sign in sign up
<<
Home , Androgen receptor, BCL6, C6orf201, C9orf152, EGR1, EGR2

A Dissertation

entitled

The as a Transcriptional Co-activator: Implications in the Growth

and Progression of

By

Mesfin Gonit

Submitted to the Graduate Faculty as partial fulfillment of

the requirements for the PhD Degree in Biomedical science

Dr. Manohar Ratnam, Committee Chair

Dr. Lirim Shemshedini, Committee Member

Dr. Robert Trumbly, Committee Member

Dr. Edwin Sanchez, Committee Member

Dr. Beata Lecka -Czernik, Committee Member

Dr. Patricia R. Komuniecki, Dean College of Graduate Studies

The University of Toledo August 2011

Copyright 2011, Mesfin Gonit

This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author.

An Abstract of

The as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer

By

Mesfin Gonit

As partial fulfillment of the requirements for the PhD Degree in Biomedical science

The University of Toledo August 2011

Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of activation by AR, activated AR signals through binding to the androgen response elements (AREs) in the target gene /enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of

LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of

androgen. profiling of LP50 cells showed that AR regulates two largely

distinct gene expression programs, androgen-dependent and apo-AR dependent.

Furthermore, a DNA binding domain mutant of AR which is unable to bind to ARE rescued androgen depletion insensitive proliferation and gene activation in LP50 cells

iii

depleted of endogenous wild type AR. Furthermore, ChIP-chip promoter tiling arrays

revealed enrichment for AR in sites that are functional but lack ARE.

To identify candidate factors that tether AR to target in the

absence of androgen, cis-elements of transcription factors in the AR interactome data set

and AR chip peaks were used. We found direct interaction between AR and Elk-1 in both

the C81 and C4-2 LNCaP variants of androgen depletion insensitive experimental model

systems representing clinical advanced prostate cancer. AR dependent promoter activity

of an Elk-1 driven promoter reporter construct and physical association between AR and

Elk-1 by coimmunoprecipitation suggested that AR acts as a co-activator of Elk-1. Elk-1

was shown to be necessary for the proliferation of C81 and C4-2 cells. Expression profile

studies further showed AR-dependent activation of gene clusters enriched for function by Elk-1. This AR dependent gene regulation by Elk-1 was insensitive to androgen antagonist.

The present study suggests that in advanced prostate cancer AR can support the

progression of the tumor through ARE independent mechanisms by acting as a

transcriptional co-activator for transcription factors such as Elk-1. This mechanism of

action of AR is insensitive to as well as . Hence, therapeutic

strategies selectively targeting the interactions between AR and critical tethering

could be a novel approach for the management of advanced prostate cancer.

iv

Acknowledgements

First and for most I would like to express my sincere gratitude to my major advisor Dr. Manohar Ratnam for his wonderful mentorship, guidance and generous support for my study. I am very grateful to my graduate research advisory committee members: Dr. Lirim Shemshedini, Dr. Robert Trumbly, Dr. Beata Lecka-Czernik and Dr.

Edwin Sanchez whose advice, suggestions and continuous help have been invaluable.

Special thanks should be given to Dr. Randall Ruch who helped me in many ways. I would like to thank former and current laboratory members: Dr. Juan Zhang, Dr Aymen

Shatnawi, Dr. Marcela d'Alincourt Salazar, Suneethi Sivakumaran, Theodore Manolukas,

Venkatesh Chari and Mugdha Patki for their contribution for this work and creating collegial work environment. Last but not least, I would like to express my deepest gratitude for my parents who put the greatest trust and confidence in me all the time.

v

Table of content

Abstract ...... iii

Acknowledgements ...... v

Table of content ...... vi

Chapter 1: Introduction and Literature review ...... 1

Introduction ...... 1

Literature review ...... 9

Chapter 2: Hormone Depletion-Insensitivity of Prostate Cancer Cells is Supported by

the Androgen Receptor without Binding to Classical Response Elements ...... 47

Abstract ...... 48

Introduction ...... 49

Results ...... 52

Discussion ...... 61

Materials and Methods ...... 66

References ...... 76

Figure Legends and Figures ...... 82

vi

Chapter 3: Elk-1 Recruits the Androgen Receptor as a and is Necessary for

Androgen Receptor Dependent Growth of Advanced Prostate Cancer Cells ...... 97

Abstract ...... 98

Introduction ...... 99

Materials and methods ...... 101

Results ...... 108

Discussion ...... 114

References ...... 119

Figure Legends and Figures ...... 124

Chapter 4: Summary and Conclusion ...... 135

References ...... 142

A: SUPPLEMENT 1...... 170

B: SUPPLEMENT 2 ...... 213

C: SUPPLEMENT 3...... 216

D: SUPPLEMENT 4...... 220

vii

Chapter 1

Introduction and Literature review

Introduction

Androgens regulate a variety of physiological functions and exert their genotropic action through the androgen receptor (AR). The androgen receptor plays a pivotal role in reproduction, gender differentiation, development of muscle mass and bone strength. AR is required for development, maintenance and function of the prostate (1). In addition to its normal physiological roles, AR is also involved in the development of prostatic hyperplasia and malignancy and is expressed in most hormone refractory prostate tumors

(2, 3). In the United States, prostate cancer is the second leading cause of cancer death in men. In 2010 an estimated 217, 730 new cases were reported and about 32,050 men died of prostate cancer the same year. The high incidence of prostate cancer is attributed to an increase in the aging population, early detection due to the increase in the number of men undergoing screening and improved health care service (4).

1

The remarkable sensitivity of prostatic epithelial cells to has been known for a while, and tapped in the management of prostate cancer. To date, androgen ablation therapy is the mainstay for the treatment of advanced prostate cancer (2).

Hormone ablation therapy initially yields a favorable response with significant tumor remission along with a drop in PSA level in the majority of patients. However, in most cases the tumor recurs and progresses to an androgen independent metastatic stage, also known as castration resistant prostate cancer or androgen independent prostate cancer.

Castration resistant tumors have limited treatment options and lead to death within 1-2 years (2, 5, 6).

The development of androgen-independence presents a major problem in treating prostate cancer, which in its early stages responds well to surgical or pharmacological androgen ablation (7). Several possible mechanisms underlie the hormone-refractoriness of AR in these tumors, notably up-regulation of AR by gene amplification or other means

(8), AR (2, 6, 9-11), an altered AR co-regulator expression and the phosphorylation or status of AR (12, 13). Up-regulation of AR and some mutations can hyper-sensitize AR to post-ablation levels of androgen or alter its ligand specificity (2, 14-17). In addition, cross talk between AR and other growth signaling pathways may render the cells hormone-refractory without AR up-regulation (2, 5, 6,

18). For example, dysregulated signaling pathways such as MAPK, PI3K/AKT and PKC converge on AR (19, 20) and apparently enable AR to enter the nucleus and regulate genes independent of androgen.

2

Although, the AR plays a vital role in the progression of the majority of prostate

cancer, mechanisms that bypass AR have also been described. The AR negative

differentiation (21), selection of a preexisting resistant cells or

prostate cancer stem cell that continually replenish the tumor cell population (22, 23)

have been suggested to cause androgen ablation failure. Other AR bypass mechanisms

such as inactivating of phosphatase tensin homologue (PTEN) (24), up-

regulation of antiapoptotic proteins such as Bcl-2 (25, 26) are reported to cause hormone

refractoriness. These mechanisms are unlikely to be mutually exclusive; hence, one or a

combination of these mechanisms may operate in prostate cancer cells to promote

progression to androgen independence.

In the classical mechanism of AR transcriptional signaling, upon androgen

binding, AR dissociates from heat shock proteins and translocates into the nucleus where

it binds as a homodimer to androgen response elements (AREs) in the promoter/

enhancer regions of its target genes; subsequently AR recruits co-activators to facilitate transcription (27, 28). Studies utilizing the prototype androgen regulated PSA gene have shown the central role of androgen response elements in the regulation of androgen target genes in prostate cancer cells (29-31).

There is a paucity of direct and unequivocal evidence for an essential role for

AREs in situations in which AR signaling supports the proliferation of prostate cancer

cells completely deprived of hormone. The limited evidence relates primarily to the

3

prostate specific antigen (PSA) gene that has served as a model androgen target gene

since it is directly and strongly induced by androgen, primarily through a well

characterized cluster of AREs that occur ~ 4.2 kb upstream of its basal promoter (29, 30).

PSA is also viewed as a good marker for such studies because this gene appears to be

exclusively regulated by AR signaling and its serum levels increase as clinical prostate

cancer progresses to androgen-independence (7). In hormone-independent LNCaP

prostate cancer cells, basal expression of PSA (i.e., in the complete absence of hormone)

was higher than that of the corresponding hormone-sensitive cells and was dependent on

the presence of AR suggesting that in the resistant cells PSA was regulated by AR

independent of androgen; however, even in those cells, the basal PSA level was

significantly lower than the androgen-induced levels in the sensitive cells (31, 32).

Further, androgen treatment also significantly up-regulated PSA in the resistant cells

(31). Notably, it was observed that in hormone-refractory prostate cancer cells, the basal

AR-dependent expression of PSA was not associated with occupancy of the PSA

promoter/enhancer region by AR (33) although this did not rule out direct or indirect

transcriptional effects of AR bound to DNA at other sites. This indicates AR supports

growth by utilizing alternative modes of association to the target genes, rather than

binding to either canonical or non-canonical AREs.

The and receptors have been shown to modulate

transcriptional activity of their target genes without directly binding to their cognate

response elements through tethering (34-37). Similarly, the recruitment of AR by (SRF) in the regulation of myoblast differentiation (38) has been

4

reported. In addition, the transcriptional modulation of genes by C/EBPα and HOXB13

(39, 40) in AR dependent manner has been reported in prostate cancer cells. However,

the role and significance of a tethering mechanism in the context of androgen ablation

resistant prostate cancer progression has not been adequately studied for AR. The

objective of the present study was to further explore the non-classical mechanism of AR

signaling to help to uncover new therapeutic targets in hormone refractory prostate cancer

cells.

In chapter two the role of androgen response elements (ARE) in hormone

independent transcriptional signaling was investigated. Here, we used the late passage

LNCaP variant termed as LP50 as good model for androgen depletion insensitive prostate

cancer. These cells were generated by extended in vitro passage (greater than 50

passages) in a regular media. The AR-positive LNCaP prostate cancer cell line is

heterogeneous and is known to become androgen-independent after extended growth in vitro or in castrated mice in vivo (41, 42). Androgen-independence of the late passage

LNCaP cells presumably reflects selection for a subpopulation of cells which are truly androgen independent. The AR in LNCaP cells also contains a T877A mutation that cross-sensitizes it to other and that has been noted in other prostate tumors (11,

43, 44). Hormone-refractory LNCaP cells developed by serial transplantation of tumor xenografts in castrated mice tend to survive by acquiring hyper-sensitivity to post- ablation levels of androgen in association with up-regulation of AR (14). In contrast, we found that a sub-population of LNCaP cells selected for during prolonged growth in vitro

(named LP50 cells) exhibited completely hormone-independent growth. This model was

5

used to more rigorously examine the role of AREs in hormone-independent AR signaling in the context of hormone-independent cell proliferation.

Our study showed that LP50 cells were profoundly dependent on AR for their proliferation, and AR was predominantly localized in the nucleus. We also demonstrated that these cells were not hyper-sensitized to castration levels of androgen. Using

Chromatin immunopreceipitation (ChIP) assay and promoter studies, we showed that AR is unable to bind functionally to androgen response elements in the absence of androgen.

