GPX4, HCFC2, HMOX2, HOOK1, HVCN1, ICA1, IL13, IPO4, IZUMO1, KDM5B, KIF2C, LAMP3, LASS3, LRRC50, MEMO1, MYCBPAP, MYST2, NCAPH, NEFM, NEK2, NEK4, NPY5R, NSUN7, NUP98, PABPC3, PDE3B, PFKP, PHYHIPL, PINK1, PKDREJ, PLK1, POLB, 6730 44464 Cell part 5.55 6.96 145 45 POLG2, POLH, POMT1, PPM1G, PRKAR2A, PRKCZ, PRM1, PRM2, PSMG1, PTTG1, (190) RAB11FIP5, RNF32, ROPN1B, RPL10L, RPL39L, RSPH1, RUVBL2, SENP1, SEPT12, SLC26A8, SLC2A14, SLC2A5, SLC6A16, SLC7A7, SMPD2, SMURF1, SPTBN2, SSNA1, STAT4, SYCE2, TBP, TCFL5, TDP1, TEX2, TKTL2, TNP1, TOPBP1, TSGA14, TSPAN16, TTC25, TUBG1, TYMS, UBN1, USP2, USP44, WBP2NL, YBX2, ZBTB32, ZMYND10, ZMYND12, ZNF259 / ADCYAP1R1, AHNAK, AKR1C3, ATP10D, ATRX, C7orf58, CAMKK2, CKMT2, CLCN5, CSRNP3, ECE1, EDNRA, EMP2, ERGIC1, F10, FGF10, FLRT2, GPR124, GSN, HEXIM1, HLF, ITGA8, ITPR1, KDM4A, LAMB2, LDB2, MAF, MAOB, MMP2, NFIA, NOTCH2, NT5E, OBSL1, PGCP, PLA2G4A, PLEKHH2, PPAP2B, PRKACB, PRKCA, SVIL, TMEFF2, TMEM47, TRIM2, TSHZ1, ZMYM3. 68

ACR, ACSBG2, ACTL7A, ADCY10, AGBL2, AGFG1, AKAP1, AKAP4, ALDH1A2, AP4M1, APH1B, ATP1A3, BAP1, BIRC5, BOLL, BRD1, BRD8, BSCL2, C1orf49, C21orf59, CAMK4, CCDC104, CCDC135, CCNA1, CDC25C, CDC42EP3, CDCA5, CDKN3, CETN1, CETN3, CNTROB, COIL, COX6B2, CRAT, CSDA, CYLD, DBF4, DDX20, DDX39, DLEC1, DNAI1, EIF4G3, ELL3, ERO1LB, FBXO25, FBXO31, FSCN3, GALNT3, GEMIN4, GK, GPX4, HCFC2, HOOK1, ICA1, KDM5B, KIF2C, LAMP3, LASS3, MEMO1, MYCBPAP, MYST2, NCAPH, NEFM, NEK2, NEK4, NSUN7, 4840 NUP98, PABPC3, PDE3B, PFKP, PHYHIPL, PINK1, PLK1, POLB, POLG2, POLH, 44424 -> Intracellular part 32.51 6.98 116 32 (148) POMT1, PPM1G, PRKAR2A, PRKCZ, PRM1, PRM2, PSMG1, PTTG1, RAB11FIP5, RNF32, ROPN1B, RPL10L, RPL39L, RSPH1, RUVBL2, SENP1, SEPT12, SLC2A14, SMURF1, SPTBN2, SSNA1, STAT4, SYCE2, TBP, TCFL5, TDP1, TKTL2, TNP1, TOPBP1, TSGA14, TTC25, TUBG1, TYMS, UBN1, USP44, WBP2NL, YBX2, ZBTB32, ZMYND10, ZNF259 / AHNAK, ATRX, C7orf58, CKMT2, CSRNP3, ECE1, ERGIC1, FGF10, GSN, HEXIM1, HLF, ITPR1, KDM4A, LAMB2, LDB2, MAF, MAOB, MMP2, NFIA, NOTCH2, NT5E, OBSL1, PGCP, PLA2G4A, PLEKHH2, PPAP2B, PRKACB, PRKCA, SVIL, TRIM2, TSHZ1, ZMYM3.

44445 -> cytosolic part 0.01 15.64 105 (2) 2 0 RPL10L, RPL39L /. macromolecular 32991 3.68 2.20 77 (4) 4 0 ACR, BIRC5, FAM186B, NEK2 /. complex extracellular region 44421 0.00 5.25 423 (10) 2 8 CRISP2, DKKL1 / FGF10, FLRT2, INHBA, LAMB2, LTBP4, MMP2, NID2, PGCP. part 1ES: Enrichment score; 2N: normal testis; 3C: cryptorchid testis 69

Chapitre 3 : Discussion complémentaire et conclusions

3.1 Discussion complémentaire

Dans la discussion de l’article, il est déjà fait mention des différents gènes associés à la descente testiculaire ou au cancer testiculaire, mais tout n’est pas dit. Cette section fera aussi mention des gènes associés aux différents types cellulaires ainsi que d’autres aspects à considérer, incluant la proportion des types cellulaires.

3.1.1 Gènes associés à la descente testiculaire

En plus des résultats obtenus par RT-qPCR, une analyse par immunobuvardage de type Western sur des extraits protéiques traités à la kératine d’homogénats de tissus provenant de testicules normaux et cryptorchides indique clairement que la protéine CALCRL (récepteur de CGRP) est beaucoup plus abondante dans le testicule cryptorchide que normal (données non montrées). Ceci corrobore les résultats obtenus avec l’ARNm par micropuces et RT-qPCR.

La cryptorchidie peut résulter d’une suppression combinée d’INSL3 et de testostérone plutôt que seulement la suppression d’INSL3. Ceci peut expliquer le manque d’études chez l’humain du rôle clé des mutations ou polymorphismes d’INSL3 dans les cas de cryptorchidie et va dans le même sens que les concepts courants qui suggèrent que les désordres, comme la cryptorchidie, viennent d’une dysfonction fondamentale plutôt que d’un simple défaut des cellules de Leydig et/ou de Sertoli [109].

Pour que la spermatogenèse se produise normalement, le testicule développe de nouvelles cellules de la lignée germinale, soit en renouvelant le stock de spermatogonies de type A ou en leur différenciation en spermatogonies de type B. Dans le testicule cryptorchide, même ces cellules sont incapables de se différencier, car un mécanisme encore inconnu inhibe ce processus. Ceci peut être le commencement d’une tumeur. En effet, les cellules carcinoma in situ (CIS) sont de grandes cellules avec un nucléole distinct, qui sont placées en un 70 patron typique d’un seul rang à la membrane basale épaissie des tubules séminifères [65]. Ainsi, cette membrane basale présentant un diamètre réduit peut mener au développement de CIS et ultimement à celui du cancer testiculaire. Cette membrane basale épaissie peut être vue avant le développement de CIS dans le testicule cryptorchide.

3.1.2 Gènes associés au cancer testiculaire

Le récepteur aux androgènes (AR) est lié au cancer testiculaire, mais aussi à l’infertilité, tout comme KITLG et PRM1 [79, 110]. Une mutation dans le gène c-kit mène au non- développement des cellules germinales primordiales dans les souris mutantes, mais l’ARNm est aussi exprimé dans les spermatogonies postnatales [11], et des modifications génétiques dans le locus encodant le ligand chez l’humain est lié au risque de cancer testiculaire [110]. De plus, l’interaction entre le ligand et son récepteur est requise pour le maintien et la prolifération des spermatogonies différenciées exprimant le récepteur, mais pas pour l’étape précédant l’initiation de la différenciation des spermatogonies [110]. Aussi, comme le cancer testiculaire (séminome) est une dérégulation des cellules germinales, il serait donc plausible de penser que les gènes reliés à ces cellules soient déréglés et non pas ceux reliés à d’autres types de cellules.

3.1.3 Gènes associés aux différents types cellulaires

3.1.3.1 Gènes associés aux cellules germinales

Les gènes associés aux cellules germinales sont beaucoup plus exprimés dans les testicules normaux que dans ceux cryptorchides, tant dans les résultats de l’analyse par micropuces que par les résultats de RT-qPCR.

3.1.3.1.1 TNP1 Plusieurs espèces, incluant l’humain, ont résolu le problème d’entrer leur ADN paternel dans un aussi petit noyau en changeant la configuration de l’empaquetage de l’ADN à sa base : en passant des histones aux protamines [111]. De nombreuses études ont démontré 71 qu’un remplacement anormal des protamines est associé à une qualité spermatique globalement diminuée, incluant un compte réduit, une habileté à féconder réduite et une augmentation des dommages à l’ADN [112]. Ainsi, il n’est pas étonnant de constater qu’il y a moins de transcrits de TNP1 (transition protein 1) dans les testicules cryptorchides. C’est le gène ayant la plus grande différence entre le testicule normal et cryptorchide. La protéine produite par ce gène est nécessaire au maintien de la spermatogenèse normale [113], puisque c’est une protéine de transition spécifique aux spermatides et qu’elle permet de remplacer une histone. Celle-ci sera par la suite remplacée par une protamine dans spermatozoïde mature. La protéine de transition TNP1 est la plus petite et est très conservée chez les mammifères, au niveau des séquences nucléotidiques et en acides aminés [114].

3.1.3.1.2 PRM1 Les protamines sont la classe de protéines nucléaires prédominante dans le spermatozoïde mature [115]. On retrouve deux protamines, protamine 1 (PRM1) et protamine 2 (PRM2), dont le ratio PRM1 sur PRM2 est près de 1, allant de 0,8 à 1,2. Un ratio anormal indique une infertilité masculine, généralement caractérisée par une faible qualité de la semence, une augmentation des dommages à l’ADN et une fertilité diminuée [112]. Par les résultats des micropuces, on retrouve une différence d’expression de 44 pour PRM1 et de 41 pour PRM2 entre le testicule normal et cryptorchide. Étant donné qu’un testicule normal devrait avoir un ratio de 1, on peut conclure que le ratio des testicules cryptorchides n’est pas de 1. L’incorporation de protamines anormales dans la chromatine peut temporairement affecter la transcription de d’autres gènes où la dérégulation des protamines cause une condensation de la chromatine précoce, un arrêt de la transcription et un échec spermatogénique [112].

3.1.3.1.3 ADAM2

Les gènes de la famille ADAM (a disintegrin and metalloproteases) sont distribués dans une variété de tissus dont près de la moitié sont exclusivement ou principalement exprimés dans le testicule [116]. Ceux-ci sont connus comme étant essentiels pour la fécondation et le développement cellulaire, de même que pour plusieurs autres processus biologiques comme le cancer, l’inflammation et la neurogenèse. Leurs protéines ont plusieurs domaines multifonctionnels supportant leurs fonctions distinctes, dont le domaine désintégrine qui 72 semblerait impliqué dans la régulation de fusion membranaire et l’adhésion cellule-cellule. La protéine la mieux caractérisée de cette famille qui médie l’interaction spermatozoïde- ovule est la fertiline, hétérodimère composée d’une sous-unité alpha (ADAM1) et bêta (ADAM2). Malgré son importance, la fertiline reste controversée chez les primates, dont l’expression d’ADAM1 chez certains est non-fonctionnelle et prévient la présentation d’ADAM2 à la surface du spermatozoïde [117]. Toutefois, le transcrit et la protéine de ADAM2 sont détectés dans les spermatogonies primordiales (PSG) et les transcrits de cette famille sont restreints à la lignée des PSG [118]. Il y a des relations complexes entre les ADAM exprimés dans les cellules spermatogéniques et les spermatozoïdes, telles que des différences dans une ADAM mène à des réductions dans les niveaux de plusieurs autres qui apparaissent à la surface spermatique. Ainsi, le phénotype observé par la délétion du gène ADAM2 chez la souris est l’infertilité masculine et des défauts dans la migration et l’adhésion du spermatozoïde. Toutefois, la protéine ADAM2 n’est pas essentielle à la fusion avec l’ovule, mais est impliquée dans ce processus [119].

3.1.3.2 Gènes associées aux cellules de Leydig

Les gènes associés aux cellules de Leydig sont plus exprimés dans les testicules cryptorchides que dans ceux normaux, tant dans les résultats de l’analyse par micropuces que par les résultats de RT-qPCR.

3.1.3.2.1 LHCGR L’hormone lutéinisante (LH) et la choriogonadotropine (hCG) lient le même récepteur, LHCGR. Il est un membre de la famille des récepteurs couplés aux protéines G [120]. Ce récepteur active la stéroïdogenèse dans les cellules de Leydig [121], mais est aussi exprimé dans les spermatozoïdes humains éjaculés [120]. Chez les salmonidés, ce gène pourrait jouer un rôle dans des stades ultérieurs et/ou durant la spermiogenèse [121]. Des mutations dans ce gène mènent à des anomalies de la différenciation sexuelle, de la puberté ou de la fertilité. On retrouve l’agénésie ou l’hypoplasie des cellules de Leydig, l’hypogonadisme hypogonadotropique dont fait partie la cryptorchidie, le pseudohermaphrodisme mâle avec des défauts des cellules de Leydig et la puberté précoce mâle familiale, aussi connue comme testotoxicose [122]. 73

De plus, la cryptorchidie par délétion de ce gène chez la souris peut être causée par des défauts dans le développement du gubernaculum à cause de la déficience en testostérone. Ces souris avaient les testicules au niveau inguinoscrotal, suggérant que l’axe hypothalamo-hypophyso-testiculaire fait partie de la deuxième phase de la descente [32]. Il est à noter qu’une déficience en INSL3 aurait le même effet sur la deuxième phase de descente testiculaire que la testostérone. Ainsi, le gène LHCGR aurait pu faire partie des gènes associés à la descente testiculaire, mais celui-ci n’avait pas été regardé pour cette association au départ.

3.1.3.2.2 CYP17A1 Le gène CYP17A1 encode un membre de la superfamille d’enzymes des cytochromes P450. Cette protéine est liée au réticulum endoplasmique lisse. Elle a des activités de 17- alpha-hydroxylase et 17,20-lyase et est une enzyme clé dans la voie stéroïdogénique [123]. Des mutations dans ce gène sont associées aux déficiences en stéroïdes 17-alpha- hydroxylase, 17-alpha-hydroxylase/17,20-lyase, menant au pseudohermaphrodisme et à l’hyperplasie adrénale [124]. De plus, après la différenciation du testicule, la gonade devient impliquée dans la stéroïdogenèse, qui semble être gonadotropine-indépendant. Dans la gonade embryonnaire murine, l’expression de plusieurs transcrits d’enzymes stéroïdogéniques, dont Cyp17a1, a augmenté dans les derniers stades du développement testiculaire embryonnaire. Ces changements ne sont pas présents dans l’ovaire [125].

3.1.3.2.3 HSD17B3 La famille des gènes 17-bêta- hydroxystéroïde déshydrogénase (17bêtaHSD) comprend différentes enzymes impliquées dans la biosynthèse d’hormones stéroïdiennes. L’isoenzyme HSD17B3 (17bêtaHSD3) catalyse la conversion de l’androstenedione en testostérone dans les cellules de Leydig. Des mutations de ce gène mènent à un désordre du développement sexuel, la déficience en HSD17B3. Les patients sont classés comme femelle à la naissance, mais développent des caractéristiques secondaires mâles à la puberté [126].

3.1.3.3 Gènes associées aux cellules de Sertoli

Les gènes associés aux cellules de Sertoli sont plus exprimés dans les testicules cryptorchides que dans ceux normaux, tant dans les résultats de l’analyse par micropuces que par les résultats de RT-qPCR.

3.1.3.3.1 GATA4 Ce gène appartient à la famille GATA qui s’est conservée avec l’évolution et code pour un facteur de transcription en doigts de zinc [127]. Les membres de cette famille reconnaissent le motif WGATAR qui est présent dans le promoteur de plusieurs gènes, dont celui de CYP17 [3, 128]. L’ARNm et la protéine de GATA4 sont détectés dans le testicule de souris en développement jusqu’à l’âge adulte et se localisent dans les cellules de Sertoli (plus fortement) et de Leydig [129]. Dans le testicule pré-pubère, la protéine GATA4 est abondamment exprimée dans le noyau des cellules de Sertoli et des spermatogonies, alors que peu de cellules de Leydig l’expriment. Après la puberté, GATA4 n’est plus détecté dans les cellules germinales, mais le devient dans les cellules de Leydig [128] et diminue durant la vie adulte dans les cellules de Sertoli [130]. L’AMH est le marqueur de la formation testiculaire et le promoteur de ce gène a été la première cible connue de GATA4 dans les cellules de Sertoli [130]. Ainsi, il n’est pas étonnant que ce gène soit impliqué tôt dans le développement testiculaire, dans la différenciation sexuelle mâle et la stéroïdogenèse des mammifères [3, 130, 131]. C’est donc un régulateur transcriptionnel clé de la fonction du testicule fœtal et adulte, donc des cellules de Sertoli [131]. Par contre, ce gène n’est pas lié au cancer, puisqu’il n’est pas exprimé dans les tumeurs de type séminome [128]. Selon notre étude, GATA4 est plus exprimé (de l’ordre de 2 fois) dans les testicules cryptorchides que normaux.

3.1.3.3.2 INHA Ce gène encode la sous-unité alpha des complexes protéiques que sont les inhibine-A et -B. Ces glycoprotéines inhibent, par rétrocontrôle négatif, la sécrétion de la FSH provenant de l’hypophyse [132]. L’expression des sous-unités alpha et bêta par les cellules de Sertoli est contrôlée par plusieurs facteurs de transcription [133]. 75

3.1.3.3.3 INHBA La sous-unité bêta A de l’inhibine-A se joint à la sous-unité alpha (INHA) pour former un inhibiteur de la sécrétion de la FSH provenant de l’hypophyse [132]. L’expression de l’ARNm de la sous-unité bêta-A est cyclique dans le tubule séminifère, étant exprimé aux stades VII-XII chez l’humain, dans les cellules de Sertoli, les cellules de Leydig [133] et aussi les cellules péritubulaires [134]. En outre, cette sous-unité bêta-A forme un homodimère, l’activine A, et peut aussi se joindre à la sous-unité bêta-B pour former un hétérodimère, l’activine AB, dont les deux protéines stimulent la sécrétion de la FSH [133]. Ainsi, cette sous-unité n’est pas le meilleur choix qui a été fait pour montrer la proportion cellulaire des cellules de Sertoli, mais concorde toutefois avec celle-ci.

3.1.4 Autres aspects à considérer

Du point de vue technique : Étant donné que la technique de micropuces est très sensible et moins spécifique et pour s’assurer que les résultats ne sont pas des faux positifs, l’expression de gènes candidats doit être confirmée par une autre technique qui mesure aussi l’ARNm, comme le RT-qPCR. Pour cette méthode, on doit pouvoir normaliser les résultats des gènes sélectionnés par rapport à des gènes constitutifs ne variant pas significativement entre les différents tissus utilisés. Les gènes HPRT1, SDHA et YWHAZ sont présents parmi les 26 671 gènes qui ne varient pas avec un p-value de 0,0005, ni avec avec un p-value de 0,05. Étant donné le peu d’échantillons disponibles pour cette étude et la variabilité entre les divers tissus (normaux, cryptorchides et séminomes), un seul gène pour normaliser n’aurait pas permis une aussi bonne normalisation. Pour les gènes sélectionnés, les niveaux d’expression mesurés par RT-qPCR étaient égaux ou supérieurs à ceux mesurés par les micropuces. Ceci peut être attribuable au fait que les signaux de fluorescence des micropuces peuvent devenir saturés et donc montrer une sous-estimation des résultats.

Du point de vue génique : Durant la spermatogenèse, le développement des cellules germinales implique des changements d’expression génique. Généralement, les gènes spécifiques au testicule peuvent être triés en trois groupes, basés sur leur profil 76 d’expression : ceux exprimés exclusivement durant la spermatogenèse, ceux exprimés dans plusieurs tissus, mais qui montrent des différences quantitatives ou qualitatives durant le développement des cellules germinales mâles et ceux qui encode une isozyme ou une isoforme protéique spécifique au testicule, d’une famille de gènes généralement plus exprimée. Plusieurs gènes exprimés dans le testicule ont souvent un type cellulaire spécifique ou un profil spécifique au stade de spermatogenèse, reflétant les exigences développementales du tissu [135].

Un très grand nombre de gènes (près du quart de tous les gènes des mammifères) est spécifiquement exprimé dans la lignée germinale, montrant la complexité des processus spermatogéniques et indiquant que des mutations dans des milliers de gènes différents peuvent causer l’infertilité masculine. Il est probable que cette complexité contribue au grand nombre des cas d’infertilité idiopathique chez les hommes [79]. Près d’une centaine de gènes ont été identifiés dans cette étude sur la régulation de la fertilité chez la souris. Par exemple, certains gènes liés à la cryptorchidie sont plus exprimés dans le testicule cryptorchide (INSL3, NR5A1) ou normal (SPATA12), d’autres liés au cancer testiculaire plus exprimés dans le testicule cryptorchide (AR, EGFR) ou normal (POLG, SPATA12, TSPY1) ou même liés à l’infertilité plus exprimés dans le testicule cryptorchide (AR, GSTM1, KITLG) ou normal (OAZ3, PRM1, TSPY, TSSK4, YBX2).

Ainsi, d’autres gènes que ceux qui ont été mentionnés dans l’article peuvent être intéressants à considérer.

Chez les mammifères, un des gènes qui montrent des caractéristiques d’un changement global des gènes durant la spermatogenèse encode l’activateur transcriptionnel CREM (cAMP-responsive element upmodulator, élément activateur de la réponse à l’AMPc) [136]. Ce gène est plus abondant d’environ quatre fois dans le testicule normal que dans celui cryptorchide, selon nos résultats. Ce résultat n’est pas étonnant du fait qu’il est très faiblement exprimé dans les cellules germinales pré-méiotiques (puisque c’est l’isoforme de répresseur qui est observée plutôt que celle d’activateur) et fortement exprimé dans les cellules germinales post-méiotiques à partir du stade pachytène. Ce changement se fait à la puberté et est intimement dirigé et modulé par l’axe hypothalomo-hypophyso-testiculaire 77

[137]. TNP1 est un gène cible de CREM et que la présence de ces deux protéines est un pré-requis à l’initiation du processus d’élongation dans les spermatides haploïdes [115].

Les concentrations circulantes de l’inhibine-B reflètent l’étendue de l’interaction entre les cellules germinales et de Sertoli, puisque son expression par les cellules de Sertoli est dépendante de la coexistence de l’activité spermatogénique dans les tubules séminifères [132]. Ainsi, l’inhibine-B est la forme physiologique importante chez le mâle [132] et plus bioactive que l’inhibine-A [138], toutefois il n’y a pas de différence d’expression observée selon les résultats de notre étude pour la sous-unité bêta-B de l’inhibine entre les testicules normaux et cryptorchides.

Les cellules péritubulaires restent peu explorées, mais ces cellules sont plus que de simples éléments de structure du tubule séminifère. Elles ont une activité sécrétoire et sont régulées de manière complexe et peuvent interagir avec plusieurs autres types cellulaires du testicule humain. Elles peuvent ainsi réguler l’homéostasie de l’environnement testiculaire et donc être impliquées dans le développement de l’infertilité masculine [96]. Ainsi, cette étude aurait pu aussi considérer les cellules péritubulaires dans la proportion des types cellulaires, mais malheureusement, comme on connait peu ce qu’elles expriment et de quelle manière, il nous est donc difficile de les considérer dans cette optique.

La proportion des différents types cellulaires principaux du testicule est différente entre le testicule normal et cryptorchide, car ce dernier manque de cellules germinales différenciées. Normalement, pour un type cellulaire donné, s’il est présent en même quantité dans deux tissus, alors on ne verra pas de différence. Par contre, comme un biais est inséré dans le ratio total de cellules par le manque de cellules germinales différenciées, ceci n’est plus respecté. Nous savons que les spermatogonies, les cellules de Leydig et de Sertoli sont présentes dans les deux testicules, mais qu’il manque les spermatocytes, spermatides et spermatozoïdes dans le testicule cryptorchide. À cause de ce manque, nous avons l’impression que le testicule cryptorchide exprime davantage les transcrits reliés aux types cellulaires présents dans les deux types de testicules que le testicule normal. Nous ne savons pas si la proportion cellulaire est respectée pour les types cellulaires présents dans les deux testicules, car je n’avais pas accès au matériel pour trouver la réponse. Ainsi, peut- 78

être que ces différents testicules ont le même nombre des différentes cellules et que seul le manque de cellules germinales différenciées montre le changement de proportion. Sinon, peut-être que les différentes cellules ne sont pas présentes en même quantité, indépendamment des cellules germinales différenciées, et c’est ce qu’on observe. Finalement, il est connu dans la littérature que les cellules germinales interagissent avec les cellules environnantes [10], ce qui me fait pencher plutôt vers la première option qui suggère que le testicule normal et cryptorchide expriment pratiquement la même proportion de cellules (exprimées dans les deux testicules) et que les cellules germinales différenciées sont celles qui apportent le biais dans la proportion. Ce biais ne peut pas être corrigé tant qu’on ne connaitra pas la vraie proportion cellulaire dans les testicules normaux et cryptorchides. Ainsi, de par la proportion cellulaire des testicules étudiés, le transcriptome testiculaire humain est différent. 79

3.2 Conclusion

La cryptorchidie est une maladie congénitale pouvant être traitée, idéalement le plus tôt possible. Le testicule cryptorchide a un plus grand risque de développer de la dégénérescence tubulaire, un CIS et ultérieurement un cancer testiculaire de type séminome.

Plusieurs autres avenues pourraient être utilisées pour continuer à comprendre les mécanismes sous-jacents qui causent et/ou créent la cryptorchidie. Avec la montée des connaissances sur les microARN, il serait intéressant de voir leur implication dans l’expression de divers gènes impliqués dans cette maladie. Utiliser la microdissection par laser sur des coupes de tissu et/ou le FACS à partir de tissu frais pour pouvoir séparer les différents types cellulaires et ainsi pouvoir identifier plus distinctement les différents gènes associés aux différents types cellulaires serait une avenue des plus pertinentes pour connaitre la proportion cellulaire de ces tissus. Pour une analyse plus précise, il serait intéressant de pouvoir séparer tous les types de spermatogonies pour déterminer les gènes exprimés dans chaque type de spermatogonies et ainsi déterminer « la signature » normale des gènes du testicule, puisque celle-ci n’est pas connue. De ce fait, il m’était donc plus difficile de comparer les gènes de ces testicules. Ceci nous permettrait de déterminer les gènes exprimés dans le testicule normal pour pouvoir ensuite faire une comparaison plus approfondie entre le testicule normal et cryptorchide. Dans une autre optique, plutôt que de seulement regarder les gènes exprimés dans le testicule cryptorchide, il serait aussi d’intérêt de regarder au niveau protéique en identifiant les différentes protéines exprimées, par exemple par gel 2D couplé à l’analyse protéomique, entre le testicule normal et cryptorchide.

Bibliographie

1. Thibault, C. and M.-C. Levasseur, La reproduction chez les mammifères et l'homme, ed. I. Ellipses. 2001. 2. Hadziselimovic, F., Cryptorchidism. Ultrastructure of normal and cryptorchid testis development. Adv Anat Embryol Cell Biol, 1977. 53(3): p. 3-71. 3. Viger, R.S., D.W. Silversides, and J.J. Tremblay, New insights into the regulation of mammalian sex determination and male sex differentiation. Vitam Horm, 2005. 70: p. 387-413. 4. Magre, S. and A. Jost, Sertoli cells and testicular differentiation in the rat fetus. J Electron Microsc Tech, 1991. 19(2): p. 172-88. 5. Kee, K., R.A. Pera, and P.J. Turek, Testicular germline stem cells. Nat Rev Urol, 2010. 7(2): p. 94-100. 6. Lejeune, H., R. Habert, and J.M. Saez, Origin, proliferation and differentiation of Leydig cells. J Mol Endocrinol, 1998. 20(1): p. 1-25. 7. Bowles, J. and P. Koopman, Retinoic acid, meiosis and germ cell fate in mammals. Development, 2007. 134(19): p. 3401-11. 8. McLaren, A., Germline and soma: interactions during early mouse development. Seminars in Developmental Biology, 1994. 5: p. 43-49. 9. Cours d'embryologie en ligne à l'usage des étudiants et étudiantes en médecine. 2008 [cited; Développé par les Universités de Fribourg, Lausanne et Berne (Suisse), sous l'égide du Campus Virtuel Suisse]. Available from: http://www.embryology.ch/. 10. Bardin CW, C.C., Mustow NA, Gunsalus GL, The Sertoli cell, in The physiology of reproduction, second edition, N.J. Knobil E, Editor. 1994, Raven Press: New York. p. 1291-1334. 11. Sharpe, R.M., Regulation of Spermatogenesis, in The physiology of reproduction, second edition, N.J. Knobil E, Editor. 1994, Raven Press: New York. p. 1363-1434. 12. Clermont, Y., Kinetics of spermatogenesis in mammals: seminiferous epithelium cycle and spermatogonial renewal. Physiol Rev, 1972. 52(1): p. 198-236. 13. de Kretser DM, K.J., The Cytology of the Testis, in The physiology of reproduction, second edition, N.J. Knobil E, Editor. 1994, Raven Press: New York, USA. p. 1170- 1290. 14. Rhee, K. and D.J. Wolgemuth, Cdk family genes are expressed not only in dividing but also in terminally differentiated mouse germ cells, suggesting their possible function during both cell division and differentiation. Dev Dyn, 1995. 204(4): p. 406-20. 15. Johnson, L., Efficiency of spermatogenesis. Microsc Res Tech, 1995. 32(5): p. 385- 422. 16. Sharpe, R.M., et al., Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction, 2003. 125(6): p. 769-84. 17. Sofikitis, N., et al., Hormonal regulation of spermatogenesis and spermiogenesis. J Steroid Biochem Mol Biol, 2008. 109(3-5): p. 323-30. 81

18. Ivell, R. and R. Anand-Ivell, Biology of insulin-like factor 3 in human reproduction. Hum Reprod Update, 2009. 15(4): p. 463-76. 19. Hall, P.F., Testicular steroid synthesis: organization and regulation, in The physiology of reproduction, second edition, N.J. Knobil E, Editor. 1994, Raven Press: New York. p. 1335-1362. 20. Johnson, L., D.L. Thompson, Jr., and D.D. Varner, Role of Sertoli cell number and function on regulation of spermatogenesis. Anim Reprod Sci, 2008. 105(1-2): p. 23- 51. 21. Maekawa, M., K. Kamimura, and T. Nagano, Peritubular myoid cells in the testis: their structure and function. Arch Histol Cytol, 1996. 59(1): p. 1-13. 22. Schell, C., et al., Exploring human testicular peritubular cells: identification of secretory products and regulation by tumor necrosis factor-alpha. Endocrinology, 2008. 149(4): p. 1678-86. 23. Roosen-Runge EC, L.J., Gonocyte degeneration in the postnatal male rat. Am J Anat, 1975. 122: p. 275-300. 24. Kerr, J.B., Functional cytology of the human testis. Baillieres Clin Endocrinol Metab, 1992. 6(2): p. 235-50. 25. Nistal, M., et al., Decrease in the number of human Ap and Ad spermatogonia and in the Ap/ Ad ratio with advancing age. New data on the spermatogonial stem cell. J Androl, 1987. 8(2): p. 64-8. 26. Heffner, L.J. and D.J. Schust, The reproductive system at a glance. 3rd ed. 2010: Wiley-Blackwell. 128 pages. 27. Russell LD, G.M., The Sertoli cell. 1993, Clearwater, Florida: Cache River Press. 28. Setchell, B.P. and S.J. Main, Drugs and the blood-testis barrier. Environ Health Perspect, 1978. 24: p. 61-4. 29. Wong, E.W. and C.Y. Cheng, Polarity proteins and cell-cell interactions in the testis. Int Rev Cell Mol Biol, 2009. 278: p. 309-53. 30. Nishimune, Y. and S. Aizawa, Temperature sensitivity of DNA synthesis in mouse testicular germ cells in vitro. Exp Cell Res, 1978. 113(2): p. 403-8. 31. Setchell BP, M.S., Brooks DE, Anatomy, vasculature, innervation and fluids of the male reproduction tract., in The physiology of reproduction, second edition, N.J. Knobil E, Editor. 1994, Raven Press: New York. p. 1063-1175. 32. Kojima, Y., et al., Advances in molecular genetics of cryptorchidism. Urology, 2009. 74(3): p. 571-8. 33. Kurpisz, M., et al., Cryptorchidism and long-term consequences. Reprod Biol, 2010. 10(1): p. 19-35. 34. Virtanen, H.E., et al., Cryptorchidism: classification, prevalence and long-term consequences. Acta Paediatr, 2007. 96(5): p. 611-6. 35. Ferlin, A., et al., Genetic alterations associated with cryptorchidism. Jama, 2008. 300(19): p. 2271-6. 36. Ivell, R. and S. Hartung, The molecular basis of cryptorchidism. Mol Hum Reprod, 2003. 9(4): p. 175-81. 37. Biers, S.M. and P.S. Malone, A critical appraisal of the evidence for improved fertility indices in undescended testes after gonadotrophin-releasing hormone therapy and orchidopexy. J Pediatr Urol, 2010. 6(3): p. 239-46. 38. Bay, K., et al., Testicular descent: INSL3, testosterone, genes and the intrauterine milieu. Nat Rev Urol, 2011. 8(4): p. 187-96. 82

39. Raynaud, A., Effect of sex hormones on development of urogenital system in reptile embryos. Sov J Dev Biol, 1972. 3(5): p. 396-406. 40. Jean, C., [Growth and structure of cryptorchid testes in mice born of mothers treated by oestradiol during pregnancy (author's transl)]. Ann Endocrinol (Paris), 1973. 34(6): p. 667-87. 41. Abney, T.O., The potential roles of estrogens in regulating Leydig cell development and function: a review. Steroids, 1999. 64(9): p. 610-7. 42. Hayashi, H. and R.G. Harrison, The development of the interstitial tissue of the human testis. Fertil Steril, 1971. 22(6): p. 351-5. 43. Raboch, J. and Z. Zahor, [Fertility in men with cryptorchidism]. Schweiz Med Wochenschr, 1955. 85(49): p. 1196-9. 44. Farrington, G.H., Histologic observations in crytorchidism: the congenital germinal-cell deficiency of the undescended testis. J Pediatr Surg, 1969. 4(6): p. 606-13. 45. Amat, P., R. Paniagua, and J. Montero, Seminiferous tubule degeneration in human cryptorchid testes. J Androl, 1985. 6(1): p. 1-9. 46. Baccetti, B., et al., "9 + 0" immotile spermatozoa in an infertile man. Andrologia, 1979. 11(6): p. 437-43. 47. Cotelli, F., et al., Ultrastructure of the tubular wall of the prepuberal cryptorchid human testis. Arch Androl, 1979. 3(4): p. 281-5. 48. Schulze, C., et al., On the morphology of the human Sertoli cells under normal conditions and in patients with impaired fertility. Andrologia, 1976. 8(2): p. 167-78. 49. Usadel, K.H., et al., [On the presence of cholinergic nerve fibers in the walls of testicular tubules in primary hypogonadism (Klinefelter's syndrome, cryptorchism) (author's transl)]. Klin Wochenschr, 1973. 51(20): p. 1016-23. 50. Sato, Y., S. Nozawa, and T. Iwamoto, Study of spermatogenesis and thickening of lamina propria in the human seminiferous tubules. Fertil Steril, 2008. 90(4): p. 1310-2. 51. Haider, S.G., J. Talati, and G. Servos, Ultrastructure of peritubular tissue in association with tubular hyalinization in human testis. Tissue Cell, 1999. 31(1): p. 90-8. 52. Mieusset, R., et al., Increase in testicular temperature in case of cryptorchidism in boys. Fertil Steril, 1993. 59(6): p. 1319-21. 53. Setchell, B.P., The Parkes Lecture. Heat and the testis. J Reprod Fertil, 1998. 114(2): p. 179-94. 54. Hadziselimovic, F. and B. Herzog, The importance of both an early orchidopexy and germ cell maturation for fertility. Lancet, 2001. 358(9288): p. 1156-7. 55. Huff, D.S., et al., Abnormal germ cell development in cryptorchidism. Horm Res, 2001. 55(1): p. 11-7. 56. Wood, H.M. and J.S. Elder, Cryptorchidism and testicular cancer: separating fact from fiction. J Urol, 2009. 181(2): p. 452-61. 57. Akre, O., A. Pettersson, and L. Richiardi, Risk of contralateral testicular cancer among men with unilaterally undescended testis: a meta analysis. Int J Cancer, 2009. 124(3): p. 687-9. 58. Manecksha, R.P. and J.M. Fitzpatrick, Epidemiology of testicular cancer. BJU Int, 2009. 104(9 Pt B): p. 1329-33. 83

59. Thorup, J., et al., What is new in cryptorchidism and hypospadias--a critical review on the testicular dysgenesis hypothesis. J Pediatr Surg, 2010. 45(10): p. 2074-86. 60. Winter, C. and P. Albers, Testicular germ cell tumors: pathogenesis, diagnosis and treatment. Nat Rev Endocrinol, 2011. 7(1): p. 43-53. 61. Patel, S.R., L.K. Kvols, and R.L. Richardson, Familial testicular cancer: report of six cases and review of the literature. Mayo Clin Proc, 1990. 65(6): p. 804-8. 62. von Eyben, F.E., Chromosomes, genes, and development of testicular germ cell tumors. Cancer Genet Cytogenet, 2004. 151(2): p. 93-138. 63. Figueroa, J.D., et al., Genetic variation in hormone metabolizing genes and risk of testicular germ cell tumors. Cancer Causes Control, 2008. 19(9): p. 917-29. 64. Garner, M.J., et al., Epidemiology of testicular cancer: an overview. Int J Cancer, 2005. 116(3): p. 331-9. 65. Hoei-Hansen, C.E., et al., Carcinoma in situ testis, the progenitor of testicular germ cell tumours: a clinical review. Ann Oncol, 2005. 16(6): p. 863-8. 66. Fossa, S.D., J. Oldenburg, and A.A. Dahl, Short- and long-term morbidity after treatment for testicular cancer. BJU Int, 2009. 104(9 Pt B): p. 1418-22. 67. Nuver, J., et al., The metabolic syndrome and disturbances in hormone levels in long-term survivors of disseminated testicular cancer. J Clin Oncol, 2005. 23(16): p. 3718-25. 68. Nguyen, M.T., D.P. Delaney, and T.F. Kolon, Gene expression alterations in cryptorchid males using spermatozoal microarray analysis. Fertil Steril, 2009. 92(1): p. 182-7. 69. Irizarry, R.A., et al., Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics, 2003. 4(2): p. 249-64. 70. Smyth, G.K., Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol, 2004. 3: p. Article3. 71. Benjamini, Y., et al., Controlling the false discovery rate in behavior genetics research. Behav Brain Res, 2001. 125(1-2): p. 279-84. 72. Wettenhall, J.M., et al., affylmGUI: a graphical user interface for linear modeling of single channel microarray data. Bioinformatics, 2006. 22(7): p. 897-9. 73. Salomonis, N., et al., GenMAPP 2: new features and resources for pathway analysis. BMC Bioinformatics, 2007. 8: p. 217. 74. van Iersel, M.P., et al., Presenting and exploring biological pathways with PathVisio. BMC Bioinformatics, 2008. 9: p. 399. 75. Simard, M., et al., Minimization of PCR efficiency differences between standards and samples through dilution of PCR amplicons in reverse transcription buffer. Anal Biochem, 2007. 362(1): p. 142-4. 76. Ohl, F., et al., Gene expression studies in prostate cancer tissue: which reference gene should be selected for normalization? J Mol Med, 2005. 83(12): p. 1014-24. 77. Vandesompele, J., et al., Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol, 2002. 3(7): p. RESEARCH0034. 78. Hughes, I.A. and C.L. Acerini, Factors controlling testis descent. Eur J Endocrinol, 2008. 159 Suppl 1: p. S75-82. 79. Matzuk, M.M. and D.J. Lamb, The biology of infertility: research advances and clinical challenges. Nat Med, 2008. 14(11): p. 1197-213. 84