Furthermore, in LP50 cells gene expression and cell proliferation was supported by a

DNA binding mutant AR. Collectively the data presented in chapter two revealed that in prostate cancer cells that have acquired “true” hormone-independence, the well-known pattern of androgen-dependent gene activation is retained but that target gene interactions of AR through ARE-independent tethering mechanisms is critical for hormone-refractory growth.

Our studies in chapter two have demonstrated that the hormone-independent transcriptional activity of AR occurs primarily by mechanisms that are independent of classical androgen response elements (AREs), which continue to require androgen to bind

AR. ChIP-chip studies on LP50 cells revealed androgen independent functional association of AR to chromatin sites that lack the classical or non-canonical androgen response elements. Furthermore, a high throughput study aimed at identifying AR interacting proteins in LNCaP cells have shown that AR physically associates with a large set of DNA binding transcription factors (45). These AR interacting proteins were

6

used for in vitro screening to identify candidate transcription factors that tether AR in

androgen depletion insensitive prostate cancer cells. Using luciferase reporter constructs driven by the cis-elements of these factors, transcription factors (Elk-1, Egr1, MTF-1,

PARP-1, and cRel) that show AR dependent promoter activity were identified. In light of

the oncogenic role of the Ets transcription factors, Elk-1 was selected as a model for

detailed characterization in chapter three.

Elk-1 is a MAPK activated that contains the ETS DNA

binding domain (46, 47). In the context of the c-Fos gene promoter it has been shown to

form heterologous interaction with the serum response factor to regulate immediate early

genes (48, 49). Of note, Elk-1 also regulates target genes independent of SRF (50-53).

Microarray studies of metastatic prostate tumors have shown the significant enrichment

of gene networks that contain Elk-1 binding sites (54). Elk-1 is a central molecule that

integrates a variety of extracellular stimuli activating ERK, JNK, p38 MAPK, hedgehog

and Akt pathways (55-57).

In chapter three the physical association and functional interactions of AR with

Elk1 was demonstrated. To study the mechanism of AR-Elk1 interaction, hormone

depletion-insensitive AR overexpressing (C4-2) and the non-overexpressing (C81) cell

culture models of advanced prostate cancer were used. The predominant nuclear

localization of AR in C4-2 and C81 cells has been reported. In both C4-2 and C81 cell culture models of prostate cancer, AR supported robust growth in the complete absence of hormone although androgen variably induced higher growth rates. Comparative gene

7

expression studies between C4-2 and C81 demonstrate that apo-AR regulated genes were largely distinct from early androgen responsive genes. analysis of AR up- regulated genes showed enrichment of genes involved in and . These findings demonstrate that these cell culture model systems represent salient features of clinical prostate tumor. Here, we have demonstrated that the tethered association of AR with Elk-1 support the prostate cancer growth in androgen depleted condition. DNA microarray analyses performed in C81 cells to identify genes synergistically activated by

Elk-1 and AR have shown enrichment of genes that support cell cycle. This transcriptional mechanism was insensitive to both androgen and antiandrogen. The androgen antagonist (Casodex) did not antagonize the co-activator role of

AR in gene activation by Elk-1 in the hormone depletion-insensitive models.

The findings suggest that critical interactions of AR in its co-activator role are potential novel targets for intervention in advanced prostate cancers; this approach may also obviate the need for androgen ablation. The physiological relevance of tethering mechanisms in hormone independent prostate cancer cells will also be addressed in the study. The findings of the study will contribute to the current understanding of hormone independent transcriptional signaling of AR in prostate cancer cells.

8

Literature review

The androgen receptor gene structure and function

The AR is member of the superfamily activated by androgens.

AR is encoded by a single copy gene located on Xq11-12 and contains 8

. The major form of androgen receptor cDNA is 10.6 kb long and contains

very long 5ʹ and 3ʹ UTR. The 5ʹ UTR is 1.1 kb long and enc oded by the first

whereas the 6.8 kb long 3ʹ UTR is encoded by exon eight. Two transcription start sites

have been identified at the promoter region of AR that show promoter activity in a

reporter assay (58, 59). However, the major transcription start site is located 1.1 kb upstream the initiator of the AR protein. The promoter of AR lacks the typical TATA or CCAAT motif. The AR promoter contains GC-rich elements, binding sites for . Promoter characterization and sequence analysis of the

AR promoter of different species have also shown binding sites for (GR), AR, AP1 and cyclic AMP binding response elements (60-63). The prototype AR protein contains 919 residues roughly 110 kDa molecular weight. (64, 65).

The AR is a modular protein consists of four distinct domains. The N-terminus of

AR forms a domain encoded by exon one. The N-terminus is highly variable in length due to the variable number of polyglutamine and polyglycine repeat. The AR contains CAG (polyglutamine) tandem repeats of 9-36

9

residues and a GGN (polyglycine) repeat ranging from 10-30 residues in its N-terminal end (64, 65). The NH2-terminal domain contains the major transcriptional activation

function (AF-1) of the androgen receptor. Deletion studies of the N-terminal domain have

demonstrated that this region harbors two discrete transcription activation units termed as

tau-1(AF1) and tau-5(AF5) that are necessary for the activity of the receptor (66). The N-

terminal domain of AR also contains FxxLF motif at the AF1 and WxxLF motif in the

AF5 region which facilitate the unique amino-carboxyl (N-C) intramolecular interaction

that stabilize androgen bound AR (67-70).

The DNA binding domain, encoded by exon 2-3, contains two fingers. The first contains α-helix that enters in to the major grove of the DNA and makes base specific contact through amino acid residues known as P-Box. While the D-box, amino acid residues in the second zinc finger, is involved in DNA dependent dimerization. Both the P-box and D-box are conserved among androgen, glucocorticoid, progesterone and mineralocorticoid receptor (71). The hinge region encoded by part of exon four is a short flexible domain that connects the DNA binding and ligand binding domain. It contains the nuclear localization signal NLS that binds to importin alpha (71,

72).

The C-terminus of the androgen receptor contains the ligand binding domain, encoded by exon 4-8. The ligand binding domain is formed by 12 helices that form a central ligand binding cavity. The ligand binding domain of the AR also contains a

10

relatively weak transactivation function termed as AF-2 that serve as a docking site for co-activators with LxxLL motif as well as FxxLF motif (64, 65, 73).

AR isoforms and variants

Two isoforms of androgen receptor has been reported in human prostate (58). The full length androgen receptor is approximately 110 kDa. The short isoform is approximately 87 kDa which result from in vitro proteolytic cleavage of the amino or carboxyl-terminal region (74, 75).

Nuclear receptors undergo multiple splicing to generate different variants (76).

Recent studies using rapid amplification of cDNA ends (RACE) and next generation sequencing of AR mRNA from normal and malignant prostate tissues have revealed the expression of AR splice variants. These AR splice variants lack the hinge region and ligand binding domain. They have N-terminus encoded by variable number of exon ranging from 1-3 (77, 78). The C-terminus of these variants is variable and encoded by cryptic exon or sequence from 2 or intron 3 (79). The expression level of AR variants with respect to the full length AR is very low and their physiological significance has not been investigated. However, recent studies indicate that these AR variants could play role in driving castration resistant prostate cancer (78).

11

Regulation of the AR gene expression

Androgen is the primary regulator of AR mRNA and protein at the transcriptional and posttranscriptional level. Androgen mediated AR autoregulation provides regulatory mechanism to limit the androgen responsiveness of cells and tissues (80-83). In vitro studies have shown that prolonged exposure of LNCaP cells to androgen decrease the steady state level of AR transcript and leads to posttranslational inactivation of the AR function (83). Of note, androgen exposure has shown to increase the stability of AR protein which is attributed in part to the amino-carboxy terminal (N-C) interaction promoted by ligand (84, 85). The expression of AR is also regulated by GR. Unlike androgen, prolonged exposure to glucocorticoid in tissues that express both receptors down regulates AR protein level (81). These finding underscore the complexity of androgen mediated autoregulatory mechanism that impinges on cell and tissue specific context as well as developmental stage (86).

Studies have shown that the AR level is under regulatory control of NFκB in cells. The pur alpha which binds at the 5ʹ UTR of AR promoter, suppressor elements, has been shown to down regulate the expression AR mRNA. In androgen independent prostate cancer cells, over expression of AR has been associated with epigenetic silencing of pur alpha (87). Furthermore, the AR protein level is regulated by miRNAs; miR34a and miR34c negatively regulate AR protein level (88).

12

Mechanism of gene regulation by AR

AR is a ligand inducible transcription factor of the receptor superfamily.

In the absence of ligand AR is localized primarily in the in complex with heat shock proteins in inactive form. Upon ligand binding, AR undergoes conformational changes which also triggers the translocation of the receptor from the cytoplasm to the nucleus (89). The binding of androgen to AR also induces AR modification such as phosphorylation which could facilitate the localization of the receptor notwithstanding other roles of the modification (90). The nuclear localized AR binds to the androgen response elements (AREs) in the promoter or enhancer regions of the target genes and regulates their expression (13, 73, 89, 91).

The transcriptional activity of AR is modulated positively or negatively by co- regulatory proteins known as co-activators or co-. In the presence of ,

AR and all class I nuclear receptors recruits the general co-activators such as the steroid receptor co-activator (SRC), CREB binding proteins (CBP), p300, p300/CBP associated factor (p/CAF), TR-associated proteins/ VDR-interacting proteins/ activator recruited cofactor (TRAP/DRIP/ARC) (13, 73, 89, 91) and facilitate the assembly of the general transcriptional machinery to activate transcription. The AR in addition recruits AR specific co-factors such as ARA70, AR50 and ARA54 to modulate the transcriptional activity (92); on the other hand upon antagonist binding AR preferential recruits co- complex, which include silencing mediators of retinoic acid and thyroid (SMRT) and nuclear receptor co-repressor (N-CoR), and deacetylase (HDAC) (93).

13

The recruitment of co-activators leads to the remodeling of a transcriptionally repressed chromatin and form a bridge between the receptor and the general transcription machinery (13, 73, 89, 91). Most co-activators such as p160 factors, CBP/p300, p/CAF have intrinsic histone acetyltransferase (HAT) activity which acetylates the residues in the histone tail. Such chromatin modification results in a relaxed chromatin which is accessible for the transcription machinery. In contrast, co-repressors such as the silencing mediators of retinoic acid and (SMRT) and nuclear receptor co-repressor (N-CoR) possess (HDAC) activity or associate with histone deacetylase complex and keep the chromatin in transcriptionally repressed state (94, 95). However, the actions of co-regulators are context dependent which is influenced by gene-specific and cell specific factors (40, 96, 97).

AR exerts its transcriptional effect by binding at the androgen response elements

(ARE) of the target genes. Functional AREs are found in both the enhancer and promoter regions (29, 98, 99). Experimental Studies using ChIP-chip assay have shown that androgen receptor regulates its target genes from a region as far as 100 kb from the transcription start site (100, 101). However, such long range transcriptional regulation of target genes by nuclear receptors have shown to require the synergistic interaction between the promoter and enhancer. Gene repression by AR, on the other hand, requires the active engagement of the promoter region only (102).

14

ARE dependent actions of AR

The consensus androgen response element is a palindromic sequence separated by

a 3 spacer. The classical response element for AR is GGTACAnnnTGTTCT

(103); however sequences that deviate from the consensus are reported in the natural promoter of genes (104). In addition, the AR binds naturally occurring selective AR direct repeat response elements besides the classical inverted repeat response elements.

The AR binds direct repeat response elements in a head to head orientation rather than head to tail. The selectivity of this response element for AR is due to the presence of additional strong interaction interface in the second zinc finger that stabilizes the AR dimers. On the other hand, GR and PR dimers don’t have this additional bond (have hole). Hence, the dimers are less stable and the interaction with direct repeat response element is suboptimal. This implies the AR generally forms head to head dimerization regardless of the DNA response elements organization (DR or IR). This also allows AR to bind divergent non-canonical DNA motifs (17, 104, 105). In addition AR binds ARE half sites as monomer and regulates target genes through synergistic interaction with other transcription factors (101).

There are two important questions with respect to the transcriptional activity of

AR, the requirement for binding to DNA (AREs) and the role of ligand for DNA binding.

Several lines of evidence have shown that androgen dependent gene activation requires

the binding of the AR to AREs. The binding of AR to the androgen response elements

(AREs) requires a conformational modification attained through hormone binding.

Furthermore, ligand binding is required for the formation of dimer at AREs (106, 107). 15

There are few studies that showed the binding of AR to AREs in the absence of hormone

in a cell free system (108-110). However, for optimal ARE mediated transcriptional

activity of AR exposure to androgens is required (106, 107).

With respect to the necessity of DNA binding by AR, it is generally assumed that

AR regulate target genes through ARE mediated signaling. Even though the requirement

for DNA binding is well established for some selected androgen regulated genes such as

KLK3, KLK2 (29, 98) there is no direct evidence that rule out the genomic action of AR

without direct DNA binding. Rather, few studies have shown that AR modulates target

genes without directly binding to the DNA (111-113).

Non-ARE mediated actions of AR

AR target gene promoter analysis has been done gene-by-gene basis for a limited number of genes (29, 98, 114). The ability of AR to regulate target genes from a distal enhancer located more than 100 kb from the transcription start site poses a considerable challenge for assigning binding sites to a specific gene. Nevertheless, it is a prevalent view that androgen receptor regulates its target gene though androgen response elements

(ARE). However, Non-classical (tethering) transcriptional mechanisms that do not require direct binding to DNA are demonstrated for nuclear receptors. Dimerization mutant GR that lacks the ability to bind DNA (GRE) has shown AP1 dependent gene repression as efficient as the wild type GR (115, 116).

16

Reichardt et al (1998) have generated dimerization-defective GR model by introducing a mutation within the D loop (A458T) of the DNA binding domain. The mutant GR does not bind cooperatively to GREs but can still repress AP-1 regulated genes. Interestingly GR knockout mice die shortly after birth whereas dimerization mutant GR mice are viable, indicating the mutant GR ability to support survival in GRE independent manner (36). Similarly, GR has been shown to physically interact and repress the transcriptional activity of NF-κB (117-119) and AP1 without directly binding to the DNA (37, 120). These studies have clearly demonstrated that GR regulates genes without directly binding to GRE though protein-protein interaction.

Estrogen receptor has also been shown to regulate target genes without directly binding to estrogen response element. Here, ER is recruited to a DNA bound AP1 (35) and SP1 protein (34, 121) to regulate target genes. ERβ has been shown to regulate androgen independent growth through KLF5 by non-classical mechanism (122).

In light of the structural similarities between GR and AR is it plausible to assume direct physical interaction between AR and NF-κB. Androgen has been shown to down regulate the expression of some NF-κB target genes that lacks ARE (123). The attenuation of IL-6 expression by androgen is an example which might suggest interaction between NF-kB and AR albeit repressive. In vitro studies utilizing transient transfection of AR and NF-κB driven reporter assays have shown mutual cross modulation between AR and RelA (112).

17

AR has been shown to interact physically with Ets family of transcription factors

to modulate the expression of target genes such as matrix metalloproteinases (MMP’s) in

prostate cancer cells. The expression of MMP1, 3 and 7 is down regulated by AR in a

manner dependent on DNA bound Ets-related family of transcription factor (ERM).

Furthermore, the repression of MMP’s is mediated by DNA binding and dimerization

mutant of AR which underlies the recruitment of AR to DNA bound ERM to mediate

transcriptional repression (113). A reciprocal co-activation between AR and ETV1 are also reported in prostate cancer (124).

Careful analyses of in vitro studies that compare androgen sensitive and resistant

cells indicate that the basal expression of PSA is significantly higher in androgen

resistant cells. Furthermore, AR regulates the basal expression of PSA without apparent

occupancy of the enhancer/promoter which suggests that PSA is regulated by AR

indirectly or through ARE independent mechanism (33). ARE independent

transcriptional activation by AR has also been reported in myoblast in which AR

regulates the activation of the skeletal alpha which is devoid of ARE. This action of

AR requires the recruitment of AR to DNA bound serum response factor at the skeletal

alpha actin gene promoter (38). Recent study by Norris et al (2009) has shown that the

transcription factor HOXB13 activates target genes in AR dependent manner.

ORM1 is an example of HOXB13 regulated gene that lacks ARE but contains binding

sites for HOXB13. The finding suggests the recruitment of AR to the DNA bound

HOXB13 as one mode of transcriptional regulation in the prostate development (40).

18

More recently Zhang et al (2010) have shown the recruitment of AR by a DNA bound

C/EBPα in a manner independent of androgen (39).

Physiological role of AR

The AR is a pivotal molecule involved in a variety of physiological functions such gender differentiation, development of bone and muscle mass, cognitive function, spermatogenesis, and development and maintenance of the prostate as well as other urogenital tissues (125-127).

The androgen receptor is involved in the embryonic development of prostate. The prenatal development of the prostate requires the interaction between the prostate stromal and epithelial cells; this interaction is dependent on the presence of functional AR on the urogenital mesenchymal cells (128). studies have shown that AR knockout mice lack prostate; individuals with complete androgen insensitivity syndrome due to inactivating mutation of AR also lack prostate. The postnatal development and maintenance of the prostate is still dependent on functional AR (129, 130).

AR is required for male and female reproductive function. AR is pivotal for spermatogenesis in male and for the development and function of ovarian follicles in female (131). In addition, androgen receptor promotes the growth of muscle mass by

19

activating protein synthesis and decreasing the degradation of protein (132, 133).

Inhibition of fat accumulation in men is another physiological function of AR which is mediated by inhibition of adipocyte differentiation in AR dependent manner (134). AR also affects hematopoiesis, coagulation, lipid, protein and carbohydrate metabolism, and psychosexual and cognitive behaviors (135).

The role of AR in the prostate

The prostate gland is composed of epithelial and stromal components. The epithelial compartment consists of secretory luminal cells, transit-amplifying cells and basal cells (136). Recent studies have shown that the transit amplifying cells secrete factors that induce the expression of AR protein in the stromal cells (136, 137).

The AR in the stromal and epithelial cells has distinct physiological function.

Upon androgen binding, the AR in the stromal cells activates the transcription and secretion of peptide growth factors such as insulin-like growth factor-1 (IGF-1), epidermal growth factor (EGF), and fibroblast growth factor (FGF) (136, 138). These peptide growth factors, termed as andromedins, diffuse through the basement membrane and bind to their cognate receptor in the epithelial cells, and support proliferation of the epithelia (136, 139). However, the binding of androgen to AR in the epithelial compartment suppresses the growth of epithelial cells and promote differentiation. As a result, the epithelial AR plays an important physiologic role in maintaining the

20

homeostatic balance of the prostate (128, 140-143). Interestingly, during prostate

tumorigenesis the AR in the epithelial cells supports proliferation, and the tumor growth

becomes stromal independent (139). This signifies an important biological switch in the

function of AR from growth suppressive to oncogenic role in the epithelial cells of the

tumor (144).

Prostate cancer and AR

Prostate cancer is one of the most common malignancies and the second leading cause of cancer related death in US men. In 2010, for example, a total of 217, 730 new cases were reported. In the same year 32,050 men died of prostate cancer in the US (4).

Multiple factors contribute to the high incidence of prostate cancer: rising aging population and improved screening methods probably constitute the major factor for the high report of prostate cancer cases.

Prostate cancer tumorigenesis

Tumors arise through the accumulation of somatic mutations that lead to uncontrolled proliferation, reduced and increase genomic instability. Tumor tissue composed of heterogeneous population of cells that contain several mutations that enables adaptation to the tumor microenvironment (145-148).

21

The exact molecular mechanisms of oncogenic transformation that lead to prostate cancer initiation are not precisely known. Deregulated signaling pathways such as Hedgehog, wnt/β-catenin, epidermal growth factor receptor (EGFR) and transforming growth factor (TGF-β) are proposed to represent a primary event for the initiation of prostate cancer (149-152). Several investigations indicate that prostate cancer is derived from a precancerous lesion termed as high grade prostatic intraepithelial neoplasia

(HGPIN) which is caused by a chronic accumulation of dysplastic lesions (153).

Demarzo et al. (1999) has put forward a model of prostate tumorigenesis suggesting prostate tissue injury as key player in the initiation of prostate cancer. Chronic inflammation of the prostate, that leads to the generation of oxidative and nitrosative radicals in the tissue microenvironment are implicated to set a fertile ground for neoplastic transformation of the prostate epithelium (154). These foci of proliferative prostate tissue injury are termed as proliferative inflammatory atrophy (PIA). It has been proposed that PIA is the precursor for prostate epithelial cell transformation (155).

However, it is not clear whether PIA leads to PIN or sufficient to cause malignant transformation independently.

Prostate tumorigenesis and AR

Different experimental model systems have been developed to understand the role of AR in prostate tumorigenesis. Most of the cell line model systems are derived from patients with advanced metastatic and/or hormone refractory disease. Because these models don’t mimic the early stage of the disease, have limitations in the understanding of the molecular alterations necessary for the prostate epithelial cells transformation.

22

Some lines of evidence have shown the oncogenic role of AR in immortalized and

transformed prostate epithelial cells in the prostate microenvironment (3, 10, 142).

The AR in the normal prostate epithelial cells is involved primarily in differentiation and growth suppression. Molecular alterations that lead to the conversion of AR signaling into epithelial cell proliferation represent an important event in prostate tumorigensis. The oncogenic role of AR has been demonstrated in a transgenic mouse model expressing prostate specific AR transgene (10). However, recent evidence showed that in the early stage of prostate epithelial cells of the prostate could loss

the growth suppressive function of AR without attaining dependence on AR for growth

(156).

Prostate cancer progression and AR

The progression of prostate cancer from androgen dependent into castration

resistant stage is a significant switch in the biology of prostate cancer. The androgen

receptor plays a central role in this progression. Prostate cancer cells are heterogeneous

with respect to the expression of AR (157, 158); however, the majority of prostate cancer

cells depend on androgen receptor for growth and survival. During androgen ablation

therapy, the androgen dependent cells undergo apoptosis and the tumor regress in size.

However, subpopulations of prostate cancer cells survive the androgen deprivation

therapy and repopulate the tumor. The majority of recurrent tumors expresses AR (16,

159-162) and frequently show an increased expression of antiapoptic protein such as Bcl-

2 (25, 163). Furthermore, recurrent tumors exhibit predominant nuclear localization of

23

AR which is consistent with the transcriptional role of AR in the tumor progression (105,

164). Both androgen dependent and castration resistant prostate cancer cells are dependent on AR signaling for their growth and progression. Several studies have shown the continued reactivation of the AR signaling in hormone refractory tumors (14, 162,

165, 166).

In androgen dependent prostate cancer, androgen receptor promotes G1/S transition through the induction of cdk1, cdk2 and cdk4 (164). In addition, growth promoting signals from several growth factor receptors signal through a multitude of interconnected pathways such as MAP , PI3K to support proliferation of prostate cancer cells (167). In castration resistant tumors, AR has been shown to promote G2/M transition through the activation of gene program which is distinct from androgen regulated genes (168). The growth promoting role of AR in androgen depletion insensitive cells has been independently established by Gonit et al (2011). In a totally androgen deprived condition, AR has been shown to activate target genes largely different from its androgen regulated genes that support cell cycle through non-classical pathways (169).