80. von Kopylow, K., et al., Screening for biomarkers of spermatogonia within the human testis: a whole genome approach. Hum Reprod, 2010. 25(5): p. 1104-12. 81. Kogo, H., et al., Screening of genes involved in chromosome segregation during meiosis I: toward the identification of genes responsible for infertility in humans. J Hum Genet, 2010. 55(5): p. 293-9. 82. Orwig, K.E., et al., Genes involved in post-transcriptional regulation are overrepresented in stem/progenitor spermatogonia of cryptorchid mouse testes. Stem Cells, 2008. 26(4): p. 927-38. 83. Wu, X., et al., Prepubertal human spermatogonia and mouse gonocytes share conserved gene expression of germline stem cell regulatory molecules. Proc Natl Acad Sci U S A, 2009. 106(51): p. 21672-7. 84. Yan, W., Male infertility caused by spermiogenic defects: lessons from gene knockouts. Mol Cell Endocrinol, 2009. 306(1-2): p. 24-32. 85. Nightingale, S.S., P. Western, and J.M. Hutson, The migrating gubernaculum grows like a "limb bud". J Pediatr Surg, 2008. 43(2): p. 387-90. 86. Shenker, N.S., et al., A new role for androgen in testicular descent: permitting gubernacular cell proliferation in response to the neuropeptide, calcitonin gene- related peptide. J Pediatr Surg, 2006. 41(2): p. 407-12. 87. Levy, J.B. and D.A. Husmann, The hormonal control of testicular descent. J Androl, 1995. 16(6): p. 459-63. 88. Chan, J.J., et al., Calcitonin gene-related peptide is a survival factor, inhibiting apoptosis in neonatal rat gubernaculum in vitro. J Pediatr Surg, 2009. 44(8): p. 1497-501. 89. Hagner, S., et al., Calcitonin receptor-like receptor: identification and distribution in human peripheral tissues. Cell Tissue Res, 2002. 310(1): p. 41-50. 90. Na, A.F., et al., Cell membrane and mitotic markers show that the neonatal rat gubernaculum grows in a similar way to an embryonic limb bud. J Pediatr Surg, 2007. 42(9): p. 1566-73. 91. Heyns, C.F., The gubernaculum during testicular descent in the human fetus. J Anat, 1987. 153: p. 93-112. 92. Harada, H., et al., FGF10 maintains stem cell compartment in developing mouse incisors. Development, 2002. 129(6): p. 1533-41. 93. Nef, S. and L.F. Parada, Cryptorchidism in mice mutant for Insl3. Nat Genet, 1999. 22(3): p. 295-9. 94. Feng, S., et al., INSL3/RXFP2 signaling in testicular descent. Ann N Y Acad Sci, 2009. 1160: p. 197-204. 95. Kawamura, K., et al., Paracrine regulation of mammalian oocyte maturation and male germ cell survival. Proc Natl Acad Sci U S A, 2004. 101(19): p. 7323-8. 96. Albrecht, M., Insights into the nature of human testicular peritubular cells. Ann Anat, 2009. 191(6): p. 532-40. 97. Girard, A., et al., A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature, 2006. 442(7099): p. 199-202. 98. Khurana, J. and W. Theurkauf, piRNA function in germline development., in Melton D, Girard L, editors. 2008, StemBook [Internet]. Cambridge (MA): Harvard Stem Cell Institute. 85

99. Qiao, D., et al., Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas. Oncogene, 2002. 21(25): p. 3988-99. 100. Gu, A., et al., Genetic variants in Piwi-interacting RNA pathway genes confer susceptibility to spermatogenic failure in a Chinese population. Hum Reprod, 2010. 25(12): p. 2955-61. 101. Persson, S., M. Rosenquist, and M. Sommarin, Identification of a novel calreticulin isoform (Crt2) in human and mouse. Gene, 2002. 297(1-2): p. 151-8. 102. Hayashi, E., et al., Identification of a novel cancer-testis antigen CRT2 frequently expressed in various cancers using representational differential analysis. Clin Cancer Res, 2007. 13(21): p. 6267-74. 103. Rothschild, G., et al., A role for kit receptor signaling in Leydig cell steroidogenesis. Biol Reprod, 2003. 69(3): p. 925-32. 104. Yan, W., J. Suominen, and J. Toppari, Stem cell factor protects germ cells from apoptosis in vitro. J Cell Sci, 2000. 113 (Pt 1): p. 161-8. 105. Unni, S.K., et al., Stage-specific localization and expression of c-kit in the adult human testis. J Histochem Cytochem, 2009. 57(9): p. 861-9. 106. Bartkova, J., et al., D-type cyclins in adult human testis and testicular cancer: relation to cell type, proliferation, differentiation, and malignancy. J Pathol, 1999. 187(5): p. 573-81. 107. Reuter, V.E., Origins and molecular biology of testicular germ cell tumors. Mod Pathol, 2005. 18 Suppl 2: p. S51-60. 108. Eble J.N., S.G., Epstein J.I., Sesterhenn I.A., ed. Pathology and Genetics of Tumours of the Urinary System and Male Genital Organs. . Vol. World Health Organization Classification of Tumours. 2004, IARC Press: Lyon. 109. McKinnell, C., et al., Expression of insulin-like factor 3 protein in the rat testis during fetal and postnatal development and in relation to cryptorchidism induced by in utero exposure to di (n-Butyl) phthalate. Endocrinology, 2005. 146(10): p. 4536-44. 110. Mithraprabhu, S. and K.L. Loveland, Control of KIT signalling in male germ cells: what can we learn from other systems? Reproduction, 2009. 138(5): p. 743-57. 111. Miller, D., M. Brinkworth, and D. Iles, Paternal DNA packaging in spermatozoa: more than the sum of its parts? DNA, histones, protamines and epigenetics. Reproduction, 2010. 139(2): p. 287-301. 112. Carrell, D.T., B.R. Emery, and S. Hammoud, The aetiology of sperm protamine abnormalities and their potential impact on the sperm epigenome. Int J Androl, 2008. 31(6): p. 537-45. 113. Khattri, A., et al., The TNP1 haplotype - GCG is associated with azoospermia. Int J Androl, 2010. 34(2): p. 173-82. 114. Luerssen, H., et al., Nucleotide sequence of the gene for human transition protein 1 and its chromosomal localization on chromosome 2. Genomics, 1990. 8(2): p. 324- 30. 115. Steger, K., et al., Round spermatids show normal testis-specific H1t but reduced cAMP-responsive element modulator and transition protein 1 expression in men with round-spermatid maturation arrest. J Androl, 1999. 20(6): p. 747-54. 86

116. Nishimura, H., D.G. Myles, and P. Primakoff, Identification of an ADAM2-ADAM3 complex on the surface of mouse testicular germ cells and cauda epididymal sperm. J Biol Chem, 2007. 282(24): p. 17900-7. 117. Kim, E., et al., Processing and subcellular localization of ADAM2 in the Macaca fascicularis testis and sperm. Anim Reprod Sci, 2010. 117(1-2): p. 155-9. 118. Rosselot, C., et al., Chronological gene expression of ADAMs during testicular development: prespermatogonia (gonocytes) express fertilin beta (ADAM2). Dev Dyn, 2003. 227(3): p. 458-67. 119. Edwards, D.R., M.M. Handsley, and C.J. Pennington, The ADAM metalloproteinases. Mol Aspects Med, 2008. 29(5): p. 258-89. 120. Eblen, A., et al., The presence of functional luteinizing hormone/chorionic gonadotropin receptors in human sperm. J Clin Endocrinol Metab, 2001. 86(6): p. 2643-8. 121. Chauvigne, F., et al., Functional and evolutionary analysis of flatfish gonadotropin receptors reveals cladal- and lineage-level divergence of the teleost glycoprotein receptor family. Biol Reprod, 2010. 82(6): p. 1088-102. 122. Misrahi, M., et al., Gonadotropin receptors and the control of gonadal steroidogenesis: physiology and pathology. Baillieres Clin Endocrinol Metab, 1998. 12(1): p. 35-66. 123. Miller, W.L., Structure of genes encoding steroidogenic enzymes. J Steroid Biochem, 1987. 27(4-6): p. 759-66. 124. Miller, W.L., R.J. Auchus, and D.H. Geller, The regulation of 17,20 lyase activity. Steroids, 1997. 62(1): p. 133-42. 125. Houmard, B., et al., Global gene expression in the human fetal testis and ovary. Biol Reprod, 2009. 81(2): p. 438-43. 126. Faienza, M.F., et al., Clinical, endocrine, and molecular findings in 17beta- hydroxysteroid dehydrogenase type 3 deficiency. J Endocrinol Invest, 2008. 31(1): p. 85-91. 127. Lourenco, D., et al., Loss-of-function mutation in GATA4 causes anomalies of human testicular development. Proc Natl Acad Sci U S A, 2011. 108(4): p. 1597- 602. 128. Ketola, I., et al., Expression of transcription factor GATA-4 during human testicular development and disease. J Clin Endocrinol Metab, 2000. 85(10): p. 3925-31. 129. LaVoie, H.A., The role of GATA in mammalian reproduction. Exp Biol Med (Maywood), 2003. 228(11): p. 1282-90. 130. Viger, R.S., et al., Role of the GATA family of transcription factors in andrology. J Androl, 2004. 25(4): p. 441-52. 131. Kyronlahti, A., et al., GATA4 regulates Sertoli cell function and fertility in adult male mice. Mol Cell Endocrinol, 2011. 333(1): p. 85-95. 132. Fujisawa, M., et al., Differential regulation of inhibin subunits by germ cells in human testes. Arch Androl, 2004. 50(5): p. 339-45. 133. Walton, K.L., et al., The synthesis and secretion of inhibins. Vitam Horm, 2011. 85: p. 149-84. 134. de Kretser, D.M., et al., The role of activin, follistatin and inhibin in testicular physiology. Mol Cell Endocrinol, 2004. 225(1-2): p. 57-64. 135. Xue, J.C. and E. Goldberg, Identification of a novel testis-specific leucine-rich protein in humans and mice. Biol Reprod, 2000. 62(5): p. 1278-84. 87

136. Deng, W. and H. Lin, miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis. Dev Cell, 2002. 2(6): p. 819-30. 137. Hogeveen, K.N. and P. Sassone-Corsi, Regulation of gene expression in post- meiotic male germ cells: CREM-signalling pathways and male fertility. Hum Fertil (Camb), 2006. 9(2): p. 73-9. 138. Makanji, Y., C.A. Harrison, and D.M. Robertson, Feedback regulation by inhibins A and B of the pituitary secretion of follicle-stimulating hormone. Vitam Horm, 2011. 85: p. 299-321.

Annexe - Données supplémentaires reliées à l’article

SYMBOL CYTOBAND DESCRIPTION PValue Fold change transition protein 1 (during histone to protamine replacement) -> TNP1 2q35-q36 3,56E-09 64,2846774 Spermatid nuclear transition protein 1 PRM1 16p13.2 protamine 1 4,27E-09 44,3443225 SMCP 1q21.3 sperm mitochondria-associated cysteine-rich protein 8,11E-09 43,7325631 ODF1 8q22.3 outer dense fiber of sperm tails 1 4,27E-09 41,6183972 PRM2 16p13.2 protamine 2 1,47E-09 40,9445776 C1orf14 1q25.3 chromosome 1 open reading frame 14 1,01E-05 39,7417639 cyclin-dependent kinase inhibitor 3 (CDK2-associated dual CDKN3 14q22 2,18E-07 38,5085795 specificity phosphatase) LDHC 11p15.5-p15.3 lactate dehydrogenase C 1,57E-05 35,9362883 ROPN1 3q21.1 ropporin, rhophilin associated protein 1 -> Ropporin-1A 3,17E-08 35,8329645 PGK2 6p12.3 phosphoglycerate kinase 2 1,19E-08 34,41328 ROPN1L 5p15.2 ropporin 1-like 3,95E-07 34,0301711 C1orf182 1q22 chromosome 1 open reading frame 182 3,12E-07 33,7499042 ADAM2 8p11.2 ADAM metallopeptidase domain 2 (fertilin beta) 3,73E-07 30,7177151 AKAP4 Xp11.2 A kinase (PRKA) anchor protein 4 4,41E-09 30,2632495 CRISP2 6p21-qter cysteine-rich secretory protein 2 9,91E-09 29,7099959 NA NA NA 3,06E-05 29,5785105 PIWIL1 12q24.33 piwi-like 1 (Drosophila) 7,02E-06 29,0125058 TMCO5 15q14 transmembrane and coiled-coil domains 5 8,77E-09 28,7126782 ACSBG2 19p13.3 acyl-CoA synthetase bubblegum family member 2 4,27E-09 26,9147291 GTSF1L 20q13.12 gametocyte specific factor 1-like 1,70E-08 25,6833413 BRDT 1p22.1 bromodomain, testis-specific 4,26E-06 25,393617 GK2 4q13 glycerol kinase 2 7,13E-08 25,3606181 CMTM2 16q21 CKLF-like MARVEL transmembrane domain containing 2 2,00E-07 25,3414821 CCDC62 12q24.31 coiled-coil domain containing 62 2,18E-07 25,2692423 89

SPATA16 3q26.31 spermatogenesis associated 16 4,35E-08 24,5171946 CCDC110 4q35.1 coiled-coil domain containing 110 2,57E-07 24,3347155 PHF7 3p21.1 PHD finger protein 7 1,16E-05 24,2951764 SPDYA 2p23.2 speedy homolog A (Drosophila) 3,36E-06 23,9270313 ANKRD7 7q31 ankyrin repeat domain 7 6,91E-06 22,6579039 C11orf64 11q12.2 chromosome 11 open reading frame 64 1,20E-07 22,4695994 FLJ26056 22q11.21 hypothetical protein LOC375127 4,35E-08 22,2342757 PDZ binding kinase (Lymphokine-activated killer T-cell-originated PBK 8p21.2 3,73E-07 22,1753274 protein kinase) C14orf53 14q23.3 chromosome 14 open reading frame 53 3,14E-08 22,1599312 KLHL10 17q21.2 kelch-like 10 (Drosophila) 2,08E-08 22,1551625 NA NA NA 5,98E-08 21,8907807 TPD52L3 9p24.1 tumor protein D52-like 3 -> Tumor protein D55 2,24E-07 21,7541991 LOC284067 17q21.31 hypothetical LOC284067 6,58E-07 21,5638668 CLGN 4q28.3-q31.1 calmegin 1,70E-06 21,349487 HSF5 17q22 heat shock transcription factor family member 5 2,42E-06 21,222313 DKFZP434B061 13p13 DKFZP434B061 protein 5,25E-08 21,0858679 SLC26A8 6p21 solute carrier family 26, member 8 (Testis anion transporter 1) 2,52E-07 21,0681101 TCP11 6p21.3-p21.2 t-complex 11 homolog (mouse) 3,32E-07 20,9677551 C6orf165 6q15 chromosome 6 open reading frame 165 8,40E-07 20,8785773 ADAD1 4q27 adenosine deaminase domain containing 1 (testis-specific) 4,36E-06 20,870706 C3orf30 3q13.32 chromosome 3 open reading frame 30 3,42E-07 20,8245007 FLJ44048 2q32.1 FLJ44048 protein 1,36E-07 20,7979006 TMEM31 Xq22.2 transmembrane protein 31 1,17E-08 20,4878331 FLJ26056 22q11.21 hypothetical protein LOC375127 5,25E-08 20,3587701 similar to PRED4 -> Ankyrin repeat domain-containing protein ANKRD30B 21q11.2 7,73E-06 20,2061422 30B LOC129881 2q31.1 hypothetical LOC129881 9,25E-07 19,9437597 ZPBP2 17q12 zona pellucida binding protein 2 3,61E-06 19,8916425 90

FLJ26056 22q11.21 hypothetical protein LOC375127 7,89E-08 19,4578041 FLJ26056 22q11.21 hypothetical protein LOC375127 7,89E-08 19,4578041 SLCO6A1 5q21.1 solute carrier organic anion transporter family, member 6A1 2,00E-07 19,3835646 HORMAD1 1q21.2 HORMA domain containing 1 7,90E-05 19,3333803 HMGB4 1p35.1 high-mobility group box 4 1,19E-08 19,2748069 SPATA22 17p13.3 spermatogenesis associated 22 1,29E-05 19,055103 DYDC1 10q23.1 DPY30 domain containing 1 7,15E-07 18,9620561 SPAG6 10p12.2 sperm associated antigen 6 1,38E-06 18,9003887 FLJ44048 2q32.1 FLJ44048 protein 5,41E-08 18,8990459 FSIP2 2q32.1 fibrous sheath interacting protein 2 2,27E-07 18,8610488 C1orf194 1p13.3 chromosome 1 open reading frame 194 8,11E-09 18,3071397 SPATA17 1q41 spermatogenesis associated 17 4,31E-07 18,1907863 ROPN1B 3q21.2 ropporin, rhophilin associated protein 1B -> Ropporin-1B 6,62E-08 18,1456836 PFN4 2p23.3 profilin family, member 4 1,70E-06 17,9495342 HIST1H2BA 6p22.2 histone cluster 1, H2ba -> Histone H2B type 1-A 4,56E-05 17,4904257 C10orf79 10q25.1 chromosome 10 open reading frame 79 2,65E-06 17,3185231 SPATA8 15q26.2 spermatogenesis associated 8 6,04E-07 16,9783635 GTSF1 12q13.2 gametocyte specific factor 1 3,90E-06 16,6758512 LOC653203 22q11.21 similar to hypothetical gene supported by BC039313 5,25E-08 16,4433461 LYPD4 19q13.2 LY6/PLAUR domain containing 4 1,81E-07 16,4057541 FLJ40243 5p13.1 hypothetical protein FLJ40243 3,34E-08 16,2187924 DNAH8 6p21.31-p21.1 dynein, axonemal, heavy chain 8 2,70E-06 16,1805249 TTC29 4q31.23 tetratricopeptide repeat domain 29 1,04E-07 16,0161835 FLJ26056 22q11.21 hypothetical protein LOC375127 5,98E-08 15,9195097 SPATA4 4q34.2 spermatogenesis associated 4 3,14E-08 15,8823501 NUF2, NDC80 kinetochore complex component, homolog (S. NUF2 1q23.3 1,67E-05 15,8590011 cerevisiae) WDR69 2q36.3 WD repeat domain 69 1,24E-06 15,744445 PIH1D2 11q23.1 PIH1 domain containing 2 5,43E-07 15,6113403 91

LCA5L 21q22.2 Leber congenital amaurosis 5-like -> Lebercilin-like protein 1,04E-06 15,5092552 CCDC83 11q14.1-q14.2 coiled-coil domain containing 83 8,62E-08 15,3642187 SPA17 11q24.2 sperm autoantigenic protein 17 -> Sperm surface protein Sp17 1,14E-06 15,3369532 solute carrier family 6, member 16 (Orphan sodium- and chloride- SLC6A16 19q13.1-q13.4 2,58E-07 15,316561 dependent neurotransmitter transporter NTT5) LOC644768 22q11.1 similar to CG10806-like 4,13E-07 15,3016572 LOC284861 22q11.21 hypothetical gene supported by BC039313 2,24E-07 15,133838 FLJ25770 4q21.1 hypothetical protein FLJ25770 2,03E-06 15,0221874 ADAM29 4q34 ADAM metallopeptidase domain 29 1,81E-07 14,8674879 chromosome 4 open reading frame 35 -> Casein-like CLPH 4q13.3 5,74E-07 14,6750855 phosphoprotein nucleoporin 210kDa-like -> Nuclear pore membrane glycoprotein NUP210L 1q21.3 1,33E-06 14,4776095 210-like FLJ26056 22q11.21 hypothetical protein LOC375127 4,29E-08 14,3162129 OAZ3 1q21.3 ornithine decarboxylase antizyme 3 5,25E-08 14,1711359 FAM81B 5q15 family with sequence similarity 81, member B 1,81E-07 14,0390655 TSGA10 2q11.2 testis specific, 10 1,46E-06 13,9382497 LOC400858 21q11.2 similar to PRED4 2,32E-05 13,9372208 UBQLN3 11p15 ubiquilin 3 2,14E-08 13,9289249 IQUB 7q31.32 IQ motif and ubiquitin domain containing 3,23E-06 13,7404753 LOC81691 16p12.2 exonuclease NEF-sp 5,86E-06 13,7368851 DKFZP434P211 22q11.22 POM121-like protein 3,73E-07 13,7044498 DKFZP434P211 22q11.22 POM121-like protein 1,87E-07 13,6949206 DKFZP434P211 22q11.22 POM121-like protein 1,87E-07 13,6949206 NA NA NA 1,95E-07 13,6829273 PAPOLB 7p22.1 poly(A) polymerase beta (testis specific) 1,48E-07 13,6615664 AKAP3 12p13.3 A kinase (PRKA) anchor protein 3 1,81E-07 13,5574881 DKFZP434P211 22q11.22 POM121-like protein 1,00E-06 13,4465951 C3orf44 3q25.1 chromosome 3 open reading frame 44 8,11E-09 13,3543097 BOLL 2q33 bol, boule-like (Drosophila) 9,25E-07 13,3431464 92

transmembrane phosphatase with tensin homology -> Putative TPTE 21p11 1,08E-04 13,2215004 tyrosine-protein phosphatase TPTE CALR3 19p13.11 calreticulin 3 3,58E-08 13,159721 TMCO2 1p34.2 transmembrane and coiled-coil domains 2 7,89E-08 12,9756823 SYCP2 20q13.33 synaptonemal complex protein 2 2,17E-05 12,9213509 C6orf10 6p21.3 chromosome 6 open reading frame 10 4,68E-07 12,9191478 DDX25 11q24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 25 4,84E-06 12,9136462 ADAM30 1p13-p11 ADAM metallopeptidase domain 30 3,83E-08 12,8848649 LOC374973 1p33 LOC374973 3,83E-08 12,8067988 CCDC54 3q13.12 coiled-coil domain containing 54 4,30E-08 12,7643131 ARMC3 10p12.31 armadillo repeat containing 3 4,35E-08 12,7405751 HSPA2 14q24.1 heat shock 70kDa protein 2 3,99E-06 12,5824198 C12orf50 12q21.32 chromosome 12 open reading frame 50 3,54E-07 12,5403569 GSG1 12p13.1 germ cell associated 1 3,12E-08 12,5207059 phospholipase C, zeta 1 -> 1-phosphatidylinositol-4,5- PLCZ1 12p12.3 2,57E-07 12,4739027 bisphosphate phosphodiesterase zeta-1 FSCB 14q21.3 fibrous sheath CABYR binding protein 1,04E-07 12,4129447 regulatory factor X, 4 (influences HLA class II expression) -> RFX4 12q24 1,03E-06 12,3612737 Transcription factor RFX4 NT5C1B 2p24.2 5'-nucleotidase, cytosolic IB 3,34E-08 12,3469474 GMCL1L 5q35.3 germ cell-less homolog 1 (Drosophila)-like 5,25E-08 12,343653 C4orf17 4q23 chromosome 4 open reading frame 17 2,00E-07 12,3210816 ACRV1 11q23-q24 acrosomal vesicle protein 1 3,14E-08 12,3193736 RSPH10B 7p22.1 radial spoke head 10 homolog B (Chlamydomonas) 8,53E-08 12,2609894 DKFZP434P211 22q11.22 POM121-like protein 2,82E-07 12,1419775 FAM71F1 7q32.1 family with sequence similarity 71, member F1 7,47E-09 12,122161 ZBBX 3q26.1 zinc finger, B-box domain containing 9,78E-07 12,0774167 SPAG17 1p12 sperm associated antigen 17 9,01E-07 11,949406 FLJ35848 17q21.31 hypothetical protein FLJ35848 5,03E-06 11,9448555 SPINK2 4q12 serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) 1,81E-07 11,9289983 93

dpy-19-like 2 pseudogene 2 (C. elegans) -> Protein dpy-19 DPY19L2P2 7q22.1 6,10E-06 11,894762 homolog 2-like 2 C1orf97 1q32.3 chromosome 1 open reading frame 97 1,48E-07 11,7294828 LOC152586 4q31.1 similar to RIKEN cDNA 4933434I20 3,94E-07 11,7266132 membrane-associated ring finger (C3HC4) 11 -> E3 ubiquitin- MARCH11 5p15.1 3,95E-07 11,7173182 protein ligase MARCH11 CNTD1 17q21.31 cyclin N-terminal domain containing 1 2,62E-06 11,7026472 TTK 6q13-q21 TTK protein kinase 5,43E-06 11,6222058 C1orf125 1q25.2 chromosome 1 open reading frame 125 1,11E-06 11,5940403 fascin homolog 3, actin-bundling protein, testicular FSCN3 7q31.3 1,91E-07 11,5877335 (Strongylocentrotus purpuratus) C10orf107 10q21.2 chromosome 10 open reading frame 107 9,25E-06 11,5756556 SYCP3 12q synaptonemal complex protein 3 8,44E-05 11,5398975 CCDC11 18q21.1 coiled-coil domain containing 11 1,75E-07 11,5373781 DKFZP434P211 22q11.22 POM121-like protein 2,58E-07 11,4660494 ZPBP 7p14.3 zona pellucida binding protein 3,07E-06 11,3832097 ASRGL1 11q12.3 asparaginase like 1 -> L-asparaginase 2,58E-07 11,3667507 tripartite motif-containing 36 -> E3 ubiquitin-protein ligase TRIM36 5q22.3 1,03E-06 11,1983363 TRIM36 RIMBP3 --- RIMS binding protein 3 2,03E-07 11,1348869 HIST1H2AA 6p22.2 histone cluster 1, H2aa 1,62E-05 11,0493071 ANKRD30A 10p11.21 ankyrin repeat domain 30A 7,95E-06 11,0435492 CABYR 18q11.2 calcium binding tyrosine-(Y)-phosphorylation regulated 9,48E-08 11,0229273 NA NA NA 5,25E-08 11,0105681 GKAP1 9q21.32 G kinase anchoring protein 1 1,11E-06 10,9813308 TPPP2 14q11.2 tubulin polymerization-promoting protein family member 2 7,49E-07 10,9655251 RNF17 13q12.12 ring finger protein 17 5,15E-05 10,9531544 HSPA1L 6p21.3 heat shock 70kDa protein 1-like 4,85E-07 10,9446886 HSPA1L 6p21.3 heat shock 70kDa protein 1-like 4,85E-07 10,9446886 HSPA1L 6p21.3 heat shock 70kDa protein 1-like 4,85E-07 10,9446886 94

GAPDHS 19q13.12 glyceraldehyde-3-phosphate dehydrogenase, spermatogenic 4,30E-08 10,8338304 RIMBP3 --- RIMS binding protein 3 1,31E-07 10,7410751 MLF1IP 4q35.1 MLF1 interacting protein -> Centromere protein U 5,56E-06 10,706626 RSPH10B 7p22.1 radial spoke head 10 homolog B (Chlamydomonas) 6,62E-08 10,69252 UBE2U 1p31.3 ubiquitin-conjugating enzyme E2U (putative) 1,01E-06 10,6705305 FLJ43980 16q11.2 FLJ43980 protein 9,97E-07 10,6565349 LELP1 1q21.3 late cornified envelope-like proline-rich 1 4,30E-08 10,5810251 ASB17 1p31.1 ankyrin repeat and SOCS box-containing 17 8,09E-07 10,5779269 ART3 4p15.1-p14 ADP-ribosyltransferase 3 2,09E-05 10,5573658 TTC21A 3p22.2 tetratricopeptide repeat domain 21A 2,70E-08 10,5542196 LOC541473 7q11.23 FK506 binding protein 6, 36kDa pseudogene 1,44E-06 10,5053149 transmembrane phosphoinositide 3-phosphatase and tensin TPTE2 13q12.11 homolog 2 -> Phosphatidylinositol-3,4,5-trisphosphate 3- 4,89E-05 10,5009031 phosphatase TPTE2 potassium channel tetramerisation domain containing 19 -> KCTD19 16q22.1 2,56E-06 10,4561657 BTB/POZ domain-containing protein KCTD19 HORMAD2 22q12.2 HORMA domain containing 2 2,51E-06 10,4208243 membrane-associated ring finger (C3HC4) 10 -> Probable E3 MARCH10 17q23.2 6,62E-08 10,4137553 ubiquitin-protein ligase MARCH10 CCT6B 17q12 chaperonin containing TCP1, subunit 6B (zeta 2) 3,25E-07 10,3550276 CCNB2 15q22.2 cyclin B2 3,50E-06 10,3134528 NA NA NA 4,42E-05 10,2976376 SYCP1 1p13-p12 synaptonemal complex protein 1 3,92E-05 10,2843414 CETN1 18p11.32 centrin, EF-hand protein, 1 3,83E-08 10,2801043 solute carrier family 25 (mitochondrial carrier; adenine nucleotide SLC25A31 4q28.1 6,67E-06 10,2602715 translocator), member 31 -> ADP/ATP translocase 4 C14orf50 14q23.3 chromosome 14 open reading frame 50 4,72E-07 10,2582555 HIST1H1T 6p21.3 histone cluster 1, H1t 1,67E-05 10,2024943 DBF4 7q21.3 DBF4 homolog (S. cerevisiae) 8,81E-07 10,1785772 ZMYND12 1p34.2 zinc finger, MYND-type containing 12 5,98E-08 10,1483481 95

C13orf28 13q34 chromosome 13 open reading frame 28 3,34E-08 10,1241368 STARD6 18q21.2 StAR-related lipid transfer (START) domain containing 6 2,04E-06 10,0904283 SPATA19 11q25 spermatogenesis associated 19 8,34E-08 10,0271138 LOC286187 8q13.1-q13.2 similar to RIKEN cDNA 1700011J18 8,94E-07 9,97788471 MYCBPAP 17q21.33 MYCBP associated protein 7,51E-08 9,91310492 SOX30 5q33 SRY (sex determining region Y)-box 30 1,27E-06 9,84548652 hCG_17324 2q14.2 primary ciliary dyskinesia protein 1 2,09E-06 9,8357666 CCDC136 7q33 coiled-coil domain containing 136 1,31E-07 9,82044228 MNS1 15q21.3 meiosis-specific nuclear structural 1 8,66E-07 9,80008322 LYZL6 17q11.2 lysozyme-like 6 2,58E-07 9,79041151 TTC25 17q21.2 tetratricopeptide repeat domain 25 2,14E-08 9,78561823 ubiquitin specific peptidase 44 -> Ubiquitin carboxyl-terminal USP44 12q22 1,91E-07 9,70571838 hydrolase 44 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 -> MYBL1 8q22 9,51E-06 9,68619468 Myb-related protein A pyruvate dehydrogenase (lipoamide) alpha 2 -> Pyruvate PDHA2 4q22-q23 dehydrogenase E1 component subunit alpha, testis-specific form, 8,11E-09 9,67916436 mitochondrial membrane-associated ring finger (C3HC4) 11 -> E3 ubiquitin- MARCH11 5p15.1 1,87E-07 9,6736276 protein ligase MARCH11 WDR63 1p22.3 WD repeat domain 63 4,49E-07 9,647255 ADCY10 1q24 adenylate cyclase 10 (soluble) 5,25E-08 9,61177582 TOP2A 17q21-q22 topoisomerase (DNA) II alpha 170kDa 4,05E-05 9,53620665 SMC1B 22q13.31 structural maintenance of chromosomes 1B 1,02E-04 9,49900564 TSPAN16 19p13.2 tetraspanin 16 8,58E-07 9,4736377 LOC440896 9q12 hypothetical gene LOC440896 2,58E-07 9,45653069 SPAG5 17q11.2 sperm associated antigen 5 1,46E-06 9,44636643 ADAM18 8p11.22 ADAM metallopeptidase domain 18 1,64E-06 9,32773305 LRRC44 1p31.1 leucine rich repeat containing 44 2,16E-06 9,24044609 LRRC46 17q21.32 leucine rich repeat containing 46 6,33E-07 9,21725076 96

DDX4 5p15.2-p13.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 7,74E-05 9,19628706 C20orf107 20q13.31 chromosome 20 open reading frame 107 5,07E-06 9,1650357 DPY19L2 12q14.2 dpy-19-like 2 (C. elegans) -> Protein dpy-19 homolog 2 2,00E-06 9,11969136 TUBA3D 2q21.1 tubulin, alpha 3d 5,57E-06 9,11553922 jumonji domain containing 2D -> Lysine (K)-specific demethylase KDM4D 11q21 3,23E-07 9,10276288 4D MDH1B 2q33.3 malate dehydrogenase 1B, NAD (soluble) 2,58E-07 9,08882944 chromosome 10 open reading frame 68 -> Coiled-coil domain CCDC7 10p11.22 9,01E-07 9,05156655 containing 7 (CCDC7) CASC5 15q14 cancer susceptibility candidate 5 7,88E-05 9,04132679 ANUBL1 10q11.21 AN1, ubiquitin-like, homolog (Xenopus laevis) 7,15E-07 8,99869628 CCDC38 12q22-q23.1 coiled-coil domain containing 38 5,43E-07 8,98477577 C4orf22 4q21.21 chromosome 4 open reading frame 22 2,65E-06 8,98370155 SIRPD 20p13 signal-regulatory protein delta 2,58E-07 8,96933795 PFKP 10p15.3-p15.2 phosphofructokinase, platelet -> 6-phosphofructokinase type C 4,27E-09 8,96250488 ACRBP 12p13.31 acrosin binding protein 1,02E-08 8,95863233 FAM154A 9p22.1 family with sequence similarity 154, member A 3,50E-07 8,88829377 LRRC9 14q23.1 leucine rich repeat containing 9 3,75E-06 8,82517569 LRRC44 1p31.1 leucine rich repeat containing 44 4,14E-06 8,8173645 LOC51233 22q11.2 hypothetical protein LOC51233 4,79E-07 8,79057478 TXNDC8 9q31.3 thioredoxin domain containing 8 (spermatozoa) 2,14E-08 8,78248983 CCDC67 11q21 coiled-coil domain containing 67 2,13E-06 8,7706879 keratin 23 (histone deacetylase inducible) -> Keratin, type I KRT23 17q21.2 2,58E-07 8,76867282 cytoskeletal 23 NIMA (never in mitosis gene a)- related kinase 10 -> NEK10 3p24.1 3,28E-07 8,75150719 Serine/threonine-protein kinase Nek10 MAEL 1q24.1 maelstrom homolog (Drosophila) 9,25E-06 8,7378328 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, ALS2CR12 2q33.1 1,74E-07 8,69180616 candidate 12 LAMP3 3q26.3-q27 lysosomal-associated membrane protein 3 7,89E-08 8,66726911 97

CCDC42 17p13.1 coiled-coil domain containing 42 6,41E-07 8,66049208 DEPDC1A 1p31.2 DEP domain containing 1 -> DEP domain-containing protein 1A 1,87E-05 8,6529556 DNAH17 17q25.3 dynein, axonemal, heavy chain 17 6,25E-08 8,61401897 EFCAB5 17q11.2 EF-hand calcium binding domain 5 3,93E-07 8,59343544 C12orf63 12q23.1 chromosome 12 open reading frame 63 1,81E-06 8,58896326 DKFZP434P211 22q11.22 POM121-like protein 2,27E-07 8,5789168 LOC100129278 2p24.1 hypothetical protein LOC100129278 7,41E-06 8,54797981 exonuclease 3'-5' domain-like 1 -> Exonuclease 3'-5' domain- EXD1 15q15.1 8,44E-07 8,51404668 containing protein 1 NRG4 15q24.2 neuregulin 4 -> Pro-neuregulin-4, membrane-bound isoform 1,35E-06 8,46540447 RP11-251J8.1 13q13.3 hypothetical protein LOC728591 3,58E-08 8,4375199 KIF18A 11p14.1 kinesin family member 18A 1,67E-05 8,42271879 chromosome 9 open reading frame 11 -> Acrosome formation- AFAF 9p21 3,30E-07 8,4081826 associated factor TTC6 14q21.1 tetratricopeptide repeat domain 6 8,74E-06 8,37593067 ARMC4 10p12.1-p11.23 armadillo repeat containing 4 1,07E-07 8,35221298 HMGB4 1p35.1 high-mobility group box 4 1,66E-07 8,34631575 LOC220115 13q14.3 TPTE pseudogene 5,12E-05 8,33937347 ADAM5P 8p11.23 ADAM metallopeptidase domain 5 pseudogene 5,60E-05 8,29860305 FK506 binding protein 6, 36kDa -> Peptidyl-prolyl cis-trans FKBP6 7q11.23 5,35E-06 8,28246384 isomerase FKBP6 C17orf64 17q23.2 chromosome 17 open reading frame 64 7,35E-08 8,24684047 GLIPR1L1 12q21.1 GLI pathogenesis-related 1 like 1 2,68E-07 8,20513175 RNF133 7q31.32 ring finger protein 133 -> E3 ubiquitin-protein ligase RNF133 7,00E-07 8,19735229 KIF2C 1p34.1 kinesin family member 2C 4,22E-07 8,19716478 dpy-19-like 2 pseudogene 1 (C. elegans) -> Protein dpy-19 DPY19L2P1 7p14.2 5,79E-06 8,19339007 homolog 2-like 1 C7orf31 7p15.2 chromosome 7 open reading frame 31 2,00E-07 8,19072695 C21orf99 21q11.2 chromosome 21 open reading frame 99 5,27E-05 8,18449839 C6orf146 6p25.2 chromosome 6 open reading frame 146 1,18E-05 8,18400201 98

capping protein (actin filament) muscle Z-line, alpha 3 -> F-actin- CAPZA3 12p12.3 5,65E-07 8,17046111 capping protein subunit alpha-3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- GALNTL5 7q36.1 2,31E-06 8,15432806 acetylgalactosaminyltransferase-like 5 WDR87 19q13.13 WD repeat domain 87 5,98E-08 8,15086121 VWA3B 2q11.2 von Willebrand factor A domain containing 3B 2,16E-07 8,09343983 C11orf70 11q22.1 chromosome 11 open reading frame 70 1,10E-06 8,07700818 DNAJC5B 8q13.1 DnaJ (Hsp40) homolog, subfamily C, member 5 beta 1,76E-06 8,0732832 LRRC50 16q24.1 leucine rich repeat containing 50 8,54E-07 8,05723313 protein phosphatase, EF-hand calcium binding domain 1 -> PPEF1 Xp22.2-p22.1 1,01E-06 8,0554741 Serine/threonine-protein phosphatase with EF-hands 1 CTAGE6 7q35 CTAGE family, member 6 2,39E-06 8,05212183 RPL39L 3q27 ribosomal protein L39-like 9,80E-07 8,00853026 ANKRD20B 2q11.1 ankyrin repeat domain 20B 8,56E-05 7,98257941 FLJ25758 19p13.3 hypothetical locus FLJ25758 1,61E-06 7,97022803 LASS3 15q26.3 LAG1 homolog, ceramide synthase 3 2,74E-07 7,95359168 RNF32 7q36 ring finger protein 32 8,33E-08 7,95183047 PTCHD3 10p12.1 patched domain containing 3 1,60E-07 7,94947453 XIRP1 3p22.2 xin actin-binding repeat containing 1 6,03E-06 7,94398005 OPN5 6p12.3 opsin 5 3,34E-08 7,91304521 C9orf43 9q32 chromosome 9 open reading frame 43 1,85E-06 7,85110653 SIX6OS1 14q23.1 chromosome 14 open reading frame 39 -> Protein SIX6OS1 1,87E-05 7,81779633 TKTL2 4q32.3 transketolase-like 2 1,15E-07 7,81622772 CCNYL3 16p11.2 cyclin Y-like 3 7,86E-06 7,77886678 CCNYL2 10q11.21 cyclin Y-like 2 1,31E-05 7,77151301 ANKRD26-like family A, member 1 -> POTE ankyrin domain family POTEA 8p11.1 2,65E-07 7,76875007 member A (POTEA) ATP/GTP binding protein-like 5 -> Cytosolic carboxypeptidase-like AGBL5 2p23.3 5,47E-07 7,75699569 protein 5 CCNA1 13q12.3-q13 cyclin A1 9,05E-08 7,7544556 99

C9orf153 9q21.33 chromosome 9 open reading frame 153 2,46E-06 7,72119153 PTTG1 5q35.1 pituitary tumor-transforming 1 -> Securin 9,10E-07 7,71259043 ZWILCH 15q22.31 Zwilch, kinetochore associated, homolog (Drosophila) 4,36E-06 7,672754 LRWD1 7q22.1 leucine-rich repeats and WD repeat domain containing 1 7,35E-08 7,66491079 LOC158830 Xq13.1 similar to Ab2-183 2,02E-07 7,66451764 LRRC36 16q22.1 leucine rich repeat containing 36 6,58E-07 7,6303805 DPY19L2P4 7q21.13 dpy-19-like 2 pseudogene 4 (C. elegans) 3,59E-06 7,62619013 C18orf34 18q12.1 chromosome 18 open reading frame 34 4,28E-06 7,62413149 TYMS 18p11.32 thymidylate synthetase 2,58E-07 7,62335997 TEX14 17q22 testis expressed 14 3,03E-06 7,62139189 CDKL2 4q21.1 cyclin-dependent kinase-like 2 (CDC2-related kinase) 1,75E-07 7,58386088 C1orf105 1q24.3 chromosome 1 open reading frame 105 1,06E-06 7,58111211 C12orf40 12q12 chromosome 12 open reading frame 40 9,58E-06 7,57994038 SEPT12 16p13.3 septin 12 6,62E-08 7,56568652 RAD9 homolog B (S. cerevisiae) -> Cell cycle checkpoint control RAD9B 12q24.11 7,22E-05 7,54289321 protein RAD9B TDRD5 1q25.2 tudor domain containing 5 1,26E-05 7,48146343 ACTL7A 9q31 actin-like 7A 4,29E-08 7,47356451 HMMR 5q33.2-qter hyaluronan-mediated motility receptor (RHAMM) 3,52E-06 7,46011826 Sad1 and UNC84 domain containing 1 -> SUN domain-containing SUN3 7p12.3 2,36E-06 7,45887474 protein 3 CCDC65 12q13.12 coiled-coil domain containing 65 3,61E-07 7,40887247 STK31 7p15.3 serine/threonine kinase 31 7,72E-05 7,40169147 DNAI1 9p21-p13 dynein, axonemal, intermediate chain 1 3,86E-07 7,39881641 MORN2 2p22.1 MORN repeat containing 2 3,30E-07 7,38583227 RNF148 7q31.33 ring finger protein 148 1,01E-06 7,37412054 chromosome 20 open reading frame 71 -> Short palate, lung and SPLUNC3 20q11.21 4,30E-08 7,36391768 nasal epithelium carcinoma-associated protein 3 C12orf55 12q23.1 chromosome 12 open reading frame 55 2,67E-06 7,35553868 GALNT3 2q24-q31 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- 9,77E-08 7,3517413 100

acetylgalactosaminyltransferase 3 (GalNAc-T3) TMPRSS12 12q13.13 transmembrane protease, serine 12 3,45E-07 7,29264163 DTL 1q32.1-q32.2 denticleless homolog (Drosophila) 2,67E-05 7,29062754 LRRIQ1 12q21.31 leucine-rich repeats and IQ motif containing 1 2,51E-06 7,26195002 MS4A6E 11q12.2 membrane-spanning 4-domains, subfamily A, member 6E 3,11E-07 7,23235252 discs, large homolog 7 (Drosophila) -> Discs, large-associated DLGAP5 14q22.3 1,34E-05 7,21653101 protein 5 APH1B 15q22.2 anterior pharynx defective 1 homolog B (C. elegans) 2,73E-07 7,21003369 SGOL2 2q33.1 shugoshin-like 2 (S. pombe) 1,17E-05 7,17906022 RNA binding motif protein 44 -> Leucine-rich repeat flightless- LRRFIP1 2q37.3 2,57E-05 7,16272474 interacting protein 1 CCDC112 5q22.3 coiled-coil domain containing 112 2,18E-06 7,15826771 C6orf201 6p25.2 chromosome 6 open reading frame 201 4,28E-07 7,15462425 C13orf27 13q33.1 chromosome 13 open reading frame 27 5,27E-05 7,15182036 TDRD6 6p12.3 tudor domain containing 6 3,78E-05 7,14594346 SPZ1 5q14.1 spermatogenic leucine zipper 1 1,01E-05 7,14367526 HOOK1 1p32.1 hook homolog 1 (Drosophila) 5,18E-07 7,11946089 chromosome 14 open reading frame 140 -> Family with sequence FAM164C 14q24.3 1,99E-06 7,09838586 similarity 164, member C (FAM164C) tudor domain containing 9 -> Putative ATP-dependent RNA TDRD9 14q32.33 6,51E-05 7,06314885 helicase TDRD9 LOC100130967 6q25.3 similar to hCG2044932 1,04E-07 7,05033104 GLIPR1L2 12q21.1-q21.2 GLI pathogenesis-related 1 like 2 2,65E-07 7,0284911 NEFM 8p21 neurofilament, medium polypeptide 150kDa 1,81E-07 7,02629184 ADAM32 8p11.23 ADAM metallopeptidase domain 32 2,32E-07 7,0249843 chromosome 9 open reading frame 18 -> MORN repeat- MORN5 9q33.2 2,58E-07 7,02044996 containing protein 5 ANKRD20B 2q11.1 ankyrin repeat domain 20B 1,03E-04 7,00401901 solute carrier family 9, member 10 -> Sodium/hydrogen SLC9A10 3q13.2 8,79E-06 6,99729589 exchanger 10 101

STAT4 2q32.2-q32.3 signal transducer and activator of transcription 4 4,04E-07 6,9836899 DKFZp779B1634 18p11.21 similar to KIAA1074 protein 8,26E-06 6,9800724 ANKRD20B 2q11.1 ankyrin repeat domain 20B 1,14E-04 6,96657474 ANKRD20B 2q11.1 ankyrin repeat domain 20B 1,14E-04 6,96657474 PMP22 claudin domain-containing protein -> Transmembrane TMEM225 11q24.1 5,96E-08 6,9655173 protein 225 AGBL2 11p11.2 ATP/GTP binding protein-like 2 -> Cytosolic carboxypeptidase 2 2,65E-07 6,95572309 CENPK 5p15.2-q12.3 centromere protein K 5,20E-05 6,94640968 C2orf16 2p23.3 chromosome 2 open reading frame 16 1,11E-06 6,93034897 NIMA (never in mitosis gene a)-related kinase 2 -> NEK2 1q32.2-q41 3,41E-07 6,91157497 Serine/threonine-protein kinase Nek2 ZSWIM2 2q32.1 zinc finger, SWIM-type containing 2 6,77E-06 6,91111746 STRBP 9q33.3 spermatid perinuclear RNA binding protein 2,95E-06 6,9086676 C11orf65 11q22.3 chromosome 11 open reading frame 65 8,98E-06 6,90691036 PDCL2 4q12 phosducin-like 2 1,53E-06 6,89826236 Ly1 antibody reactive homolog (mouse) -> Cell growth-regulating LYAR 4p16.2 4,76E-07 6,88169284 nucleolar protein C7orf45 7q32.2 chromosome 7 open reading frame 45 2,51E-07 6,87386491 ANKRD20B 2q11.1 ankyrin repeat domain 20B 7,11E-05 6,85798382 CCNE2 8q22.1 cyclin E2 1,37E-05 6,83302071 LRRC6 8q24.22 leucine rich repeat containing 6 1,80E-06 6,83238845 KH domain containing, RNA binding, signal transduction KHDRBS3 8q24.2 1,95E-06 6,82869075 associated 3 C2orf14 2q21.1 chromosome 2 open reading frame 14 2,65E-05 6,78245232 HRASLS 3q29 HRAS-like suppressor 1,54E-06 6,78077418 EFHB 3p24.3 EF-hand domain family, member B 1,23E-06 6,77843865 chromosome 15 open reading frame 23 -> Putative TRAF4- TRAF4AF1 15q15.1 2,58E-07 6,76961834 associated factor 1 CYLC2 9q31.1 cylicin, basic protein of sperm head cytoskeleton 2 2,60E-06 6,76860957 BNC1 15q25.2 basonuclin 1 3,23E-06 6,76786129 102

FLJ40176 13q33.1 hypothetical LOC121951 1,55E-05 6,75894465 FNDC8 17q12 fibronectin type III domain containing 8 7,94E-07 6,74561276 IFLTD1 12p12.1 intermediate filament tail domain containing 1 3,53E-06 6,72266612 cancer/testis antigen CT45 -> Cancer/testis antigen family 45, CT45A2 Xq26.3 2,87E-04 6,72147332 member A2 (CT45A2) C2orf14 2q21.1 chromosome 2 open reading frame 14 2,94E-05 6,72083041 C10orf62 10q24.2 chromosome 10 open reading frame 62 1,44E-07 6,71792412 DDX20 1p21.1-p13.2 DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 2,57E-07 6,71030806 DKKL1 19q13.33 dickkopf-like 1 (soggy) 1,57E-07 6,69493941 C3orf24 3p25.3 chromosome 3 open reading frame 24 1,80E-07 6,67929114 FBXL13 7q22.1 F-box and leucine-rich repeat protein 13 2,52E-06 6,67502158 LOC100129969 9p13.3 hypothetical protein LOC100129969 7,58E-07 6,62635272 DNAH12 3p14.3 dynein heavy chain domain 2 -> Dynein heavy chain 12, axonemal 7,99E-06 6,60864042 C18orf54 18q21.2 chromosome 18 open reading frame 54 1,90E-05 6,58039187 NA NA NA 1,74E-07 6,56099899 LYZL2 10p11.23 lysozyme-like 2 6,81E-06 6,5541037 La ribonucleoprotein domain family, member 2 -> La-related LARP1B 4q28.2 5,73E-07 6,54483354 protein 1B DAZL 3p24.3 deleted in azoospermia-like 1,16E-04 6,53055453 NA NA NA 1,16E-07 6,4991543 C10orf122 10q26.13 chromosome 10 open reading frame 122 4,07E-06 6,49083013 cancer/testis antigen CT45 -> Cancer/testis antigen family 45, CT45A2 Xq26.3 2,57E-04 6,48838308 member A2 (CT45A2) RBM46 4q32.1 RNA binding motif protein 46 6,34E-05 6,48359286 PCYT2 17q25.3 phosphate cytidylyltransferase 2, ethanolamine 3,14E-08 6,48023441 C1orf101 1q44 chromosome 1 open reading frame 101 5,85E-07 6,47849409 CAPN11 6p12 calpain 11 2,80E-07 6,42820082 CCDC79 16q22.1 coiled-coil domain containing 79 3,89E-05 6,4048665 C1orf100 1q44 chromosome 1 open reading frame 100 5,48E-06 6,38534469 TDRD1 10q25.3 tudor domain containing 1 1,05E-04 6,38106841 103

TDRG1 6p21.2 testis development related protein 1 -> HCG2000155 6,11E-06 6,37778295 CCDC36 3p21.31 coiled-coil domain containing 36 2,02E-06 6,32897338 DIAPH3 13q21.2 diaphanous homolog 3 (Drosophila) 4,40E-05 6,32192097 FLJ40298 2p16.2 hypothetical protein FLJ40298 4,28E-06 6,30439312 C16orf73 16p13.3 chromosome 16 open reading frame 73 2,44E-05 6,3022457 CEP55 10q23.33 centrosomal protein 55kDa 2,74E-07 6,29142141 GLT1D1 12q24.32 glycosyltransferase 1 domain containing 1 3,43E-06 6,28252932 C17orf74 17p13.1 chromosome 17 open reading frame 74 2,03E-07 6,27323453 CDC25C 5q31 cell division cycle 25 homolog C (S. pombe) 7,56E-07 6,26937228 ANKRD20B 2q11.1 ankyrin repeat domain 20B 8,21E-05 6,25931161 SPATS1 6p21.1 spermatogenesis associated, serine-rich 1 6,04E-07 6,25759592 non-metastatic cells 5, protein expressed in (nucleoside- NME5 5q31 9,83E-07 6,24285519 diphosphate kinase) EFCAB6 22q13.1-q13.33 EF-hand calcium binding domain 6 8,19E-07 6,240666 NIMA (never in mitosis gene a)-related kinase 5 -> NEK5 13q14.3 9,40E-07 6,23256274 Serine/threonine-protein kinase Nek5 polo-like kinase 4 (Drosophila) -> Serine/threonine-protein kinase PLK4 4q28 1,70E-05 6,21946291 PLK4 C14orf45 14q24.3 chromosome 14 open reading frame 45 1,16E-06 6,21660322 C22orf23 22q13.1 chromosome 22 open reading frame 23 3,12E-08 6,20708972 RNF151 16p13.3 ring finger protein 151 3,32E-07 6,20121109 C20orf26 20p11.23 chromosome 20 open reading frame 26 1,33E-06 6,195323 CEP110 9q33-q34 centrosomal protein 110kDa 3,87E-06 6,19005617 ubiquitin specific peptidase 2 -> Ubiquitin carboxyl-terminal USP2 11q23.3 1,44E-07 6,18701701 hydrolase 2 TCP10L 21q22.11 t-complex 10 (mouse)-like 2,29E-07 6,17058171 XK, Kell blood group complex subunit-related family, member 3 -> XKR3 22q11.1 1,35E-06 6,16727424 XK-related protein 3 DEPDC7 11p13 DEP domain containing 7 7,35E-08 6,16131587 POTED 21q11.2 ANKRD26-like family B, member 3 -> POTE ankyrin domain family, 1,10E-04 6,14750286 104

member D (POTED) proteasome (prosome, macropain) subunit, alpha type, 8 -> PSMA8 18q11.2 5,18E-06 6,14505959 Proteasome subunit alpha type-7-like LOC645961 9q22.1 similar to chromosome 9 open reading frame 36 1,51E-07 6,14458681 phosphate cytidylyltransferase 2, ethanolamine -> Ethanolamine- PCYT2 17q25.3 3,58E-08 6,13595116 phosphate cytidylyltransferase FLJ43390 14q23.2 hypothetical LOC646113 3,61E-06 6,11820946 cancer/testis antigen CT45 -> Cancer/testis antigen family 45, CT45A2 Xq26.3 3,44E-04 6,10706839 member A2 (CT45A2) LEMD1 1q32.1 LEM domain containing 1 1,60E-06 6,1019506 IFT88 13q12.1 intraflagellar transport 88 homolog (Chlamydomonas) 3,93E-06 6,09850449 NA NA NA 3,08E-06 6,07789183 C13orf26 13q12.3 chromosome 13 open reading frame 26 2,74E-06 6,06834875 Ral GEF with PH domain and SH3 binding motif 2 -> Ras-specific RALGPS2 1q25.2 3,15E-06 6,05474626 guanine nucleotide-releasing factor RalGPS2 non-SMC condensin I complex, subunit G -> Condensin complex NCAPG 4p15.33 3,38E-05 6,04915237 subunit 3 LOC157740 8p23.1 hypothetical protein C8orf9 2,57E-07 6,03836933 FANK1 10q26.2 fibronectin type III and ankyrin repeat domains 1 1,45E-06 6,03581463 ANKRD20A2 9p12-p11.2 ankyrin repeat domain 20 family, member A2 6,32E-05 6,0259053 C12orf56 12q14.2 chromosome 12 open reading frame 56 4,31E-06 6,01721331 CCDC135 16q13 coiled-coil domain containing 135 9,05E-08 6,01311062 chromosome 6 open reading frame 94 -> Family with sequence FAM164B 6q24.2 1,28E-05 6,0002225 similarity 164, member B (FAM164B) RIMBP3 --- RIMS binding protein 3 2,58E-07 5,99228607 OVOS 12p13 ovostatin 8,10E-05 5,98799701 PRC1 15q26.1 protein regulator of cytokinesis 1 1,48E-06 5,97015546 ANKRD20A2 9p12-p11.2 ankyrin repeat domain 20 family, member A2 5,76E-05 5,96687684 ANKRD20A2 9p12-p11.2 ankyrin repeat domain 20 family, member A2 5,76E-05 5,96687684 ANKRD19 9q22.31 ankyrin repeat domain 19 2,05E-06 5,96585949 105

tubulin tyrosine ligase-like family, member 6 -> Tubulin TTLL6 17q21.32 1,15E-06 5,96234146 polyglutamylase TTLL6 C1orf158 1p36.21 chromosome 1 open reading frame 158 1,75E-07 5,95341514 OVOS2 12p11.21 ovostatin 2 5,61E-05 5,943466 MSH4 1p31 mutS homolog 4 (E. coli) 1,07E-05 5,94148887 NA NA NA 4,28E-06 5,93754894 PPIL6 6q21 peptidylprolyl isomerase (cyclophilin)-like 6 2,69E-06 5,9372732 CP110 16p12.3 CP110 protein 1,05E-05 5,92938921 cancer/testis antigen CT45 -> Cancer/testis antigen family 45, CT45A2 Xq26.3 3,59E-04 5,92516981 member A2 (CT45A2) ASB14 3p21.1 ankyrin repeat and SOCS box-containing 14 1,10E-06 5,91535602 SOHLH2 13q13.3 spermatogenesis and oogenesis specific basic helix-loop-helix 2 7,83E-06 5,89760214 NRIP3 11p15.3 nuclear receptor interacting protein 3 4,54E-06 5,8943266 KIF9 3p21.31 kinesin family member 9 3,30E-07 5,88659348 ANKRD20B 2q11.1 ankyrin repeat domain 20B 1,57E-04 5,88285102 FBXO43 8q22.2 F-box protein 43 6,04E-07 5,87542617 KIF15 3p21.31 kinesin family member 15 2,70E-06 5,87316024 FLJ25439 5p13.2 hypothetical protein FLJ25439 1,78E-06 5,86638193 C9orf144A 9p13.2 chromosome 9 open reading frame 144 5,00E-07 5,85447174 CDC20B 5q11.2 cell division cycle 20 homolog B (S. cerevisiae) 3,99E-08 5,84192566 CASC1 12p12.1 cancer susceptibility candidate 1 9,94E-06 5,84023329 IFT122 3q21 intraflagellar transport 122 homolog (Chlamydomonas) 3,98E-06 5,83694106 ASAP2 2p25|2p24 development and differentiation enhancing factor 2 3,12E-07 5,83579215 C8orf45 8q13.1 chromosome 8 open reading frame 45 6,83E-06 5,83547664 CYB5R2 11p15.4 cytochrome b5 reductase 2 4,35E-08 5,83169796 C14orf174 14q24.3 chromosome 14 open reading frame 174 3,30E-07 5,82028581 LOC619208 6q21 hypothetical protein LOC619208 4,39E-07 5,81984004 ANKRD20A2 9p12-p11.2 ankyrin repeat domain 20 family, member A2 5,96E-05 5,819836 DYNLRB2 16q23.3 dynein, light chain, roadblock-type 2 2,16E-06 5,8102289 106

YBX2 17p11.2-p13.1 Y box binding protein 2 1,31E-07 5,80761775 NA NA NA 3,24E-06 5,79918435 NPY5R 4q31-q32 neuropeptide Y receptor Y5 1,81E-07 5,79183499 deleted in a mouse model of primary ciliary dyskinesia -> Protein DPCD 10q24.32 2,71E-07 5,78498813 DPCD HEMGN 9q22.33 hemogen 8,27E-06 5,78481972 SENP1 12q13.1 SUMO1/sentrin specific peptidase 1 -> Sentrin-specific protease 1 5,03E-07 5,78243843 EZH2 7q35-q36 enhancer of zeste homolog 2 (Drosophila) 1,07E-05 5,76976876 DNAH12L 3p14.3 dynein, axonemal, heavy chain 12-like 7,26E-07 5,76468589 MTL5 11q13.2-q13.3 metallothionein-like 5, testis-specific (tesmin) 1,96E-07 5,74988659 CCIN 9p13.3 calicin 2,19E-06 5,72923494 cancer/testis antigen CT45 -> Cancer/testis antigen family 45, CT45A2 Xq26.3 3,84E-04 5,72866709 member A2 (CT45A2) CAGE1 6p24.3 cancer antigen 1 9,34E-06 5,71717718 CDK1 10q21.1 cell division cycle 2, G1 to S and G2 to M 1,61E-06 5,70412066 ZMYND10 3p21.3 zinc finger, MYND-type containing 10 4,29E-08 5,69340607 C16orf65 16p12.1 chromosome 16 open reading frame 65 6,73E-06 5,68633463 C20orf85 20q13.32 chromosome 20 open reading frame 85 2,57E-07 5,67928574 WBP2 N-terminal like -> Postacrosomal sheath WW domain- WBP2NL 22q13.2 1,33E-06 5,67184261 binding protein oleoyl-ACP hydrolase -> S-acyl fatty acid synthase thioesterase, OLAH 10p13 2,10E-06 5,66259952 medium chain C16orf78 16q12.1 chromosome 16 open reading frame 78 8,56E-06 5,66132992 C10orf120 10q26.13 chromosome 10 open reading frame 120 3,49E-06 5,65978206 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, ALS2CR11 2q33.1 3,06E-06 5,64568447 candidate 11 C12orf25 12q13.12 chromosome 12 open reading frame 25 8,48E-08 5,64529511 RIBC2 22q13.31 RIB43A domain with coiled-coils 2 6,54E-07 5,64129546 non-SMC condensin I complex, subunit H -> Condensin complex NCAPH 2q11.2 8,58E-07 5,61225476 subunit 2 107

AKAP1 17q21-q23 A kinase (PRKA) anchor protein 1 8,08E-07 5,58120833 LOC642864 1p13.3 spermatogenesis-related protein 7 7,85E-06 5,57077868 ANKRD26-like family B, member 1 -> POTE ankyrin domain family POTEB 15q11.2 8,57E-05 5,56796831 member B (POTEB) LYZL1 10p11.23 lysozyme-like 1 5,57E-06 5,55474814 FLJ25371 4q32.1 hypothetical protein FLJ25371 6,21E-06 5,55026248 NOL1/NOP2/Sun domain family, member 7 -> Putative NSUN7 4p14 6,04E-07 5,54685687 methyltransferase NSUN7 IL13RA2 Xq13.1-q28 interleukin 13 receptor, alpha 2 9,80E-06 5,53695386 SPANX family, member N3 -> Sperm protein associated with the SPANXN3 Xq27.3 2,68E-07 5,52358718 nucleus on the X chromosome N3 GRK4 4p16.3 G protein-coupled receptor kinase 4 6,02E-07 5,51867337 LOC645961 9q22.1 similar to chromosome 9 open reading frame 36 1,26E-07 5,51567901 C20orf152 20q11.23 chromosome 20 open reading frame 152 1,71E-06 5,51225642 CDCA2 8p21.2 cell division cycle associated 2 2,37E-05 5,51187817 CCDC39 3q26.33 coiled-coil domain containing 39 1,11E-06 5,50315132 FBXW10 17p12 F-box and WD repeat domain containing 10 3,75E-07 5,47885909 ABHD1 2p23.3 abhydrolase domain containing 1 4,49E-07 5,45969743 NA NA NA 1,64E-04 5,45816875 GLB1L 2q35 galactosidase, beta 1-like 5,83E-07 5,45553998 LRRCC1 8q21.2 leucine rich repeat and coiled-coil domain containing 1 1,79E-06 5,44354317 cancer/testis antigen CT45 -> Cancer/testis antigen family 45, CT45A2 Xq26.3 3,70E-04 5,40936595 member A2 (CT45A2) COIL 17q22-q23 coilin 6,38E-08 5,40732099 CDRT1 17p12 CMT1A duplicated region transcript 1 4,61E-05 5,39896364 protein phosphatase 3 (formerly 2B), regulatory subunit B, beta PPP3R2 9q31.1 1,79E-07 5,39553867 isoform -> Calcineurin subunit B type 2 LOC400566 17p13.3 hypothetical gene supported by AK128660 1,96E-07 5,39022875 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) - BUB1 2q14 8,26E-06 5,3895432 > Mitotic checkpoint serine/threonine-protein kinase 108

MORC1 3q13 MORC family CW-type zinc finger 1 4,71E-05 5,38335289 MGC26718 18p11.21 similar to ankyrin repeat domain 20A 3,89E-05 5,38273537 male germ cell-associated kinase -> Serine/threonine-protein MAK 6p24 3,96E-07 5,36843658 kinase MAK C6orf224 6q21 chromosome 6 open reading frame 224 6,21E-06 5,36686091 C22orf27 22q12.2 chromosome 22 open reading frame 27 9,01E-07 5,36064278 leucine zipper-EF-hand containing transmembrane protein 2 -> LETM2 8p12 9,46E-07 5,35564933 LETM1 domain-containing protein LETM2, mitochondrial GOLGA8E 15q11.2 golgi autoantigen, golgin subfamily a, 8E 4,37E-06 5,35470279 DNAH7 2q32.3 dynein, axonemal, heavy chain 7 2,74E-06 5,35329813 ANKRD20B 2q11.1 ankyrin repeat domain 20B 2,25E-05 5,34424816 RP11-146D12.4 9p11.2 family with sequence similarity 95, member B1 2,25E-05 5,34424816 RACGAP1 12q13.13 Rac GTPase activating protein 1 1,07E-05 5,33919041 HSPA4L 4q28 heat shock 70kDa protein 4-like 4,55E-07 5,33580336 golgi autoantigen, golgin subfamily a, 8G -> Golgin subfamily A GOLGA8G 15q13.1 5,04E-06 5,32803109 member 8F/8G ANKRD20A2 9p12-p11.2 ankyrin repeat domain 20 family, member A2 1,84E-05 5,31756956 chromosome 19 open reading frame 15 -> Cation channel sperm- CATSPERG 19q13.1 7,51E-08 5,31696327 associated protein subunit gamma LOC651452 20p11.21 similar to POM121-like 2,84E-06 5,2995652 C9orf57 9q21.13 chromosome 9 open reading frame 57 5,53E-07 5,29434607 ANKRD26-like family C, member 1B -> POTE ankyrin domain POTEF 2q21.1 6,44E-05 5,26479552 family, member F (POTEF) LOC158381 9p13.3 ATPase, Class I, type 8B family pseudogene 1,77E-06 5,26001349 C6orf103 6q24.3 chromosome 6 open reading frame 103 7,71E-07 5,25645259 golgi autoantigen, golgin subfamily a, 6B -> Golgin subfamily A GOLGA6B 15q24.1 5,47E-07 5,24899419 member 6B PPIL5 14q22.1 peptidylprolyl isomerase (cyclophilin)-like 5 4,82E-07 5,24755725 SPATA18 4q12 spermatogenesis associated 18 homolog (rat) 1,16E-06 5,23798708 LEF1 4q23-q25 lymphoid enhancer-binding factor 1 4,14E-06 5,2282296 109

phosphodiesterase 1A, calmodulin-dependent -> PDE1A 2q32.1 Calcium/calmodulin-dependent 3',5'-cyclic nucleotide 5,18E-06 5,21780671 phosphodiesterase 1A SPACA4 19q13.33 sperm acrosome associated 4 1,46E-06 5,21651389 C6orf81 6p21.31 chromosome 6 open reading frame 81 2,40E-07 5,2018363 CETN3 5q14.3 centrin, EF-hand protein, 3 (CDC31 homolog, yeast) 1,10E-06 5,18939913 RP11-195B21.3 9q12 hypothetical LOC644249 4,93E-05 5,18147376 DEPDC1B 5q12.1 DEP domain containing 1B 5,07E-07 5,17862826 RAD51AP1 12p13.2-p13.1 RAD51 associated protein 1 1,79E-05 5,17069067 DCDC1 11p13 doublecortin domain containing 1 2,21E-05 5,14918463 CDRT1 17p12 CMT1A duplicated region transcript 1 4,43E-07 5,14688126 ANKRD26-like family B, member 1 -> POTE ankyrin domain family POTEB 15q11.2 5,55E-05 5,14647815 member B (POTEB) ASZ1 7q31.2 ankyrin repeat, SAM and basic leucine zipper domain containing 1 1,44E-04 5,14259486 golgi autoantigen, golgin subfamily a, 8G -> Golgin subfamily A GOLGA8G 15q13.1 3,23E-06 5,13768522 member 8F/8G golgi autoantigen, golgin subfamily a, 8G -> Golgin subfamily A GOLGA8G 15q13.1 3,23E-06 5,13768522 member 8F/8G ZNF233 19q13.31 zinc finger protein 233 1,11E-06 5,13587824 BTG4 11q23 B-cell translocation gene 4 1,17E-07 5,11935659 AURKA 20q13.2-q13.3 aurora kinase A -> Serine/threonine-protein kinase 6 2,07E-05 5,11553099 C12orf12 12q21.33 chromosome 12 open reading frame 12 3,30E-07 5,11457017 golgi autoantigen, golgin subfamily a, 6 -> Golgin subfamily A GOLGA6A 15q24.1 5,89E-07 5,11219015 member 6A DNAH10 12q24.31 dynein, axonemal, heavy chain 10 1,41E-06 5,10855759 TMEM146 19p13.3 transmembrane protein 146 5,12E-07 5,10494883 solute carrier family 2 (facilitated glucose/fructose transporter), SLC2A5 1p36.2 1,70E-08 5,10477191 member 5 CLTCL1 22q11.2|22q11.21 clathrin, heavy chain-like 1 1,29E-07 5,10041274 ATP1A3 19q13.31 ATPase, Na+/K+ transporting, alpha 3 polypeptide 1,96E-07 5,09814533 110

ANKRD26-like family C, member 1A -> POTE ankyrin domain POTEE 2q21.1 5,69E-05 5,08437521 family, member E (POTEE) TEKT3 17p12 tektin 3 2,90E-06 5,080081 RNFT1 17q23.1 ring finger protein, transmembrane 1 1,79E-06 5,06983221 SPATA6 1p33 spermatogenesis associated 6 4,36E-07 5,05963566 TBPL1 6q22.1-q22.3 TBP-like 1 3,43E-06 5,05791398 RGSL1 1q25 regulator of G-protein signaling like 1 1,97E-05 5,0338684 CAMK4 5q21.3 calcium/calmodulin-dependent protein kinase IV 1,11E-06 5,0187845 FAM71D 14q23.3 family with sequence similarity 71, member D 4,40E-06 5,00544384 GK Xp21.3 glycerol kinase 3,30E-07 5,00017643 RGSL1 1q25 regulator of G-protein signaling like 1 2,36E-05 4,97625529 C12orf54 12q13.11 chromosome 12 open reading frame 54 1,38E-06 4,97102376 POM121L2 6p22.1 POM121 membrane glycoprotein-like 2 (rat) 1,46E-06 4,96834033 NA NA NA 8,96E-06 4,96779452 phosphorylase kinase, gamma 2 (testis) -> Phosphorylase b kinase PHKG2 16p12.1-p11.2 7,89E-08 4,96597328 gamma catalytic chain, testis/liver isoform OR2J3 6p22.1 olfactory receptor, family 2, subfamily J, member 3 6,77E-05 4,95742862 BUB1 budding uninhibited by benzimidazoles 1 homolog beta BUB1B 15q15 (yeast) -> Mitotic checkpoint serine/threonine-protein kinase 4,04E-06 4,95655418 BUB1 beta golgi autoantigen, golgin subfamily a, 6B -> Golgin subfamily A GOLGA6B 15q24.1 8,19E-07 4,95197318 member 6B C6orf105 6p24.1 chromosome 6 open reading frame 105 3,85E-05 4,94649459 TDRD10 1q21.3 tudor domain containing 10 1,64E-06 4,93478421 NA NA NA 1,22E-06 4,90248936 FLJ40092 5q13.2 FLJ40092 protein 6,30E-07 4,90232795 Klkbl4 16q21 plasma kallikrein-like protein 4 8,01E-07 4,90155326 STAG3 7q22.1 stromal antigen 3 -> Cohesin subunit SA-3 9,75E-06 4,90128147 LOC100133469 --- hypothetical protein LOC100133469 2,49E-07 4,89184774 CCDC99 5q35.1 coiled-coil domain containing 99 -> Protein Spindly 7,99E-06 4,88559069 111

BRCA1 interacting protein C-terminal helicase 1 -> Fanconi BRIP1 17q22-q24 8,92E-06 4,87647784 anemia group J protein C20orf132 20q11.22 chromosome 20 open reading frame 132 2,58E-07 4,86181838 GRAMD1C 3q13.31 GRAM domain containing 1C 4,43E-06 4,85023114 LOC440905 2q21.1 hypothetical protein LOC440905 1,39E-05 4,84772547 FTMT 5q21.3 ferritin mitochondrial 1,48E-06 4,84262907 C9orf131 9p13.3 chromosome 9 open reading frame 131 5,84E-07 4,84207525 StAR-related lipid transfer (START) domain containing 10 -> PCTP- STARD10 11q13 9,88E-08 4,84107686 like protein LOC221442 6p21.1 hypothetical LOC221442 5,91E-06 4,82355896 WDR78 1p31.3 WD repeat domain 78 5,36E-06 4,81239979 ANKRD20B 2q11.1 ankyrin repeat domain 20B 3,95E-05 4,80599118 CCDC15 11q24.2 coiled-coil domain containing 15 3,82E-06 4,80263611 TULP2 19q13.1 tubby like protein 2 -> Tubby-related protein 2 7,49E-07 4,79950959 solute carrier family 4, sodium bicarbonate cotransporter, SLC4A8 12q13.13 8,01E-06 4,7895214 member 8 -> Electroneutral sodium bicarbonate exchanger 1 RAD51 15q15.1 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 1,82E-06 4,78755978 ANKRD31 5q13.3 ankyrin repeat domain 31 7,32E-06 4,786352 sterile alpha motif domain containing 4A -> Protein Smaug SAMD4A 14q22.2 1,29E-06 4,7821421 homolog 1 polo-like kinase 1 (Drosophila) -> Serine/threonine-protein kinase PLK1 16p12.1 5,53E-07 4,77110025 PLK1 IZUMO1 19q13.33 izumo sperm-egg fusion 1 8,32E-07 4,73979282 PROCA1 17q11.2 proline-rich cyclin A1-interacting protein 2,11E-07 4,73947744 LOC126536 19p13.12 hypothetical protein LOC126536 2,16E-07 4,73869399 FLJ40504 17q11.2 hypothetical protein FLJ40504 8,01E-08 4,72098369 CLPB 11q13.4 ClpB caseinolytic peptidase B homolog (E. coli) 1,36E-06 4,71982216 NHEDC1 4q24 Na+/H+ exchanger domain containing 1 2,13E-06 4,7193887 regulatory factor X, 2 (influences HLA class II expression) -> DNA- RFX2 19p13.3-p13.2 1,88E-07 4,71883426 binding protein RFX2 112

CCDC29 9q12 coiled-coil domain containing 29 1,50E-05 4,71317255 FBXO47 17q12 F-box protein 47 1,30E-04 4,70480523 RP11-218C14.6 20p11.21 cystatin pseudogene 3,09E-05 4,70309019 FAM54A 6q23.3 family with sequence similarity 54, member A 1,76E-06 4,70247085 WDR62 19q13.12 WD repeat domain 62 5,58E-07 4,70013762 LOC200383 2p11.2 similar to Dynein heavy chain at 16F 2,71E-05 4,69889165 HSF2BP 21q22.3 heat shock transcription factor 2 binding protein 3,50E-06 4,69785603 C10orf96 10q25.3 chromosome 10 open reading frame 96 1,06E-04 4,69378903 GK Xp21.3 glycerol kinase 7,02E-07 4,68617717 C1orf49 1q25.2 chromosome 1 open reading frame 49 3,71E-07 4,6829171 apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like APOBEC4 1q25.3 1,96E-04 4,67699051 4 (putative) FBXO31 16q24.2 F-box protein 31 2,57E-07 4,67519487 FLJ42177 6q21 FLJ42177 protein 1,11E-06 4,66954344 sphingomyelin phosphodiesterase 2, neutral membrane (neutral SMPD2 6q21 2,52E-07 4,66195313 sphingomyelinase) CCDC147 10q25.1 coiled-coil domain containing 147 2,22E-07 4,63883651 DMC1 dosage suppressor of mck1 homolog, meiosis-specific DMC1 22q13.1 2,41E-05 4,63613154 homologous recombination (yeast) similar to Leucine-rich repeat protein SHOC-2 (Ras-binding RP11-139H14.4 13q14.12 4,48E-05 4,62830199 protein Sur-8) CPA5 7q32 carboxypeptidase A5 1,29E-05 4,61669684 KPNA2 17q24.2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1,53E-05 4,6118641 NA NA NA 6,57E-05 4,60958541 DKFZP434P211 22q11.22 POM121-like protein 5,24E-06 4,60911256 LRRC37A4 17q21.31 leucine rich repeat containing 37, member A4 (pseudogene) 1,42E-05 4,59916992 solute carrier family 2 (facilitated glucose transporter), member SLC2A14 12p13.31 8,58E-07 4,59162716 14 NKAPL 6p22.1 NFKB activating protein-like 2,02E-06 4,58907696 LRRC37A2 17q21.32 leucine rich repeat containing 37, member A2 1,44E-05 4,58561744 113

chromosome 13 open reading frame 3 -> Spindle and SKA3 13q12.11 3,31E-05 4,57199238 kinetochore-associated protein 3 WDR65 1p34.2 WD repeat domain 65 2,32E-06 4,57153289 KPNA2 17q24.2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1,42E-05 4,57009609 PMFBP1 16q22.3 polyamine modulated factor 1 binding protein 1 4,26E-06 4,5529023 IQCD 12q24.13 IQ motif containing D 1,53E-07 4,55146977 TXNDC2 --- thioredoxin domain-containing 2 (spermatozoa) 3,36E-06 4,5419537 TSPAN1 1p34.1 tetraspanin 1 7,42E-05 4,5352749 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 -> V- ATP6V1E2 2p21 1,17E-06 4,53247795 type proton ATPase subunit E 2 SFMBT1 3p21.1 Scm-like with four mbt domains 1 3,86E-07 4,52471994 TUBA3E 2q21.1 tubulin, alpha 3e 7,29E-06 4,52277429 BIRC8 19q13.3-q13.4 baculoviral IAP repeat-containing 8 8,08E-07 4,52187622 KIF23 15q23 kinesin family member 23 7,23E-06 4,50494659 solute carrier family 12 (potassium/chloride transporters), SLC12A6 15q13-q15 5,55E-06 4,49581447 member 6 LOC283129 11q13.1 hypothetical protein LOC283129 9,25E-06 4,49283164 NA NA NA 8,42E-06 4,49236765 sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida SPAM1 7q31.3 6,46E-05 4,48734467 binding) -> Hyaluronidase PH-20 AGBL3 7q33 ATP/GTP binding protein-like 3 -> Cytosolic carboxypeptidase 3 5,51E-06 4,47613175 LOC133491 5q35.2 hypothetical protein LOC133491 5,35E-05 4,47414341 KIF20A 5q31 kinesin family member 20A 2,08E-06 4,47378368 CCDC21 1p36.11 coiled-coil domain containing 21 6,78E-06 4,468512 DSCR8 21q22.2 Down syndrome critical region gene 8 2,31E-06 4,45789303 C1orf135 1p36.11 chromosome 1 open reading frame 135 3,05E-06 4,45168188 ANKRD45 1q25.1 ankyrin repeat domain 45 1,48E-06 4,44447188 RP11-35F15.2 Xq27.1 hypothetical LOC347487 3,94E-07 4,44040725 C2orf42 2p14 chromosome 2 open reading frame 42 6,43E-07 4,43078862 SPACA1 6q15 sperm acrosome associated 1 3,22E-07 4,42608145 114