The molecular mechanisms of castration resistance

Androgen deprivation therapy is successful in deactivating the AR signaling and subsequent tumor remission. However, AR resumes its function by overriding this deactivating therapy. Hormone ablation insensitivity is a multifactorial process that

24

allows the prostate cancer cells to survive and proliferate in the absence or very low

levels of androgenic stimuli (2). Different molecular mechanisms are proposed to describe the mechanism which enables the tumor to escape hormonal therapy and acquire resistance. Even though, the contribution of each of the mechanisms described below is not systematically investigated, the evidences thus far suggest that these mechanisms may not be mutually exclusive.

Amplification/over-expression of AR

Amplification of AR gene has been shown in 30 % of recurrent prostate cancer who failed hormone deprivation therapy (8, 160, 162). However, hormone ablation naive tumors have not shown AR amplification. Such findings suggest that AR gene amplification is not causally associated with the tumorigenesis of the prostate cancer rather an acquired molecular mechanism for hormone resistance. Almost all cases of AR amplification investigated have shown to have increased levels of AR mRNA. Hence, the amplification and subsequent over expression of AR enables cancer cells growth under low androgen condition. The clonal expansion of such cancer cells under the selective pressure of androgen deprivation could leads to therapy failure (8, 170).

Apart from AR gene amplification, prostatic tumors show a spectrum of AR expression levels ranging from AR-positive to AR-negative cancer cell subpopulations within the same patient. Most metastatic prostate cancers show elevated expression level of AR (16, 159-162). The loss of Pur alpha, a transcriptional repressor of AR, is one determinant factor that leads to over expression of AR in castration resistant tumors (87).

25

Increased AR protein stability (15) and activation of AR promoter (12, 171, 172) have

been shown to increase AR level. Over expression of AR has been shown to confer the

cancer cells androgen independent growth under androgen ablation condition.

Furthermore, a modest increase in the AR level could be sufficient to hyper-sensitize the prostate cancer cells to residual androgen levels and promote castration resistance (14,

173, 174). Of note, several lines of evidence have shown the spectacular heterogeneity of prostate cancer with respect to the expression levels of AR. For example, Shah et al(2004) have shown an overall down regulation of AR in hormone refractory prostate cancer and speculated the role of an alternative AR bypass mechanisms in the progression of the tumor (148).

Mutation of AR.

The overall prevalence of somatic mutation in the AR coding region in prostatic tumors is very low; nevertheless, over 300 AR mutations are documented to date (175).

The level of recurring mutations in hormone refractory tumors is significantly higher

compared to treatment naive tumors. Suggesting specific mutations of AR play vital role

in tumor progression by providing proliferative advantage during androgen ablation

therapy (147).

The majority of AR mutations are identified in the amino terminal domain of AR

which is critical for the transcriptional activity, N-C interaction and nuclear localization

of the receptor. Mutations in the N-terminus domain have been shown to alter the

26

stability, localization and transcriptional activity of AR (9, 147). For example, W435L mutation, which is frequently seen in metastatic tumors samples from treated patients, results in a change of WxxLF motif to LxxLF motif (147). This weakens the ligand dependent transcriptional activity and increases the ligand independent activity of the receptor via enhanced binding to co-activators. In addition, the steady state level of AR increases since the mutation alters the sensitivity of the receptor for proteosomal degradation (176). In another example, E255K mutation has been shown to enhance the nuclear localization of AR in the absence of hormone (9, 147).

Recurrent mutation in the ligand binding domain of AR in hormone refractory prostate tumors is not uncommon. Mutations that occurs at the ligand binding domain

(LBD) of AR confers gain of function in which the AR activated by non-androgenic steroids such as estrogen or hydrocortisone. T877A mutation, found in LNCaP, leads to the activation of AR by antiandrogen, (177), and other novel mutation such as

W741C or W741L also leads to activation of AR by bicalutamide (178, 179). AR mutation provides proliferative advantage, therapy resistance and increased AR activity for the tumor cells.

AR splice variants

AR splice variants are reported in prostate cancer cell lines, xenografts and tumor samples. AR splice variants lack the hinge region, ligand binding domain and show constitutive transcriptional activity (77, 78). AR splice variants are androgen independent and their transcriptional activity is not controlled by either antiandrogen or by the

27

prototype AR. Hormone resistant cancer cell lines and tumors have shown increased

expression of AR variants. In addition, AR splice variants have shown to support

androgen independent growth (77, 78).

Novel AR splice variants such as C-terminal truncated isoform of AR (180),

isoforms that lack the ligand binding domain (77, 78) are implicated for castration

resistance and subsequent tumor progression. A recent study by Sun et al (2010) have

suggested the generation of a novel AR splice variant, in which exon 5, 6 and 7 are deleted, as one molecular mechanism that confers castration resistance. This AR splice variant is constitutively active, nuclear localized and supports the growth of tumor in castrated mice. Often times it is generated under low androgen conditions and support

androgen independent growth (181).

In contrast, Waston et al (2010) have challenged the idea implicating AR splice

variants as driver of hormone refractory growth. They have shown that the generation of

AR variants is as an acute response to androgen ablation therapy rather than selection for

AR clones that confers growth advantage. They also showed that AR splice variants are dependent on the full length AR, possibly through hetrodimerization, to exert their function. Even though earlier studies (77, 78, 181) have reported that the actions of AR variants are ligand independent; the contradictory finding by Waston et al (2010) suggests AR variants are functionally dependent on the full length AR. In addition, they have demonstrated that targeting the prototype AR would suffice to inhibit the action of AR variants (79). However, gene expression studies using full length AR

28

and AR variants have shown some differential gene regulation (78, 181). While further studies are required to arrive into consensus, the biology of AR splice variants probably be more complex and may not be the same as the full length AR.

Cross talk between AR and other growth signaling pathways

The activity of AR depends not only on the concentration of the hormone but also on the activity of signaling pathways that activate AR and its co-regulators. Several studies have shown that substantially modulate the function of nuclear receptors.

Based on sequence analysis for kinase consensus motif, AR contains over 40 predicted phosphorylation sites and the phosphorylation status of AR affects its transcriptional activity (90, 182). Receptor kinase signaling pathways such as epidermal growth factor receptor (Her2/neu), transforming growth factor-alpha (TGF-α), insulin-like growth factor receptor-1 (IGFR-1), and interlukin-6 (IL-6), keratinocyte growth factor receptor (KGFR) and their downstream kinases activate AR in the absence or very low levels of androgen. The post-translational modification of AR leads to increased transcriptional activity, protein stability and/or nuclear localization of the receptor (183-

187).

Growth factor signaling pathways are frequently overexpressed in prostatic tumors in the progression to hormone refractory stage. These pathways activate AR and restore its function in the absence of androgen (164, 183). For example, the over- expression of the Her2/neu in the androgen dependent LNCaP cells

29

allows androgen independent growth as well as activation of genes in the complete

absence of androgen (188). The phosphorylation of AR at specific residues, for example,

Ser-515 by MAPK and Ser-578 by PKC regulates the nuclear-cytoplasmic shuttling and

transcriptional activity of AR (189). The PI3K/Akt pathway (18, 190) and EGFR (189,

191, 192) play a prominent role in controlling the transcriptional function and stability of

AR through post translational modifications (187). Aberrant AR phosphorylation has been shown to support the proliferation of prostate cancer cells under androgen ablation condition (164, 193).

In addition to receptor tyrosine kinases, AR phosphorylation by non-receptor tyrosine kinase such as Src (194) has been demonstrated in the development of hormone resistant prostate cancer through an adaptive compensatory response to androgen ablation therapy.

Dysregulated co-regulator expression

The majority of recurrent prostate tumors over express the transcriptional co-

activators TIF2 and SRC1 (2, 12). Over-expression of these co-activators increases the transcriptional output of AR by adrenal androgens and other steroids. Genomic analyses of primary and metastatic tumor samples have shown a gain in copy number, increased mRNA expression as well as mutation of TIF2. The high expression of TIF2 increases the AR transcriptional activity under androgen ablation condition (195). Furthermore, over-expression of TIF2 and SRC1 strengthen the interaction between the AF2 domain of

AR with the LxxLL motifs of the p160 co-activators and enhance the transactivation of

30

AR in the absence of hormone (12, 144). Fujimoto and colleagues (2007) have shown

increased expression of ARA55, AR specific co-activator, in hormone resistant tumors

(196). Suggesting an increased activity of the co-regulator supports AR function in advanced recurrent prostate tumors. Hence, deregulated co-activator expression provides

AR enhanced transcriptional capacity to support proliferation under androgen ablation

condition.

The transcriptional activity of AR is negatively regulated by co-repressors. The number of co-regulatory proteins that repress the transcriptional activity of AR keeps growing. For example, prohibitin has been shown to co-repress AR, and it is expressed at low level in advanced prostate cancer (197, 198). The unique interaction between prostate tumor cells and macrophages in the tumor microenvironment releases NCoR/HDAC repressor complex from AR target genes and causes hormone resistance (199). The co- repressor Hey1, mediator of the notch signaling, represses the AR transcriptional activity.

In prostatic tumors Hey1 is excluded from the nucleus and the aberrant subcellular localization has been implicated for the development of hormone refractoriness (200).

The Erbb3 binding protein, EBP1, has been shown to physically interact with AR and down regulates its activity through the recruitment of Sin3A/HDAC2 complex.

Decreased expression levels of EBP1 in hormone refractory prostate cancer is associated with increased AR activity and contributes to the growth of cancer cells in androgen deprived environment (201). The deregulation of these and other co-repressors promotes castration resistant growth through derepression of AR genes.

31

AR bypass pathway

Prostate cancer cells can acquire molecular alterations that enable them to bypass

AR signaling for growth and survival; and these confer androgen ablation resistance (25,

163, 202). About 20-30 % of metastatic prostate tumors do not express AR (157, 203).

The loss of AR expression in a subset of cancer cells plays an important role in the

progression of prostate cancer. The lack of AR expression provides selective proliferative

advantage under androgen ablation condition. AR negative tumors, rather, depend on

alternative signaling pathways such as the epidermal growth factor, TGFβ to support

growth (2, 158).

Methylation of the CpG islands of the AR promoter is one mechanism for the

transcriptional inactivation of AR in these cells (158, 202). The proto- Bcl-2 has

been implicated in the AR bypass mechanism of hormone resistance (25, 163). Bcl-2

shows unique distribution pattern in the normal prostate epithelium, it is exclusively

expressed in the basal cells of the glandular epithelium which are resistant to hormone

ablation. The secretory epithelial cells, however, does not express Bcl-2. Large

proportion of tumors from hormone refractory adenocarcinoma show uniformly elevated

levels of Bcl-2 (25, 163). Bcl-2 results in increased cell viability, independent of cell division, by overriding apoptosis. Of particular note, androgen ablation therapy increases the expression of Bcl-2 in the prostate epithelium as a consequence of selection of cells

resistant to apoptosis. Even though, such increased expression of Bcl-2 is a secondary molecular event following androgen deprivation therapy, it confers hormone refractory

32

for the tumor cells and promotes progression of the cancer cells under low

androgen environment (25, 163).

Increased prostatic ligand availability

Androgen ablation therapy often times does not completely suppress androgen at the tissue level. For example, medical castration using gonadotrophin releasing hormone antagonist decreases only 75 % of the intraprostatic level (204). It is

implicated that the residual prostatic androgen of castrate patients sufficient to activate

AR. Suboptimal suppression of androgen following androgen deprivation therapy is suggested to contribute for the selection of resistant clones that could proliferate under low androgen environment (204, 205). In addition, increased expression of

involved in steroid has been suggested to increase the bioavailability of

intratumoral androgenic ligands to support AR action in androgen ablation resistant

tumor (206). Of particular note, the failure of antiandrogen therapy to block tumor

progression suggests the presence of clonal subpopulations that are totally androgen

independent. Similarly, a recent clinical trial using , 5α-reductase inhibitor, has shown the development of aggressive prostate cancer in the treatment group (207).