C1orf192 1q23.3 chromosome 1 open reading frame 192 2,07E-05 4,42121533 C19orf51 19q13.4 chromosome 19 open reading frame 51 1,42E-07 4,41480893 SPAG1 8q22.2 sperm associated antigen 1 3,31E-06 4,41470183 C12orf24 12q24.11 chromosome 12 open reading frame 24 8,90E-07 4,41369978 FOXM1 12p13 forkhead box M1 2,11E-07 4,41097322 C2orf39 2p23.3 chromosome 2 open reading frame 39 2,56E-06 4,4031607 SPATA3 2q37.1 spermatogenesis associated 3 1,35E-06 4,40084329 CREM 10p11.21 cAMP responsive element modulator 1,75E-06 4,39766284 FLJ40092 5q13.2 FLJ40092 protein 8,94E-07 4,39234385 LOC442132 5p15.31 similar to hypothetical protein FLJ36144 2,36E-06 4,38265009 protein tyrosine phosphatase, non-receptor type 20B -> Tyrosine- PTPN20B 10q11.22 2,02E-05 4,38222026 protein phosphatase non-receptor type 20 ATPase, aminophospholipid transporter-like, class I, type 8A, ATP8A2 13q12 4,10E-06 4,37864959 member 2 -> Probable phospholipid-transporting ATPase IB AKAP14 Xq24 A kinase (PRKA) anchor protein 14 1,41E-06 4,37861014 C6orf199 6q21 chromosome 6 open reading frame 199 6,21E-06 4,37747063 C1orf114 1q24 chromosome 1 open reading frame 114 1,50E-05 4,37745698 ODF2 9q34.11 outer dense fiber of sperm tails 2 2,57E-07 4,3755974 NUP155 5p13.1 nucleoporin 155kDa 1,04E-06 4,37265644 ALLC 2q35 allantoicase 6,06E-06 4,36596783 polo-like kinase 2 (Drosophila) -> Serine/threonine-protein kinase PLK2 5q12.1-q13.2 5,24E-06 4,35351441 PLK2 DCC 18q21.3 deleted in colorectal carcinoma 4,64E-06 4,34682194 dynein, axonemal, heavy chain 14 -> Putative uncharacterized DNAH14 1q42.12 1,88E-06 4,34335538 protein DNAH14 AK7 14q32.2 adenylate kinase 7 5,83E-06 4,34146966 FLJ40092 5q13.2 FLJ40092 protein 4,10E-06 4,33990963 DNAH6 2p11.2 dynein heavy chain-like 1 -> Dynein, axonemal, heavy chain 6 3,50E-06 4,32129284 ZNF473 19q13.33 zinc finger protein 473 9,46E-07 4,32031049 ENTHD1 22q13.1 ENTH domain containing 1 4,41E-06 4,32013531 115

LOC338579 10q11.21 hypothetical protein LOC338579 2,47E-05 4,31979695 TCFL5 20q13.3-qter transcription factor-like 5 (basic helix-loop-helix) 2,58E-07 4,3174052 AMN1 12p11.21 antagonist of mitotic exit network 1 homolog (S. cerevisiae) 9,59E-07 4,30247855 FLJ25758 19p13.3 hypothetical locus FLJ25758 5,47E-07 4,29902798 MS4A5 11q12 membrane-spanning 4-domains, subfamily A, member 5 4,71E-05 4,28683384 STK33 11p15.3 serine/threonine kinase 33 3,36E-06 4,28273823 FLJ40235 19q13.33 hypothetical protein FLJ40235 3,04E-06 4,27473948 OXR1 8q23 oxidation resistance 1 1,38E-06 4,26149607 TEX15 8p12 testis expressed 15 4,28E-04 4,25222519 STIL 1q32 SCL/TAL1 interrupting locus 2,06E-05 4,25187593 CENPF 1q32-q41 centromere protein F, 350/400ka (mitosin) 2,57E-05 4,2507208 ZNF546 19q13.2 zinc finger protein 546 9,97E-07 4,24286419 WDR66 12q24.31 WD repeat domain 66 9,83E-07 4,24029607 ANLN 7p15-p14 anillin, actin binding protein 4,29E-05 4,23710535 tubulin tyrosine ligase-like family, member 2 -> Probable tubulin TTLL2 6q27 8,08E-07 4,23663987 polyglutamylase TTLL2 UBXN10 1p36.12 UBX domain containing 3 -> UBX domain-containing protein 10 4,58E-07 4,23498394 TEX101 19q13.31 testis expressed 101 1,08E-04 4,23110943 LOC441251 7q11.23 Williams Beuren syndrome chromosome region 19 pseudogene 8,49E-07 4,22703044 tubulin tyrosine ligase-like family, member 5 -> Tubulin TTLL5 14q24.3 4,75E-07 4,22629655 polyglutamylase TTLL5 C1orf129 1q24.3 chromosome 1 open reading frame 129 1,54E-05 4,22410003 TEKT2 1p35.3-p34.1 tektin 2 (testicular) 8,49E-07 4,22123896 C11orf63 11q24.1 chromosome 11 open reading frame 63 3,19E-07 4,22001755 SPANX family, member C -> Sperm protein associated with the SPANXC Xq27.1 8,16E-07 4,19643577 nucleus on the X chromosome C RNF113B 13q32.2 ring finger protein 113B 1,17E-06 4,19143861 CATSPERB 14q32.12 cation channel, sperm-associated, beta 4,83E-05 4,18896695 LEKR1 3q25.31-q25.32 leucine, glutamate and lysine rich 1 2,31E-06 4,18746026 ADAM21 14q24.1 ADAM metallopeptidase domain 21 3,30E-05 4,18629941 116

GMNN 6p22.2 geminin, DNA replication inhibitor 8,27E-06 4,17122606 chromosome 15 open reading frame 48 -> Normal mucosa of NMES1 15q21.1 2,28E-06 4,16952778 esophagus-specific gene 1 protein C15orf43 15q21.1 chromosome 15 open reading frame 43 3,55E-06 4,16790242 ANKRD26-like family C, member 1A -> POTE ankyrin domain POTEE 2q21.1 1,36E-04 4,1670026 family, member E (POTEE) PSMC3 interacting protein -> Homologous-pairing protein 2 PSMC3IP 17q12-q21 9,20E-06 4,15659591 homolog PHYHIPL 10q11 phytanoyl-CoA 2-hydroxylase interacting protein-like 8,01E-07 4,15466744 IL13 5q31 interleukin 13 6,35E-07 4,15273266 CDR2 16p12.3 cerebellar degeneration-related protein 2, 62kDa 4,24E-07 4,15223328 OR4N4 15q11.2 olfactory receptor, family 4, subfamily N, member 4 2,19E-05 4,14340976 C9orf68 9p24.2-p24.1 chromosome 9 open reading frame 68 1,11E-06 4,1362833 CA2 8q22 carbonic anhydrase II 5,10E-06 4,12032318 FSIP1 15q14 fibrous sheath interacting protein 1 2,67E-05 4,12006615 t-complex-associated-testis-expressed 3 -> Tctex1 domain- TCTE3 6q27 3,74E-06 4,11704581 containing protein 3 synaptosomal-associated protein, 91kDa homolog (mouse) -> SNAP91 6q14.2 1,24E-05 4,11697446 Clathrin coat assembly protein AP180 NA NA NA 1,20E-04 4,11675902 tubulin tyrosine ligase-like family, member 13 -> Tubulin TTLL13 15q26.1 3,16E-06 4,11515423 polyglutamylase TTLL13 AQP5 12q13 aquaporin 5 1,86E-06 4,11400487 NOL4 18q12 nucleolar protein 4 4,81E-06 4,11325781 coiled-coil domain containing 35 -> Dynein heavy chain domain 1- DNHD1L 11p15.4 2,19E-06 4,10941633 like protein transmembrane protein with EGF-like and two follistatin-like TMEFF1 9q31 1,26E-05 4,1070215 domains 1 -> Tomoregulin-1 NA NA NA 8,48E-06 4,10438482 CLMN 14q32.13 calmin (calponin-like, transmembrane) 2,12E-06 4,10231564 LRRC37A2 17q21.32 leucine rich repeat containing 37, member A2 1,10E-04 4,0994788 117

TRIP13 5p15.33 thyroid hormone receptor interactor 13 3,40E-05 4,09909521 WD repeat domain 21C -> DDB1- and CUL4-associated factor 4- DCAF4L2 8q21.3 7,08E-05 4,09759671 like protein 2 BRD8 5q31 bromodomain containing 8 8,02E-07 4,09615412 FLJ21062 7q21.13 hypothetical protein FLJ21062 3,29E-06 4,09474752 FAM71A 1q32.3 family with sequence similarity 71, member A 1,38E-05 4,0934095 FLJ40092 5q13.2 FLJ40092 protein 1,47E-06 4,09028962 COX7A2 6q12 cytochrome c oxidase subunit VIIa polypeptide 2 (liver) 1,96E-07 4,08651916 BVES 6q21 blood vessel epicardial substance 3,31E-05 4,08030501 KIF24 9p13.3 kinesin family member 24 1,24E-06 4,05805242 NA NA NA 4,02E-05 4,05797928 CCDC104 2p16.1 coiled-coil domain containing 104 4,03E-07 4,0568009 FANCD2 3p26 Fanconi anemia, complementation group D2 1,41E-05 4,04875403 SPTBN2 11q13 spectrin, beta, non-erythrocytic 2 -> Spectrin beta chain, brain 2 4,20E-07 4,04863196 FLJ40092 5q13.2 FLJ40092 protein 2,02E-06 4,04627956 LOC149837 20p12.3 hypothetical LOC149837 1,71E-06 4,04139118 TCTE1 6p21.1 t-complex-associated-testis-expressed 1 5,53E-07 4,03903179 ATXN3L Xp22.2 ataxin 3-like -> Putative ataxin-3-like protein 3,00E-05 4,03556172 tubulin tyrosine ligase-like family, member 9 -> Probable tubulin TTLL9 20q11.21 2,65E-06 4,03349509 polyglutamylase TTLL9 TACC3 4p16.3 transforming, acidic coiled-coil containing protein 3 5,97E-06 4,03302542 SMAD specific E3 ubiquitin protein ligase 1 -> E3 ubiquitin-protein SMURF1 7q22.1 8,44E-07 4,02310949 ligase SMURF1 TTC18 10q22.2 tetratricopeptide repeat domain 18 7,98E-06 4,02053224 SH3GL3 15q24 SH3-domain GRB2-like 3 -> Endophilin-A3 1,10E-06 4,01627345 CNBD1 8q21.3 cyclic nucleotide binding domain containing 1 6,68E-06 4,01456174 CATSPER3 5q31.1 cation channel, sperm associated 3 5,74E-06 4,0039973 C17orf46 17q21.31 chromosome 17 open reading frame 46 2,55E-06 3,99783104 NA NA NA 1,64E-06 3,99558293 CKS2 9q22 CDC28 protein kinase regulatory subunit 2 1,87E-05 3,99527968 118

protein phosphatase 1G (formerly 2C), magnesium-dependent, PPM1G 2p23.3 3,30E-07 3,99090932 gamma isoform C9orf135 9q21.11 chromosome 9 open reading frame 135 4,02E-06 3,98185173 KIF11 10q24.1 kinesin family member 11 3,61E-05 3,97920714 NA NA NA 1,49E-05 3,97131968 NA NA NA 6,92E-05 3,96880588 NA NA NA 6,92E-05 3,96880588 SHCBP1 16q11.2 SHC SH2-domain binding protein 1 3,20E-06 3,95527225 C17orf57 17q21.32 chromosome 17 open reading frame 57 8,88E-05 3,95071014 SLC25A33 1p36.22 solute carrier family 25, member 33 2,23E-06 3,94414202 RUVBL2 19q13.3 RuvB-like 2 (E. coli) 4,61E-07 3,93503918 TKTL1 Xq28 transketolase-like 1 4,63E-04 3,9251397 RAB11FIP5 2p13-p12 RAB11 family interacting protein 5 (class I) 3,25E-07 3,92466088 WDR53 3q29 WD repeat domain 53 8,66E-07 3,92157991 NA NA NA 6,94E-06 3,92058381 GOLGA8E 15q11.2 golgi autoantigen, golgin subfamily a, 8E 1,84E-05 3,91464776 C14orf25 14q21.1 chromosome 14 open reading frame 25 3,34E-06 3,91084267 protein tyrosine phosphatase, non-receptor type 20B -> Tyrosine- PTPN20B 10q11.22 4,10E-06 3,90732294 protein phosphatase non-receptor type 20 TSNAXIP1 16q22.1 translin-associated factor X interacting protein 1 9,76E-07 3,90033759 RABL5 7q22.1 RAB, member RAS oncogene family-like 5 1,02E-06 3,88114007 C13orf16 13q34 chromosome 13 open reading frame 16 4,11E-06 3,87818197 PIWIL2 8p21.3 piwi-like 2 (Drosophila) 1,05E-04 3,87759063 BRCA2 13q12.3 breast cancer 2, early onset 6,68E-05 3,87556326 glutathione peroxidase 4 (phospholipid hydroperoxidase) -> GPX4 19p13.3 Phospholipid hydroperoxide glutathione peroxidase, 8,79E-08 3,86929842 mitochondrial LRRC37A 17q21.31 leucine rich repeat containing 37A 2,01E-05 3,86503908 TBL2 7q11.23 transducin (beta)-like 2 2,18E-07 3,86407474 FLJ43987 2p13.2 similar to RIKEN cDNA 4930433I11 gene 1,93E-06 3,86405064 119

KIF20B 10q23.31 M-phase phosphoprotein 1 -> Kinesin-like protein KIF20B 2,12E-04 3,86403323 GOLGA8E 15q11.2 golgi autoantigen, golgin subfamily a, 8E 1,29E-05 3,86189382 NUP188 9q34.11 nucleoporin 188kDa 1,61E-06 3,85984389 LRRC37A2 17q21.32 leucine rich repeat containing 37, member A2 1,87E-05 3,85768408 C3orf67 3p14.2 chromosome 3 open reading frame 67 1,38E-06 3,8562725 solute carrier family 44, member 5 -> Choline transporter-like SLC44A5 1p31.1 2,08E-05 3,843734 protein 5 SPATIAL 10q22.1 chromosome 10 open reading frame 27 -> Protein SPATIAL 2,70E-06 3,84142876 C1orf26 1q25 chromosome 1 open reading frame 26 6,64E-06 3,84140613 SPANX family, member B1 -> Sperm protein associated with the SPANXB1 Xq27.1 2,14E-05 3,84085766 nucleus on the X chromosome B/F SPANX family, member B1 -> Sperm protein associated with the SPANXB1 Xq27.1 2,14E-05 3,84085766 nucleus on the X chromosome B/F phosphodiesterase 10A -> cAMP and cAMP-inhibited cGMP 3',5'- PDE10A 6q26 1,31E-05 3,83802604 cyclic phosphodiesterase 10A YPEL1 22q11.2 yippee-like 1 (Drosophila) 7,00E-07 3,83746608 TSSK6 19p13.11 testis-specific serine kinase 6 6,49E-06 3,83422101 ANKRD13A 12q24.11 ankyrin repeat domain 13A 3,30E-07 3,83355931 C3orf48 3p24.3 chromosome 3 open reading frame 48 3,85E-05 3,83151512 FBXO24 7q22 F-box protein 24 -> F-box only protein 24 2,13E-06 3,82633052 solute carrier family 7 (cationic amino acid transporter, y+ SLC7A7 14q11.2 5,41E-07 3,81916963 system), member 7 -> Y+L amino acid transporter 1 GK3P 4q32.1 glycerol kinase 3 pseudogene -> Putative glycerol kinase 3 9,32E-06 3,81885462 EIF4E 4q21-q25 eukaryotic translation initiation factor 4E 1,14E-04 3,81341489 LOC100129478 16p13.3 hypothetical protein LOC100129478 8,08E-07 3,80774667 Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse) -> MOV10L1 22q13.33 1,67E-05 3,80709349 Putative helicase Mov10l1 GPSM2 1p13.3 G-protein signaling modulator 2 (AGS3-like, C. elegans) 3,01E-05 3,8015717 DDI1 11q22.3 DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) 5,83E-07 3,78873044 PIK3R3 1p34.1 phosphoinositide-3-kinase, regulatory subunit 3 (gamma) 8,37E-05 3,78290095 120

CYLC1 Xq21.1 cylicin, basic protein of sperm head cytoskeleton 1 1,79E-05 3,78093095 KIF14 1q32.1 kinesin family member 14 2,99E-04 3,78078157 OR4M2 15q11.2 olfactory receptor, family 4, subfamily M, member 2 2,15E-04 3,77654637 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu ELAVL2 9p21 3,88E-04 3,77380794 antigen B) TTC12 11q23.1 tetratricopeptide repeat domain 12 8,40E-07 3,7709604 CEP70 3q22-q23 centrosomal protein 70kDa 7,99E-06 3,76547143 ALKBH7 19p13.3 alkB, alkylation repair homolog 7 (E. coli) 1,81E-07 3,76365138 ECT2 3q26.1-q26.2 epithelial cell transforming sequence 2 oncogene -> Protein ECT2 1,86E-05 3,76228724 PLAC8L1 5q32 PLAC8-like 1 8,71E-05 3,75716116 coiled-coil domain containing 35 -> Dynein heavy chain domain 1- DNHD1L 11p15.4 1,84E-06 3,75678486 like protein golgi autoantigen, golgin subfamily a, 8G -> Golgin subfamily A GOLGA8G 15q13.1 1,57E-05 3,75650104 member 8F/8G ARMC2 6q21 armadillo repeat containing 2 1,81E-06 3,7532724 LOC285679 5q35.3 hypothetical protein LOC285679 2,52E-07 3,74882635 NDC80 18p11.32 NDC80 homolog, kinetochore complex component (S. cerevisiae) 5,18E-06 3,7476728 ICA1 7p22 islet cell autoantigen 1, 69kDa 1,08E-06 3,74249659 NA NA NA 2,52E-05 3,74041151 ARL13A Xq22.1 ADP-ribosylation factor-like 13A 7,12E-06 3,73945624 THEG 19pter-p13 Theg homolog (mouse) 1,50E-05 3,73429267 RP1-199H16.1 22q13.1 hypothetical LOC388900 2,16E-06 3,73370903 FLJ44082 9q21.32 FLJ44082 protein 4,81E-06 3,73134304 KPNA5 6q22.2 karyopherin alpha 5 (importin alpha 6) 8,57E-06 3,72695268 CIT 12q24 citron (rho-interacting, serine/threonine kinase 21) 1,39E-06 3,72598405 C1orf173 1p31.1 chromosome 1 open reading frame 173 1,64E-06 3,72567931 TDRD7 9q22.33 tudor domain containing 7 4,47E-06 3,7256225 ARHGAP11A 15q13.2 Rho GTPase activating protein 11A 2,46E-04 3,72039293 PHTF1 1p13 putative homeodomain transcription factor 1 8,02E-07 3,71180521 LOC285735 6q23.2 hypothetical protein LOC285735 4,10E-06 3,71034156 121

TSGA14 7q32 testis specific, 14 -> Centrosomal protein of 41 kDa 1,57E-06 3,70658347 CYB5R4 6pter-q22.33 cytochrome b5 reductase 4 2,95E-06 3,70114845 TMEM202 15q24.1 transmembrane protein 202 2,23E-06 3,70048021 YSK4 2q21.3 yeast Sps1/Ste20-related kinase 4 (S. cerevisiae) 1,63E-05 3,70024039 LIN7A 12q21 lin-7 homolog A (C. elegans) 2,26E-06 3,69544474 WDR93 15q26.1 WD repeat domain 93 1,98E-06 3,69333212 FAM40B 7q32.1 family with sequence similarity 40, member B 1,63E-05 3,69228266 CTAGE6 7q35 CTAGE family, member 6 1,15E-05 3,68981632 C9orf93 9p22.3 chromosome 9 open reading frame 93 3,79E-06 3,6886528 YEATS4 12q13-q15 YEATS domain containing 4 3,01E-05 3,68660028 CC2D2B 10q23.33 coiled-coil and C2 domain containing 2B 1,54E-05 3,67975956 SPERT 13q14.12 spermatid associated 3,42E-05 3,67917296 MTTP 4q24 microsomal triglyceride transfer protein 4,81E-06 3,6787267 chromosome 13 open reading frame 15 -> Response gene to RGC32 13q14.11 6,06E-06 3,67779228 complement 32 protein IQCF2 3p21.1 IQ motif containing F2 4,59E-05 3,67383797 NA NA NA 4,73E-05 3,67093991 GINS complex subunit 1 (Psf1 homolog) -> DNA replication GINS1 20p11.21 2,35E-05 3,66639824 complex GINS protein PSF1 NA NA NA 9,34E-06 3,66489407 DNAJC5G 2p23.3 DnaJ (Hsp40) homolog, subfamily C, member 5 gamma 4,63E-06 3,66383238 IQCK 16p12.3 IQ motif containing K 1,21E-06 3,66068592 LOC162632 17p11.2 TL132 pseudogene 7,62E-06 3,66062249 CCDC18 1p22.1 coiled-coil domain containing 18 3,92E-05 3,65809997 PLEKHO1 1q21.2 pleckstrin homology domain containing, family O member 1 1,13E-06 3,65802643 MND1 4q31.3 meiotic nuclear divisions 1 homolog (S. cerevisiae) 1,68E-04 3,65487483 ERO1LB 1q42.2-q43 ERO1-like beta (S. cerevisiae) 2,02E-06 3,6518715 NA NA NA 2,20E-05 3,64567385 DDX39 19p13.12 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 3,35E-07 3,64409609 122

LOC200383 2p11.2 similar to Dynein heavy chain at 16F 5,76E-05 3,63615198 CCDC60 12q24.23 coiled-coil domain containing 60 4,93E-06 3,63377351 TUBG1 17q21 tubulin, gamma 1 4,61E-07 3,63074724 TGFB-induced factor homeobox 2-like, Y-linked -> Homeobox TGIF2LY Yp11.2 6,42E-05 3,6304591 protein TGIF2LY LOC442229 6q12 similar to mitochondrial carrier triple repeat 1 6,67E-05 3,6206507 DDX43 6q12-q13 DEAD (Asp-Glu-Ala-Asp) box polypeptide 43 1,47E-04 3,61935219 NA NA NA 3,32E-04 3,61882038 CRAT 9q34.1 carnitine acetyltransferase 1,04E-07 3,61823472 LOC554226 2q21.2 hypothetical protein LOC554226 4,12E-05 3,61478039 aldehyde dehydrogenase 1 family, member A2 -> Retinal ALDH1A2 15q22.1 1,93E-06 3,61394863 dehydrogenase 2 unc-51-like kinase 4 (C. elegans) -> Serine/threonine-protein ULK4 3p22.1 1,82E-06 3,61381211 kinase ULK4 TMEM116 12q24.13 transmembrane protein 116 1,60E-06 3,61363302 FLJ25328 19p13.12 hypothetical LOC148231 2,57E-07 3,61345268 FAM106A 17p11.2 family with sequence similarity 106, member A 1,36E-05 3,60983651 chromosome 18 open reading frame 10 -> Tubulin C18orf10 18q12.2 3,50E-06 3,60680268 polyglutamylase complex subunit 2 (short name: PGs2) COX6B2 19q13.42 cytochrome c oxidase subunit VIb polypeptide 2 (testis) 5,54E-07 3,60653519 LOC440570 1p36.13 LOC440570 1,63E-05 3,60482194 FLJ40176 13q33.1 hypothetical LOC121951 2,02E-04 3,60224673 FAM106A 17p11.2 family with sequence similarity 106, member A 1,42E-05 3,59980685 LOC348840 3q29 hypothetical LOC348840 1,17E-05 3,5973761 ANO5 11p14.3 transmembrane protein 16E -> Anoctamin 5 (ANO5) 3,94E-06 3,59655209 FANCI 15q26.1 Fanconi anemia, complementation group I 7,58E-05 3,59065863 RIMBP3B 22q11.21 RIMS binding protein 3B 2,18E-07 3,58979883 ZCWPW1 7q22.1 zinc finger, CW type with PWWP domain 1 1,57E-04 3,58573159 EPHA6 3q11.2 EPH receptor A6 -> Ephrin type-A receptor 6 2,27E-05 3,58043407 TP53TG5 20q12-q13.12 chromosome 20 open reading frame 10 -> TP53 target gene 5 3,80E-05 3,57994519 123

protein C1orf59 1p13.3 chromosome 1 open reading frame 59 5,05E-05 3,57138706 CENPJ 13q12.12 centromere protein J 1,60E-05 3,56918331 FLJ46266 11q23.1 FLJ46266 protein 9,34E-06 3,56190614 TGFB-induced factor homeobox 2-like, X-linked -> Homeobox TGIF2LX Xq21.31 8,21E-05 3,55972798 protein TGIF2LX NUP88 17p13.2 nucleoporin 88kDa -> Nuclear pore complex protein Nup88 2,42E-06 3,55521794 C16orf71 16p13.3 chromosome 16 open reading frame 71 1,14E-06 3,55406607 PKD2L2 5q31 polycystic kidney disease 2-like 2 5,29E-05 3,55192717 CDCA5 11q12.1 cell division cycle associated 5 -> Sororin 1,61E-06 3,55152219 CCR6 6q27 chemokine (C-C motif) receptor 6 1,41E-06 3,55069269 PDILT 16p12.3 protein disulfide isomerase-like protein of the testis 1,18E-05 3,54818197 LOC401052 3p25.3 hypothetical LOC401052 1,87E-07 3,54816598 LRRC37A2 17q21.32 leucine rich repeat containing 37, member A2 1,73E-05 3,5478266 MGC26647 7q21.13 hypothetical protein MGC26647 3,37E-05 3,54361532 PABPC3 13q12-q13 poly(A) binding protein, cytoplasmic 3 5,43E-07 3,54091448 C20orf106 20q13.31 chromosome 20 open reading frame 106 1,67E-06 3,54060402 VRK3 19q13 vaccinia related kinase 3 -> Serine/threonine-protein kinase VRK3 4,82E-07 3,53946792 RPGRIP1L 16q12.2 RPGRIP1-like -> Protein fantom 1,73E-05 3,53870133 IFT74 9p21.2 intraflagellar transport 74 homolog (Chlamydomonas) 2,27E-05 3,53731942 PGAM2 7p13-p12 phosphoglycerate mutase 2 (muscle) 2,58E-07 3,53285858 KIF6 6p21.2 kinesin family member 6 3,26E-06 3,53150344 AKNAD1 1p13.3 chromosome 1 open reading frame 62 -> Protein AKNAD1 4,60E-05 3,52867974 GPR18 13q32 G protein-coupled receptor 18 -> N-arachidonyl glycine receptor 3,90E-04 3,52443867 LOC100131606 19q13.12 hypothetical protein LOC100131606 4,43E-06 3,52431774 C2orf56 2p22.2 chromosome 2 open reading frame 56 4,10E-06 3,52301471 SPATA1 1p22.3 spermatogenesis associated 1 3,06E-05 3,5223237 OIP5 15q15.1 Opa interacting protein 5 -> Protein Mis18-beta 3,67E-06 3,52215036 IQCH 15q23 IQ motif containing H 4,10E-06 3,51596571 124

KYNU 2q22.2 kynureninase (L-kynurenine hydrolase) 7,06E-06 3,51531507 ZNF596 8p23.3 zinc finger protein 596 1,56E-05 3,51314835 CCDC138 2q13 coiled-coil domain containing 138 1,48E-04 3,50811855 GDPD4 11q13.5 glycerophosphodiester phosphodiesterase domain containing 4 6,86E-05 3,50806991 retinitis pigmentosa GTPase regulator interacting protein 1 -> X- RPGRIP1 14q11 5,36E-06 3,50743167 linked retinitis pigmentosa GTPase regulator-interacting protein 1 FLJ43950 9q21.32 FLJ43950 protein 2,80E-05 3,50421914 RAD21-like 1 (S. pombe) -> Double-strand-break repair protein RAD21L1 --- 5,97E-05 3,49778715 rad21-like protein 1 polycystic kidney disease (polycystin) and REJ homolog (sperm PKDREJ 22q13.31 3,30E-07 3,49584689 receptor for egg jelly homolog, sea urchin) MTFR1 8q13.1 mitochondrial fission regulator 1 4,91E-06 3,49424678 FMN1 15q13.3 formin 1 1,09E-04 3,49031441 NA NA NA 3,49E-04 3,47918043 LOC220594 17p11.2 TL132 protein 7,12E-06 3,4786234 RIMBP3B 22q11.21 RIMS binding protein 3B 1,64E-06 3,47598535 NA NA NA 1,04E-04 3,47460505 FBXO25 8p23.3 F-box protein 25 -> F-box only protein 25 1,01E-06 3,47454243 LOC388965 2p11.2 FUN14 domain containing 2 pseudogene 5,15E-05 3,47405718 LOC401387 7q21.2 hypothetical protein LOC401387 2,71E-04 3,47356959 IPO4 14q12 importin 4 3,35E-07 3,47175707 CDC20 1p34.1 cell division cycle 20 homolog (S. cerevisiae) 5,28E-06 3,47121085 ACSL6 5q31 acyl-CoA synthetase long-chain family member 6 5,00E-06 3,46967612 chromosome 1 open reading frame 67 -> Dynein, axonemal, DNAH14 1q42.12 1,02E-05 3,46955828 heavy chain 14 LOC387646 10p12.1 leucine rich repeat containing 37, member A family pseudogene 5,35E-06 3,46546152 SRPK1 6p21.3-p21.2 SFRS protein kinase 1 -> Serine/threonine-protein kinase SRPK1 8,12E-06 3,46345877 FAM126A 7p15.3 family with sequence similarity 126, member A -> Hyccin 1,47E-05 3,46081422 DNAH17 17q25.3 dynein, axonemal, heavy chain 17 4,55E-07 3,46067749 TEX2 17q23.3 testis expressed 2 1,99E-06 3,45981525 125

LRRC49 15q23 leucine rich repeat containing 49 3,73E-06 3,45773667 CPXCR1 Xq21.3 CPX chromosome region, candidate 1 1,79E-06 3,4556749 INPP1 2q32 inositol polyphosphate-1-phosphatase 6,49E-06 3,45470495 TDRD12 19q13.11 tudor domain containing 12 2,66E-05 3,4516711 CIB4 2p23.3 calcium and integrin binding family member 4 5,89E-05 3,45119502 ZNF474 5q23.1-q23.2 zinc finger protein 474 4,93E-05 3,44468008 FAM75A7 9q12 family with sequence similarity 75, member A7 3,79E-06 3,44300434 C1orf111 1q23.3 chromosome 1 open reading frame 111 1,38E-05 3,44165026 DNAI2 17q25 dynein, axonemal, intermediate chain 2 1,88E-06 3,43833115 family with sequence similarity 44, member C -> Putative BOD1P 18q21.31 2,67E-07 3,43653583 biorientation of chromosomes in cell division protein 1-like 2 dynein, axonemal, light intermediate chain 1 -> Axonemal dynein DNALI1 1p35.1 6,04E-07 3,43333945 light intermediate polypeptide 1 NA NA NA 1,10E-06 3,43164782 FAM75A7 9q12 family with sequence similarity 75, member A7 4,10E-06 3,42987381 NPHP1 2q13 nephronophthisis 1 (juvenile) -> Nephrocystin-1 7,06E-06 3,42528255 CTAGE6 7q35 CTAGE family, member 6 1,35E-05 3,42158788 KIAA1409 14q32.13 KIAA1409 -> Protein unc-79 homolog 2,84E-06 3,41920755 FAM135B 8q24.23 family with sequence similarity 135, member B 1,22E-06 3,41758329 ZCCHC13 Xq13.2 zinc finger, CCHC domain containing 13 4,75E-06 3,41023108 FAM106A 17p11.2 family with sequence similarity 106, member A 1,80E-05 3,40833348 DDX53 Xp22.11 DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 6,15E-05 3,40779724 FAM75A7 9q12 family with sequence similarity 75, member A7 3,75E-06 3,40559057 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, MLLT10 10p12 2,39E-06 3,4044329 Drosophila); translocated to, 10 -> Protein AF-10 FAM75A7 9q12 family with sequence similarity 75, member A7 4,04E-06 3,39718433 ZNF165 6p21.3 zinc finger protein 165 8,09E-07 3,39680641 RAE1 20q13.31 RAE1 RNA export 1 homolog (S. pombe) -> mRNA export factor 3,36E-06 3,39577648 C10orf93 10q26.3 chromosome 10 open reading frame 93 7,79E-06 3,39511631 SLC22A16 6q21-q22.1 solute carrier family 22 (organic cation/carnitine transporter), 4,03E-07 3,39102166 126

member 16 HYLS1 11q24.2 hydrolethalus syndrome 1 1,94E-05 3,39059038 FGFR1OP 6q27 FGFR1 oncogene partner 1,17E-05 3,38876243 DENND2C 1p13.2 DENN/MADD domain containing 2C 3,33E-04 3,38748604 CHKA 11q13.2 choline kinase alpha 3,44E-06 3,38726181 unc-51-like kinase 4 (C. elegans) -> Serine/threonine-protein ULK4 3p22.1 6,50E-06 3,38384855 kinase ULK4 WDR16 17p13.1 WD repeat domain 16 4,99E-07 3,38197736 LRRC37B --- leucine rich repeat containing 37B 5,87E-06 3,37814323 NA NA NA 3,96E-06 3,37511229 chromosome 6 open reading frame 12 -> Non-protein coding RNA NCRNA00171 6p21.33 1,13E-05 3,37403748 171 (NCRNA00171) -> Putative uncharacterized protein C6orf12 BRCA1 17q21 breast cancer 1, early onset 3,36E-06 3,37052541 FAAH 1p35-p34 fatty acid amide hydrolase 3,73E-07 3,36255415 C1orf201 1p36.11 chromosome 1 open reading frame 201 1,06E-05 3,35863263 NA NA NA 1,08E-04 3,35825318 HIST1H3B 6p21.3 histone cluster 1, H3b 4,36E-05 3,35715349 TDRKH 1q21 tudor and KH domain containing 3,01E-05 3,35573316 IQ motif containing GTPase activating protein 2 -> Ras GTPase- IQGAP2 5q13.3 1,27E-05 3,35428553 activating-like protein IQGAP2 CSNK2A2 16q21 casein kinase 2, alpha prime polypeptide 1,99E-06 3,3537113 membrane-associated ring finger (C3HC4) 3 -> E3 ubiquitin- MARCH3 5q23.2 6,23E-06 3,35123533 protein ligase MARCH3 STGC3 --- hypothetical STGC3 1,10E-06 3,3505246 CCDC88A 2p16.1 coiled-coil domain containing 88A -> Girdin 1,39E-05 3,34639559 CCDC34 11p14.1 coiled-coil domain containing 34 1,42E-06 3,34442803 PROM1 4p15.32 prominin 1 2,39E-05 3,34339544 CCDC150 2q33.1 coiled-coil domain containing 150 1,01E-05 3,34223575 KIF27 9q21.32 kinesin family member 27 1,34E-05 3,33848024 ASPM 1q31 asp (abnormal spindle) homolog, microcephaly associated 3,79E-05 3,33661563 127

(Drosophila) CDC45 22q11.21 CDC45 cell division cycle 45-like (S. cerevisiae) 1,04E-05 3,33608952 TMC7 16p12.3 transmembrane channel-like 7 3,76E-06 3,32876956 SPANX family, member A2 -> Sperm protein associated with the SPANXA2 Xq27.1 3,93E-06 3,32755382 nucleus on the X chromosome A SPANX family, member A2 -> Sperm protein associated with the SPANXA2 Xq27.1 3,93E-06 3,32755382 nucleus on the X chromosome A SGOL1 3p24.3 shugoshin-like 1 (S. pombe) 1,47E-04 3,32663481 SPC25, NDC80 kinetochore complex component, homolog (S. SPC25 2q24.3 9,62E-06 3,31439374 cerevisiae) FHAD1 1p36.21 forkhead-associated (FHA) phosphopeptide binding domain 1 4,79E-06 3,30823564 NA NA NA 6,31E-05 3,30642345 CXorf59 Xp21.1 chromosome X open reading frame 59 2,37E-05 3,30593303 general transcription factor IIA, 2, 12kDa -> Transcription GTF2A2 15q22.2 1,53E-05 3,30558589 initiation factor IIA subunit 2 TRIM69 15q21.1 tripartite motif-containing 69 4,73E-05 3,30517807 VRK1 14q32 vaccinia related kinase 1 -> Serine/threonine-protein kinase VRK1 1,74E-05 3,30517692 CXCL16 17p13 chemokine (C-X-C motif) ligand 16 1,53E-05 3,30071483 OSCP1 1p34.3 chromosome 1 open reading frame 102 -> Protein OSCP1 8,21E-07 3,29592406 SPATA9 5q15 spermatogenesis associated 9 6,73E-06 3,29454219 non-SMC condensin II complex, subunit G2 -> Condensin-2 NCAPG2 7q36.3 9,72E-06 3,29280482 complex subunit G2 RGS22 8q22.2 regulator of G-protein signaling 22 3,37E-05 3,28821926 STAMBPL1 10q23.31 STAM binding protein-like 1 -> AMSH-like protease 3,53E-06 3,28818735 PSMG1 21q22.3 proteasome (prosome, macropain) assembly chaperone 1 1,62E-06 3,28805402 LOC100130988 7p12.2 hypothetical protein LOC100130988 6,42E-05 3,28123631 TMEM99 17q21.2 transmembrane protein 99 1,59E-06 3,27402423 NA NA NA 8,80E-06 3,27216841 NA NA NA 2,33E-05 3,27099715 C1orf175 1p32.3 chromosome 1 open reading frame 175 5,35E-06 3,27034763 128

SPO11 meiotic protein covalently bound to DSB homolog (S. SPO11 20q13.2-q13.3 3,34E-04 3,27006542 cerevisiae) -> Meiotic recombination protein SPO11 FAM75A7 9q12 family with sequence similarity 75, member A7 3,43E-06 3,26794681 TBC1D28 17p11.2 TBC1 domain family, member 28 3,31E-06 3,26539722 FAM75A7 9q12 family with sequence similarity 75, member A7 3,12E-06 3,26265739 male-specific lethal 3-like 2 (Drosophila) -> Putative male-specific MSL3L2 2q37.1 1,28E-05 3,26218703 lethal-3 protein-like 2 CCDC103 17q21.31 coiled-coil domain containing 103 7,60E-07 3,25880607 OR4M1 14q11.2 olfactory receptor, family 4, subfamily M, member 1 9,72E-05 3,25566668 MLF1 3q25.1 myeloid leukemia factor 1 3,79E-06 3,25338938 protein tyrosine phosphatase, non-receptor type 20A -> Tyrosine- PTPN20A 10q11.22 7,17E-06 3,2526374 protein phosphatase non-receptor type 20 FAM75A7 9q12 family with sequence similarity 75, member A7 3,84E-06 3,25177965 Williams Beuren syndrome chromosome region 19 -> Speedy SPDYE1 7p13 4,11E-06 3,2507813 protein E1 kinesin family member 4A -> Chromosome-associated kinesin KIF4A Xq13.1 3,67E-05 3,24492582 KIF4A protein tyrosine phosphatase, non-receptor type 20B -> Tyrosine- PTPN20B 10q11.22 5,77E-06 3,24218182 protein phosphatase non-receptor type 20 TEX9 15q21.3 testis expressed 9 2,65E-05 3,24202676 ABCC12 16q12.1 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 5,06E-07 3,23981178 ESCO2 8p21.1 establishment of cohesion 1 homolog 2 (S. cerevisiae) 5,83E-05 3,23878118 IQCG 3q29 IQ motif containing G 1,64E-06 3,23860384 WARS 14q32.31 tryptophanyl-tRNA synthetase 3,60E-06 3,23835804 SRrp35 6q15 serine-arginine repressor protein (35 kDa) 6,38E-05 3,23676921 DYX1C1 15q21.3 dyslexia susceptibility 1 candidate 1 2,41E-05 3,23612986 ZCWPW2 3p24.1 zinc finger, CW type with PWWP domain 2 4,28E-05 3,23500177 C10orf90 10q26.2 chromosome 10 open reading frame 90 2,62E-04 3,23449952 ubiquitin specific peptidase 32 -> Ubiquitin carboxyl-terminal USP32 17q23.2 3,17E-07 3,23328572 hydrolase 32 129

C17orf47 17q22 chromosome 17 open reading frame 47 1,82E-05 3,23250029 LRRC48 17p11.2 leucine rich repeat containing 48 3,60E-06 3,23205892 C5orf35 5q11.2 chromosome 5 open reading frame 35 1,82E-05 3,22899566 HK1 10q22 hexokinase 1 1,13E-05 3,2280938 C9orf98 9q34.13 chromosome 9 open reading frame 98 2,03E-06 3,21848222 SYCE1 10q26.3 synaptonemal complex central element protein 1 4,69E-06 3,214585 protein phosphatase 1, regulatory (inhibitor) subunit 2 PPP1R2P3 5q33.3 pseudogene 3 -> Putative protein phosphatase inhibitor 2-like 1,38E-06 3,21441121 protein 3 gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl GGH 8q12.3 1,47E-05 3,20899602 hydrolase) NACA2 17q23.2 nascent polypeptide-associated complex alpha subunit 2 1,36E-04 3,208728 VPS13A 9q21 vacuolar protein sorting 13 homolog A (S. cerevisiae) 4,64E-05 3,20840218 C19orf45 19p13.2 chromosome 19 open reading frame 45 2,76E-06 3,20600461 DYRK4 12p13.32 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 3,62E-06 3,20520137 SSX3 Xp11.23 synovial sarcoma, X breakpoint 3 3,46E-04 3,19307735 CXorf58 Xp22.11 chromosome X open reading frame 58 8,97E-05 3,18509632 solute carrier family 9, member 11 -> Sodium/hydrogen SLC9A11 1q25.1 6,78E-06 3,18373995 exchanger 11 C14orf145 14q31.1 chromosome 14 open reading frame 145 1,19E-05 3,18356451 KNTC1 12q24.31 kinetochore associated 1 7,21E-05 3,18161441 MYO3A 10p11.1 myosin IIIA 6,38E-06 3,17544438 CKAP2 13q14 cytoskeleton associated protein 2 3,80E-05 3,17144319 ZNF318 6pter-p12.1 zinc finger protein 318 8,12E-06 3,16653714 HCFC2 12q23.3 host cell factor C2 1,54E-06 3,16571088 UNQ9391 8p23.1 tryptophan/serine protease 3,12E-05 3,16242113 CSDA 12p13.1 cold shock domain protein A 1,17E-06 3,1578869 NA NA NA 4,99E-06 3,15500874 NA NA NA 1,26E-05 3,14792136 LOC136242 7q34 similar to RIKEN cDNA 1700016G05 -> LOC136242 protein 1,72E-05 3,14770753 130

CPSF3 2p25.1 cleavage and polyadenylation specific factor 3, 73kDa 1,08E-05 3,14686001 BANF2 20p12.1 barrier to autointegration factor 2 1,87E-05 3,14078241 elongation factor RNA polymerase II-like 3 -> RNA polymerase II ELL3 15q15.3 2,58E-06 3,13734025 elongation factor ELL3 NUSAP1 15q15.1 nucleolar and spindle associated protein 1 3,29E-05 3,12408455 AGTPBP1 9q21.33 ATP/GTP binding protein 1 -> Cytosolic carboxypeptidase 1 2,68E-05 3,12296089 CNTN4 3p26-p25 contactin 4 3,18E-05 3,11872533 SYCE2 19p13.13 synaptonemal complex central element protein 2 1,10E-06 3,11788129 CCDC87 11q13.1 coiled-coil domain containing 87 1,07E-05 3,11709581 C6orf167 6q16.1 chromosome 6 open reading frame 167 2,28E-05 3,11647038 IFT81 12q24.13 intraflagellar transport 81 homolog (Chlamydomonas) 4,72E-05 3,114121 LZTFL1 3p21.3 leucine zipper transcription factor-like 1 1,72E-05 3,11288008 NA NA NA 4,42E-05 3,11007097 POM121L1 22q11.22 POM121 membrane glycoprotein-like 1 (rat) 1,57E-05 3,10701779 DOT1-like, histone H3 methyltransferase (S. cerevisiae) -> DOT1L 19p13.3 2,97E-06 3,10626734 Histone-lysine N-methyltransferase, H3 lysine-79 specific HFM1 1p22.2 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1,53E-04 3,10562471 membrane protein, palmitoylated 6 (MAGUK p55 subfamily MPHOSPH6 7p15 4,45E-05 3,10315014 member 6) -> M-phase phosphoprotein 6 SMC4 3q26.1 structural maintenance of chromosomes 4 1,47E-04 3,09998127 chromosome 3 open reading frame 15 -> AMY-1-associating AAT1 3q12-q13.3 4,62E-05 3,09625223 protein expressed in testis 1 GOLGA8E 15q11.2 golgi autoantigen, golgin subfamily a, 8E 2,20E-05 3,09083577 CCDC144A 17p11.2 coiled-coil domain containing 144A 8,49E-06 3,09013314 PTBP2 1p22.1-p21.3 polypyrimidine tract binding protein 2 9,39E-05 3,08826382 CTAGE6 7q35 CTAGE family, member 6 1,35E-05 3,0877469 NA NA NA 8,80E-06 3,08734884 CART prepropeptide -> Cocaine- and amphetamine-regulated CARTPT 5q13.2 1,07E-05 3,08282287 transcript protein CARTPT 5q13.2 CART prepropeptide -> Cocaine- and amphetamine-regulated 1,07E-05 3,08282287 131

transcript protein RAB3IP 12q14.3 RAB3A interacting protein (rabin3) 1,67E-05 3,08100495 protein inhibitor of activated STAT, 2 -> E3 SUMO-protein ligase PIAS2 18q21.1 5,00E-06 3,07832702 PIAS2 absent in melanoma 1 -> Membrane-associated transporter SLC45A2 6q21 3,23E-06 3,07764216 protein PCDH17 13q21.1 protocadherin 17 2,26E-06 3,07564928 LDHAL6B 15q22.2 lactate dehydrogenase A-like 6B 1,97E-05 3,0753082 FAM75C1 9q22 family with sequence similarity 75, member C1 4,32E-05 3,07427772 WDR67 8q24.13 WD repeat domain 67 8,87E-06 3,07390803 MGC26718 18p11.21 similar to ankyrin repeat domain 20A 6,04E-07 3,07369177 FAM72A 1q32.1 family with sequence similarity 72, member A 2,56E-04 3,07249039 Williams Beuren syndrome chromosome region 19 -> Speedy SPDYE1 7p13 1,01E-05 3,07043806 protein E1 LOC646187 4q28.3 similar to hCG2026352 6,06E-06 3,06964326 TOPBP1 3q22.1 topoisomerase (DNA) II binding protein 1 2,26E-06 3,06895395 ACR pseudogene 2q14.1 acrosin-like protease 2,24E-06 3,06789371 RNF138 18q12.1 ring finger protein 138 -> E3 ubiquitin-protein ligase RNF138 3,99E-05 3,06507739 FBXO15 18q22.3 F-box protein 15 -> F-box only protein 15 1,32E-06 3,06291005 NA NA NA 8,80E-06 3,06193042 minichromosome maintenance complex component 4 -> DNA MCM4 8q11.2 4,37E-05 3,06144868 replication licensing factor MCM4 CCDC73 11p13 coiled-coil domain containing 73 3,48E-04 3,05692467 RIBC1 Xp11.22 RIB43A domain with coiled-coils 1 4,01E-06 3,05563347 CCDC19 1q22 coiled-coil domain containing 19 8,48E-06 3,05538673 PPM1J 1p13.2 protein phosphatase 1J (PP2C domain containing) 2,38E-06 3,05377126 FMR1NB Xq27.3-q28 fragile X mental retardation 1 neighbor 8,58E-05 3,05277445 hydrogen voltage-gated channel 1 -> Voltage-gated hydrogen HVCN1 12q24.11 4,99E-07 3,04937166 channel 1 MPP7 10p11.23 membrane protein, palmitoylated 7 (MAGUK p55 subfamily 3,91E-05 3,04861824 132

member 7) protein phosphatase 2 (formerly 2A), regulatory subunit B'', PPP2R3C 14q13.2 1,29E-05 3,04682682 gamma ENKUR 10p12.1 chromosome 10 open reading frame 63 -> Enkurin 1,19E-05 3,03109275 NA NA NA 3,43E-04 3,0300939 CRY1 12q23-q24.1 cryptochrome 1 (photolyase-like) 4,87E-06 3,0227308 LOC220594 17p11.2 TL132 protein 7,82E-06 3,01773684 CTAGE1 18p11.2 cutaneous T-cell lymphoma-associated antigen 1 1,96E-05 3,01311346 PSMD6 3p14.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 1,53E-05 3,00977471 LOC402573 7q22.1 hypothetical LOC402573 1,79E-06 3,00903106 KIAA1324 1p13.3 KIAA1324 -> UPF0577 protein KIAA1324 1,19E-06 3,00878913 CDCA3 12p13 cell division cycle associated 3 5,98E-07 3,0076496 ASF1 anti-silencing function 1 homolog B (S. cerevisiae) -> Histone ASF1B 19p13.12 1,07E-05 3,00622606 chaperone ASF1B TMEM108 3q21 transmembrane protein 108 7,37E-05 3,00390565 IFT57 3q13.12 intraflagellar transport 57 homolog (Chlamydomonas) 5,19E-06 3,00348717 BRAP 12q24 BRCA1 associated protein 5,21E-06 3,00289077 LOC283767 15q11.2 FLJ40198 protein -> LOC283767 protein 1,11E-06 3,00278254 FLJ25694 13q21.31 hypothetical protein FLJ25694 6,68E-06 3,00264205 chromosome 11 open reading frame 82 -> Nitric oxide-inducible NOXIN 11q14.1 1,51E-04 3,00108358 gene protein minichromosome maintenance complex component 8 -> DNA MCM8 20p12.3 1,32E-04 3,0000863 replication licensing factor MCM8 NIMA (never in mitosis gene a)-related kinase 3 -> NEK3 13q14.13 4,16E-04 2,99315502 Serine/threonine-protein kinase Nek3 solute carrier family 25 (mitochondrial thiamine pyrophosphate SLC25A19 17q25.3 carrier), member 19 -> Mitochondrial thiamine pyrophosphate 1,60E-06 2,9893224 carrier katanin p60 subunit A-like 2 -> Katanin p60 ATPase-containing KATNAL2 18q21.1 1,43E-05 2,98801005 subunit A-like 2 DRG1 22q12.2 developmentally regulated GTP binding protein 1 4,91E-06 2,98721898 133

CLSPN 1p34.2 claspin homolog (Xenopus laevis) 1,18E-04 2,98665998 C9orf144A 9p13.2 chromosome 9 open reading frame 144 6,38E-05 2,98401234 MMRN1 4q22 multimerin 1 2,82E-05 2,97892128 sel-1 suppressor of lin-12-like 2 (C. elegans) -> Protein sel-1 SEL1L2 20p12.1 1,29E-04 2,97734726 homolog 2 DUSP18 22q12.2 dual specificity phosphatase 18 3,38E-05 2,97603811 DNAH2 17p13.1 dynein, axonemal, heavy chain 2 1,38E-06 2,97373172 RANBP17 5q34 RAN binding protein 17 4,56E-05 2,97040366 HIST1H3A 6p21.3 histone cluster 1, H3a -> Histone H3.1 5,05E-05 2,97005779 MDC1 6p21.3 mediator of DNA damage checkpoint 1 4,65E-06 2,96879505 MDC1 6p21.3 mediator of DNA damage checkpoint 1 4,65E-06 2,96879505 PCM1 8p22-p21.3 pericentriolar material 1 8,37E-06 2,96769535 LACTB2 8p22-q22.3 lactamase, beta 2 -> Beta-lactamase-like protein 2 5,79E-06 2,9632688 chromosome 6 open reading frame 60 -> Family with sequence FAM184A 6q22.31 4,66E-05 2,96182931 similarity 184, member A (FAM184A) TTC30A 2q31.2 tetratricopeptide repeat domain 30A 6,12E-06 2,96086559 similar to Williams Beuren syndrome chromosome region 19 -> SPDYE3 7q22.1 1,99E-06 2,95616439 Speedy homolog E3 (Xenopus laevis) NA NA NA 3,74E-05 2,95589086 N-glycanase 1 -> Peptide-N(4)-(N-acetyl-beta- NGLY1 3p24.2 1,34E-05 2,95185939 glucosaminyl)asparagine amidase olfactory receptor, family 4, subfamily F, member 16 -> Olfactory OR4F16 1p36.33 2,15E-04 2,94876632 receptor 4F3/4F16/4F29 olfactory receptor, family 4, subfamily F, member 16 -> Olfactory OR4F16 1p36.33 2,15E-04 2,94876632 receptor 4F3/4F16/4F29 olfactory receptor, family 4, subfamily F, member 16 -> Olfactory OR4F16 1p36.33 2,15E-04 2,94876632 receptor 4F3/4F16/4F29 ZSCAN5 19q13.43 zinc finger and SCAN domain containing 5 2,92E-05 2,94817569 DKFZp434F142 7q11.21 hypothetical protein DKFZp434F142 2,48E-06 2,94295096 LOC283767 15q11.2 FLJ40198 protein -> Golgi autoantigen, golgin subfamily a-like 7,00E-07 2,94271434 134

solute carrier family 38, member 9 -> Putative sodium-coupled SLC38A9 5q11.2 3,42E-05 2,93970014 neutral amino acid transporter 9 suppressor of variegation 3-9 homolog 2 (Drosophila) -> Histone- SUV39H2 10p13 4,28E-06 2,9395789 lysine N-methyltransferase SUV39H2 ZNF433 19p13.2 zinc finger protein 433 3,93E-06 2,93759091 RSPH1 21q22.3 radial spoke head 1 homolog (Chlamydomonas) 2,65E-06 2,93233616 C1orf94 1p34.3 chromosome 1 open reading frame 94 3,36E-06 2,930153 KIF2B 17q22 kinesin family member 2B 1,07E-05 2,9290392 MDGA2 14q21.3 MAM domain containing glycosylphosphatidylinositol anchor 2 2,13E-04 2,92419395 LOC253724 12q23.3 hypothetical LOC253724 2,66E-04 2,92351907 LOC389765 9q21.33 similar to KIF27C 9,25E-06 2,92200065 CUL3 2q36.2 cullin 3 4,98E-06 2,92164016 SAMD13 1p31.1 sterile alpha motif domain containing 13 1,07E-06 2,92142854 LRRC34 3q26.2 leucine rich repeat containing 34 3,54E-05 2,92075531 KIAA1377 11q22.1 KIAA1377 -> Uncharacterized protein KIAA1377 3,98E-05 2,91989907 MGC12966 7p22.1 hypothetical protein LOC84792 1,33E-06 2,91768473 CCHCR1 6p21.3 coiled-coil alpha-helical rod protein 1 3,23E-06 2,91674144 STK17A 7p12-p14 serine/threonine kinase 17a 4,42E-05 2,9150952 ACTL6A 3q26.33 actin-like 6A 9,11E-06 2,91486992 phosphodiesterase 3B, cGMP-inhibited -> cGMP-inhibited 3',5'- PDE3B 11p15.1 2,67E-06 2,91426183 cyclic phosphodiesterase B DNAJC27 2p23.3 rab and DnaJ domain containing 3,09E-06 2,91387098 Williams Beuren syndrome chromosome region 19 -> Speedy SPDYE1 7p13 9,56E-06 2,91293296 protein E1 male sterility domain containing 1 -> Fatty acyl CoA reductase 2 FAR2 12p11.22 4,45E-06 2,91161883 (FAR2) CDC14A 1p21 CDC14 cell division cycle 14 homolog A (S. cerevisiae) 3,94E-05 2,90762154 C11orf47 11p15.4 chromosome 11 open reading frame 47 4,43E-06 2,90669763 LOC284788 20p11.21 hypothetical protein LOC284788 1,81E-05 2,90210456 TIAM2 6q25.2 T-cell lymphoma invasion and metastasis 2 1,06E-05 2,90024746 135

MEI1 22q13.2 meiosis inhibitor 1 9,16E-06 2,89651071 Putative transmembrane domain-containing protein LOC100132025 15q11.2 1,42E-06 2,89159199 ENSP00000320207 NA NA NA 3,76E-07 2,8902945 TRIM42 3q23 tripartite motif-containing 42 9,78E-05 2,88888946 FAM72A 1q32.1 family with sequence similarity 72, member A 2,12E-04 2,88827177 C15orf33 15q21.1-q21.2 chromosome 15 open reading frame 33 2,19E-05 2,88656157 MED12L 3q25.1 mediator complex subunit 12-like 1,62E-05 2,88611143 SSX2 Xp11.23-p11.22 synovial sarcoma, X breakpoint 2 1,07E-04 2,8829084 HIST1H1A 6p21.3 histone cluster 1, H1a 4,60E-05 2,88017006 OR2J3 6p22.1 olfactory receptor, family 2, subfamily J, member 3 9,66E-05 2,87747222 OR2J3 6p22.1 olfactory receptor, family 2, subfamily J, member 3 9,66E-05 2,87747222 C11orf74 11p12 chromosome 11 open reading frame 74 5,07E-05 2,87714314 LOC283677 15q22 hypothetical LOC283677 1,16E-05 2,87659377 LRRC23 12p13 leucine rich repeat containing 23 3,54E-06 2,87263561 CAB39L 13q14.2-q14.3 calcium binding protein 39-like 9,52E-05 2,87181736 FAM104A 17q25.1 family with sequence similarity 104, member A 9,84E-07 2,87019946 PPP1R7 2q37.3 protein phosphatase 1, regulatory (inhibitor) subunit 7 4,07E-06 2,86979563 HIST3H3 1q42 histone cluster 3, H3 6,73E-06 2,8690806 DNAH10 12q24.31 dynein, axonemal, heavy chain 10 1,72E-06 2,86879922 CEP63 3q22.1-q22.2 centrosomal protein 63kDa 7,12E-06 2,86769283 CKAP2L 2q13 cytoskeleton associated protein 2-like 3,41E-05 2,86617461 CCDC144A 17p11.2 coiled-coil domain containing 144A 1,45E-05 2,86394344 LOC283767 15q11.2 FLJ40198 protein -> Golgi autoantigen, golgin subfamily a-like 1,23E-06 2,86361789 MS4A7 11q12 membrane-spanning 4-domains, subfamily A, member 7 2,78E-05 2,86278733 ATPase, class I, type 8B, member 3 -> Probable phospholipid- ATP8B3 19p13.3 3,51E-07 2,86063712 transporting ATPase IK POLD3 11q14 polymerase (DNA-directed), delta 3, accessory subunit 1,29E-05 2,86055682 UGT3A1 5p13.2 UDP glycosyltransferase 3 family, polypeptide A1 1,30E-05 2,86045074 136

RFESD 5q15 Rieske (Fe-S) domain containing 1,50E-04 2,86034665 PPP1R1C 2q31.3 protein phosphatase 1, regulatory (inhibitor) subunit 1C 2,58E-06 2,85946253 RANBP9 6p23 RAN binding protein 9 4,79E-06 2,85878277 NA NA NA 1,56E-05 2,85724748 EFCAB3 17q23.2 EF-hand calcium binding domain 3 2,23E-04 2,85700785 cyclin-dependent kinase-like 3 -> Serine/threonine-protein PPP2CA 5q31 2,64E-05 2,85675933 phosphatase 2A catalytic subunit alpha isoform LOC494141 11p15.1 similar to mitochondrial carrier triple repeat 1 1,79E-05 2,85658805 C1orf56 1q21.2 chromosome 1 open reading frame 56 2,03E-06 2,85431093 NA NA NA 1,02E-05 2,85319332 FAM154B 15q25.2 family with sequence similarity 154, member B 1,10E-05 2,85178852 LOC148696 1q32.2 hypothetical LOC148696 3,42E-06 2,85066696 ubiquitin specific peptidase 50 -> Inactive ubiquitin carboxyl- USP50 15q21.1 1,04E-05 2,84943326 terminal hydrolase 50 PRKAR2A 3p21.3-p21.2 protein kinase, cAMP-dependent, regulatory, type II, alpha 3,27E-06 2,84781514 LRRC8B 1p22.2 leucine rich repeat containing 8 family, member B 2,39E-06 2,84563673 TBP 6q27 TATA box binding protein 9,46E-07 2,84526988 CCNE1 19q12 cyclin E1 5,33E-05 2,84258404 SCCPDH 1q44 saccharopine dehydrogenase (putative) 1,45E-06 2,83946868 TEX12 11q22 testis expressed 12 1,21E-04 2,83371074 OR4F21 8p23.3 olfactory receptor, family 4, subfamily F, member 21 3,30E-04 2,83305086 KIAA1009 6q14.3 KIAA1009 -> Protein QN1 homolog 1,34E-04 2,83056784 ADRBK2 22q11|22q12.1 adrenergic, beta, receptor kinase 2 5,51E-06 2,82992339 ESPL1 12q extra spindle pole bodies homolog 1 (S. cerevisiae) 6,58E-06 2,82628999 FAF1 1p33 Fas (TNFRSF6) associated factor 1 5,85E-06 2,82526756 ZNF479 7p11.2 zinc finger protein 479 1,82E-05 2,82472124 DCDC5 11p14.1-p13 doublecortin domain containing 5 1,19E-04 2,82460768 GGN 19q13.2 gametogenetin 6,68E-06 2,82334024 GEMIN4 17p13 gem (nuclear organelle) associated protein 4 1,48E-06 2,82307313 137

ZNF479 7p11.2 zinc finger protein 479 2,20E-05 2,82131157 LOC728773 2q22.3 similar to poly(A) binding protein, cytoplasmic 1 1,48E-06 2,82118544 C1orf92 1q23.1 chromosome 1 open reading frame 92 1,07E-05 2,81731524 HELLS 10q24.2 helicase, lymphoid-specific -> Lymphoid-specific helicase 4,12E-04 2,81461579 C3orf34 3q29 chromosome 3 open reading frame 34 1,53E-05 2,81400911 unc-51-like kinase 2 (C. elegans) -> Serine/threonine-protein ULK2 17p11.2 7,29E-06 2,81214308 kinase ULK2 GAS2L3 12q23.1 growth arrest-specific 2 like 3 9,96E-06 2,81186923 CCDC96 4p16.1 coiled-coil domain containing 96 1,53E-06 2,81184097 FAM71B 5q33.3 family with sequence similarity 71, member B 1,67E-05 2,81025881 PR domain containing 9 -> Histone-lysine N-methyltransferase PRDM9 5p14 4,95E-06 2,81010298 PRDM9 WDR52 3q13.2 WD repeat domain 52 1,67E-05 2,80823564 C11orf66 11q12.2 chromosome 11 open reading frame 66 3,58E-05 2,80765759 SPATA7 14q31.3 spermatogenesis associated 7 1,01E-05 2,80642596 NBPF22P 5q14.3 neuroblastoma breakpoint family, member 22 (pseudogene) 1,74E-04 2,80625965 sperm associated antigen 4-like -> SUN domain-containing SUN5 20q11.21 1,73E-06 2,8057384 protein 5 ANKRD5 20pter-q11.23 ankyrin repeat domain 5 2,62E-05 2,80386716 MRGBP 20q13.33 chromosome 20 open reading frame 20 -> MRG-binding protein 2,51E-06 2,80357274 DONSON 21q22.1 downstream neighbor of SON 6,81E-05 2,8035261 NA NA NA 5,03E-07 2,80228172 solute carrier family 36 (proton/amino acid symporter), member SLC36A3 5q33.1 2,20E-05 2,80142137 3 -> Proton-coupled amino acid transporter 3 protein phosphatase 3 (formerly 2B), catalytic subunit, gamma PPP3CC 8p21.3 8,80E-06 2,80093014 isoform KIAA1524 3q13.13 KIAA1524 -> Protein CIP2A 8,61E-05 2,79720696 C2orf53 2p23.3 chromosome 2 open reading frame 53 7,95E-06 2,79684151 C20orf111 20q13.11 chromosome 20 open reading frame 111 5,72E-05 2,79575318 UBL4B 1p13.3 ubiquitin-like 4B 1,69E-05 2,79515251 138

integrin beta 3 binding protein (beta3-endonexin) -> Centromere ITGB3BP 1p31.3 3,12E-04 2,79453356 protein R ZBTB32 19q13.1 zinc finger and BTB domain containing 32 1,11E-06 2,79261366 IPO13 1p34.1 importin 13 1,22E-05 2,78942643 CCNYL1 2q33.3 cyclin Y-like 1 6,99E-05 2,7879564 CCDC81 11q14.2 coiled-coil domain containing 81 1,07E-05 2,78779311 VPRBP 3p21.2 Vpr (HIV-1) binding protein -> Protein VPRBP 3,15E-06 2,78669479 FAM72A 1q32.1 family with sequence similarity 72, member A 3,23E-04 2,78579578 HNF4G 8q21.11 hepatocyte nuclear factor 4, gamma 4,95E-05 2,78546271 COX7B2 4p12 cytochrome c oxidase subunit VIIb2 1,19E-05 2,78412696 X-ray repair complementing defective repair in Chinese hamster XRCC2 7q36.1 5,71E-06 2,78260572 cells 2 -> DNA repair protein XRCC2 FAM3B 21q22.3 family with sequence similarity 3, member B 1,63E-06 2,78180251 LOC253012 7q21.3 hypothetical protein LOC253012 2,19E-05 2,78011681 KIAA0895 7p14.2 KIAA0895 protein 4,28E-06 2,7790976 SYNGR4 19q13.3 synaptogyrin 4 8,01E-07 2,77867384 FK506 binding protein 4, 59kDa -> Peptidyl-prolyl cis-trans FKBP4 12p13.33 1,74E-05 2,77860546 isomerase FKBP4 OR2J3 6p22.1 olfactory receptor, family 2, subfamily J, member 3 9,65E-05 2,77753964 STK36 2q35 serine/threonine kinase 36, fused homolog (Drosophila) 6,89E-06 2,77727685 CCDC144A 17p11.2 coiled-coil domain containing 144A 2,72E-05 2,77657045 NA NA NA 6,06E-06 2,77593445 FERM and PDZ domain containing 2 like 1 -> Putative protein FRMPD2L1 10q11.22 1,77E-05 2,77248951 FRMPD2-like FERM and PDZ domain containing 2 like 1 -> Putative protein FRMPD2L1 10q11.22 1,77E-05 2,77248951 FRMPD2-like MEA1 6p21.3-p21.1 male-enhanced antigen 1 3,03E-06 2,77181698 LOC340286 7p14.1 hypothetical protein LOC340286 3,94E-05 2,77086995 SSX4 Xp11.23 synovial sarcoma, X breakpoint 4 5,19E-05 2,76770753 FLJ36144 15q11.2 hypothetical protein FLJ36144 1,77E-04 2,76618568 139

CHEK1 11q24-q24 CHK1 checkpoint homolog (S. pombe) 1,34E-04 2,76277773 EAN57 22q12-q13 chromosome 22 open reading frame 33 -> Protein EAN57 1,32E-04 2,76072943 SKAP1 17q21.32 src kinase associated phosphoprotein 1 4,42E-05 2,75992775 PCSK4 19p13.3 proprotein convertase subtilisin/kexin type 4 1,33E-06 2,75963411 NA NA NA 1,79E-06 2,75953082 1-acylglycerol-3-phosphate O-acyltransferase 9 -> Glycerol-3- AGPAT9 4q21.23 1,73E-04 2,75897427 phosphate acyltransferase 3 NA NA NA 7,53E-05 2,75810332 ZCCHC14 16q24.2 zinc finger, CCHC domain containing 14 3,34E-06 2,75773819 FBXW5 9q34.3 F-box and WD repeat domain containing 5 1,27E-06 2,75413638 PLSCR2 3q24 phospholipid scramblase 2 1,62E-04 2,75078713 HFM1 1p22.2 HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) 1,70E-04 2,74923075 TPK1 7q34-q35 thiamin pyrophosphokinase 1 1,84E-05 2,74558961 HYDIN 16q22.1-q22.3 hydrocephalus inducing homolog (mouse) 8,12E-05 2,74360635 YBX1P2 7q22.2 Y box binding protein 1 pseudogene 2 5,83E-06 2,74357592 TUBB2C 9q34 tubulin, beta 2C 3,99E-06 2,74167678 EXOSC9 4q27 exosome component 9 -> Exosome complex exonuclease RRP45 3,53E-05 2,74126158 LIPJ 10q23.31 lipase, family member J 9,65E-05 2,74117037 COPR5 17q11.2 chromosome 17 open reading frame 79 -> Cooperator of PRMT5 1,46E-06 2,74021767 SEC61A2 10p14 Sec61 alpha 2 subunit (S. cerevisiae) 7,67E-05 2,73813485 CCDC63 12q24.11 coiled-coil domain containing 63 3,71E-04 2,73273961 jumonji, AT rich interactive domain 1B -> Lysine (K)-specific KDM5B 1q32.1 7,43E-07 2,7320398 demethylase 5B NLR family, pyrin domain containing 4 -> NACHT, LRR and PYD NLRP4 19q13.42 5,19E-05 2,73007295 domains-containing protein 4 C6orf118 6q27 chromosome 6 open reading frame 118 1,97E-04 2,72953747 LOC1720 2p12 dihydrofolate reductase pseudogene 2,79E-05 2,72940976 SSX4 Xp11.23 synovial sarcoma, X breakpoint 4 5,47E-05 2,72621246 LOC100129827 11p15.4 hypothetical protein LOC100129827 1,34E-05 2,72554455 LOC389458 7p22.1 hypothetical LOC389458 7,48E-06 2,72535469 140

C3orf22 3q21.3 chromosome 3 open reading frame 22 1,84E-04 2,7232473 NA NA NA 1,30E-04 2,72255463 XK, Kell blood group complex subunit-related family, member 9 -> XKR9 8q13.3 3,01E-04 2,72208761 XK-related protein 9 FAM134B 5p15.1 family with sequence similarity 134, member B 1,50E-04 2,71995447 GLCCI1 7p21.3 glucocorticoid induced transcript 1 1,34E-05 2,71348607 chromosome 4 open reading frame 28 -> PARK2 co-regulated-like PACRGL 4p15.31 4,07E-06 2,71265674 (PACRGL) GJA9 1p34 gap junction protein, alpha 9, 59kDa 1,50E-05 2,71179571 ubiquitin specific peptidase 1 -> Ubiquitin carboxyl-terminal USP1 1p31.3 3,67E-05 2,71124408 hydrolase 1 phosphatidylinositol glycan anchor biosynthesis, class V -> GPI PIGV 1p36.11 5,04E-06 2,70978427 mannosyltransferase 2 C2orf57 2q37.1 chromosome 2 open reading frame 57 2,19E-05 2,70939643 chromosome 21 open reading frame 55 -> DnaJ (Hsp40) homolog, DNAJC28 21q22.11 1,26E-04 2,70765701 subfamily C, member 28 (DNAJC28) LDHAL6A 11p15.1 lactate dehydrogenase A-like 6A 6,24E-05 2,70561957 C6orf52 6p24.1 chromosome 6 open reading frame 52 1,28E-05 2,70460986 chromosome 15 open reading frame 51 -> UPF0621 protein C15orf51 15q26.3 6,86E-07 2,70345904 C15orf51 C12orf60 12p12.3 chromosome 12 open reading frame 60 3,50E-05 2,70048961 nucleoporin 98kDa -> Nuclear pore complex protein Nup98- NUP98 11p15.5 3,17E-06 2,69936113 Nup96 DNAH3 16p12.2 dynein, axonemal, heavy chain 3 4,31E-05 2,69925168 CDKL4 2p22.1 cyclin-dependent kinase-like 4 7,54E-05 2,69786283 NA NA NA 6,91E-06 2,69634574 CCDC114 19q13.32 coiled-coil domain containing 114 1,38E-06 2,69495653 UBE2T 1q32.1 ubiquitin-conjugating enzyme E2T (putative) 1,10E-05 2,6942972 CEP152 15q21.1 centrosomal protein 152kDa 7,48E-05 2,6930061 NA NA NA 1,60E-04 2,69171469 141

NA NA NA 1,60E-04 2,69171469 similar to Williams Beuren syndrome chromosome region 19 -> SPDYE3 7q22.1 3,49E-06 2,69161208 Speedy homolog E3 (Xenopus laevis) C16orf61 16q23.2 chromosome 16 open reading frame 61 2,94E-06 2,68986916 C21orf59 21q22.1 chromosome 21 open reading frame 59 1,88E-06 2,6882252 ZYG11A 1p32.3 zyg-11 homolog A (C. elegans) 2,41E-04 2,68546236 SECISBP2 9q22.2 SECIS binding protein 2 1,53E-05 2,68151998 CEP78 9q21.2 centrosomal protein 78kDa 6,28E-05 2,68064653 DAZ interacting protein 3, zinc finger -> E3 ubiquitin-protein ligase DZIP3 3q13.13 3,81E-05 2,67973716 DZIP3 ZNF541 19q13.32 zinc finger protein 541 5,49E-06 2,6751847 TBC1D3B 17q12 TBC1 domain family, member 3B 9,90E-05 2,67181108 BTBD10 11p15.2 BTB (POZ) domain containing 10 5,00E-06 2,67161293 HEATR4 14q24.3 HEAT repeat containing 4 2,21E-05 2,66881907 C6orf64 6p21.2 chromosome 6 open reading frame 64 3,82E-06 2,66753648 elongation factor 1 homolog (S. cerevisiae) -> Transcription ELOF1 19p13.2 9,45E-07 2,66712788 elongation factor 1 homolog TP53TG3 16p13 TP53- target gene 3 protein 6,76E-05 2,66481338 SCAPER 15q24 S phase cyclin A-associated protein in the ER 1,19E-05 2,66251195 NA NA NA 1,82E-06 2,662034 STK17B 2q32.3 serine/threonine kinase 17b 4,18E-05 2,66188639 KRT72 12q13.13 keratin 72 -> Keratin, type II cytoskeletal 72 1,16E-04 2,66183289 LOC100129901 9q21.33 similar to KIF27B 2,62E-05 2,66132094 C16orf82 16p12.1 chromosome 16 open reading frame 82 2,56E-05 2,65976356 NA NA NA 4,60E-05 2,65920684 nuclear transcription factor, X-box binding-like 1 -> NF-X1-type NFXL1 4p12 2,75E-05 2,65652723 zinc finger protein NFXL1 TRYX3 7q34 trypsin X3 3,05E-05 2,6551392 RBBP8 18q11.2 retinoblastoma binding protein 8 1,64E-04 2,65180097 CHD5 1p36.31 chromodomain helicase DNA binding protein 5 2,63E-06 2,65141316 142

FAM7A1 15q13.3 family with sequence similarity 7, member A1 3,51E-04 2,65111729 TNFAIP6 2q23.3 tumor necrosis factor, alpha-induced protein 6 8,10E-05 2,64955394 BSCL2 11q12-q13.5 Bernardinelli-Seip congenital lipodystrophy 2 (seipin) 3,57E-06 2,64846969 NA NA NA 4,01E-05 2,6458981 SLC22A14 3p21.3 solute carrier family 22, member 14 4,79E-06 2,64582841 LOC100129543 19p12 hypothetical protein LOC100129543 2,55E-04 2,64444872 NIMA (never in mitosis gene a)- related kinase 11 -> NEK11 3q22.1 4,81E-06 2,64161552 Serine/threonine-protein kinase Nek11 FAM27A 9q12 family with sequence similarity 27, member A 1,05E-05 2,64093995 similar to Williams Beuren syndrome chromosome region 19 -> SPDYE3 7q22.1 5,27E-06 2,63946402 Speedy homolog E3 (Xenopus laevis) INTS7 1p36.13-q42.3 integrator complex subunit 7 1,16E-05 2,63916399 ACR 22q13-qter acrosin 6,56E-06 2,63788286 ubiquitin specific peptidase 42 -> Ubiquitin carboxyl-terminal USP42 7p22.1 2,04E-05 2,63738009 hydrolase 42 C20orf195 20q13.33 chromosome 20 open reading frame 195 1,86E-05 2,63718083 ZDHHC13 11p15.1 zinc finger, DHHC-type containing 13 8,15E-05 2,63402493 CCDC146 7q11.23 coiled-coil domain containing 146 1,01E-04 2,63395829 NA NA NA 1,43E-04 2,6327399 FAM24A 10q26.13 family with sequence similarity 24, member A 8,92E-06 2,63255377 MORN3 12q24.31 MORN repeat containing 3 9,74E-06 2,63252549 CDCA8 1p34.3 cell division cycle associated 8 -> Borealin 1,03E-05 2,63246345 C10orf30 10p13 chromosome 10 open reading frame 30 1,87E-05 2,63219341 pleckstrin homology domain containing, family A PLEKHA1 10q26.13 5,26E-05 2,63207208 (phosphoinositide binding specific) member 1 FAM27A 9q12 family with sequence similarity 27, member A 1,04E-05 2,63007876 tumor protein p53 inducible protein 3 -> Quinone oxidoreductase TP53I3 2p23.3 3,44E-06 2,62895783 PIG3 TBC1D3G 17q12 TBC1 domain family, member 3G 2,65E-04 2,62892503 LOC390561 15q13.2 similar to hect domain and RLD 2 8,42E-05 2,62755962 143