However, the blockade of intratumoral androgen synthesis using small molecules

inhibitor, abiratrone, which blocks CPY17, has shown antitumor activity implicating the

significance of intratumoral androgen for the development of resistance (208). However, the presence of tumor heterogeneity would allow a subpopulation of cells to circumvent hormonal therapy.

33

Prostate cancer management and therapeutic targets

The incidence of clinical prostate cancer is very rare in men less than 50 years of

age. Autopsy studies have shown that 27 % of men in their forties and 34 % of men in

their fifth decades of life show subclinical prostate cancer lesion in their prostate (17).

Since all localized prostate cancer will not progress to show clinical presentation, the

management of prostate cancer depends on the clinical stage, pathological stage, Gleason

sum, PSA level, the underling medical condition and age of the patient. So far studies

have not shown what biological characteristics dictate the progression of indolent early

lesions into a clinical prostate cancer (209).

Localized prostate cancer

Currently there is no optimal treatment guideline for localized prostate cancer and

remains to be controversial (210); hence the clinical decision is largely based on

informed discussion between the patient and physician on weighing the benefits and side

effects of each approaches. The available approaches are active surveillance/watchful

waiting, radical prostatectomy and radiotherapy. Of note, the clinical stage of the tumor,

histological grade, life expectancy of the patients, underling health conditions are

important considerations in deciding the treatment modalities (209).

Advanced (metastatic) prostate cancer

Hormone deprivation therapy is the mainstay in the management of locally advanced prostate cancer. Androgen ablation therapy is aimed at lowering the serum

34

level. Medical castration using luteinizing-hormone releasing hormone

(LHRH) analogues are used to lower the androgen level (211). Medical castration is usually used in combination with antiandrogen therapy to achieve total androgen blockade. Of note, the majority of patients on androgen ablation therapy invariably progress into a castration resistant stage (2).

Castration resistant prostate cancer

The majority of patients respond favorably to androgen ablation therapy with substantial tumor remission and decline of PSA level. However, most patients develop resistance to therapy characterized by tumor recurrence and biochemical relapse. Such tumors are refractory for further hormonal manipulation and progress into a lethal metastatic stage termed as hormone refractory prostate cancer or castration resistant prostate cancer or androgen ablation insensitive prostate cancer (2). Castration resistant prostate cancer has limited treatment options and grim prognosis. The median survival for hormone refractory prostate cancer patients is 16-18 months (2, 5). Three treatment approaches are used to manage patients that progress into hormone refractory state: additional hormone manipulation, chemotherapy and bisphosphonate therapy (212, 213).

Molecularly targeted therapies in prostate cancer

Signaling pathways that support the growth and progression of prostate cancer are

often perturbed and can be used as a target in the development of new treatment strategy.

35

For example, over-expression of the androgen receptor, aberrant activation of PI3K/Akt

pathway, increased expression of insulin like growth factor-1 (IGF-1), HER-2/neu (14,

214, 215) have been reported as driver of prostate cancer. A new generation anti

androgen receptor, MDV3100, has been developed for the treatment of castration

resistant prostate cancer (216). This experimental drug targets AR and inhibits its nuclear

translocation and recruitment of co-activators (216). To block the ligand dependent action

of AR, the androgen synthesis pathway has been explored as therapeutic target.

Experimental molecules specifically inhibiting CYP17, rate limiting in steroid

hormone biosynthesis, are under investigation to achieve complete androgen suppression

in the treatment of castration resistant prostate cancer (217).

Several small molecule inhibitors targeting PI3K/Akt/mTOR pathway have been

developed. Pre-clinical studies have shown that inhibition of mTOR induce apoptosis of

the prostate epithelial cells and reversal of neoplastic phenotype in PTEN-null murine

model of prostate cancer (218, 219). Currently, mTOR inhibitors in combination with docetaxel are under investigation in Phase I /II clinical trials for hormone refractory prostate cancer (220). Antiangiogenic agents targeting vascular endothelial growth factor

(VEGF) such as sunitinib and bevacizumab have shown significant activity in other tumors. Inhibition of angiogenesis by bevacizumab in combination with docetaxel has shown PSA response and well tolerated in phase II study of docetaxel pretreated hormone refractory prostate cancer patients (221).

36

An investigational monoclonal against RANKL, denosumab, has shown

to inhibit RANKL mediated osteoclastic bone resorption. A phase II clinical trial of

prostate cancer patients with bone metastasis have shown reduction of skeletal related

events and normalization of resorption in patients treated with denosumab (222, 223).

The ETS transcription factors

The ETS transcription factors are nuclear phosphoproteins that are involved in hematopoiesis, vasculogenesis, neuronal development, proliferation, differentiation and

oncogenic transformation (47). The ETS transcription factors contain a highly conserved

winged helix-turn-helix DNA binding domain. Several studies have shown that Ets

transcription factors are downstream effectors of the Ras-MAPK signaling cascade. The

transactivation of target genes, protein-protein interaction and stability of Ets is

modulated by phosphorylation status (46, 47, 224).

There are 27 ETS domain family members; however, two subfamilies are most

extensively studied. 1. The Ets subfamily which includes Ets1, Ets2, and Pointed (P2) has amino terminal pointed domain and C-terminal Ets DNA binding domain. This group has single MAPK phosphorylation site in their pointed domain. 2. The ternary complex factor

(TCF) subfamily which includes Elk-1, SAP-1, SAP-2/Net, in contrast have N-terminal

Ets DNA binding domain and C-terminal transactivation, protein–protein interaction

37

domain. TCFs have multiple phosphorylation sites on their transactivation domain (46,

47, 224).

ETS transcription factors in prostate cancer

The ETS transcription factors are linked to a variety of cancers through their

involvement in chromosomal translocation or over-expression in cancer as well as their

ability to mediate the signaling of aberrant oncogenic signaling cascades (47). Members

of the ETS transcription factors play role in the development and progression of prostate

cancer. In vivo mouse model have shown that elevated expression of ETS protein in the

prostate epithelial cells is sufficient to cause prostate hyperplasia and PIN lesion (124).

However, for the generation of full blown adenocarcinoma, synergistic interaction

between ETS transcription factors and other genetic alterations such as AR

overexpression, Akt activation, Pten knockdown is required (124, 225). The ETS

transcription factors such ETS variant 1(ETV1) has also been shown to promote the

progression into androgen independence as well as prostate cancer metastasis and

invasion (226, 227). The prostate specific Ets transcription factor (PDEF) has been shown

to modulate hormone independent gene activation in prostate cancer cells (228).

Several studies have shown that chromosomal translocation involving the ETS transcription factors is a common genetic alteration in prostate cancer (229, 230). The promoter region of genes which are either androgen regulated or constitutively activated

38

is fused to the coding region of ETS transcription factor members. ETV1, ETV4, ETV5

and ETS related gene (ERG) form fusion with various genes in prostate cancer (229,

230). The majority of prostatic tumors harbor TMPRSS2-ERG or TMPRSS2-ETV1 fusion (229, 230) which indicate the substantial deregulation of the ETS transcription factors and their role in the development of carcinoma. Recent study demonstrated that the TMPRSS2-ERG fusion promotes tumor progression by inhibiting the lineage specific differentiation role of AR and activating dedifferentiation program (231).

Elk-1 gene structure and domains

Elk-1 is member of the ternary complex factor (TCF) subfamily of the ETS transcription factors that contains the ETS DNA binding domain. The TCF subfamily of

ETS is comprised of three proteins: Elk-1, SAP-1 (Elk-4) and SAP-2 (Elk-3/Net) encoded by three different genes localized at different chromosome . Elk-1 is located at chromosome X (Xp11.2), SAP-1 and SAP-2 are located at 1q32 and 12q23, respectively (232).

Elk-1 is a modular protein consists of four domains. The N-terminus of Elk-1 that contains the ETS DNA binding domain forms domain A. The A domain also contains a conserved motif that recruits mSin3A-histone deacetylase co-repressor complex and act as a repressor domain (233). The B domain of Elk-1 contains a highly conserved sequence motif termed as B-box that forms interaction with SRF. This domain is also

39

involved in the interaction of other MADS box family of transcription factors. The C-

terminus of Elk-1 forms the C domain that functions as transcriptional activation domain.

The activation domain is the target of MAPK phosphorylation and consists of multiple

/ phosphorylation sites. The docking site for MAPK forms the D domain.

The D domain facilitates the recruitment of MAP kinase to the correct substrate and

confers additional specificity (234). Elk-1 also consists of the R motif which is a

repressor domain that dampens the transcriptional activation (48, 235).

There are three isoforms of Elk-1; the full length Elk-1 contains 428 amino acid residues, the short form of Elk1 (sElk-1) lacks the first 54 amino acid residues and it is generated by utilizing alternative translation start site. The third isoform, ∆Elk-1, contains

285 amino acid residues and it is an alternative splice variant of Elk-1 that has lost SRF binding site and part of DNA binding site (48, 236, 237).

Transcriptional regulation by Elk-1

Specificity of action by Elk-1

The Ets-domain transcription factor family comprised of 27 different transcription factors that are expressed in human cells. In vitro studies have shown that these transcription factors recognize a DNA core containing GGAA/T motif embedded in a 10 bp consensus sequence (47, 238). This poses the question how the ETS domain family members achieve specificity in the transcriptional regulation of target genes. The

40

presence of overlapping cis-elements suggests a potential functional redundancy. For

example, some overlap of binding site between Elk-1 and alternative ETS family

members such as GABPA has been reported (51). However, Elk-1 also regulates target

genes that do not overlap with other members of the ETS family of transcription factor

(238). Furthermore, disruptions of the ETS family members in mouse have shown

specific phenotype that indicates the non-redundant role of these factors. Suggesting

complex transcriptional mechanisms are employed to achieve in vivo selectivity.

Elk-1 exerts its transcriptional regulation through the formation of complex with a

heterologous transcription factor SRF in a subset of target genes. Studies using the FOS

gene promoter as a model system have shown that SRF is an essential partner of Elk-1 to

confer in vivo selectivity of the target genes (48, 49). Alternative ETS transcription

factors can also bind and regulate the promoter of some Elk-1 targets. Redundant

promoter occupancy by divergent ETS family members has been demonstrated in HeLa

and Jurkat T cells (51, 239). In addition, Elk-1 regulates target genes autonomously independent of ETS family members (50-53). It has been shown that phosphorylation of

Elk-1 facilitates SRF independent autonomous DNA binding of Elk-1 (240). Using microarray analysis and knockdown approaches Bross et al (2009) have shown the direct

regulation of genes by Elk-1 independent of SRF (51). A recent study employing ChIP- chip analysis have also shown the co-occupancy of Elk-1 and SRF account for only 22 % of the Elk-1 target genes in HeLa cells (50).

41

Specificity of gene regulation has also been demonstrated among the ternary

complex factor (TCF) subfamily of ETS transcription factor. Unique amino acid residues

play critical role to achieve specificity. Amino acid residues D38 and D69 of Elk-1 have

shown to confer differential binding specificity between Elk-1 and Sap1 and mutation of

these residues abrogate specificity (241). Structural studies have shown that TCF family members exhibit different DNA binding property. The differential binding property mediated by non-conserved amino acid residues located distal to the DNA binding domain that confer different interaction between the protein recognition helix and the

DNA (241, 242).