LYRM1 16p11.2 LYR motif containing 1 7,29E-06 2,62496102 MTMR6 13q12 myotubularin related protein 6 2,09E-05 2,6243834 TBC1D3C 17q12 TBC1 domain family, member 3C 2,68E-04 2,62152354 C1orf189 1q21.3 chromosome 1 open reading frame 189 6,33E-05 2,62071233 DCN1, defective in cullin neddylation 1, domain containing 1 (S. DCUN1D1 3q26.3 3,03E-05 2,61973067 cerevisiae) UBE2NL Xq27.3 ubiquitin-conjugating enzyme E2N-like 1,05E-06 2,61902985 FAT tumor suppressor homolog 2 (Drosophila) -> Protocadherin FAT2 5q32-q33 3,32E-05 2,61588841 Fat 2 GUCA1A 6p21.1 guanylate cyclase activator 1A (retina) 3,31E-05 2,61358486 MEMO1 2p22-p21 mediator of cell motility 1 -> Protein MEMO1 2,70E-06 2,61084806 LRRC27 10q26.3 leucine rich repeat containing 27 1,28E-05 2,61021564 SSX2 Xp11.23-p11.22 synovial sarcoma, X breakpoint 2 1,56E-04 2,60915111 ANKLE2 12q24.33 ankyrin repeat and LEM domain containing 2 9,83E-07 2,60743809 NA NA NA 3,46E-05 2,60682367 similar to Williams Beuren syndrome chromosome region 19 -> SPDYE3 7q22.1 4,95E-06 2,60681644 Speedy homolog E3 (Xenopus laevis) similar to Williams Beuren syndrome chromosome region 19 -> SPDYE3 7q22.1 4,95E-06 2,60681644 Speedy homolog E3 (Xenopus laevis) KIAA1012 18q12.1 KIAA1012 -> Protein TRS85 homolog 2,28E-05 2,60494426 TBC1D3C 17q12 TBC1 domain family, member 3C 3,13E-04 2,60406237 NA NA NA 1,06E-04 2,60401544 similar to Williams Beuren syndrome chromosome region 19 -> SPDYE3 7q22.1 4,47E-06 2,60394956 Speedy homolog E3 (Xenopus laevis) NA NA NA 3,87E-05 2,60263861 C10orf78 10q25.1 chromosome 10 open reading frame 78 1,99E-04 2,60207492 EID3 12q23-q24.1 EP300 interacting inhibitor of differentiation 3 1,17E-05 2,60110205 TBC1D3C 17q12 TBC1 domain family, member 3C 2,81E-04 2,60044225 LOC648987 5p12 hypothetical LOC648987 7,06E-06 2,59977091 CCDC53 12q23.2 coiled-coil domain containing 53 -> WASH complex subunit 5,87E-06 2,59839093 1 44

CCDC53 PRKACG 9q13 protein kinase, cAMP-dependent, catalytic, gamma 5,00E-06 2,59752116 NA NA NA 2,56E-06 2,59676597 THUMPD3 3p25.3 THUMP domain containing 3 8,04E-06 2,59659498 SUMO1/sentrin/SMT3 specific peptidase 2 -> Sentrin-specific SENP2 3q27.2 6,64E-06 2,59612527 protease 2 NA NA NA 1,04E-05 2,59503141 TRIM59 3q26.1 tripartite motif-containing 59 8,54E-05 2,59487223 QRICH2 17q25.1 glutamine rich 2 4,60E-05 2,59362068 UBQLNL 11p15.4 ubiquilin-like 1,01E-04 2,59265277 ATXN7L1 7q22.2 ataxin 7-like 1 1,12E-05 2,59243982 EFHC1 6p12.3 EF-hand domain (C-terminal) containing 1 2,43E-05 2,59118766 IPO5 13q32.2 importin 5 9,34E-06 2,59020359 C5orf36 5q15 KIAA0825 protein -> Uncharacterized protein C5orf36 9,38E-05 2,58998905 NA NA NA 7,09E-06 2,5895708 LOC441601 11p11.12 septin 7 pseudogene 5,57E-06 2,58822134 UBN1 16p13.3 ubinuclein 1 3,73E-06 2,58647814 TTC26 7q34 tetratricopeptide repeat domain 26 2,89E-05 2,58523602 CDC6 17q21.3 cell division cycle 6 homolog (S. cerevisiae) 1,57E-04 2,58486422 FLJ46321 9q21.32 FLJ46321 protein 2,01E-06 2,58126722 PPM1E 17q22 protein phosphatase 1E (PP2C domain containing) 2,60E-05 2,58053912 XPO5 6p21.1 exportin 5 1,21E-05 2,57893695 OR2H1 6p21.3 olfactory receptor, family 2, subfamily H, member 1 2,57E-05 2,57679095 ACTRT2 1p36.32 actin-related protein T2 1,38E-05 2,57427825 LIN9 1q42.12 lin-9 homolog (C. elegans) 2,92E-05 2,57287702 chromosome 18 open reading frame 37 -> INO80 complex INO80C 18q12.2 6,91E-06 2,57242319 subunit C (INO80C) MYO9A 15q22-q23 myosin IXA 3,01E-06 2,57220299 ANKRD36 2q11.2 ankyrin repeat domain 36 6,38E-05 2,57149884 145

NUT 15q14 chromosome 15 open reading frame 55 -> Protein NUT 4,65E-06 2,5709998 similar to 4931415M17 protein -> Family with sequence similarity FAM166A 9q34.3 1,47E-04 2,56826042 166, member A (FAM166A) EYA4 6q23 eyes absent homolog 4 (Drosophila) 1,64E-04 2,56820524 TSSK3 1p35-p34 testis-specific serine kinase 3 5,42E-05 2,5679498 TBC1D3B 17q12 TBC1 domain family, member 3B 2,52E-04 2,56557198 CSMD3 8q23.3 CUB and Sushi multiple domains 3 8,99E-05 2,56269805 BLM 15q26.1 Bloom syndrome 7,30E-05 2,56260035 TBC1D3B 17q12 TBC1 domain family, member 3B 2,49E-04 2,56227176 PLS1 3q23 plastin 1 (I isoform) 2,63E-05 2,56026829 TBC1D3G 17q12 TBC1 domain family, member 3G 2,66E-04 2,56009882 COX8C 14q32.13 cytochrome c oxidase subunit 8C 5,39E-06 2,55952039 mitochondrial ribosomal protein S15 -> 28S ribosomal protein MRPS15 1p35-p34.1 4,54E-06 2,55742601 S15, mitochondrial LOC100130518 19p12 similar to hCG1773661 5,55E-05 2,55734092 WFDC3 20q13.12 WAP four-disulfide core domain 3 1,87E-05 2,55677109 HIRIP3 16p11.2 HIRA interacting protein 3 5,65E-06 2,55436289 MTCH2 11p11.2 mitochondrial carrier homolog 2 (C. elegans) 1,21E-05 2,55317336 TBC1D3G 17q12 TBC1 domain family, member 3G 2,81E-04 2,55251511 polymerase (DNA directed), epsilon -> DNA polymerase epsilon POLE 12q24.3 1,13E-05 2,55054579 catalytic subunit A TBC1D3B 17q12 TBC1 domain family, member 3B 8,47E-05 2,55021256 LIN28B 6q21 lin-28 homolog B (C. elegans) 2,41E-04 2,54846051 LOC340286 7p14.1 hypothetical protein LOC340286 4,05E-05 2,54664083 SPIRE1 18p11.21 spire homolog 1 (Drosophila) 1,32E-06 2,546632 ACOT13 6p22.2 thioesterase superfamily member 2 1,68E-05 2,54565427 NA NA NA 5,35E-06 2,54341962 RAD17 homolog (S. pombe) -> Cell cycle checkpoint protein RAD17 5q13 2,00E-04 2,54319661 RAD17 UBR7 14q32.12 chromosome 14 open reading frame 130 -> Putative E3 ubiquitin- 1,67E-05 2,54300976 146

protein ligase UBR7 CEP76 18p11.21 centrosomal protein 76kDa 5,98E-05 2,54290577 NA NA NA 2,03E-05 2,54164846 DEPDC4 12q23.1 DEP domain containing 4 4,35E-04 2,5414582 ZNRF4 19p13.3 zinc and ring finger 4 5,86E-06 2,54096499 FLJ43826 17q12 FLJ43826 protein 8,60E-06 2,53995511 C3orf14 3p14.2 chromosome 3 open reading frame 14 2,58E-04 2,53970072 WDR54 2p13.1 WD repeat domain 54 6,91E-06 2,53967168 TUBA3C 13q11 tubulin, alpha 3c 1,18E-06 2,53804826 neuroblastoma breakpoint family, member 6 -> Neuroblastoma NBPF4 1p13.3 2,73E-05 2,53665708 breakpoint family, member 4 DNHD1 11p15.4 dynein heavy chain domain 1 1,01E-06 2,53636259 CNTROB 17p13.1 centrobin, centrosomal BRCA2 interacting protein 1,69E-06 2,53627644 PTEN induced putative kinase 1 -> Serine/threonine-protein PINK1 1p36 8,21E-07 2,53586598 kinase PINK1, mitochondrial C9orf128 9p13.3 chromosome 9 open reading frame 128 4,54E-06 2,53573327 RDM1 17q11.2 RAD52 motif 1 7,74E-06 2,53471581 C3orf20 3p25.1-p24.3 chromosome 3 open reading frame 20 1,80E-04 2,53462445 MAD2 mitotic arrest deficient-like 1 (yeast) -> Mitotic spindle MAD2L1 4q27 1,04E-04 2,53374529 assembly checkpoint protein MAD2A DDHD1 14q21 DDHD domain containing 1 3,22E-05 2,53241703 tubulin tyrosine ligase-like family, member 7 -> Tubulin TTLL7 1p31.1 1,68E-05 2,53189136 polyglutamylase TTLL7 GPR85 7q31 probable G protein-coupled receptor 85 1,07E-05 2,53119648 RMND5B 5q35.3 required for meiotic nuclear division 5 homolog B (S. cerevisiae) 3,39E-06 2,53048338 SBNO1 12q24.31 strawberry notch homolog 1 (Drosophila) 1,19E-04 2,5298757 CATSPER4 1p35.3 cation channel, sperm associated 4 2,12E-05 2,52973278 AHCTF1 1q44 AT hook containing transcription factor 1 -> Protein ELYS 1,54E-05 2,52753488 NA NA NA 2,16E-05 2,52610831 NA NA NA 2,51E-05 2,52588945 147

testis-specific kinase 2 -> Dual specificity testis-specific protein TESK2 1p32 8,48E-06 2,52488469 kinase 2 ARHGAP28 18p11.31 Rho GTPase activating protein 28 5,91E-05 2,52427047 golgi associated, gamma adaptin ear containing, ARF binding GGA1 22q13.31 3,25E-06 2,52364941 protein 1 NA NA NA 7,22E-06 2,52150135 SETX 9q34.13 senataxin -> Probable helicase senataxin 4,81E-06 2,52104261 neural precursor cell expressed, developmentally down-regulated NEDD1 12q23.1 9,28E-05 2,51995156 1 -> LOC401357 7p11.2 hypothetical LOC401357 2,69E-05 2,519129 HHIPL2 1q41 HHIP-like 2 2,03E-06 2,51886185 TIPIN 15q22.31 TIMELESS interacting protein 7,29E-05 2,51881122 TISP43 2q21.1 similar to mCG22736 3,05E-05 2,5182491 TISP43 2q21.1 similar to mCG22736 3,05E-05 2,5182491 NA NA NA 6,92E-06 2,51667427 chromosome 12 open reading frame 48 -> UPF0419 protein C12orf48 12q23.2 4,87E-04 2,51512569 C12orf48 RPP38 10p13 ribonuclease P/MRP 38kDa subunit 2,46E-04 2,51459403 PCID2 13q34 PCI domain containing 2 1,89E-05 2,51402239 CCT2 12q15 chaperonin containing TCP1, subunit 2 (beta) 3,57E-05 2,51355629 TDP1 14q32.11 tyrosyl-DNA phosphodiesterase 1 3,43E-06 2,51251725 RNF19B 1p35.1 ring finger protein 19B -> E3 ubiquitin-protein ligase RNF19B 3,78E-06 2,51053267 KIF2A 5q12-q13 kinesin heavy chain member 2A 5,49E-06 2,50959838 CDC25A 3p21 cell division cycle 25 homolog A (S. pombe) 4,13E-05 2,50951227 CCDC77 12p13.33 coiled-coil domain containing 77 5,04E-05 2,50776646 NAA10 4q21.21 ARD1 homolog B (S. cerevisiae) 3,40E-05 2,50703824 LOC100131454 17p13.3 similar to hCG1646635 5,29E-05 2,50685057 NOL1/NOP2/Sun domain family, member 4 -> Putative NSUN4 1p34 9,37E-06 2,50674892 methyltransferase NSUN4 ZC3H14 14q31.3 zinc finger CCCH-type containing 14 7,82E-06 2,50593675 148

C1orf112 1q24.2 chromosome 1 open reading frame 112 3,60E-04 2,50499201 TBC1D3C 17q12 TBC1 domain family, member 3C 3,17E-04 2,50494165 DMRTC2 19q13.2 DMRT-like family C2 5,38E-05 2,50444946 chromosome 14 open reading frame 148 -> Pyrroline-5- C14orf148 14q24.3 2,33E-05 2,50421339 carboxylate reductase-like protein C14orf148 PCOTH 13q12 prostate collagen triple helix -> Protein PCOTH 2,98E-05 2,5040806 ATP1A4 1q21-q23 ATPase, Na+/K+ transporting, alpha 4 polypeptide 3,83E-05 2,50120967 RNF6 13q12.2 ring finger protein (C3H2C3 type) 6 8,16E-06 2,50081962 ARV1 1q42.2 ARV1 homolog (S. cerevisiae) 4,13E-05 2,50054748 AURKC 19q13.43 aurora kinase C -> Serine/threonine-protein kinase 13 7,96E-06 2,50053448 FAM27A 9q12 family with sequence similarity 27, member A 1,45E-05 2,49961257 CCHCR1 6p21.3 coiled-coil alpha-helical rod protein 1 8,69E-06 2,49946097 NBPF22P 5q14.3 neuroblastoma breakpoint family, member 22 (pseudogene) 2,50E-05 2,49893695 chromosome 15 open reading frame 51 -> UPF0621 protein C15orf51 15q26.3 1,22E-04 2,49862951 C15orf51 LOC441734 15q26.3 similar to hypothetical protein DKFZp434I1020 1,22E-04 2,49862951 NA NA NA 1,22E-04 2,49862951 NA NA NA 1,02E-04 2,49813337 similar to Williams Beuren syndrome chromosome region 19 -> SPDYE3 7q22.1 7,23E-06 2,49742179 Speedy homolog E3 (Xenopus laevis) AKR1E2 10p15.1 aldo-keto reductase family 1, member C-like 2 1,62E-06 2,49721321 NA NA NA 1,94E-05 2,49655381 EXO1 1q42-q43 exonuclease 1 3,43E-05 2,49196102 C20orf79 20p11.23 chromosome 20 open reading frame 79 6,29E-05 2,48945338 family with sequence similarity 82, member A1 -> Regulator of FAM82A1 2p22.2 1,34E-05 2,48870547 microtubule dynamics protein 2 FBN2 5q23-q31 fibrillin 2 (congenital contractural arachnodactyly) 6,16E-05 2,48862267 NA NA NA 1,29E-04 2,48836048 NA NA NA 1,29E-04 2,48836048 CCDC113 16q21 coiled-coil domain containing 113 8,80E-06 2,48810781 149

DOM3Z 6p21.3 dom-3 homolog Z (C. elegans) 6,25E-06 2,48731289 MGC12966 7p22.1 hypothetical protein LOC84792 9,34E-06 2,48470315 CATSPER2 15q14 cation channel, sperm associated 2 1,44E-05 2,48410818 HRASLS5 11q13.2 HRAS-like suppressor family, member 5 5,40E-06 2,4834531 NA NA NA 1,46E-05 2,48223637 ZNF487 10q11.21 zinc finger protein 487 4,41E-04 2,4815964 similar to Zinc finger and SCAN domain containing 5 -> Zinc finger ZSCAN5C 19q13.43 7,87E-05 2,4797093 and SCAN domain-containing protein 5C NA NA NA 2,87E-04 2,47572145 amine oxidase (flavin containing) domain 2 -> Lysine (K)-specific KDM1 1p36.12 1,51E-05 2,47435328 demethylase 1 CCDC91 12p11.22 coiled-coil domain containing 91 5,27E-05 2,47335444 NIMA (never in mitosis gene a)-related kinase 4 -> NEK4 3p21.1 3,04E-06 2,4722292 Serine/threonine-protein kinase Nek4 STXBP5 6q24.3 syntaxin binding protein 5 (tomosyn) 8,53E-05 2,47094689 NA NA NA 1,30E-04 2,47083556 chromosome 17 open reading frame 81 -> Dermal papilla-derived DERP6 17p13.1 9,51E-06 2,47058638 protein 6 WDR52 3q13.2 WD repeat domain 52 8,94E-05 2,46922962 TLE4 9q21.31 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1,53E-05 2,46817724 CCNB1 5q12 cyclin B1 2,14E-04 2,46761873 C19orf41 19q13.33 chromosome 19 open reading frame 41 1,30E-04 2,46754261 CDRT4 17p12 CMT1A duplicated region transcript 4 1,15E-04 2,46704495 NA NA NA 2,36E-04 2,46653285 Cas-Br-M (murine) ecotropic retroviral transforming sequence -> CBL 11q23.3 1,34E-04 2,46553289 E3 ubiquitin-protein ligase AMZ2 17q24.2 archaelysin family metallopeptidase 2 -> Archaemetzincin-2 1,31E-05 2,46506553 KIAA1407 3q13.31 KIAA1407 -> Coiled-coil domain-containing protein KIAA1407 3,62E-05 2,46472895 TPTE and PTEN homologous inositol lipid phosphatase LOC374491 13q12.12 1,62E-04 2,46264641 pseudogene 150

TTBK2 15q15.2 tau tubulin kinase 2 4,25E-06 2,46006767 LOC91431 -> 4q25 3,87E-04 2,45973688 C4orf21 prematurely terminated mRNA decay factor-like ubiquitin specific peptidase 6 (Tre-2 oncogene) -> Ubiquitin USP6 17p13 1,05E-04 2,45894506 carboxyl-terminal hydrolase 6 NA NA NA 1,84E-04 2,45804955 THOC4 17q25.3 THO complex 4 4,04E-06 2,4572736 CSE1L 20q13 CSE1 chromosome segregation 1-like (yeast) 5,84E-05 2,45548584 AHCTF1 1q44 AT hook containing transcription factor 1 -> Protein ELYS 1,49E-05 2,45344597 VAV3 1p13.3 vav 3 guanine nucleotide exchange factor 4,12E-04 2,45122769 H2AFZ 4q24 H2A histone family, member Z 1,08E-05 2,44844027 LIPE 19q13.2 lipase, hormone-sensitive 5,83E-06 2,44775557 RSHL1 19q13.3 radial spokehead-like 1 3,94E-05 2,44742135 MSTO1 1q22 misato homolog 1 (Drosophila) 1,32E-04 2,44713128 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, ALS2CR8 2q33.1-q33.2 6,53E-05 2,44618582 candidate 8 TEKT1 17p13.2 tektin 1 2,60E-04 2,44607646 leucine rich repeat containing 37, member B2 -> Putative LRRC37B2 17q11.2 1,54E-05 2,44547718 LRRC37B-like protein 2 TEKT5 16p13.13 tektin 5 1,78E-05 2,44360738 NA NA NA 3,55E-05 2,44226204 CENPL 1q25.1 centromere protein L 2,90E-05 2,44162053 SNX14 6q14.3 sorting nexin 14 1,07E-05 2,44094367 C11orf80 11q13.1 chromosome 11 open reading frame 80 3,69E-05 2,4408633 POLB 8p11.2 polymerase (DNA directed), beta 5,01E-06 2,43707728 LOC340900 10p12.31 similar to hCG1652542 3,18E-05 2,43646331 NA NA NA 5,24E-05 2,4360327 NA NA NA 2,32E-06 2,43508646 WEE1 11p15.3-p15.1 WEE1 homolog (S. pombe) 5,53E-05 2,43503161 LRTOMT 11q13.4 leucine rich repeat containing 51 3,93E-05 2,43465441 151

MEMO1 2p22-p21 mediator of cell motility 1 -> Protein MEMO1 5,21E-06 2,43386138 EFCAB7 1p31.3 EF-hand calcium binding domain 7 1,82E-04 2,43365979 WDR47 1p13.3 WD repeat domain 47 1,69E-04 2,43234774 CCDC70 13q14.3 coiled-coil domain containing 70 8,21E-05 2,43201732 CXorf20 Xp22.13 chromosome X open reading frame 20 3,97E-04 2,43172486 LOC100131211 2q32.2 similar to hCG1646803 3,18E-04 2,43123357 C21orf15 21q11 chromosome 21 open reading frame 15 3,60E-04 2,43109033 NA NA NA 4,34E-04 2,43031531 BIN2 12q13 bridging integrator 2 1,47E-04 2,42960284 FAM48A 13q13.3 family with sequence similarity 48, member A 1,39E-05 2,42923658 LOC340069 5q23.1 hypothetical protein LOC340069 1,26E-05 2,42729676 LOC285679 5q35.3 hypothetical protein LOC285679 3,04E-06 2,42647669 UTS2D 3q28 urotensin 2 domain containing -> Urotensin-2B 5,86E-05 2,4242912 WDR35 2p24.1 WD repeat domain 35 3,15E-05 2,42274993 NA NA NA 1,03E-05 2,42261391 spindle assembly 6 homolog (C. elegans) -> Spindle assembly SASS6 1p21.2 7,83E-05 2,42186509 abnormal protein 6 homolog MUC1 1q21 mucin 1, cell surface associated 1,80E-05 2,4217736 RAD17 homolog (S. pombe) -> Cell cycle checkpoint protein RAD17 5q13 1,79E-04 2,41910183 RAD17 NA NA NA 5,37E-05 2,41778926 IQCF1 3p21.1 IQ motif containing F1 9,14E-05 2,417403 WDTC1 1p36.11 WD and tetratricopeptide repeats 1 1,68E-05 2,41648745 solute carrier family 37 (glycerol-3-phosphate transporter), SLC37A1 21q22.3 5,00E-05 2,41567271 member 1 -> Glycerol-3-phosphate transporter C2orf63 2p16.1 chromosome 2 open reading frame 63 3,11E-04 2,41472936 NA NA NA 4,26E-05 2,41365755 C1orf124 1q42.12-q43 chromosome 1 open reading frame 124 2,79E-05 2,41261297 LACE1 6q22.1 lactation elevated 1 9,32E-05 2,41184551 NA NA NA 7,82E-06 2,41130726 152

MPHOSPH9 12q24.31 M-phase phosphoprotein 9 6,78E-06 2,41042577 TAF5 RNA polymerase II, TATA box binding protein (TBP)- TAF5 10q24-q25.2 associated factor, 100kDa -> Transcription initiation factor TFIID 4,22E-04 2,40858026 subunit 5 RFC4 3q27 replication factor C (activator 1) 4, 37kDa 7,38E-06 2,40709236 family with sequence similarity 29, member A -> HAUS augmin- HAUS6 9p22.1 1,75E-04 2,40648678 like complex, subunit 6 SHARPIN 8q24.3 SHANK-associated RH domain interactor 7,94E-07 2,40614903 OVOS2 12p11.21 ovostatin 2 8,48E-06 2,4046693 AARSD1 17q21.31 alanyl-tRNA synthetase domain containing 1 3,73E-06 2,40349366 SPESP1 15q23 sperm equatorial segment protein 1 1,82E-05 2,40323462 C11orf71 11q14.2-q14.3 chromosome 11 open reading frame 71 1,69E-05 2,40217874 NA NA NA 4,12E-04 2,40082376 NA NA NA 1,24E-06 2,40061825 TPP2 13q32-q33 tripeptidyl peptidase II 9,95E-06 2,4004244 GLE1 9q34.11 GLE1 RNA export mediator homolog (yeast) -> Nucleoporin GLE1 2,40E-06 2,39848846 C10orf88 10q26.13 chromosome 10 open reading frame 88 1,68E-05 2,39772965 CEP350 1p36.13-q41 centrosomal protein 350kDa 7,92E-06 2,39442708 NA NA NA 2,09E-06 2,390873 KIF3A 5q31 kinesin family member 3A 3,81E-04 2,38952026 SPATS2 12q13.12 spermatogenesis associated, serine-rich 2 2,17E-05 2,38871213 EFCAB1 8q11.21 EF-hand calcium binding domain 1 4,83E-04 2,38846875 CSNK1G2 19p13.3 casein kinase 1, gamma 2 9,63E-06 2,38772966 FK506 binding protein 12-rapamycin associated protein 1 -> FRAP1 1p36.2 5,24E-06 2,38693619 Serine/threonine-protein kinase mTOR 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase- HTR7 10q21-q24 7,30E-06 2,38679639 coupled) -> 5-hydroxytryptamine receptor 7 NA NA NA 1,38E-06 2,38669713 NBPF5 1p13.3 neuroblastoma breakpoint family, member 5 3,40E-05 2,38409463 GSG2 17p13 germ cell associated 2 (haspin) -> Serine/threonine-protein kinase 1,42E-05 2,38403927 153

haspin IDE 10q23-q25 insulin-degrading enzyme 7,82E-06 2,38198694 RAD54-like (S. cerevisiae) -> DNA repair and recombination RAD54L 1p32 9,46E-05 2,38162703 protein RAD54-like ZNF683 1p36.11 zinc finger protein 683 2,20E-05 2,38106912 C10orf82 10q25.3 chromosome 10 open reading frame 82 4,05E-05 2,37985059 AREG 4q13-q21 amphiregulin (schwannoma-derived growth factor) 3,80E-04 2,37625226 NA NA NA 8,73E-06 2,37430208 OR4Q3 14q11.2 olfactory receptor, family 4, subfamily Q, member 3 4,16E-04 2,37311662 LOC401357 7p11.2 hypothetical LOC401357 6,86E-05 2,37281151 serine threonine kinase 39 (STE20/SPS1 homolog, yeast) -> STK39 2q24.3 5,12E-05 2,3726602 STE20/SPS1-related proline-alanine-rich protein kinase XRRA1 11q13.4 X-ray radiation resistance associated 1 1,96E-05 2,37187174 MYST2 17q21.32 MYST histone acetyltransferase 2 5,00E-06 2,3702948 C12orf42 12q23.2-q23.3 chromosome 12 open reading frame 42 3,65E-04 2,37011901 GDF9 5q31.1 growth differentiation factor 9 1,78E-05 2,37009354 SRRT 7q21 arsenate resistance protein 2 -> Serrate RNA effector molecule 3,94E-06 2,36901035 ODF3L1 15q24.2 outer dense fiber of sperm tails 3-like 1 1,03E-04 2,36769131 NA NA NA 5,89E-05 2,36709072 ubiquitin specific peptidase 29 -> Ubiquitin carboxyl-terminal USP29 19q13.43 1,53E-05 2,3657006 hydrolase 29 presenilin enhancer 2 homolog (C. elegans) -> Gamma-secretase PSENEN 19q13.12 5,83E-06 2,36466941 subunit PEN-2 WASF1 6q21-q22 WAS protein family, member 1 2,38E-05 2,36466941 RB1CC1 8q11 RB1-inducible coiled-coil 1 1,96E-05 2,36292445 CNOT10 3p22.3 CCR4-NOT transcription complex, subunit 10 3,68E-05 2,36180606 HIV-1 Rev binding protein -> Arf-GAP domain and FG repeats- AGFG1 2q36.3 4,25E-06 2,36111776 containing protein 1 PRKCZ 1p36.33-p36.2 protein kinase C, zeta 2,58E-06 2,36035114 NUPL1 13q12.13 nucleoporin like 1 -> Nucleoporin p58/p45 4,25E-05 2,35995606 154

RPL10L 14q13-q21 ribosomal protein L10-like 4,96E-06 2,35960766 sphingomyelin synthase 2 -> Phosphatidylcholine:ceramide SGMS2 4q25 6,82E-06 2,35891674 cholinephosphotransferase 2 DLEC1 3p22-p21.3 deleted in lung and esophageal cancer 1 2,18E-06 2,35875324 LOC202051 5q31.2 hypothetical protein LOC202051 9,75E-06 2,35654789 PIGF 2p21-p16 phosphatidylinositol glycan anchor biosynthesis, class F 3,61E-04 2,35578683 C3orf25 3q21.3 chromosome 3 open reading frame 25 7,99E-06 2,35555497 CCDC121 2p23.2 coiled-coil domain containing 121 2,68E-06 2,35403864 C8orf78 8q24.13 chromosome 8 open reading frame 78 2,51E-05 2,35246621 NA NA NA 1,74E-05 2,3515834 Williams Beuren syndrome chromosome region 19 -> Speedy SPDYE1 7p13 8,59E-06 2,34957692 protein E1 RAB28, member RAS oncogene family -> Ras-related protein Rab- RAB28 4p15.33 7,55E-05 2,34627237 28 C14orf38 14q23.1 chromosome 14 open reading frame 38 5,59E-05 2,34624554 SPEF2 5p13.2 sperm flagellar 2 6,98E-05 2,34504239 WDR60 7q36.3 WD repeat domain 60 1,62E-04 2,34490992 ZNF20 19p13.3-p13.2 zinc finger protein 20 1,87E-05 2,34433704 KLHDC9 1q23.3 kelch domain containing 9 1,72E-05 2,34213949 chromosome 3 open reading frame 60 -> NADH dehydrogenase NDUFAF3 3p21.31 3,46E-06 2,34160381 [ubiquinone] 1 alpha subcomplex assembly factor 3 chromosome 5 open reading frame 37 -> Centrosomal protein POC5 5q13.3 3,37E-05 2,34096279 POC5 OVOL1 11q13 ovo-like 1(Drosophila) -> Putative transcription factor Ovo-like 1 2,40E-06 2,33944531 ODF3 11p15.5 outer dense fiber of sperm tails 3 1,01E-04 2,33500154 NA NA NA 3,49E-05 2,33429517 C4orf21 4q25 chromosome 4 open reading frame 21 2,51E-04 2,33429112 MGC26597 6p24.3 PIP5K1A pseudogene 2,26E-06 2,33405814 LRRC28 15q26.3 leucine rich repeat containing 28 9,62E-05 2,33400799 LYZL4 3p22.1 lysozyme-like 4 3,94E-05 2,33316365 155

UBE2S 19q13.43 ubiquitin-conjugating enzyme E2S 3,84E-06 2,33157688 CLOCK 4q12 clock homolog (mouse) 2,62E-04 2,33033279 ANKRD42 11q14.1 ankyrin repeat domain 42 3,79E-05 2,32961331 MARVELD2 5q13.2 MARVEL domain containing 2 5,83E-06 2,32761266 MARVELD2 5q13.2 MARVEL domain containing 2 5,83E-06 2,32761266 BAT3 6p21.3 HLA-B associated transcript 3 -> Large proline-rich protein BAT3 2,33E-06 2,3273505 BAT3 6p21.3 HLA-B associated transcript 3 -> Large proline-rich protein BAT3 2,33E-06 2,3273505 FANCA 16q24.3 Fanconi anemia, complementation group A 2,88E-05 2,32679482 zuotin related factor 1 -> DnaJ (Hsp40) homolog, subfamily C, DNAJC2 7q22 6,47E-05 2,32639327 member 2 (DNAJC2) NA NA NA 3,47E-05 2,32625701 LOC729595 5q35.3 similar to high-mobility group box 3 4,83E-05 2,32620219 BROMI 6q22.31 chromosome 6 open reading frame 170 -> Protein broad-minded 5,76E-05 2,32566855 NLR family, pyrin domain containing 2 -> NACHT, LRR and PYD NLRP2 19q13.42 1,13E-04 2,32550493 domains-containing protein 2 CCDC144A 17p11.2 coiled-coil domain containing 144A 9,24E-05 2,32513342 CLUAP1 16p13.3 clusterin associated protein 1 8,66E-06 2,32468542 PYROXD1 12p12.1 pyridine nucleotide-disulphide oxidoreductase domain 1 1,23E-04 2,32388552 PCBP3 21q22.3 poly(rC) binding protein 3 1,63E-05 2,3197977 FLJ20209 3p21.31 hypothetical LOC57245 1,19E-05 2,31927196 TBC1D21 15q24.1 TBC1 domain family, member 21 2,48E-05 2,3186282 C19orf18 19q13.43 chromosome 19 open reading frame 18 3,82E-05 2,31853901 C9orf116 9q34.3 chromosome 9 open reading frame 116 1,72E-05 2,31817584 C17orf66 17q12 chromosome 17 open reading frame 66 1,65E-04 2,31662335 NA NA NA 2,21E-06 2,31643548 mitochondrial translation optimization 1 homolog (S. cerevisiae) - MTO1 6q13 7,31E-06 2,31627814 > Protein MTO1 homolog, mitochondrial SLAIN2 4p12 SLAIN motif family, member 2 6,53E-06 2,31547551 CMTM1 16q21 CKLF-like MARVEL transmembrane domain containing 1 1,54E-05 2,31385025 SOCS7 17q12 suppressor of cytokine signaling 7 1,82E-06 2,31261563 156

Williams Beuren syndrome chromosome region 19 -> Speedy SPDYE1 7p13 7,23E-06 2,31241366 protein E1 RAB27B, member RAS oncogene family -> Ras-related protein RAB27B 18q21.2 2,69E-04 2,31015476 Rab-27B NA NA NA 5,92E-06 2,30815963 BAT3 6p21.3 HLA-B associated transcript 3 -> Large proline-rich protein BAT3 2,49E-06 2,30796205 NA NA NA 2,36E-05 2,3076917 DYRK3 1q32.1 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 5,51E-05 2,3071783 CENPO 2p23.3 centromere protein O 1,13E-04 2,305292 CCNB3 Xp11 cyclin B3 1,59E-04 2,3049333 DYNC2H1 11q21-q22.1 dynein, cytoplasmic 2, heavy chain 1 5,62E-05 2,30398927 NA NA NA 9,52E-06 2,30355892 CATSPER2P1 15q15.3 cation channel, sperm associated 2 pseudogene 1 6,41E-05 2,30238644 minichromosome maintenance complex component 7 -> DNA MCM7 7q21.3-q22.1 2,33E-05 2,2999508 replication licensing factor MCM7 ASB15 7q31.31 ankyrin repeat and SOCS box-containing 15 6,41E-05 2,29789838 GLTPD1 1p36.33 glycolipid transfer protein domain containing 1 1,79E-05 2,29611357 MAST2 1p34.1 microtubule associated serine/threonine kinase 2 4,65E-06 2,29501725 EFHC2 Xp11.3 EF-hand domain (C-terminal) containing 2 1,91E-04 2,29432537 dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) -> DUS2L 16q22.1 4,91E-06 2,29413215 tRNA-dihydrouridine synthase 2-like MBTD1 17q21.33 mbt domain containing 1 3,24E-05 2,29240906 jumonji C domain containing histone demethylase 1 homolog D JHDM1D 7q34 1,78E-04 2,29232087 (S. cerevisiae) -> Histone lysine demethylase JHDM1D CCNA2 4q25-q31 cyclin A2 7,62E-05 2,29224619 TIMM9 -> Mitochondrial import inner membrane translocase TIMM9 14q23.1 8,99E-05 2,29113981 subunit Tim9 NA NA NA 2,82E-05 2,29056817 RNF182 6p23 ring finger protein 182 5,22E-05 2,29042369 NA NA NA 3,29E-04 2,28840833 157

GRIK5 19q13.2 glutamate receptor, ionotropic, kainate 5 3,94E-05 2,28753133 TMEM67 8q22.1 transmembrane protein 67 -> Meckelin 8,10E-05 2,28460223 NA NA NA 2,79E-05 2,28364912 APITD1 1p36.22 apoptosis-inducing, TAF9-like domain 1 6,31E-06 2,28287363 NA NA NA 2,36E-06 2,28218778 synovial sarcoma, X breakpoint 2 interacting protein -> Afadin- SSX2IP 1p22.3 3,55E-05 2,28173619 and alpha-actinin-binding protein TMF1 3p21-p12 TATA element modulatory factor 1 8,75E-05 2,27817725 GRB10 7p12-p11.2 growth factor receptor-bound protein 10 3,25E-04 2,27777225 FER1L6 --- fer-1-like 6 (C. elegans) 7,64E-05 2,27752438 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) MTHFD2L 4q13.3 2-like -> Probable bifunctional methylenetetrahydrofolate 7,24E-05 2,27717237 dehydrogenase/cyclohydrolase 2 ST7L 1p13.2 suppression of tumorigenicity 7 like 2,48E-04 2,27713765 HHLA2 3q13.13 HERV-H LTR-associating 2 4,13E-04 2,27576644 NUP93 16q13 nucleoporin 93kDa -> Nuclear pore complex protein Nup93 6,77E-05 2,27548567 LOC388333 17p13.1 hypothetical LOC388333 1,51E-05 2,27524752 IQCB1 3q13.33|3q21.1 IQ motif containing B1 1,01E-04 2,27512293 HMOX2 16p13.3 heme oxygenase (decycling) 2 5,00E-06 2,27444492 polymerase (DNA directed), gamma 2, accessory subunit -> DNA POLG2 17q 2,84E-06 2,27228296 polymerase subunit gamma-2, mitochondrial NA NA NA 8,49E-06 2,27200499 HJURP 2q37.1 Holliday junction recognition protein 3,80E-05 2,27175696 ZNF217 20q13.2 zinc finger protein 217 4,27E-04 2,27118464 NA NA NA 5,60E-05 2,2699602 EPHA10 1p34.3 EPH receptor A10 -> Ephrin type-A receptor 10 7,70E-06 2,26923497 primase, DNA, polypeptide 1 (49kDa) -> DNA primase small PRIM1 12q13 3,15E-04 2,26911857 subunit C4orf37 4q22.3-q23 chromosome 4 open reading frame 37 6,38E-05 2,26785201 NT5C3L 17q21.2 5'-nucleotidase, cytosolic III-like 1,84E-05 2,26768303 158

TSSK4 14q12 testis-specific serine kinase 4 2,04E-04 2,26562015 C18orf62 18q22.3 chromosome 18 open reading frame 62 9,64E-05 2,26297948 NA NA NA 1,31E-04 2,2626697 WEE1 11p15.3-p15.1 WEE1 homolog (S. pombe) 2,00E-04 2,26214828 ZNF479 7p11.2 zinc finger protein 479 2,64E-04 2,26161522 XRCC6 binding protein 1 -> Mitochondrial inner membrane XRCC6BP1 12q14.1 1,87E-05 2,26141614 protease ATP23 homolog NFYA 6p21.3 nuclear transcription factor Y, alpha 1,35E-05 2,26103841 LOC440570 1p36.13 LOC440570 1,80E-04 2,26036225 TUBA8 22q11.1 tubulin, alpha 8 1,05E-05 2,25977244 THOC4 17q25.3 THO complex 4 6,35E-06 2,25969726 DNAJC4 11q13 DnaJ (Hsp40) homolog, subfamily C, member 4 8,22E-06 2,25907395 DHFR 5q11.2-q13.2 dihydrofolate reductase 8,28E-05 2,25870131 SAGE1 Xq26 sarcoma antigen 1 4,68E-04 2,25851109 PSMA6 14q13 proteasome (prosome, macropain) subunit, alpha type, 6 4,53E-05 2,25815341 FLJ36000 17p11.2 hypothetical protein FLJ36000 1,14E-05 2,25807985 DSN1, MIND kinetochore complex component, homolog (S. DSN1 20q11.23 3,99E-05 2,25784352 cerevisiae) -> Kinetochore-associated protein DSN1 homolog Mdm1 nuclear protein homolog (mouse) -> Nuclear protein MDM1 12q15 1,21E-05 2,25773631 MDM1 RIMS1 6q12-q13 regulating synaptic membrane exocytosis 1 2,28E-05 2,25618521 KIAA1257 3q21.3 KIAA1257 1,80E-04 2,25520878 SSNA1 9q34.3 Sjogren syndrome nuclear autoantigen 1 2,97E-06 2,25281758 cystic fibrosis transmembrane conductance regulator (ATP- CFTR 7q31.2 8,99E-05 2,25150706 binding cassette sub-family C, member 7) C4orf36 4q21.3 chromosome 4 open reading frame 36 2,33E-04 2,2507183 CD163L1 12p13.3 CD163 molecule-like 1 2,95E-05 2,25059194 DNAJC21 5p13.2 DnaJ (Hsp40) homolog, subfamily C, member 21 2,84E-05 2,24976139 immunoglobulin mu binding protein 2 -> DNA-binding protein IGHMBP2 11q13.3 6,74E-06 2,24940899 SMUBP-2 159

PAQR9 3q23 progestin and adipoQ receptor family member IX 1,71E-05 2,24885556 hCG_1645220 2p21 hCG1645220 1,95E-05 2,2481472 LCP1 13q14.3 lymphocyte cytosolic protein 1 (L-plastin) -> Plastin-2 2,47E-05 2,2474118 DCDC2 6p22.1 doublecortin domain containing 2 2,24E-04 2,24656764 ADC 1p33-p34.3 arginine decarboxylase 2,10E-06 2,24550822 KLC1 14q32.33 chromosome 14 open reading frame 153 -> Kinesin light chain 1 4,59E-05 2,24526775 UIMC1 5q35.2 ubiquitin interaction motif containing 1 1,72E-05 2,24490828 NA NA NA 4,10E-06 2,24348028 ZNF646 16p11.2 zinc finger protein 646 5,24E-06 2,24311098 NA NA NA 2,58E-04 2,24305578 NA NA NA 3,52E-05 2,24098657 ZNF35 3p22-p21 zinc finger protein 35 4,21E-05 2,23994297 IL5 5q31.1 interleukin 5 (colony-stimulating factor, eosinophil) 7,00E-05 2,23941126 MSTO1 1q22 misato homolog 1 (Drosophila) 1,32E-05 2,23918853 LOC388882 22q11.23 hypothetical LOC388882 7,54E-05 2,23443333 ATG9A 2q35 ATG9 autophagy related 9 homolog A (S. cerevisiae) 7,99E-06 2,232834 HDGFL1 6p22.3 hepatoma derived growth factor-like 1 7,06E-06 2,23281388 WDR76 15q15.3 WD repeat domain 76 3,25E-04 2,23281079 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, NDUFAF1 15q11.2-q21.3 5,55E-05 2,23134254 assembly factor 1 solute carrier family 4 (anion exchanger), member 1, adaptor SLC4A1AP 2p23.2 2,45E-05 2,23128376 protein -> Kanadaptin G2E3 14q12 KIAA1333 -> G2/M-phase specific E3 ubiquitin ligase 3,74E-04 2,22981265 FLJ30851 2p23.3 hypothetical LOC653140 2,24E-06 2,22908403 LOC347411 Xp11.4 hypothetical LOC347411 1,35E-05 2,22789308 HIST1H2AB 6p21.3 histone cluster 1, H2ab -> Histone H2A type 1-B/E 1,24E-04 2,22640878 PACRG 6q26 PARK2 co-regulated -> Parkin coregulated gene protein 4,73E-05 2,22487842 LOC100133616 --- hypothetical protein LOC100133616 4,67E-05 2,22459468 LOC100133616 --- hypothetical protein LOC100133616 4,67E-05 2,22459468 160

family with sequence similarity 29, member A -> HAUS augmin- HAUS6 9p22.1 1,76E-04 2,22391169 like complex, subunit 6 NA NA NA 1,73E-05 2,22335374 PCGF6 10q24.33 polycomb group ring finger 6 1,41E-04 2,22319193 DHX57 2p22.1 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 9,97E-05 2,22236148 NA NA NA 5,33E-05 2,22228292 chromosome 15 open reading frame 51 -> UPF0621 protein C15orf51 15q26.3 1,11E-04 2,22147515 C15orf51 jumonji domain containing 1A -> Lysine (K)-specific demethylase KDM3A 2p11.2 2,29E-05 2,22101633 3A GFPT1 2p13 glutamine-fructose-6-phosphate transaminase 1 9,01E-06 2,21938122 cell division cycle 7 homolog (S. cerevisiae) -> Cell division cycle 7- CDC7 1p22 3,23E-05 2,21861525 related protein kinase makorin, ring finger protein, 1 -> E3 ubiquitin-protein ligase MKRN1 7q34 3,79E-06 2,21816856 makorin-1 LOC100130988 7p12.2 hypothetical protein LOC100130988 2,78E-04 2,21732462 GPN3 12q24.11 GPN-loop GTPase 3 1,02E-04 2,21610694 phosphodiesterase 6D, cGMP-specific, rod, delta -> Retinal rod PDE6D 2q35-q36 rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit 5,45E-05 2,21558627 delta CEP135 4q12 centrosomal protein 135kDa 1,64E-04 2,21360913 NA NA NA 5,29E-06 2,21289424 protein phosphatase 2 (formerly 2A), regulatory subunit B, beta PPP2R2B 5q31-q32 1,75E-04 2,21218954 isoform FXR1 3q28 fragile X mental retardation, autosomal homolog 1 1,08E-05 2,21070267 KIAA1257 3q21.3 KIAA1257 3,01E-05 2,2105617 HIPK4 19q13.2 homeodomain interacting protein kinase 4 4,48E-05 2,21047513 ZNF385D 3p24.3 zinc finger protein 385D 7,62E-05 2,21016028 C10orf92 10q26.3 chromosome 10 open reading frame 92 4,86E-05 2,2088761 ATL1 14q22.1 spastic paraplegia 3A (autosomal dominant) -> Atlastin-1 3,17E-04 2,20760568 RGPD1 2p11.2 RANBP2-like and GRIP domain containing 1 8,58E-05 2,20409896 161

RGPD1 2p11.2 RANBP2-like and GRIP domain containing 1 8,58E-05 2,20409896 ALMS1 2p13 Alstrom syndrome 1 1,08E-05 2,20325198 CXorf27 Xp21.1 chromosome X open reading frame 27 7,55E-05 2,20319471 chromosome 6 open reading frame 128 -> Transmembrane TMEM217 6p21.2 3,12E-06 2,20245188 protein 217 (TMEM217) membrane-associated ring finger (C3HC4) 8 -> E3 ubiquitin- MARCH8 10q11.21 1,87E-05 2,2024473 protein ligase MARCH8 TXLNB 6q24.1 taxilin beta 1,24E-04 2,20190618 CCDC90B 11q14.1 coiled-coil domain containing 90B 3,43E-05 2,2012027 NUP214 9q34.1 nucleoporin 214kDa -> Nuclear pore complex protein Nup214 1,22E-05 2,20092045 NA NA NA 1,70E-05 2,20042546 INTS8 8q22.1 integrator complex subunit 8 1,14E-04 2,19998929 DPEP3 16q22.1 dipeptidase 3 5,83E-05 2,19915608 NA NA NA 1,84E-05 2,19672154 FAM71E1 19q13.33 family with sequence similarity 71, member E1 8,97E-06 2,19615975 C9orf24 9p13.3 chromosome 9 open reading frame 24 2,71E-04 2,19553115 KIAA1841 2q14 KIAA1841 -> Uncharacterized protein KIAA1841 4,16E-04 2,19461063 ATPase, Cu++ transporting, beta polypeptide -> Copper- ATP7B 13q14.3 2,06E-04 2,1943452 transporting ATPase 2 WDR51A 3p21.1 WD repeat domain 51A 6,06E-06 2,19372624 LRGUK 7q33 leucine-rich repeats and guanylate kinase domain containing 3,22E-04 2,1924896 NA NA NA 8,37E-05 2,19246985 IFT172 2p23.3 intraflagellar transport 172 homolog (Chlamydomonas) 2,33E-05 2,1918423 ARL6 3q11.2 ADP-ribosylation factor-like 6 1,33E-04 2,18845012 DHFR 5q11.2-q13.2 dihydrofolate reductase 1,05E-04 2,18716491 WDR48 3p21.33 WD repeat domain 48 2,15E-05 2,18690796 CATSPER1 11q12.1 cation channel, sperm associated 1 3,03E-05 2,18517375 coiled-coil domain containing 59 -> Thyroid transcription factor 1- CCDC59 12q21.31 1,14E-04 2,18483677 associated protein 26 YBX1 1p34 Y box binding protein 1 -> Nuclease-sensitive element-binding 1,62E-06 2,1848345 162

protein 1 NA NA NA 2,02E-06 2,18439915 BPY2 Yq11 basic charge, Y-linked, 2 -> Testis-specific basic protein Y 2 3,48E-04 2,18399114 BPY2 Yq11 basic charge, Y-linked, 2 -> Testis-specific basic protein Y 2 3,48E-04 2,18399114 BPY2 Yq11 basic charge, Y-linked, 2 -> Testis-specific basic protein Y 2 3,48E-04 2,18399114 DOC2A 16p11.2 double C2-like domains, alpha 3,41E-04 2,1822895 FLJ36032 1q21.3 hypothetical protein FLJ36032 2,30E-05 2,18189398 acyl-CoA thioesterase 7-like -> Cytosolic acyl coenzyme A LOC344967 4p14 9,31E-06 2,18119084 thioester hydrolase-like BBS12 4q27 Bardet-Biedl syndrome 12 1,40E-04 2,18072069 erythrocyte membrane protein band 4.1 like 5 -> Band 4.1-like EPB41L5 2q14.2 1,81E-04 2,18042822 protein 5 PTDSS2 11p15 phosphatidylserine synthase 2 8,32E-06 2,17925573 NA NA NA 4,54E-05 2,17676852 OR7E19P 19p13.2 olfactory receptor, family 7, subfamily E, member 19 pseudogene 8,32E-05 2,17300275 NA NA NA 1,37E-05 2,17291614 LNP 2q31 KIAA1715 -> Protein lunapark 1,26E-04 2,17242896 BTB (POZ) domain containing 12 -> Structure-specific BTBD12 16p13.3 1,34E-05 2,17159114 endonuclease subunit SLX4 FBXL2 3p22.3 F-box and leucine-rich repeat protein 2 2,39E-05 2,17155727 LOC399744 10p11.21 hypothetical LOC399744 1,88E-05 2,17132397 TSKS 19q13.3 testis-specific kinase substrate 8,79E-05 2,17069646 THOC3 5q35.2 THO complex 3 1,96E-05 2,16750076 ZNF10 12q24.33 zinc finger protein 10 2,93E-04 2,1674309 G protein-coupled receptor 137 -> Integral membrane protein GPR137 11cen-q22.3 3,05E-06 2,16678048 GPR137 KATNB1 16q13 katanin p80 (WD repeat containing) subunit B 1 8,06E-06 2,16648238 CDC42EP3 2p21 CDC42 effector protein (Rho GTPase binding) 3 5,83E-06 2,16609347 LOC440570 1p36.13 LOC440570 2,11E-04 2,16602666 LOC440570 1p36.13 LOC440570 2,11E-04 2,16602666 163

SYT16 14q23.2 synaptotagmin XVI 4,08E-05 2,16600714 ARFGAP3 22q13.2-q13.3 ADP-ribosylation factor GTPase activating protein 3 9,76E-06 2,16525659 NA NA NA 2,60E-04 2,16461658 ZNF131 5p12-p11 zinc finger protein 131 8,15E-05 2,16289106 mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N- MGAT4C 12q21 acetylglucosaminyltransferase, isozyme C (putative) -> Alpha-1,3- 6,28E-05 2,16286032 mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C RPESP 8q21.11 RPE-spondin 2,92E-04 2,16278911 JTV1 gene -> Aminoacyl tRNA synthetase complex-interacting AIMP2 7p22 9,93E-06 2,16254252 multifunctional protein 2 chromosome 1 open reading frame 34 -> Tetratricopeptide TTC39A 1p32.3 1,78E-05 2,16030274 repeat domain 39A CIAPIN1 16q13-q21 cytokine induced apoptosis inhibitor 1 -> Anamorsin 4,93E-05 2,16027578 FLJ45445 19p13.3 hypothetical LOC399844 1,23E-04 2,16024509 GSTCD 4q24 glutathione S-transferase, C-terminal domain containing 2,60E-04 2,15771826 ADSS 1cen-q12 adenylosuccinate synthase 4,41E-05 2,15735635 C2orf67 2q34 chromosome 2 open reading frame 67 9,57E-05 2,15707076 DYNC2H1 11q21-q22.1 dynein, cytoplasmic 2, heavy chain 1 2,65E-04 2,15579501 COX10 homolog, cytochrome c oxidase assembly protein, heme COX10 17p12-p11.2 A: farnesyltransferase (yeast) -> Protoheme IX farnesyltransferase, 1,06E-05 2,15548795 mitochondrial C10orf55 10q22.2 chromosome 10 open reading frame 55 4,74E-04 2,15501364 HIST1H2BB 6p21.3 histone cluster 1, H2bb -> Histone H2B type 1-B 3,62E-05 2,15461186 C1orf88 1p13.2 chromosome 1 open reading frame 88 1,07E-05 2,15416312 STYXL1 7q11.23 serine/threonine/tyrosine interacting-like 1 1,11E-05 2,15398171 ZDHHC20 13q12.11 zinc finger, DHHC-type containing 20 1,16E-04 2,15383167 TBC1D12 10q23.33 TBC1 domain family, member 12 1,01E-05 2,15331219 ZSCAN29 15q15.3 zinc finger and SCAN domain containing 29 1,70E-05 2,1533107 DIXDC1 --- DIX domain containing 1 1,01E-05 2,15311518 MALL 2q13 mal, T-cell differentiation protein-like -> MAL-like protein 2,54E-05 2,15255187 164

SPATA12 3p14.3 spermatogenesis associated 12 1,04E-04 2,1522684 DZIP1 13q32.1 DAZ interacting protein 1 -> Zinc finger protein DZIP1 6,14E-05 2,15171052 HECT domain and ankyrin repeat containing, E3 ubiquitin protein HACE1 6q21 5,07E-05 2,15138839 ligase 1 - E3 ubiquitin-protein ligase UDP glycosyltransferase 8 (UDP-galactose ceramide UGT8 4q26 3,54E-04 2,14808935 galactosyltransferase) ATXN7L1 7q22.2 ataxin 7-like 1 2,13E-05 2,14687322 DHX30 3p21.31 DEAH (Asp-Glu-Ala-His) box polypeptide 30 5,52E-06 2,1466768 PIPSL 10q23.33 PIP5K1A and PSMD4-like 2,19E-05 2,1466768 mitochondrial ribosomal protein L47 -> 39S ribosomal protein MRPL47 3q26.33 2,39E-05 2,14618658 L47, mitochondrial PIK3CG 7q22.3 phosphoinositide-3-kinase, catalytic, gamma polypeptide 8,80E-06 2,14487564 CCNH 5q13.3-q14 cyclin H 1,56E-04 2,14455007 TRIM73 7q11.23 stromal antigen 3-like 3 -> Tripartite motif-containing 73 2,02E-05 2,14436352 STAG3L2 7q11.23 stromal antigen 3-like 2 -> STAG3-like protein 1,72E-05 2,14383965 STT3, subunit of the oligosaccharyltransferase complex, homolog STT3B 3p23 B (S. cerevisiae) -> Dolichyl-diphosphooligosaccharide--protein 1,72E-05 2,14381067 glycosyltransferase subunit STT3B BTBD16 10q26.13 BTB (POZ) domain containing 16 4,04E-04 2,14355064 KIAA0586 14q23.1 KIAA0586 4,06E-05 2,1423356 NA NA NA 1,02E-04 2,14158064 RCN2 15q23 reticulocalbin 2, EF-hand calcium binding domain 1,16E-04 2,14024507 COP9 constitutive photomorphogenic homolog subunit 3 COPS3 17p11.2 3,75E-05 2,13849673 (Arabidopsis) TOE1 --- target of EGR1, member 1 (nuclear) 1,33E-05 2,1337409 FAM27E2 9q12 family with sequence similarity 27, member E2 1,84E-04 2,13366917 KBTBD10 2q31.1 kelch repeat and BTB (POZ) domain containing 10 2,79E-04 2,13165727 SYNJ1 21q22.2 synaptojanin 1 1,57E-04 2,13095703 BBS9 7p14 Bardet-Biedl syndrome 9 -> Protein PTHB1 2,79E-05 2,12983697 ISG20L2 1q23.1 interferon stimulated exonuclease gene 20kDa-like 2 1,12E-05 2,12948269 165

CABLES2 20q13.33 Cdk5 and Abl enzyme substrate 2 1,42E-05 2,12821809 NBPF3 1p36.12 neuroblastoma breakpoint family, member 3 6,41E-05 2,12710389 CDRT1 17p12 CMT1A duplicated region transcript 1 1,68E-05 2,123374 NA NA NA 3,24E-06 2,12307671 NA NA NA 1,18E-04 2,12306935 NA NA NA 7,76E-05 2,12238738 GOLGA9P 15q11.2 golgi autoantigen, golgin subfamily a, 9 pseudogene 2,94E-04 2,12142621 RANBP1 22q11.21 RAN binding protein 1 -> Ran-specific GTPase-activating protein 2,20E-05 2,11983357 makorin, ring finger protein, 5 -> Makorin ring finger protein MKRNP6 12q21.32 3,31E-05 2,11979463 pseudogene 6 (MKRNP6) - Putative makorin-5 C9orf119 9q34.11 chromosome 9 open reading frame 119 3,85E-05 2,11929218 ZMYND15 17p13.2 zinc finger, MYND-type containing 15 1,59E-04 2,11856883 NA NA NA 6,73E-05 2,11686241 asparagine-linked glycosylation 8 homolog (S. cerevisiae, alpha- ALG8 11q14.1 1,3-glucosyltransferase) -> Probable dolichyl pyrophosphate 1,73E-05 2,11518522 Glc1Man9GlcNAc2 alpha-1,3-glucosyltransferase BIRC5 17q25 baculoviral IAP repeat-containing 5 (survivin) 3,90E-06 2,11490154 TMEM57 1p36.11 transmembrane protein 57 -> Macoilin 3,44E-05 2,11443249 glutamic-oxaloacetic transaminase 1, soluble (aspartate GOT1 10q24.1-q25.1 2,72E-05 2,11398699 aminotransferase 1) -> Aspartate aminotransferase, cytoplasmic LPIN1 2p25.1 lipin 1 -> Phosphatidate phosphatase LPIN1 4,82E-05 2,11392618 PAF 15q22.31 KIAA0101 -> PCNA-associated factor 5,32E-05 2,11340022 NA NA NA 1,13E-05 2,11234283 ATXN7L1 7q22.2 ataxin 7-like 1 3,01E-05 2,11146012 EXOSC8 13q13.1 exosome component 8 -> Exosome complex exonuclease RRP43 1,63E-04 2,11103939 SPEM1 17p13.1 spermatid maturation 1 2,02E-04 2,11031008 NUP35 2q32.1 nucleoporin 35kDa -> Nucleoporin NUP53 1,83E-04 2,10746402 TBC1D1 4p14 TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 1,30E-04 2,10493546 TMEM120A 7q11.23 transmembrane protein 120A 1,75E-04 2,10476622 SPANXD Xq27.1 SPANX family, member E -> Sperm protein associated with the 7,30E-05 2,10386116 166

nucleus on the X chromosome D TUBE1 6q21 tubulin, epsilon 1 6,28E-05 2,10283915 ATG3 3q13.2 ATG3 autophagy related 3 homolog (S. cerevisiae) 1,05E-04 2,10254183 CEP170 1q44 centrosomal protein 170kDa 5,37E-05 2,10229117 BUD13 11q23.3 BUD13 homolog (S. cerevisiae) 3,22E-05 2,10192982 TIMP2 17q25 TIMP metallopeptidase inhibitor 2 1,33E-04 2,10178777 chromosome 2 open reading frame 65 -> Uncharacterized protein C2orf65 2p13.1 1,72E-04 2,09940063 C2orf65 KIAA1529 9q22.33 KIAA1529 -> Uncharacterized protein KIAA1529 9,93E-06 2,09836987 TRIM73 7q11.23 stromal antigen 3-like 3 -> Tripartite motif-containing 73 2,23E-05 2,09811826 C18orf21 18q12.2 chromosome 18 open reading frame 21 4,93E-05 2,09780561 MUC19 12q12 mucin 19, oligomeric 7,55E-05 2,09608686 CCDC92 12q24.31 coiled-coil domain containing 92 3,08E-05 2,09527775 SPANX family, member N4 -> Sperm protein associated with the SPANXN4 Xq27.3 1,07E-04 2,0945459 nucleus on the X chromosome N4 WDR88 19q13.11 WD repeat domain 88 4,91E-05 2,0944225 ATXN2L 16p11 ataxin 2-like 4,83E-06 2,09376279 abhydrolase domain containing 5 -> 1-acylglycerol-3-phosphate ABHD5 3p21 1,39E-04 2,09335864 O-acyltransferase ABHD5 HAS2 8q24.12 hyaluronan synthase 2 1,03E-04 2,09289147 POLH 6p21.1 polymerase (DNA directed), eta 7,93E-06 2,09158989 NA NA NA 3,73E-05 2,09045284 C21orf81 21q11.2 chromosome 21 open reading frame 81 3,34E-05 2,09029491 thyroid hormone receptor interactor 12 -> Probable E3 ubiquitin- TRIP12 2q36.3 2,14E-05 2,08877776 protein ligase TRIP12 TCP10 6q27 t-complex 10 homolog (mouse) 1,27E-05 2,08843827 GOLGA9P 15q11.2 golgi autoantigen, golgin subfamily a, 9 pseudogene 3,19E-04 2,0870787 FAM7A1 15q13.3 family with sequence similarity 7, member A1 2,42E-04 2,08655435 UTP18, small subunit (SSU) processome component, homolog UTP18 17q21.33 1,16E-04 2,08635477 (yeast) -> U3 small nucleolar RNA-associated protein 18 homolog 167

CD109 6q13 CD109 molecule -> CD109 antigen 2,95E-04 2,08577205 THAP9 4q21.22 THAP domain containing 9 7,86E-05 2,08513313 PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae) RDH14 12q13.2-q13.3 5,32E-05 2,08501462 -> Retinol dehydrogenase 14 C7orf34 7q34 chromosome 7 open reading frame 34 1,04E-04 2,08454859 UBE2S 19q13.43 ubiquitin-conjugating enzyme E2S 3,84E-06 2,08413611 LOC90379 19p13.12 hypothetical protein BC002926 3,67E-05 2,08360239 chromosome 20 open reading frame 91 -> Family with sequence FAM182A 20p11.1 1,50E-05 2,08298724 similarity 182, member A (FAM182A) LIAS 4p14 lipoic acid synthetase -> Lipoyl synthase, mitochondrial 1,42E-04 2,08280533 EXOC5 14q23.1 exocyst complex component 5 2,77E-05 2,08231741 chromosome 21 open reading frame 57 -> Putative C21orf57 21q22.3 5,30E-05 2,08220917 metalloprotease C21orf57 3-oxoacid CoA transferase 1 -> Succinyl-CoA:3-ketoacid-coenzyme OXCT1 5p13.1 4,12E-04 2,08206124 A transferase 1, mitochondrial BRCA1 associated protein-1 (ubiquitin carboxy-terminal BAP1 3p21.31-p21.2 7,93E-06 2,08119984 hydrolase) ORC2L 2q33 origin recognition complex, subunit 2-like (yeast) 2,24E-04 2,08037701 phosphatase, orphan 1 -> Phosphoethanolamine/phosphocholine PHOSPHO1 17q21.32 2,29E-04 2,07998338 phosphatase translocated promoter region (to activated MET oncogene) -> TPR 1q25 4,35E-05 2,07937217 Nucleoprotein TPR ACBD7 10p13 acyl-Coenzyme A binding domain containing 7 7,91E-05 2,07854142 ARPM1 3q26.2 actin related protein M1 2,53E-04 2,07770669 NA NA NA 3,94E-05 2,07711199 TSPYL6 2p16.2 TSPY-like 6 1,59E-04 2,07624544 EIF4G3 1p36.12 eukaryotic translation initiation factor 4 gamma, 3 5,00E-06 2,07591446 NA NA NA 9,67E-05 2,07566339 CCDC74A 2q21.1 coiled-coil domain containing 74A 1,21E-05 2,07491969 SAAL1 11p15.1 serum amyloid A-like 1 5,63E-05 2,07466299 168

LRRC7 1p31.1 leucine rich repeat containing 7 1,36E-05 2,07375578 GJC1 17q21.31 gap junction protein, gamma 1, 45kDa 3,30E-04 2,07184417 NLR family, pyrin domain containing 7 -> NACHT, LRR and PYD NLRP7 19q13.42 3,10E-04 2,07139832 domains-containing protein 7 ZNF259 11q23.3 zinc finger protein 259 8,04E-06 2,07077313 GOLGA9P 15q11.2 golgi autoantigen, golgin subfamily a, 9 pseudogene 2,96E-04 2,06853519 HYOU1 11q23.1-q23.3 hypoxia up-regulated 1 1,54E-05 2,0684592 IGF2BP3 7p11 insulin-like growth factor 2 mRNA binding protein 3 4,59E-05 2,06732183 AHNAK2 14q32.33 AHNAK nucleoprotein 2 8,62E-05 2,06666851 NA NA NA 4,59E-05 2,06640638 PASK 2q37.3 PAS domain containing serine/threonine kinase 5,91E-05 2,06567316 DYNC1LI1 3p22.3 dynein, cytoplasmic 1, light intermediate chain 1 1,91E-04 2,06531165 NA NA NA 3,34E-04 2,06518139 CPEB3 10q23.32 cytoplasmic polyadenylation element binding protein 3 5,94E-05 2,06396857 KIFC1 6p21.3 kinesin family member C1 8,01E-05 2,06191377 BBS5 2q31.1 Bardet-Biedl syndrome 5 8,56E-05 2,06147291 ARID2 12q12 AT rich interactive domain 2 (ARID, RFX-like) 2,03E-05 2,06141218 DNAH6 --- dynein, axonemal, heavy chain 6 1,54E-04 2,06105571 C6orf130 6p21.1 chromosome 6 open reading frame 130 7,55E-05 2,05866203 ERI2 16p12.2 exonuclease domain containing 1 -> ERI1 exoribonuclease 2 1,31E-04 2,05787165 MFAP3L 4q32.3 microfibrillar-associated protein 3-like 4,87E-04 2,05773828 VDAC3 8p11.2 voltage-dependent anion channel 3 4,12E-05 2,05772116 FAM27E3 9q12 family with sequence similarity 27, member E3 1,67E-04 2,05768622 POMT1 9q34.1 protein-O-mannosyltransferase 1 8,77E-06 2,05682065 NA NA NA 1,55E-04 2,05542325 C9orf9 9q34 chromosome 9 open reading frame 9 2,94E-05 2,05431726 LOC90835 16p11.2 hypothetical protein LOC90835 4,01E-05 2,05316347 FBXO45 3q29 F-box protein 45 -> F-box/SPRY domain-containing protein 1 8,44E-05 2,0529429 TFDP1 13q34 transcription factor Dp-1 1,70E-05 2,05209213 169

FLJ13305 2p15 hypothetical protein FLJ13305 1,25E-04 2,05152253 BCL2-associated athanogene 5 -> BAG family molecular BAG5 14q32.33 2,02E-04 2,05012233 chaperone regulator 5 DNMT1 19p13.2 DNA (cytosine-5-)-methyltransferase 1 1,95E-05 2,04987509 C1orf150 1q44 chromosome 1 open reading frame 150 1,93E-04 2,04893611 RP1-127L4.6 22q12.3 hypothetical protein LOC150297 5,66E-05 2,04673596 SLCO3A1 15q26 solute carrier organic anion transporter family, member 3A1 8,08E-06 2,04553823 PCNA 20pter-p12 proliferating cell nuclear antigen 4,36E-05 2,04538936 chromosome 20 open reading frame 19 -> Centrosomal protein PLK1S1 20pter-q11.23 2,55E-04 2,04482092 kizuna tubulin tyrosine ligase-like family, member 4 -> Tubulin TTLL4 2p24.3-p24.1 2,20E-05 2,04460053 polyglutamylase TTLL4 Wolf-Hirschhorn syndrome candidate 1 -> Probable histone-lysine WHSC1 4p16.3 1,24E-05 2,04424626 N-methyltransferase NSD2 cylindromatosis (turban tumor syndrome) -> Probable ubiquitin CYLD 16q12.1 5,27E-06 2,04418108 carboxyl-terminal hydrolase BRD1 22q13.33 bromodomain containing 1 5,17E-06 2,04366326 ZDHHC3 3p21.31 zinc finger, DHHC-type containing 3 1,74E-05 2,04342034 NA NA NA 1,27E-04 2,04147302 C19orf44 19p13.11 chromosome 19 open reading frame 44 3,46E-05 2,04027412 IFT140 16p13.3 intraflagellar transport 140 homolog (Chlamydomonas) 1,26E-05 2,03999201 NA NA NA 8,20E-05 2,03973821 ZDHHC19 3q29 zinc finger, DHHC-type containing 19 1,16E-04 2,03509057 TRAFD1 12q TRAF-type zinc finger domain containing 1 7,90E-05 2,03468294 NA NA NA 1,50E-04 2,03418656 diazepam binding inhibitor (GABA receptor modulator) -> Acyl- DBI 2q12-q21 1,66E-05 2,03394406 CoA-binding protein Ras association (RalGDS/AF-6) domain family (N-terminal) RASSF8 12p12.3 2,02E-05 2,03371568 member 8 NA NA NA 2,79E-05 2,03368537 170

NA NA NA 6,62E-05 2,03329635 FAM27E1 9p11.2 family with sequence similarity 27, member E1 1,71E-04 2,03290247 AP4M1 7q22.1 adaptor-related protein complex 4, mu 1 subunit 7,64E-06 2,03221917 ZNF705A 12p13.31 zinc finger protein 705A 1,07E-04 2,03004611 SFRS14 19p12 splicing factor, arginine/serine-rich 14 3,18E-05 2,02978933 RAGE 14q32 renal tumor antigen -> MAPK/MAK/MRK overlapping kinase 5,59E-05 2,0297021 DKFZp667G2110 3q11.2 hypothetical protein DKFZp667G2110 2,50E-04 2,02890456 chromosome X open reading frame 61 -> Kita-kyushu lung cancer KKLC1 Xq23 2,82E-04 2,02789788 antigen 1 centaurin, gamma-like family, member 3 -> Poly (ADP-ribose) PARG 10q11.23 4,61E-05 2,02757742 glycohydrolase USP6NL 10p13 USP6 N-terminal like 1,29E-05 2,02646885 CSNK2B 6p21-p12|6p21.3 casein kinase 2, beta polypeptide 5,67E-06 2,02629468 Williams Beuren syndrome chromosome region 19 -> Speedy SPDYE1 7p13 3,91E-05 2,02571961 protein E1 centaurin, gamma-like family, member 3 -> Poly (ADP-ribose) PARG 10q11.23 5,93E-05 2,02475942 glycohydrolase NA NA NA 2,30E-05 2,02406974 G protein-coupled receptor kinase interactor 1 -> ARF GTPase- GIT1 17p11.2 4,53E-05 2,02398837 activating protein GIT1 protein kinase, membrane associated tyrosine/threonine 1 -> PKMYT1 16p13.3 Membrane-associated tyrosine- and threonine-specific cdc2- 1,39E-05 2,02246817 inhibitory kinase ADAT1 16q23.1 adenosine deaminase, tRNA-specific 1 1,67E-05 2,02176246 DCLK3 3p22.2 doublecortin-like kinase 3 3,00E-04 2,01942351 BAZ1A 14q12-q13 bromodomain adjacent to zinc finger domain, 1A 6,85E-05 2,01830401 C12orf10 12q13 chromosome 12 open reading frame 10 7,26E-06 2,01807459 NA NA NA 4,05E-05 2,0172117 MBD1 18q21 methyl-CpG binding domain protein 1 1,07E-05 2,01592714 mitochondrial ribosomal protein L39 -> 39S ribosomal protein MRPL39 21q21.3 1,60E-05 2,01591876 L39, mitochondrial 171

C14orf79 14q32.33 chromosome 14 open reading frame 79 3,26E-05 2,0129286 ZNF608 5q23.2 zinc finger protein 608 5,54E-05 2,010726 CYTSA 22q11.23 SPECC1-like -> Cytospin A 2,99E-05 2,00982794 ZNF354A 5q35.3 zinc finger protein 354A 1,76E-04 2,00938847 CCDC86 11q12.2 coiled-coil domain containing 86 2,36E-05 2,0084207 DBX2 12q12 developing brain homeobox 2 4,61E-05 2,00818614 MGC4172 17q12 short-chain dehydrogenase/reductase 2,46E-05 2,00805252 DNAJC18 5q31.2 DnaJ (Hsp40) homolog, subfamily C, member 18 1,41E-04 2,0074708 potassium channel modulatory factor 1 -> E3 ubiquitin-protein KCMF1 2p11.2 2,91E-05 2,00635097 ligase KCMF1 antigen identified by monoclonal antibody Ki-67 -> MKI67 FHA MKI67 10q25-qter 3,83E-04 2,00625849 domain-interacting nucleolar phosphoprotein STBD1 4q24-q25 starch binding domain 1 2,24E-04 2,00518382 UBXN11 1p36.11 UBX domain containing 5 -> UBX domain protein 11 4,24E-05 2,00475926 TAPT1 4p15.32 transmembrane anterior posterior transformation 1 1,77E-04 2,00435701 REC8 homolog (yeast) -> Meiotic recombination protein REC8 REC8 14q11.2-q12 5,49E-06 2,00357845 homolog CCDC74A 2q21.1 coiled-coil domain containing 74A 1,87E-05 2,00328891 centaurin, gamma-like family, member 3 -> Poly (ADP-ribose) PARG 10q11.23 6,39E-05 2,00293486 glycohydrolase C8orf41 8p12 chromosome 8 open reading frame 41 1,57E-05 2,00218114 SETD3 14q32.2 SET domain containing 3 5,60E-05 2,00099214 ANKRD36B 2q11.2 ankyrin repeat domain 36B 3,64E-04 2,00088604 PIR Xp22.2 pirin (iron-binding nuclear protein) 4,00E-05 0,49982726 MFGE8 15q25 milk fat globule-EGF factor 8 protein 7,64E-05 0,49955987 SYNPO2 4q26 synaptopodin 2 2,08E-05 0,49951174 NGFRAP1 Xq22.2 nerve growth factor receptor (TNFRSF16) associated protein 1 2,06E-05 0,49945012 solute carrier family 24 (sodium/potassium/calcium exchanger), SLC24A3 20p13 1,12E-05 0,49938746 member 3 -> Sodium/potassium/calcium exchanger 3 TMSB4X Xq21.3-q22 thymosin beta 4, X-linked 2,95E-05 0,49894286 172

AOX1 2q33 aldehyde oxidase 1 3,41E-04 0,49877757 IGF2 11p15.5 insulin-like growth factor 2 (somatomedin A) 1,14E-04 0,49839638 CD34 1q32 CD34 molecule 2,95E-05 0,49817758 NA NA NA 4,67E-04 0,49816912 HS6ST2 Xq26.2 heparan sulfate 6-O-sulfotransferase 2 5,63E-05 0,49816653 PRKG1 10q11.2 protein kinase, cGMP-dependent, type I 7,62E-05 0,49799374 PAK3 Xq22.3-q23 p21 (CDKN1A)-activated kinase 3 8,74E-06 0,49761263 FKBP9 7p11.1 FK506 binding protein 9, 63 kDa 6,75E-05 0,49747864 ZFP36L1 14q22-q24 zinc finger protein 36, C3H type-like 1 5,10E-05 0,49747278 LGALS3BP 17q25 lectin, galactoside-binding, soluble, 3 binding protein 5,82E-05 0,49740675 PDE8B 5q14.1 phosphodiesterase 8B 1,55E-04 0,49719097 SMAD3 15q22.33 SMAD family member 3 3,04E-04 0,49714755 aldehyde dehydrogenase 1 family, member B1 -> Aldehyde ALDH1B1 9p11.1 3,95E-05 0,49709862 dehydrogenase X, mitochondrial CPNE3 8q21.3 copine III 2,14E-05 0,49689537 solute carrier family 24 (sodium/potassium/calcium exchanger), SLC24A6 12q24.13 1,25E-04 0,49629575 member 6 -> Sodium/potassium/calcium exchanger 6 NA NA NA 2,10E-04 0,49624157 PRKACB 1p36.1 protein kinase, cAMP-dependent, catalytic, beta 2,23E-06 0,49606274 MR1 1q25.3 major histocompatibility complex, class I-related 1,06E-04 0,4958649 ATP11A 13q34 ATPase, class VI, type 11A 3,21E-05 0,49573877 LRP4 11p11.2-p12 low density lipoprotein receptor-related protein 4 1,37E-04 0,49564068 GBP4 1p22.2 guanylate binding protein 4 2,02E-04 0,49560804 TRIM38 6p21.3 tripartite motif-containing 38 4,85E-05 0,49553247 NA NA NA 7,54E-05 0,49541828 NA NA NA 3,29E-04 0,4952921 solute carrier family 9 (sodium/hydrogen exchanger), member 9 - SLC9A9 3q24 1,40E-04 0,49498561 > Sodium/hydrogen exchanger 9 NA NA NA 6,16E-05 0,49457373 CITED2 6q23.3 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy- 2,01E-05 0,4945619 173

terminal domain, 2 PCYOX1 2p13.3 prenylcysteine oxidase 1 6,41E-05 0,49455607 runt-related transcription factor 1; translocated to, 1 (cyclin D- RUNX1T1 8q22 4,64E-05 0,49454442 related) family with sequence similarity 130, member A2 -> Cysteine- CSRNP3 2q24.3 1,09E-05 0,49423977 serine-rich nuclear protein 3 (CSRNP3) CAMKK2 12q24.2 calcium/calmodulin-dependent protein kinase kinase 2, beta 9,10E-06 0,49409094 RNF150 4q31.21 ring finger protein 150 7,02E-06 0,4937212 SAMD9L 7q21.2-q21.3 sterile alpha motif domain containing 9-like 2,54E-04 0,49339876 FAM113B 12q13.11 family with sequence similarity 113, member B 3,51E-05 0,49311875 F10 13q34 coagulation factor X 1,07E-05 0,49304202 SEC14L4 22q12.2 SEC14-like 4 (S. cerevisiae) 2,06E-04 0,4924776 chromosome 1 open reading frame 32 -> Immunoglobulin-like ILDR2 1q24.1 1,15E-04 0,49223631 domain containing receptor 2 (ILDR2) PHKA1 Xq12-q13 phosphorylase kinase, alpha 1 (muscle) 2,57E-05 0,49198833 NA NA NA 2,26E-05 0,49196736 NA NA NA 4,62E-05 0,49185688 FAM46A 6q14 family with sequence similarity 46, member A 3,00E-05 0,49168764 LRIG3 12q14.1 leucine-rich repeats and immunoglobulin-like domains 3 2,62E-05 0,49159785 NA NA NA 1,14E-04 0,49109243 VCL 10q22.1-q23 vinculin 2,64E-05 0,49095425 KLF12 13q22 Kruppel-like factor 12 5,01E-05 0,49093775 KLF8 Xp11.21 Kruppel-like factor 8 1,79E-04 0,49091869 PLXDC2 10p12.32-p12.31 plexin domain containing 2 3,78E-05 0,4908389 PORCN Xp11.23 porcupine homolog (Drosophila) 8,80E-06 0,4902522 GPR124 8p12 G protein-coupled receptor 124 4,95E-06 0,4895279 EIF2AK2 2p22-p21 eukaryotic translation initiation factor 2-alpha kinase 2 3,31E-05 0,48932283 LOC284033 17p12 hypothetical LOC284033 2,00E-04 0,48920617 AHNAK nucleoprotein -> Neuroblast differentiation-associated AHNAK 11q12.2 1,09E-05 0,48819976 protein AHNAK 174