Transcriptional activation and repression by Elk-1

Elk-1 is involved in the activation and repression of genes. The transcriptional effect of Elk-1 is determined by the level co-regulators and cellular context (233). The

DNA binding and transcriptional activity of Elk-1 is regulated by phosphorylation (48,

243). In the absence of activation signal intermolecular interaction between the ETS

DNA binding and transactivation domain inhibits DNA binding. Phosphorylation of the

transactivation domain abrogates intermolecular interaction and relives the

autoinhibition. In addition, interaction between Id basic helix-loop-helix proteins (bHLH)

with the ETS DNA binding domain has been shown to sequester Elk-1 and prevents

DNA binding (244).

Elk-1 is MAP kinase inducible transcription factor that regulate the transient

expression of immediate early genes such as c-Fos, Egr1, Egr2, pip92 (48, 232, 233). Of

42

note, Elk-1 can also be activated by MAP kinase independent pathways involving novel

kinases (57). Studies have shown that Elk-1 constitutively bound the promoter region of

its target genes in the absence of activation stimulus. Elk-1 integrates signal from ERK,

JNK, p38 MAPK, hedgehog and Akt pathways (55-57). Upon activation by kinase,

phosphorylated Elk-1 has been shown to form complex with SRF at the SRE of c-Fos

promoter and recruits co-activators such as CBP, p300 and Sur-2 (245, 246). However,

the phosphorylation of Elk-1 is not necessary for the recruitment co-activators. MAPK

independent interaction between Elk-1 and CBP (245, 247) and between Elk-1 and p300

(248) has been demonstrated. However, phosphorylation of both Elk-1 and CBP is

required for functional cooperation (245, 247). The histone acetyl transferase (HAT)

activity of co-activator proteins catalyzes the acetylation of core histone to remodel the

chromatin for transcriptional activation.

The activation of immediate early genes is tightly regulated by cycles of

repression-activation-repression. Studies have shown that the rapid induction of

immediate early genes followed by down regulation. Hence, Elk-1 mediated gene

activation triggers the recruitment of co-repressor complex to down regulate expression.

In a prototypic model it has been shown that MAP kinase induced activation of c-Fos

stimulates the recruitment of mSin3A-HDAC repressor complex by Elk-1 to turn off the activation signal to the basal state. The histone deacetlylase activity of the repressor complex facilitates chromatin modification and transcriptional repression (233).

43

In the absence of activation, Elk-1 has been shown to repress target genes through

the recruitment of mSin3A-HDAC repressor complex (233). This Elk-1 mediated

repression is often times dependent on modification of Elk-1 by conjugation of small

like modifiers (SUMO). SUMOylation of the R motif confers additional

repression of the target gene promoter (249). Modification of the phosphorylation status of Elk-1 by protein phosphatase has also been shown to inhibit the transcriptional output of MAP kinase signaling (250, 251). The transcriptional output of Elk-1 is profoundly dependent on the balance between phosphorylation and dephosphorylation. Calcenurin

(PP2B) is an Elk-1 phosphatase which is activated by increased levels of nuclear down regulates Elk-1 through dephosphorylation (251). On the other hand, factors that enhance the phosphorylation of MAPK activate Elk-1. Of note, Elk-1 plays a central role in the transcriptional activation and repression of target genes by coordinating a plethora of extracellular stimuli (48, 55-57).

The role of Elk-1 isoforms in transcriptional regulation

The role of Elk-1 isoforms (sElk-1 and ∆Elk -1) in the transcriptional regulation has not been adequately investigated. The short form of Elk1 (sElk-1) expression is limited to neuronal tissues. Because of the deletion of the first 54 amino acids from N- terminal DNA binding domain, sElk-1 does not form complex with SRF and has low

DNA binding properties. The sElk-1 isoform has been shown to antagonize the transcriptional effect of Elk-1 (237).

44

Alternative splice variant of Elk-1, ∆Elk-1, has been isolated from cDNA clones

and the expression pattern of this isoform has not been studied.∆Elk -1 has lost SRE

interaction motif, the repressor sequence of the A domain and part of the DNA binding

domain. It shows different DNA binding properties and failed to form complex with SRF.

It has been shown to compete with full length Elk-1 and blocks SRF dependent gene

activation (236).

Physiologic function of Elk-1

The Ets transcription factors play pivotal role in a wide variety of physiological functions including cell proliferation, differentiation, survival and development (252).

Based on tissue expression pattern Elk-1 has been shown to support neuronal

proliferation and differentiation and probably involved in (253). However, disruption of Elk-1 in mouse has shown minor phenotypic abnormalities (144) probably due to the functional redundancy of TCF transcription factors. Hence it is imperative to generate double or triple knockout mice to characterize the physiological role of this molecule.

Elk-1 and prostate cancer

Elk-1 is involved in cell proliferation, survival and tumorigenesis. The oncogenic

role of Elk-1 is through the regulation of such as c-Fos whose role

45

in tumorigenesis has been demonstrated in in-vitro cell culture and animal model studies

(47). For example, a recent study has shown that the proliferative action of Elk-1 in

is attenuated by the recruitment of BRAC1 co-repressor (254). Elk-1 also

promotes cell survival by inhibiting apoptosis in neuroblastoma cells through SUMO

dependent repression of Egr-1 (255). Oncogenic chromosomal rearrangement of mixed

lineage leukemia (MLL) activates Elk-1 to support the pathogenesis of MLL fusion

leukemia (256). Furthermore, the oncogenic role of Elk-1 has been demonstrated in

human hepatocellular carcinoma (257). It has been shown that epidermal growth factor

promotes breast tumor development and metastasis by regulating plasminogen activator

inhibitor 1 (PAI-1) expression via Elk-1(258).

Growth factor receptors such as the epidermal growth factor, insulin like growth factor, platelet-derived growth factor are often times up-regulated in most prostate cancer tumors (259-261). Activation of these signaling pathways initiates a signaling cascade that promotes anti-apoptotic and pro-mitotic signals. The chronic activation of MAP kinase pathways in tumors activates Elk-1 target genes that are involved in the proliferation and subsequent progression of tumor. Ricote et al (2006) have shown that activation of IL-1 and TNF alpha leads to increased proliferation of prostate cancer cells through Elk-1 and ATF-2 through p38. The growth promoting function of Elk-1 has been

correlated with elevated levels of pElk-1 in prostate cancer tissue samples compared to normal control (262).

46

Chapter 2

Hormone Depletion-Insensitivity of Prostate Cancer Cells is Supported by the Androgen Receptor without Binding to Classical Response Elements

Mesfin Gonita, Juan Zhanga,1, Marcela d’Alincourt Salazara, Hongjuan Cuia, Aymen Shatnawib, Robert Trumblya,c, Manohar Ratnama,2

aDepartment of Biochemistry and Cancer Biology and cBioinformatics & Proteomics/Genomics Core Division, Medical University of Ohio, 3000 Arlington Avenue, Toledo, OH 43614 and bDepartment of Pharmacology and Cancer Biology, Duke University School of Medicine, Trent Drive, Durham, NC 27706.

(Published on Mol Endocrinol. 2011 Apr; 25(4):621-34)

1 Present address: Crown BioScience, Inc., Beijing, China.

2 To whom correspondence should be addressed at Department of Biochemistry and Cancer Biology, Medical University of Ohio, 3035 Arlington Avenue, Toledo, OH 43614. Phone: 419- 383-3862; Fax: 419-383-6228; E-mail: [email protected]

MG and JZ are Equal contributors

Grant support: this work was supported by NIH grant CA103964 and an endowment from the Harold and Helen McMaster Foundation to M.R.

47

Abstract

A need for androgen response elements (ARE) for androgen receptor (AR)-

dependent growth of hormone depletion-insensitive prostate cancer is generally presumed. In such cells androgen-independent activation by AR of certain genes has been attributed to selective increases in basal associations of AR with putative enhancers. We examined the importance of AR binding to DNA in prostate cancer cells in which proliferation in the absence of hormone was profoundly (~ 90 percent) dependent on endogenous AR and where the receptor was not up-regulated or mutated but was predominantly nuclear. Here, ARE-mediated promoter activation and the binding of AR to a known ARE in the chromatin remained entirely androgen-dependent and the cells showed an androgen responsive gene expression profile with an unaltered sensitivity to androgen dose. In the same cells, a different set of genes primarily enriched for cell division functions was activated by AR independently of hormone and significantly overlapped the signature gene over-expression profile of hormone ablation-insensitive clinical tumors. Following knockdown of endogenous AR, hormone depletion-insensitive cell proliferation as well as AR apoprotein-dependent gene expression were rescued by an AR mutant that was unable to bind to ARE but that could transactivate through a well- established AR tethering protein. Hormone depletion-insensitive AR binding sites in the chromatin were functional, binding and responding to both the wild type and the mutant

AR, and lacked enrichment for canonical or non-canonical ARE half-sites. Therefore, a potentially diverse set of ARE-independent mechanisms of AR interactions with target genes must underlie truly hormone depletion-insensitive gene regulation and proliferation in prostate cancer.

48

Introduction

The androgen receptor (AR) plays an essential role in the development and

physiology of the prostate by mediating the actions of the natural androgens, testosterone

and dihydrotestosterone (1). The major form of AR signaling is transcriptional (2, 3) with

a relatively minor contribution from its non-genomic/cytosolic interactions (4-6). Similar to other steroid receptors, the AR apo-protein occurs in a cytosolic complex containing heat shock proteins; ligand binding causes the receptor to dissociate from this complex and translocate to the nucleus (7) and to bind as a homodimer to a hormone response element in its target genes (8, 9). The agonist bound AR molecule then recruits co- activators; in contrast, when bound to antagonists, co-repressors are preferentially recruited (10, 11). AR shares the typical domain structure of other steroid receptors (12) but also has several distinctive characteristics in its structural and functional organization

(2, 13-16) including its ability to bind as a homodimer to both direct and inverted repeat androgen response elements (AREs) (17).

AR is also commonly expressed in malignant prostate where it is believed to support both androgen-dependent growth and subsequent refractoriness to androgen ablation (18-21). The development of androgen ablation-insensitivity presents a major problem in treating prostate cancer that in its early stages responds well to androgen ablation (22). AR may support androgen-independent growth of prostate tumors through one or more mechanisms notably, up-regulation of AR, AR mutations, an altered AR co-

regulator complement and changes in the phosphorylation or acetylation status of AR

49

(22, 23). Dysregulated signaling pathways that support androgen-independent prostate cancer growth including MAPK, PI3/AKT and PKC converge on AR (24, 25). Cellular and molecular changes in hormone depletion-insensitive prostate cancer cells apparently enable AR to enter the nucleus and regulate genes independently of androgen.

Although DNA sequence variations of the ARE and its interactions with AR have been well characterized (26), the functionally relevant AREs from which individual androgen-responsive genes are regulated have only been definitively identified for a

limited number of genes since AR appears to commonly regulate its target gene

promoters from multiple sites at great distances from the target promoter, generally >10

kb (27, 28). Nevertheless, the concept of ARE-mediated gene activation by androgen

extends to the prevalent view of transcriptional regulation by AR in all hormone

depletion-insensitive cells. For example, it has been demonstrated that over-expression of

AR in prostate cancer cells will sensitize the cells to post-ablation levels of androgen in

vivo or up to an 80% lower androgen concentration in vitro and also result in an agonist

response to classical androgen antagonists (23). It has also been suggested that AR

mutations that alter its ligand specificity may enable its activation by cross-reacting

ligands and anti-androgens in hormone depletion-insensitive tumors (29-31). In both

these cases (i.e., hyper-sensitization and altered ligand specificity), the ligand bound AR

requires a functional DNA binding domain and therefore it appears to exert its

transcriptional activity through its classical mechanism by binding to response elements

in its target genes (23). On the other hand, post-translational modifications and some

mutations of AR associated with androgen-independent growth of prostate cancer have

50

been presumed to alter its conformation, not only allowing hormone depletion-insensitive

nuclear localization of the receptor but also its association as a homodimer with target

AREs (22, 24, 32, 33).

There is not an adequate amount of direct and unequivocal evidence for a

necessary role for AREs in situations in which AR signaling supports the proliferation of

prostate cancer cells completely deprived of hormone (i.e., in “truly” hormone depletion-

insensitive cells). In a recent study of hormone depletion-insensitive cells (34) specific

AREs were assigned to a few selected AR-activated genes based on an increase in androgen-independent association of AR compared to the same regions in hormone- sensitive cells. Nevertheless, androgen further increased the binding of AR at those sites in the hormone depletion-insensitive cells indicating that the binding of AR to those

AREs was suboptimal in the absence of androgen. On the other hand in hormone depletion-insensitive cells, the well-established AREs of the androgen responsive PSA gene (35-37) are not occupied by AR in the absence of hormone (38), indicating that AR either targets such genes indirectly or that it acts through an ARE-independent mechanism. Identification of hormone depletion-insensitive sites of AR binding in the chromatin of hormone depletion-insensitive cells has been limited by the less extensive and weak signals obtained by chromatin methods (34). It was the goal of this study to use a different approach to examine the importance of AREs in the activation of genes critical for the growth of hormone depletion-insensitive prostate cancer cells. This information is of obvious importance for the design of mechanism

51

based treatment strategies, particularly in view of the fact that many advanced prostate

tumors do not have amplified AR or show heterogeneity in AR expression levels.

The AR-positive LNCaP prostate cancer cell line is heterogeneous and is known

to become androgen-independent after extended growth in vitro or in castrated mice in

vivo. Androgen-independence of the late passage LNCaP cells presumably reflects

selection pressure for a subpopulation of cells identified by profiling of cluster

designation cell surface markers (39), especially when androgen is unavailable or is

limiting. Hormone depletion-insensitive LNCaP cells developed by serial transplantation

of tumor xenografts in castrated mice tend to survive by acquiring hypersensitivity to

post-ablation levels of androgen in association with up-regulation of AR (23). In contrast,

we found that a sub-population of LNCaP cells selected for during prolonged growth in

vitro (named LP50 cells) exhibited AR-dependent but truly hormone depletion- insensitive growth, i.e., without an associated increase in AR expression or hyper- sensitization to androgen. Since advanced prostate tumors are quite heterogeneous with respect to AR expression (40, 41), we chose the LP50 cells as a reasonable model to examine the role of AREs in AR signaling in the context of truly hormone depletion- insensitive cell proliferation.

Results

Proliferation of LP50 cells is AR-dependent but hormone depletion-insensitive without an associated increase in AR. LNCaP is a heterogeneous cell line that was

52

derived from a hormone ablation-insensitive prostate tumor, but the cells in early passage

(EP-LNCaP) are known to exhibit androgen-dependence. Under normal culture

conditions, LP50 cells grew more rapidly than EP-LNCaP cells, with a doubling time that

was half that of EP-LNCaP cells. Addition of the synthetic androgen, R1881 did not

influence the growth of LP50 cells in hormone-depleted media (Figure 1A). The basal

level of the AR protein as well as AR mRNA in LP50 cells was comparable to that of EP-

LNCaP cells (Figure 1B). Further, the sequencing of reverse transcribed endogenous AR

mRNA in LP50 cells showed an identical sequence to that in EP-LNCaP cells. However

LP50 cells showed a higher level of mRNA for prostate specific antigen (PSA) (Figure

1B).

R1881 stimulated the incorporation of 3H-labeled thymidine in EP-LNCaP cells

(Figure 1C) but did not significantly stimulate [3H]thymidine incorporation in LP50 cells

(Figure 1D), although the uptake and functionality of R1881 in LP50 cells was apparent

in consideration of its known ability to stabilize AR (Figure 1D, inset). Infection of LP50

cells with AR shRNA lentivirus resulted in a knockdown of AR to an undetectable level

(Figure 1D, inset) and an inhibition of proliferation by >90 percent (Figure 1D); this

demonstrates a profound dependence of LP50 cells on hormone depletion-insensitive AR

signaling.

The AR in LP50 cells is localized in the nucleus. The intracellular localization of AR

observed by confocal microscopy was predominantly nuclear in LP50 cells even in the

absence of hormone (Figure 2A); in contrast the EP-LNCaP cells generally showed a

53

mixed distribution of AR between the nucleus and the and a dependence on

androgen for nuclear localization of AR (Figure 2B). In LP50 cells, hormone depletion-

insensitive nuclear localization of AR is consistent with its ability to support androgen-

independent proliferation.

Functional and physical association of AR with the ARE requires androgen in LP50

cells. The ability of AR in LP50 cells to activate through the classical PSA enhancer was

studied using transfected promoter-luciferase reporter constructs. The PSA promoter plus enhancer region including 6.1 kb of upstream DNA sequence is known to be activated by androgen and AR by the binding of the receptor predominantly to a cluster of AREs located at -4366nt to -3874nt. As a negative control for ARE-mediated effects, cells were also transfected with the same promoter construct in which only the AREs were deleted.

R1881 stimulated the promoter activity in an ARE-dependent manner (Figure 3A). Co- transfection of AR shRNA plasmid effectively knocked down AR as evident from both the western blot (Figure 3A, inset) and the inability of R1881 to activate the promoter

(Figure 3A). Knocking down AR did not significantly affect the basal PSA promoter activity (Figure 3A), indicating that AR could not functionally associate with the ARE in the absence of hormone.

The ability of AR to associate with AREs in the chromatin context in situ was also tested in LP50 cells by chromatin immunoprecipitation (ChIP) analysis. The major cluster of AREs within the PSA enhancer region (-4366nt to -3874nt) was chosen as the target region for the ChIP assay. The AR ChIP signal was strikingly enriched in the

54

R1881 treated cells relative to the input genomic DNA but there was not a significant

enrichment in the absence of hormone (Figure 3B) indicating the requirement for

hormone for AR to physically associate with the ARE in situ.

LP50 cells are not hyper-sensitized to androgen. It has been demonstrated (23) that

androgen-independent prostate cancer cells could simply be sensitized to lower androgen concentrations rather than being truly androgen-independent; hyper-sensitization to

androgen was associated with an increase in AR expression. Although LP50 cells did not

have elevated AR, it was nevertheless of significance in this study to test whether they

had acquired hypersensitivity to androgen by any other means. Therefore, the R1881 dose

dependence for induction of endogenous PSA mRNA was compared between EP-LNCaP cells and LP50 cells. Following hormone depletion, both cells showed a similar R1881 dose response, which was optimal at 50 pM (Figure 4). Therefore, LP50 cells are not hyper-sensitized to low levels of R1881 compared to their androgen-dependent

counterpart and are thus truly androgen-insensitive.

In hormone depleted LP50 cells, the AR activated gene set is primarily enriched for

cell division functions and reflects gene over-expression in advanced prostate

tumors. The influence of completely knocking down AR (using shRNA lentivirus, see

Fig. 1D, inset) on the mRNA profile of LP50 cells was examined in the absence of hormone by Affymetrix DNA microarray analysis. For this purpose RNA was obtained from hormone-deprived control and AR knockdown cells. A decrease in the basal expression by > 50 percent was observed for a total of 2015 probe sets upon knocking

55

down AR (annotated gene list provided in Supplement 1). The Affymetrix IDs for the

genes down 2-fold or more (1291 IDs) were submitted to the DAVID server (42) for

functional classification. Compared with the background set of all human genes, this

group was predominantly enriched for gene clusters supporting cell division.

The possible relevance of the genes identified in LP50 cells as targets of hormone

depletion-insensitive regulation by AR to clinical prostate cancer progression was

examined. Tomlins et al (43) have recently reported the pattern of mRNA up-regulation

associated with the malignant epithelial cells in clinical metastatic (hormone ablation-

insensitive) prostate tumors by examining a platform of ~10,000 unique genes. The

Affymetrix platform used in the present study to identify genes up-regulated in LP50

cells by AR independent of hormone represents ~20,000 unique annotated genes. Of the

1291 AR-regulated (independent of hormone) genes identified in this study 593 were

represented in the platform used by Tomlins et al.; this subset of genes was therefore used

to examine overlap with the genes up-regulated in the Tomlins study. A comparison with

the top 5% genes (505 genes) most consistently over-expressed in the metastatic tumors

(Figure 5A) showed an overlap of 81 genes (16%); this overlap is highly significant, with

a P-value of 4 X 10-7 and the average fold-up-regulation of these genes by AR in LP50 cells was 4.21. A comparison with the top 1% most consistently over-expressed genes in the metastatic tumors (99 genes) (Figure 5B) showed a match of 28 genes (28%). This correlation was highly significant, with a P-value of 2.7 X 10-16. The average fold-up- regulation of the overlapping gene subset by AR in LP50 cells was 3.31; for comparison, the average fold-change for the 1291 AR-dependent genes was 3.47. The annotated gene

56

lists are provided in Supplement 2. Using the David server for gene ontology analysis as

above, the set of 81 overlapping genes was also predominantly categorized as gene

clusters with cell division functions, with the lowest P-value of 2.7 X 10-18 for mitotic

cell cycle.

The results demonstrate that the pattern of hormone depletion-insensitive gene

regulation by AR, observed in LP50 cells, is both functionally and clinically relevant to

advanced prostate cancer.

A distinct set of AR regulated genes in LP50 cells is early androgen-responsive with

only a few among them showing partial androgen-independence. The effect of R1881 treatment on the mRNA profile of LP50 cells was determined by Affymetrix DNA microarray analysis. A total of 114 unique annotated genes showed a > 2-fold increase in

expression within 6h of treatment indicating that the ability of androgen to strongly

activate genes was retained despite the progression to hormone depletion-insensitivity

(annotated gene lists provided in Supplement 3). Among the androgen-responsive genes the basal expression of only 17 genes was also decreased by knocking down AR in LP50 cells. This subset of genes represents <15 percent of the 6h androgen responsive genes

(Figure 5C).

ARE-independent gene activation and hormone depletion-insensitive cell

proliferation are supported by a DBD mutant of AR. A mutant form of AR (mutAR)

that lacked the ability to bind to ARE was used as a tool to directly test whether the

57

ability of AR to support proliferation of LP50 cells was independent of ARE,

notwithstanding the limitation that the mutation could also partially or fully disrupt other

modes of interaction with target genes. mutAR was identical in amino acid sequence to

that of the endogenous AR in LNCaP cells with the exception that it contained a V581F

mutation in its DBD; the V581F mutation has been previously demonstrated to disrupt

DNA binding (44). mutAR also contained silent mutations to eliminate the target

sequence for knockdown by AR shRNA. In EP-LNCaP cells in which endogenous AR

was knocked down, ectopic mutAR was unable to rescue androgen activation of known

androgen target genes (Figure 6A). mutAR was also unable to activate an ARE-driven

promoter-luciferase reporter in transfected HeLa cells in contrast to the wtAR (Figure

6B). Both wtAR and mutAR however, were able to activate an artificial minimal

promoter-luciferase reporter construct containing three tandem C/EBP elements upstream

of a TATA box [(C/EBP)3-TATA-Luc]; the promoter activation was dependent on

C/EBPα, a well-established AR tethering protein (45) and the activation was hormone depletion-insensitive (Figure 6C). Further, among the androgen responsive genes tested in Figure 6A, the basal level of TMPRSS2 was decreased upon knocking down endogenous AR in hormone-depleted LP50 cells; ectopic mutAR recued the basal expression of TMPRSS2 (Figure 6D).