TRERF1 6p21.1-p12.1 transcriptional regulating factor 1 1,64E-04 0,48812075 GPR155 2q31.1 G protein-coupled receptor 155 5,60E-05 0,48789902 ARHGAP1 11p12-q12 Rho GTPase activating protein 1 5,20E-05 0,4878718 NA NA NA 3,04E-04 0,48781009 BHMT2 5q13 betaine-homocysteine methyltransferase 2 1,79E-05 0,4877871 USP9Y Yq11.2 ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila) 1,07E-05 0,48762078 NA NA NA 2,45E-04 0,4872981 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N- OGT Xq13 1,60E-05 0,48658407 acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) TBC1D8B Xq22.3 TBC1 domain family, member 8B (with GRAM domain) 2,93E-04 0,48651173 GPRASP1 Xq22.1 G protein-coupled receptor associated sorting protein 1 4,42E-06 0,48623124 FAT1 4q35 FAT tumor suppressor homolog 1 (Drosophila) 4,19E-05 0,48612037 OBSL1 2q35 obscurin-like 1 5,24E-06 0,4858423 CX3CR1 3p21|3p21.3 chemokine (C-X3-C motif) receptor 1 3,98E-04 0,4855797 MMP15 16q13-q21 matrix metallopeptidase 15 (membrane-inserted) 4,59E-05 0,48509123 SCARA5 8p21.1 scavenger receptor class A, member 5 (putative) 3,95E-05 0,48502399 IGSF1 Xq25 immunoglobulin superfamily, member 1 1,22E-04 0,48501323 NTRK2 9q22.1 neurotrophic tyrosine kinase, receptor, type 2 1,82E-04 0,48492028 NR2F2 15q26 nuclear receptor subfamily 2, group F, member 2 2,74E-05 0,48491121 TET1 10q21 tet oncogene 1 1,47E-05 0,48441771 INSR 19p13.3-p13.2 insulin receptor 4,53E-05 0,48431161 MGST2 4q28.3 microsomal glutathione S-transferase 2 1,27E-05 0,48422551 ATPase, class I, type 8B, member 2 -> Probable phospholipid- ATP8B2 1q21.3 1,36E-05 0,48421796 transporting ATPase ID ACSS3 12q21.31 acyl-CoA synthetase short-chain family member 3 1,53E-05 0,48413473 NA NA NA 1,38E-04 0,48411711 PCDH18 4q31 protocadherin 18 6,47E-05 0,48407064 PCOLCE 7q22 procollagen C-endopeptidase enhancer 1,89E-05 0,48275982 COL12A1 6q12-q13 collagen, type XII, alpha 1 1,47E-05 0,48258334 175

solute carrier family 1 (glial high affinity glutamate transporter), SLC1A3 5p13 3,66E-04 0,48241779 member 3 -> Excitatory amino acid transporter 1 melanoma antigen family D, 2 -> Melanoma-associated antigen MAGED2 Xp11.2 9,15E-05 0,48240391 D2 ZEB2 2q22 zinc finger E-box binding homeobox 2 1,84E-05 0,4822802 ANO6 12q12 transmembrane protein 16F -> Anoctamin 6 (ANO6) 2,63E-05 0,48117664 PID1 2q36.3 phosphotyrosine interaction domain containing 1 6,24E-06 0,48101207 ABCA8 17q24 ATP-binding cassette, sub-family A (ABC1), member 8 3,99E-05 0,48099207 PRRX1 1q24 paired related homeobox 1 3,87E-06 0,4809749 mir199a2Stemloop NA MI0000281 Homo sapiens miR-199a-2 stem-loop 3,25E-04 0,48092556 FHL2 2q12-q14 four and a half LIM domains 2 2,19E-05 0,48060331 AXL receptor tyrosine kinase -> Tyrosine-protein kinase receptor AXL 19q13.1 1,27E-05 0,48047125 UFO MATN2 8q22 matrilin 2 7,29E-05 0,48031591 REPS2 Xp22.2 RALBP1 associated Eps domain containing 2 7,14E-05 0,48023285 TMSB4X Xq21.3-q22 thymosin beta 4, X-linked 2,65E-05 0,48004565 DTNA 18q12 dystrobrevin, alpha 1,02E-04 0,48003533 MSX2 5q34-q35 msh homeobox 2 1,61E-04 0,47999324 SC4MOL 4q32-q34 sterol-C4-methyl oxidase-like 4,58E-04 0,47990858 RGS2 1q31 regulator of G-protein signaling 2, 24kDa 3,32E-05 0,47956258 HSD11B2 16q22 hydroxysteroid (11-beta) dehydrogenase 2 1,10E-04 0,47919242 ACSF2 17q21.33 acyl-CoA synthetase family member 2 1,31E-04 0,47912782 basic helix-loop-helix domain containing, class B, 3 -> Class E basic BHLHE41 12p11.23-p12.1 6,80E-05 0,47904099 helix-loop-helix protein 41 PTCH2 1p33-p34 patched homolog 2 (Drosophila) 2,99E-04 0,4790106 transmembrane protein with EGF-like and two follistatin-like TMEFF2 2q32.3 5,05E-06 0,47892611 domains 2 NR5A1 9q33 nuclear receptor subfamily 5, group A, member 1 6,94E-05 0,47868616 SPARCL1 4q22.1 SPARC-like 1 (mast9, hevin) 3,27E-05 0,47849973 MAGED1 Xp11.23 melanoma antigen family D, 1 -> Melanoma-associated antigen 2,50E-05 0,47831883 176

D1 NA NA NA 1,96E-05 0,47829728 PRKAR2B 7q22 protein kinase, cAMP-dependent, regulatory, type II, beta 1,38E-05 0,47821656 NA NA NA 2,53E-05 0,47786963 tissue factor pathway inhibitor (lipoprotein-associated TFPI 2q32 1,78E-05 0,47771083 coagulation inhibitor) MGC16121 Xq26.3 hypothetical protein MGC16121 4,24E-05 0,47746173 NA NA NA 3,19E-04 0,4772804 HLA-DPB1 6p21.3 major histocompatibility complex, class II, DP beta 1 3,61E-04 0,47706178 CYP1B1 2p21 cytochrome P450, family 1, subfamily B, polypeptide 1 1,01E-04 0,47703797 CLIP3 19q13.12 CAP-GLY domain containing linker protein 3 1,95E-05 0,47679698 TLL1 4q32-q33 tolloid-like 1 2,80E-05 0,4766795 solute carrier family 44, member 1 -> Choline transporter-like SLC44A1 9q31.2 2,82E-04 0,476407 protein 1 PLEK2 14q23.3 pleckstrin 2 3,21E-05 0,47622046 SMOC2 6q27 SPARC related modular calcium binding 2 4,08E-05 0,47605907 integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen ITGAV 2q31-q32 2,82E-05 0,47595877 CD51) OPHN1 Xq12 oligophrenin 1 1,50E-05 0,47576696 LAMP2 Xq24 lysosomal-associated membrane protein 2 8,94E-05 0,47559947 GLO1 6p21.3-p21.1 glyoxalase I 4,41E-05 0,47535855 ITGB5 3q21.2 integrin, beta 5 8,26E-06 0,47500151 SDPR 2q32-q33 serum deprivation response (phosphatidylserine binding protein) 3,23E-05 0,47463898 adenylate cyclase activating polypeptide 1 (pituitary) receptor ADCYAP1R1 7p14 1,01E-05 0,47455279 type I ITGA8 10p13 integrin, alpha 8 8,48E-06 0,47392954 DET1 15q25.3 de-etiolated homolog 1 (Arabidopsis) 3,19E-05 0,47372657 LASS4 19p13.2 LAG1 homolog, ceramide synthase 4 3,62E-05 0,47372394 PLLP 16q13 plasma membrane proteolipid (plasmolipin) 4,42E-05 0,47372296 KDM4A 1p34.1 jumonji domain containing 2A -> Lysine (K)-specific demethylase 4,98E-06 0,47358901 177

4A (KDM4A) TFE3 Xp11.22 transcription factor binding to IGHM enhancer 3 1,13E-05 0,47320673 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 -> Rho ARHGEF6 Xq26 1,17E-05 0,47283722 guanine nucleotide exchange factor 6 LGALS1 22q13.1 lectin, galactoside-binding, soluble, 1 (galectin 1) 1,46E-04 0,4726334 KIAA1804 1q42 mixed lineage kinase 4 1,52E-04 0,47247241 NA NA NA 2,88E-04 0,4722298 PDE5A 4q25-q27 phosphodiesterase 5A, cGMP-specific 2,36E-05 0,47158149 LONRF2 2q11.2 LON peptidase N-terminal domain and ring finger 2 4,28E-06 0,47143556 COL1A1 17q21.33 collagen, type I, alpha 1 2,29E-04 0,47136907 ITPR3 6p21 inositol 1,4,5-triphosphate receptor, type 3 6,41E-05 0,47131467 MSI2 17q22 musashi homolog 2 (Drosophila) 4,36E-06 0,47100099 CAMKK1 17p13.2 calcium/calmodulin-dependent protein kinase kinase 1, alpha 9,96E-06 0,47096165 LDB2 4p16 LIM domain binding 2 4,10E-06 0,470961 VGLL3 3p12.1 vestigial like 3 (Drosophila) 1,53E-05 0,47071688 alpha thalassemia/mental retardation syndrome X-linked (RAD54 ATRX Xq13.1-q21.1 3,70E-06 0,47070171 homolog, S. cerevisiae) -> Transcriptional regulator ATRX NSBP1 Xq13.3 nucleosomal binding protein 1 9,42E-05 0,46980452 RNF213 17q25.3 ring finger protein 213 2,47E-05 0,46976561 IGF1R 15q26.3 insulin-like growth factor 1 receptor 2,34E-05 0,46946304 LAMA1 18p11.31 laminin, alpha 1 1,19E-05 0,46939585 SFXN1 --- sideroflexin 1 4,55E-05 0,46926459 GRB14 2q22-q24 growth factor receptor-bound protein 14 1,62E-04 0,46853558 MID1 interacting protein 1 (gastrulation specific G12 homolog MID1IP1 Xp11.4 7,76E-05 0,46840131 (zebrafish)) GPNMB 7p15 glycoprotein (transmembrane) nmb 3,01E-04 0,46787028 MAMLD1 Xq28 mastermind-like domain containing 1 4,48E-05 0,46773053 TMSB4X Xq21.3-q22 thymosin beta 4, X-linked 5,28E-05 0,46748647 COL6A1 21q22.3 collagen, type VI, alpha 1 1,68E-05 0,46716011 ECE1 1p36.1 endothelin converting enzyme 1 6,91E-06 0,46698156 178

ARHGEF9 Xq11.1 Cdc42 guanine nucleotide exchange factor (GEF) 9 7,74E-06 0,46640172 NA NA NA 7,53E-05 0,46620536 PHACTR2 6q24.2 phosphatase and actin regulator 2 2,31E-06 0,4653298 LSAMP 3q13.2-q21 limbic system-associated membrane protein 3,00E-06 0,46515566 DFNA5 7p15 deafness, autosomal dominant 5 1,70E-04 0,46495258 NA NA NA 1,12E-05 0,46487138 RASSF2 20pter-p12.1 Ras association (RalGDS/AF-6) domain family member 2 1,03E-04 0,46464153 NOTCH2 1p13-p11 Notch homolog 2 (Drosophila) 5,48E-06 0,46455603 PTMS 12p13 parathymosin 1,20E-04 0,46422577 MGST3 1q23 microsomal glutathione S-transferase 3 3,31E-05 0,46394751 SAMD9 7q21.2 sterile alpha motif domain containing 9 2,20E-05 0,46371121 CHST3 10q22.1 carbohydrate (chondroitin 6) sulfotransferase 3 1,16E-05 0,46357543 TTC37 5q15 KIAA0372 -> Tetratricopeptide repeat domain 37 (TTC37) 4,91E-06 0,46332422 CHST9 18q11.2 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 4,96E-04 0,46313301 IDS Xq28 iduronate 2-sulfatase (Hunter syndrome) 7,22E-06 0,46308952 PERP 6q24 PERP, TP53 apoptosis effector 2,50E-05 0,46251162 ANXA6 5q32-q34 annexin A6 1,68E-05 0,46192355 NA NA NA 2,21E-04 0,46174332 CTSK 1q21 cathepsin K 2,72E-05 0,46142098 CLCN5 Xp11.23-p11.22 chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) 4,31E-06 0,46103846 ARMCX1 Xq21.33-q22.2 armadillo repeat containing, X-linked 1 1,97E-05 0,46096576 TRIM16 17p11.2 tripartite motif-containing 16 5,83E-05 0,46074135 GATA4 8p23.1-p22 GATA binding protein 4 -> Transcription factor GATA-4 1,80E-05 0,45898567 NXF3 Xq22-q23 nuclear RNA export factor 3 3,40E-05 0,4584113 UNC5C 4q21-q23 unc-5 homolog C (C. elegans) 3,43E-05 0,45835554 C5orf4 5q31-q32 chromosome 5 open reading frame 4 3,19E-05 0,45821338 MAP3K15 Xp22.12 mitogen-activated protein kinase kinase kinase 15 5,52E-05 0,45779814 NA NA NA 5,83E-06 0,45770787 NA NA NA 3,78E-04 0,45762713 179

C20orf117 20q11.23 chromosome 20 open reading frame 117 1,07E-05 0,4575101 RGAG1 Xq22.3 retrotransposon gag domain containing 1 9,59E-05 0,45719959 NT5E 6q14-q21 5'-nucleotidase, ecto (CD73) 3,99E-06 0,45709518 KITLG 12q22 KIT ligand 4,48E-05 0,45638491 NID1 1q43 nidogen 1 1,30E-04 0,4559729 MEIS1 2p14-p13 Meis homeobox 1 1,16E-05 0,45553317 LAYN 11q23.1 layilin 1,34E-05 0,45468222 TRIM16L 17p11.2 tripartite motif-containing 16-like 1,30E-04 0,45437945 RGAG4 Xq13.1 retrotransposon gag domain containing 4 1,16E-05 0,45409341 IFI6 1p35 interferon, alpha-inducible protein 6 1,87E-04 0,45367797 NA NA NA 6,74E-05 0,45311998 KLHDC8A 1q32.1 kelch domain containing 8A 7,26E-06 0,45310317 ITGB8 7p15.3 integrin, beta 8 1,81E-05 0,45296014 HNMT 2q22.1 histamine N-methyltransferase 4,27E-05 0,45290363 TGFBR3 1p33-p32 transforming growth factor, beta receptor III 9,47E-05 0,45275862 CAV2 7q31.1 caveolin 2 1,89E-05 0,45275171 GALM 2p22.1 galactose mutarotase (aldose 1-epimerase) 7,82E-06 0,45266887 hypothetical locus FLJ32742 -> WD repeat domain 42C -> DDB1- DCAF8L2 Xp21.3 7,76E-05 0,45248159 and CUL4-associated factor 8-like protein 2 SUSD1 9q31.3-q33.1 sushi domain containing 1 2,98E-05 0,45223467 TRIM2 4q31.3 tripartite motif-containing 2 6,82E-06 0,45135876 PRLR 5p14-p13 prolactin receptor 3,66E-04 0,450933 RBMS3 3p24-p23 RNA binding motif, single stranded interacting protein 7,90E-05 0,45071988 RHOBTB3 5q15 Rho-related BTB domain containing 3 3,00E-06 0,45013901 LAMB2 3p21 laminin, beta 2 (laminin S) 5,35E-06 0,45012091 ZFPM2 8q23 zinc finger protein, multitype 2 3,12E-06 0,45003153 NA NA NA 3,67E-04 0,4493827 solute carrier family 22 (extraneuronal monoamine transporter), SLC22A3 6q26-q27 1,97E-05 0,44927852 member 3 180

GSN 9q33 gelsolin (amyloidosis, Finnish type) 3,58E-06 0,44848682 CDH11 16q22.1 cadherin 11, type 2, OB-cadherin (osteoblast) 7,53E-06 0,44830624 ZMYM3 Xq13.1 zinc finger, MYM-type 3 4,93E-06 0,44807604 LOC283174 11q25 hypothetical LOC283174 9,87E-06 0,44799297 NFIA 1p31.3-p31.2 nuclear factor I/A 4,83E-06 0,44790044 HEG1 3q21.2 HEG homolog 1 (zebrafish) 1,17E-05 0,44764315 NA NA NA 4,08E-05 0,44752789 ZC3H7B 22q13.2 zinc finger CCCH-type containing 7B 1,49E-05 0,44690048 TMEM109 11q12.2 transmembrane protein 109 2,01E-05 0,44689816 NA NA NA 2,73E-06 0,44677334 TRHDE 12q15-q21 thyrotropin-releasing hormone degrading enzyme 2,09E-04 0,4464517 DDR2 1q23.3 discoidin domain receptor tyrosine kinase 2 1,36E-04 0,44601836 NA NA NA 4,83E-05 0,44597817 LHX9 1q31-q32 LIM homeobox 9 1,74E-05 0,44585763 DIRAS3 1p31 DIRAS family, GTP-binding RAS-like 3 8,40E-05 0,44583769 MFAP4 17p11.2 microfibrillar-associated protein 4 1,41E-05 0,44516683 sema domain, transmembrane domain (TM), and cytoplasmic SEMA6A 5q23.1 4,69E-04 0,44441995 domain, (semaphorin) 6A ROBO2 3p12.3 roundabout, axon guidance receptor, homolog 2 (Drosophila) 6,82E-05 0,44355165 CPA3 3q21-q25 carboxypeptidase A3 (mast cell) 2,26E-04 0,44271741 ZADH2 18q22.3 zinc binding alcohol dehydrogenase, domain containing 2 3,04E-06 0,44226669 alpha thalassemia/mental retardation syndrome X-linked (RAD54 ATRX Xq13.1-q21.1 3,23E-05 0,44193849 homolog, S. cerevisiae) -> Transcriptional regulator ATRX HEPH Xq11-q12 hephaestin 2,26E-05 0,44155085 ANG 14q11.1-q11.2 angiogenin, ribonuclease, RNase A family, 5 1,42E-04 0,44104232 NEGR1 1p31.1 neuronal growth regulator 1 1,34E-05 0,44097583 ARMCX4 Xq22.1 armadillo repeat containing, X-linked 4 7,99E-06 0,44085389 NA NA NA 2,68E-05 0,44081952 NID2 14q21-q22 nidogen 2 (osteonidogen) 9,40E-07 0,44011685 181

phosphorylase, glycogen; muscle (McArdle syndrome, glycogen PYGM 11q12-q13.2 3,55E-06 0,4393518 storage disease type V) KDELC2 11q22.3 KDEL (Lys-Asp-Glu-Leu) containing 2 4,37E-06 0,43933855 fatty acid binding protein 3, muscle and heart (mammary-derived FABP3 1p33-p32 4,27E-04 0,43920199 growth inhibitor) RNF152 18q21.33 ring finger protein 152 1,73E-06 0,43902211 FAM111A 11q12.1 family with sequence similarity 111, member A 5,83E-06 0,43840571 LOC51152 --- melanoma antigen -> Putative uncharacterized protein LOC51152 3,22E-04 0,4382257 DDR2 1q23.3 discoidin domain receptor tyrosine kinase 2 9,79E-05 0,43807598 WBP5 Xq22.1-q22.2 WW domain binding protein 5 5,35E-06 0,43793131 LAMC3 9q31-q34 laminin, gamma 3 1,10E-05 0,43750048 TCEAL2 Xq22.1-q22.3 transcription elongation factor A (SII)-like 2 1,10E-05 0,43740481 WWTR1 3q23-q24 WW domain containing transcription regulator 1 1,46E-05 0,43701282 NA NA NA 1,50E-05 0,43695678 v-maf musculoaponeurotic fibrosarcoma oncogene homolog MAF 16q22-q23 5,49E-06 0,43631486 (avian) ZNF275 Xq28 zinc finger protein 275 5,31E-05 0,4361546 EBF1 5q34 early B-cell factor 1 3,07E-06 0,43614734 PDGFRL 8p22-p21.3 platelet-derived growth factor receptor-like 6,81E-06 0,43506157 DOCK5 8p21.2 dedicator of cytokinesis 5 1,84E-06 0,43464818 sema domain, immunoglobulin domain (Ig), short basic domain, SEMA3D 7q21.11 3,75E-04 0,4342582 secreted, (semaphorin) 3D DCN 12q21.33 decorin 1,16E-05 0,43400739 SH3PXD2B 5q35.1 SH3 and PX domains 2B 8,60E-06 0,43386527 SCN7A 2q21-q23 sodium channel, voltage-gated, type VII, alpha 2,17E-04 0,43326722 FLRT3 20p11 fibronectin leucine rich transmembrane protein 3 1,04E-04 0,43183393 S100A16 1q21 S100 calcium binding protein A16 3,43E-05 0,43170823 APOA1 11q23-q24 apolipoprotein A-I 4,63E-05 0,43156597 calcitonin receptor-like -> Calcitonin gene-related peptide type 1 CALCRL 2q32.1 4,86E-05 0,431439 receptor 182

TSHZ1 18q22.3 teashirt zinc finger homeobox 1 3,33E-06 0,43113975 semaphorin 7A, GPI membrane anchor (John Milton Hagen blood SEMA7A 15q22.3-q23 2,79E-04 0,43055502 group) NA NA NA 1,29E-04 0,43053114 SREBF2 22q13 sterol regulatory element binding transcription factor 2 1,34E-05 0,42920566 LTBP3 11q12 latent transforming growth factor beta binding protein 3 2,10E-06 0,4290211 ANTXR1 2p13.1 anthrax toxin receptor 1 8,21E-06 0,42820024 NAV3 12q14.3 neuron navigator 3 4,83E-05 0,42819297 pleiotrophin (heparin binding growth factor 8, neurite growth- PTN 7q33-q34 1,28E-05 0,42771746 promoting factor 1) sushi, von Willebrand factor type A, EGF and pentraxin domain SVEP1 9q32 2,31E-04 0,42742894 containing 1 SVIL 10p11.2 supervillin 4,36E-06 0,42713559 MTUS1 8p22 mitochondrial tumor suppressor 1 1,54E-05 0,42693756 PCSK6 15q26.3 proprotein convertase subtilisin/kexin type 6 2,19E-05 0,4262127 IGSF9B 11q25 immunoglobulin superfamily, member 9B 4,36E-06 0,42546519 SSPN 12p11.2 sarcospan (Kras oncogene-associated gene) 1,04E-05 0,42528415 TNS3 7p12.3 tensin 3 6,24E-05 0,42523139 C8orf49 8p23.1 chromosome 8 open reading frame 49 7,59E-06 0,42518895 NA NA NA 1,74E-04 0,42509833 TMEM2 9q13-q21 transmembrane protein 2 5,28E-05 0,42488594 BST2 19p13.2 bone marrow stromal cell antigen 2 2,23E-05 0,4242019 APOA1 11q23-q24 apolipoprotein A-I 4,50E-05 0,42325881 MRC2 17q23.2 mannose receptor, C type 2 4,81E-06 0,42292317 NA NA NA 2,19E-05 0,42261401 PLOD1 1p36.3-p36.2 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1,02E-05 0,42261255 NA NA NA 1,74E-05 0,4223121 MI0003196 Homo sapiens miR-509-1 stem-loop /// MI0005530 mir509stem NA Homo sapiens miR-509-2 stem-loop /// MI0005717 Homo sapiens 1,27E-05 0,42202197 miR-509-3 stem-loop 183

HGSNAT 8p11.1 heparan-alpha-glucosaminide N-acetyltransferase 2,31E-06 0,42191316 ZNF431 19p12 zinc finger protein 431 2,49E-05 0,42154279 NA NA NA 5,62E-05 0,42133437 COL14A1 8q23 collagen, type XIV, alpha 1 3,01E-05 0,42123917 NA NA NA 7,08E-05 0,42075768 family with sequence similarity 114, member A1 -> Protein FAM114A1 4p14 2,01E-05 0,4204316 NOXP20 RBP4 10q23-q24 retinol binding protein 4, plasma 4,84E-04 0,41999702 CYBRD1 2q31.1 cytochrome b reductase 1 7,22E-05 0,41988292 PPAP2B 1pter-p22.1 phosphatidic acid phosphatase type 2B 5,28E-06 0,41985352 ARRB1 11q13 arrestin, beta 1 6,94E-06 0,41898892 androgen receptor (dihydrotestosterone receptor; testicular AR Xq11.2-q12 feminization; spinal and bulbar muscular atrophy; Kennedy 5,67E-06 0,41850957 disease) epidermal growth factor receptor (erythroblastic leukemia viral EGFR 7p12 6,16E-06 0,41801743 (v-erb-b) oncogene homolog, avian) PGCP 8q22.2 plasma glutamate carboxypeptidase 1,76E-06 0,41754975 CD22 19q13.1 CD22 molecule 2,59E-05 0,41685325 HIST2H2BF 1q21.2 histone cluster 2, H2bf 6,14E-07 0,41673972 NAP1L3 Xq21.3-q22 nucleosome assembly protein 1-like 3 2,27E-04 0,41570846 LOC653354 Xq22.1 hypothetical LOC653354 1,07E-05 0,41560301 RAB30 11q12-q14 RAB30, member RAS oncogene family 5,66E-06 0,41560286 low density lipoprotein-related protein 1 (alpha-2-macroglobulin LRP1 12q13-q14 2,55E-05 0,4155984 receptor) NCAM1 11q23.1 neural cell adhesion molecule 1 2,18E-05 0,41549312 TM4SF18 3q25.1 transmembrane 4 L six family member 18 5,52E-05 0,41533778 MAOB Xp11.23 monoamine oxidase B 5,00E-06 0,41511918 CAV1 7q31.1 caveolin 1, caveolae protein, 22kDa 8,27E-05 0,41460603 KIRREL 1q21-q25 kin of IRRE like (Drosophila) 6,55E-05 0,41258764 KLHL4 Xq21.3 kelch-like 4 (Drosophila) 7,04E-05 0,41209418 184

LOC493869 5q11.2 similar to RIKEN cDNA 2310016C16 2,15E-04 0,41155239 METTL7A 12q13.13 methyltransferase like 7A 2,08E-04 0,41068581 MUM1L1 Xq22.3 melanoma associated antigen (mutated) 1-like 1 1,07E-04 0,41017202 RGN Xp11.3 regucalcin (senescence marker protein-30) 2,05E-06 0,40884645 ND2 --- NADH dehydrogenase, subunit 2 (complex I) 2,04E-04 0,40883851 ANTXR2 4q21.21 anthrax toxin receptor 2 7,59E-06 0,40845527 CMBL 5p15.2 carboxymethylenebutenolidase homolog (Pseudomonas) 1,39E-04 0,40806701 NA NA NA 1,57E-04 0,40745906 NA NA NA 1,98E-04 0,40632443 NA NA NA 1,53E-04 0,40521318 ADAM metallopeptidase with thrombospondin type 1 motif, 5 ADAMTS5 21q21.3 6,28E-05 0,40489788 (aggrecanase-2) NA NA NA 2,73E-04 0,40465743 SNED1 2q37.3 sushi, nidogen and EGF-like domains 1 1,12E-05 0,40388585 LRRC17 7q22.1 leucine rich repeat containing 17 3,76E-05 0,40253761 HLF 17q22 hepatic leukemia factor 4,71E-06 0,40224419 C5orf13 5q22.1 chromosome 5 open reading frame 13 -> Neuronal protein 3.1 2,20E-05 0,40200783 GSTM4 1p13.3 glutathione S-transferase M4 1,14E-05 0,40194556 TBC1D9 4q31.21 TBC1 domain family, member 9 (with GRAM domain) 1,02E-05 0,40148166 RARRES2 7q36.1 retinoic acid receptor responder (tazarotene induced) 2 3,96E-05 0,40138525 FHOD3 18q12 formin homology 2 domain containing 3 2,71E-04 0,40130569 PLAGL1 6q24-q25 pleiomorphic adenoma gene-like 1 4,81E-06 0,4010418 CRISPLD2 16q24.1 cysteine-rich secretory protein LCCL domain containing 2 1,78E-04 0,39995095 IGFBP6 12q13 insulin-like growth factor binding protein 6 3,24E-06 0,39992947 SELENBP1 1q21-q22 selenium binding protein 1 6,82E-06 0,39894921 NA NA NA 1,26E-04 0,39727516 solute carrier family 16, member 9 (monocarboxylic acid SLC16A9 10q21.1 4,45E-04 0,39671642 transporter 9) -> Monocarboxylate transporter 9 C7orf58 7q31.31 chromosome 7 open reading frame 58 2,39E-06 0,39519867 185

FGF10 5p13-p12 fibroblast growth factor 10 1,44E-06 0,39482726 CCDC69 5q33.1 coiled-coil domain containing 69 2,44E-05 0,39477882 PDGFRB 5q31-q32 platelet-derived growth factor receptor, beta polypeptide 3,23E-06 0,39432607 adhesion molecule with Ig-like domain 2 -> Amphoterin-induced AMIGO2 12q13.11 2,50E-05 0,39388967 protein 2 NA NA NA 7,95E-05 0,3934794 FLNB 3p14.3 filamin B, beta (actin binding protein 278) 1,33E-05 0,39346358 LAMA2 6q22-q23 laminin, alpha 2 (merosin, congenital muscular dystrophy) 1,53E-05 0,39332151 PLXNC1 12q23.3 plexin C1 6,90E-05 0,39319735 SPTLC3 20p12.1 serine palmitoyltransferase, long chain base subunit 3 1,46E-05 0,39268557 ATP10D 4p12 ATPase, class V, type 10D 3,70E-06 0,39214742 RCAN2 6p12.3 regulator of calcineurin 2 1,13E-06 0,39179449 NA NA NA 5,83E-06 0,3912943 AS3MT 10q24.32 arsenic (+3 oxidation state) methyltransferase 1,04E-05 0,39053845 MYO7A 11q13.5 myosin VIIA 3,43E-05 0,39023904 PODN 1p32.3 podocan 1,07E-06 0,38989796 PIK3R1 5q13.1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1,54E-04 0,38968222 FLRT2 14q24-q32 fibronectin leucine rich transmembrane protein 2 5,04E-06 0,38949386 FAM198B 4q32.1 chromosome 4 open reading frame 18 -> Protein FAM198B 4,08E-06 0,38839674 USP13 3q26.2-q26.3 ubiquitin specific peptidase 13 (isopeptidase T-3) 7,53E-06 0,38813138 GREB1 2p25.1 GREB1 protein 3,94E-05 0,38762244 PLA2G4A 1q25 phospholipase A2, group IVA (cytosolic, calcium-dependent) 3,12E-07 0,38758496 NA NA NA 2,98E-05 0,38677796 LOC728264 5q33.1 hypothetical protein LOC728264 1,53E-04 0,38412373 NA NA NA 1,28E-05 0,38410509 SNORD113-3 14q32.31 small nucleolar RNA, C/D box 113-3 4,11E-04 0,38407887 MME 3q25.1-q25.2 membrane metallo-endopeptidase 3,62E-05 0,38138777 ANKDD1A 15q22.31 ankyrin repeat and death domain containing 1A 5,45E-07 0,38092926 ISLR 15q23-q24 immunoglobulin superfamily containing leucine-rich repeat 3,76E-06 0,38074078 186

COL15A1 9q21-q22 collagen, type XV, alpha 1 1,91E-05 0,38056822 RHOJ 14q23.2 ras homolog gene family, member J 7,36E-05 0,3770992 OLFML3 1p13.2 olfactomedin-like 3 3,97E-04 0,37646457 NA NA NA 1,05E-04 0,37610034 ND2 --- NADH dehydrogenase, subunit 2 (complex I) 9,49E-05 0,37607701 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid AKR1C3 10p15-p14 1,89E-06 0,37575195 dehydrogenase, type II) HSPB6 19q13.12 heat shock protein, alpha-crystallin-related, B6 3,38E-05 0,37572838 HIST2H2BF 1q21.2 histone cluster 2, H2bf 8,07E-07 0,37310135 GSTM2 1p13.3 glutathione S-transferase M2 (muscle) 6,73E-06 0,37239717 CPM 12q14.3 carboxypeptidase M 3,56E-04 0,36983278 hydroxysteroid (17-beta) dehydrogenase 3 -> Testosterone 17- HSD17B3 9q22 2,64E-05 0,3696995 beta-dehydrogenase 3 ZNF536 19q12 zinc finger protein 536 1,06E-05 0,36810124 NA NA NA 1,92E-05 0,3679529 GSTA4 6p12.1 glutathione S-transferase A4 3,55E-06 0,36710903 VCAM1 1p32-p31 vascular cell adhesion molecule 1 1,52E-05 0,36182124 PDZRN4 12q12 PDZ domain containing RING finger 4 1,35E-06 0,36152216 LTBP4 19q13.1-q13.2 latent transforming growth factor beta binding protein 4 4,76E-07 0,36150425 CRYAB 11q22.3-q23.1 crystallin, alpha B 1,48E-05 0,35956886 TCEA3 1p36.12 transcription elongation factor A (SII), 3 3,99E-05 0,35932843 SLC40A1 2q32 solute carrier family 40 (iron-regulated transporter), member 1 3,21E-04 0,35742761 MI0000107 Homo sapiens miR-29b-2 stem-loop /// Homo sapiens mir29b2 NA microRNA 29b-2/29c, precursor RNA, microRNA 29b-2 and 1,93E-04 0,35666103 microRNA 29c, complete sequence; alternatively spliced. CLSTN2 3q23-q24 calsyntenin 2 1,53E-06 0,35463959 AOPEP 9q22.32 chromosome 9 open reading frame 3 -> Aminopeptidase O 2,23E-04 0,35396681 NRK Xq22.3 Nik related kinase 1,80E-05 0,35382086 extracellular matrix protein 2, female organ and adipocyte ECM2 9q22.3 2,30E-05 0,35239858 specific 187

matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa MMP2 16q13-q21 2,65E-06 0,3522435 type IV collagenase) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide B3GALT2 1q31 4,16E-04 0,35145515 2 -> Beta-1,3-galactosyltransferase 2 INHBA 7p15-p13 inhibin, beta A 1,04E-06 0,35059152 hypothetical gene supported by AK123403 -> Hypothetical LOC389834 --- 5,94E-05 0,35034665 LOC389834 PRKCA 17q22-q23.2 protein kinase C, alpha 1,40E-06 0,34854951 FLJ38894 11q14.1 hypothetical protein LOC646029 2,21E-04 0,34677661 HSD17B6 12q13 hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse) 7,94E-05 0,33995578 ITM2A Xq13.3-Xq21.2 integral membrane protein 2A 1,22E-05 0,33778695 PGRMC1 Xq22-q24 progesterone receptor membrane component 1 3,36E-06 0,33573003 mir154stem NA MI0000480 Homo sapiens miR-154 stem-loop 2,13E-04 0,33436796 NA NA Intronic normalization control 2,68E-07 0,33395763 CRYZ 1p31-p22 crystallin, zeta (quinone reductase) 5,54E-05 0,33121112 CMYA5 5q14.1 cardiomyopathy associated 5 9,84E-07 0,32901608 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid HSD3B1 1p13.1 3,99E-05 0,32706199 delta-isomerase 1 PDGFRA 4q11-q13 platelet-derived growth factor receptor, alpha polypeptide 2,15E-05 0,32643632 MIR29C 1q32.2 microRNA 29c 1,89E-06 0,32626056 EPHX1 1q42.1 epoxide hydrolase 1, microsomal (xenobiotic) 1,22E-05 0,32579074 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid HSD3B2 1p13.1 5,04E-05 0,32549494 delta-isomerase 2 SEPP1 5q31 selenoprotein P, plasma, 1 1,31E-04 0,32449418 ATP1A2 1q21-q23 ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide 2,95E-05 0,32299651 NA NA NA 1,88E-04 0,32096914 TMEM47 Xp11.4 transmembrane protein 47 9,25E-07 0,32062271 OGN 9q22 osteoglycin 3,57E-06 0,31724867 TSHZ2 20q13.2 teashirt zinc finger homeobox 2 3,86E-07 0,31427328 ITPR1 3p26-p25 inositol 1,4,5-triphosphate receptor, type 1 2,11E-06 0,31053128 188

NA NA NA 9,80E-05 0,31033246 NA NA NA 9,80E-05 0,31033246 NA NA NA 7,45E-05 0,30999074 INHA 2q33-q36 inhibin, alpha 3,04E-06 0,30959348 MAMDC2 9q21.11 MAM domain containing 2 6,00E-05 0,30921646 LIPH 3q27 lipase, member H 5,22E-05 0,30655971 C7 5p13 complement component 7 1,29E-05 0,3042893 NDRG2 14q11.2 NDRG family member 2 4,36E-06 0,30312243 cartilage intermediate layer protein, nucleotide CILP 15q22 5,47E-06 0,30028879 pyrophosphohydrolase OLFML1 11p15.4 olfactomedin-like 1 1,93E-06 0,2978652 EDNRA 4q31.23 endothelin receptor type A 6,04E-07 0,29542555 CCND2 12p13 cyclin D2 7,02E-06 0,29535378 OSR2 8q22.2 odd-skipped related 2 (Drosophila) 1,09E-05 0,2942121 CYP11A1 15q23-q24 cytochrome P450, family 11, subfamily A, polypeptide 1 1,74E-05 0,29348049 TSHZ2 20q13.2 teashirt zinc finger homeobox 2 1,99E-06 0,29256468 ANGPTL1 1q25.2 angiopoietin-like 1 3,06E-05 0,29056131 RBP1 3q23 retinol binding protein 1, cellular 6,00E-05 0,28974597 HTR1A 5q11.2-q13 5-hydroxytryptamine (serotonin) receptor 1A 7,82E-06 0,2857525 SNAI2 8q11 snail homolog 2 (Drosophila) 3,38E-06 0,28215347 JUN 1p32-p31 jun oncogene -> Transcription factor AP-1 1,24E-04 0,27328212 NA NA NA 5,43E-05 0,27069891 DLK1 14q32 delta-like 1 homolog (Drosophila) 2,50E-05 0,26929008 CLDN1 3q28-q29 claudin 1 9,11E-05 0,26697323 C6 5p13 complement component 6 4,54E-06 0,26290191 pleckstrin homology domain containing, family H (with MyTH4 PLEKHH2 2p21 5,41E-07 0,2504191 domain) member 2 DPT 1q12-q23 dermatopontin 9,83E-07 0,21980476 C4orf49 4q31.1 ovary-specific acidic protein -> Uncharacterized protein C4orf49 1,57E-05 0,19777096 189

NA NA NA 5,66E-06 0,19741657 RSPO3 6q22.33 R-spondin 3 homolog (Xenopus laevis) 5,25E-08 0,18211713 LHCGR 2p21 luteinizing hormone/choriogonadotropin receptor 1,07E-04 0,17958497 GSTM5 1p13.3 glutathione S-transferase M5 1,91E-06 0,1795597 IGFBP5 2q33-q36 insulin-like growth factor binding protein 5 7,15E-05 0,15286441 mir202stem NA MI0003130 Homo sapiens miR-202 stem-loop 3,03E-05 0,13646326

190