Both mutAR and AR shRNA plasmids were introduced into LP50 cells by electroporation, which yielded a transfection efficiency (determined using a co- transfected GFP expression plasmid) of approx. 50 percent. AR shRNA knocked down the endogenous AR mRNA and protein (Figure 7A) and decreased cell proliferation

58

(Figure 7B). Ectopic mutAR expressed at a level that compensated for the loss of

endogenous AR in the AR knockdown cells (Figure 7A, inset) completely rescued cell

proliferation (Figure 7B). The approx. 50 percent decrease in AR caused by the AR

shRNA represents 100 percent decrease in AR in the transfected sub-population of cells.

This is proven in Figure 3A in which AR shRNA was co-transfected with an ARE-driven promoter-Luc and where the response of the promoter to R1881 was completely abrogated demonstrating that the knockdown of AR was complete in the transfected sub-

population of cells. Therefore, the rescue of proliferation by mutAR observed in Figure

7B could not be due to heterodimerization of wt and mutAR.

The results demonstrate that in LP50 cells AR activates genes in the absence of

hormone and supports hormone depletion-insensitive cell proliferation in LP50 cells

without requiring the binding of AR to ARE.

Chromatin sites of hormone depletion-insensitive AR recruitment are functional

and lack AREs. In the chromatin context, androgen commonly appears to regulate target

genes by inducing the binding of AR at AREs located at great distances (>10 kb) from

the target promoters (27). In the absence of hormone however, global ChIP analysis

showed less extensive and relatively weak signals for AR binding to chromatin even in

hormone depletion-insensitive cells (34) but this could possibly reflect a limited

efficiency of immunoprecipitation of AR in its hormone depletion-insensitive modes of

chromatin binding. The present study sought to use ChIP-chip analysis of LP50 cells to identify a limited set of genomic DNA sequences that gave detectable signals for

59

hormone depletion-insensitive AR binding, to examine whether those sites indeed lacked

AREs and to functionally test the ability of selected sequences to recruit AR in the

absence of hormone. Accordingly, the Roche-Nimblegen promoter tiling arrays covering

promoter regions -3500nt to +1000nt were chosen for the analysis. The number of

androgen-independent peaks of chromatin associations of AR within this limited array was 113 with a false discovery rate (FDR) of <0.01 (peak list provided in Supplement 4) all of which gave relatively weak ChIP signals (<2-fold enrichment relative to input

DNA). The peak sequences were submitted to the Trawler program (43) to identify over-

represented sequences. The analysis yielded several families of motifs, but none

matching ARE half-sites. Peak DNA sequences were inserted upstream of the minimal

promoter within the pG5luc reporter plasmid and tested in HeLa cells for their ability to

enhance promoter activity in response to ectopic AR, independent of hormone. HeLa

cells were chosen for this experiment because they lack endogenous AR and because in

these cells over-expressed ectopic AR enters the nuclear compartment without the need

for ligand binding (45). Among the 15 most intense peaks, 5 peak sequences were cloned

into pG5luc based on the availability of suitable flanking sequences for specific PCR

amplification from genomic DNA. All of the five sequences promoted androgen-

independent transactivation by wtAR and three among them supported androgen-

independent transactivation by mutAR in the range of 2-fold to 6-fold (Figure 8A)

indicating that the ChIP-chip peaks include non-ARE sites of relatively strong hormone

depletion-insensitive action of AR despite their relatively weak ChIP signal.

60

To further validate the chromatin sites selected above, the ability of endogenous

wtAR as well as mutAR to bind to those sites in situ was tested by chromatin

immunoprecipitation (Figure 8B). Only 4 of the 5 sites were tested because of the

inability to develop a suitable TaqMan probe for one of them. In all cases, the

endogenous wtAR bound to the chromatin sites, consistent with the ChIP-chip data and

the ChIP signal decreased when the wtAR was knocked down by transfected AR shRNA

(transfection efficiency, ~50 percent). The ChIP signal was rescued when mutAR was co-

transfected with the AR shRNA (Figure 8B). The mutAR was apparently recruited to all of the sites (Figure 8B) regardless of its ability to be functional (Figure 8A), suggesting that the mutation may interfere in some instances with its function.

The above results demonstrate that in LP50 cells AR may be recruited in a hormone depletion-insensitive and functional manner, to chromatin sites that lack ARE, without the receptor binding directly to DNA.

Discussion

The foregoing studies contradict a common perception that in prostate cancer cells that are truly hormone depletion-insensitive, AR supports proliferation through androgen-independent transcriptional signaling by a mechanism that essentially mimics its classical ligand-dependent gene activation at AREs. The LP50 cell model of hormone depletion-insensitive prostate cancer used in this study, showed a profound dependence on AR for hormone depletion-insensitive growth. In these cells, the endogenous AR was

61

not up-regulated or mutated and retained the same androgen dose response as its hormone-sensitive counterpart for gene activation by the classical mechanism, indicating that its ability to support cell growth was not associated with hyper-sensitization to androgen. Further, LP50 cells showed a molecular profile of hormone depletion-

insensitive gene regulation by AR that represented advanced clinical tumors. In addition,

in these cells the genes most highly up-regulated by AR in a hormone depletion- insensitive manner including the subset consistently over-expressed in clinical tumors were primarily genes supporting cell division. Although the AR in these cells still retained its ability to activate genes in an androgen-dependent manner, the majority of the early androgen target genes nevertheless were excluded from the large set of genes

directly or indirectly activated by AR in the absence of hormone. The set of genes

supported by AR in the absence of hormone in LP50 cells was essentially functionally

similar by gene ontology analysis to that previously reported by Wang et al (34) in

LNCaP-abl cells although the degree of AR dependence for growth as well as gene

expression was generally greater in LP50 cells.

Within the LP50 model, in addition to the existence of two distinctive gene

regulation profiles, several lines of evidence made a clear distinction between the

classical mechanism of androgen-dependent gene regulation and the mechanism of

hormone depletion-insensitive gene activation by AR. Hormone depletion-insensitive

gene activation by AR supported cell proliferation without direct binding of AR to ARE.

The evidence for this conclusion includes studies of physical and functional associations

of AR with known AREs both in promoter constructs and in the chromatin. Wider

62

functional chromatin associations of AR were also unrelated to AREs. Further evidence

was provided by using a mutant AR defective in DNA binding but that could

transactivate a promoter through a well-established AR tethering mechanism (i.e.,

C/EBPα). The mutant AR (i) rescued basal expression of TMPRSS2 following its

decrease due to knockdown of endogenous AR in LP50 cells, (ii) physically and

functionally associated with chromatin sites that lacked ARE and (iii) supported hormone

depletion-insensitive proliferation of LP50 cells.

AR was localized primarily in the nucleus in LP50 cells even in the absence of

hormone. It follows that in the context of transcriptional signaling by AR in the complete

absence of hormone, one essential role of cellular changes or changes related to the AR

protein is to permit hormone depletion-insensitive entry of AR into the nucleus, although the precise mechanistic basis for the predominantly nuclear localization of AR in LP50 cells was not investigated in this study.

It is formally possible that some unidentified AR agonist is synthesized by LP50 cells, accounting for the nuclear localization of AR in hormone deplete cells and/or gene activation by the receptor. If this were the case, the putative agonist must be readily displaced by R1881, since the androgen dose response for gene activation is the same in

LP50 cells vs. EP-LNCaP cells. Further, the putative agonist must not support the classical mechanism of gene activation by AR through association with AREs.

63

The studies indicate that in LP50 cells, AR must associate in a hormone

depletion-insensitive and functional manner with chromatin sites that do not contain

classical response elements. Therefore, the functionally significant hormone depletion-

insensitive associations of AR must occur through tethering mechanisms. Although AR

could conceivably influence gene transcription through different mechanisms that are

independent of its ability to bind to DNA, tethering of AR by DNA-bound proteins offers the most likely mechanism for global gene regulation. Tethering mechanisms have been well studied for other steroid receptors, particularly the (ER). Gene activation by ER is known to occur by recruitment of the receptor to its target genes by

DNA bound transcription factors such as Sp family proteins (46) and AP-1 (47). AR is known to repress gene activation by AP-1 and NFkB (RelA) but this appears to occur indirectly, principally through sequestration of limiting amounts of the co-activator, CBP

(48, 49). Gene activation through AR tethering however, has not received adequate attention. It has been reported that in myoblasts, AR activates the skeletal α-actin gene through its recruitment to the target promoter by serum response factor (50). HoxB13 can act as an AR tethering transcription factor during prostate development (51) . We have recently found that C/EBPα, which is a co-repressor of AR, also redirects the transcriptional activity of AR by tethering it to C/EBP elements (45); C/EBPα is a tumor suppressor which is absent in LNCaP cells but is expressed in the nucleus of differentiated prostate epithelial cells (52). Recent studies examining the components of

AR interactomes in LNCaP cells have identified a variety of DNA bound transcription factors that physically associate with AR (53). Many of the candidate AR tethering proteins are substantially up-regulated in advanced prostate tumors (Oncomine database)

64

and studies are underway in this laboratory to systematically examine the potential role of

AR as a hormone depletion-insensitive co-activator of each of them.

AR is distinct from other Class I nuclear receptors in that it can form dimeric conformations that can bind to both direct and inverted repeat elements (26). In the absence of hormone, tethering factors may be able to recruit AR to the target promoters as a monomer; this is evident for the recruitment of AR by C/EBPα (45) and is an issue that warrants investigation for other AR tethering proteins as well. Another important characteristic of gene activation by tethered AR evident from our studies of AR-C/EBPα interactions (45) is that it is insensitive to flutamide, a classical androgen antagonist. AR is also distinctive in terms of specific characteristics of its activation functions and co- regulator interactions (2, 13-16) which should be re-examined in the context of tethered associations of AR with its target genes.

The frequency and extent of the contribution of known molecular events associated with hormone depletion-insensitivity in clinical prostate tumors is unclear; however, AR over-expression is frequently observed in metastatic prostate tumors

(please see Oncomine database) and only a few-fold increase in AR expression has been shown to confer sensitization to post-ablation levels of androgen in prostate cancer cells and to cause a functional switch of classical AR antagonists to (23). Whereas, the tumors hyper-sensitized to androgen in this manner could conceivably be treated with a new generation of androgen antagonists (54), the tumors are themselves heterogeneous in terms of AR expression (40, 41) and cells within the tumor could circumvent such

65

therapies by acquiring “true” hormone depletion-insensitivity. It is implicit from the

present studies of the LP50 model that in the progression of prostate cancer to true

hormone depletion-insensitivity, the cells not only acquire the ability to translocate AR into the nucleus independent of hormone but that they also become reliant on non- classical mechanisms including tethering to activate a largely different set of target genes.

Significantly, our recent studies (45) of one AR tethering protein (C/EBPα) demonstrated

insensitivity of this mechanism to a classical androgen antagonist. Future studies should

reveal whether progression to androgen-independence is accompanied by either over-

expression or de novo expression of critical AR tethering proteins and whether the

tethering proteins are causally associated with hormone depletion-insensitivity or are only

critical for supporting it. In any event, the development of peptidomimetic or other agents

that target critical AR tethering proteins or their interactions is a conceivable approach to

treating such tumors.

Materials and Methods

Chemicals, and reagents. Dulbecco’s minimum essential medium (DMEM),

RPMI 1640, sodium pyruvate, and penicillin/streptomycin/L- stock mix were purchased from Life Technologies, Inc. (Carlsbad, CA). Fetal bovine serum (FBS) and charcoal stripped FBS (CS-FBS) were from Invitrogen (Carlsbad, CA). Luciferase assay reagents were from Promega (Madison, WI). Affinity-purified rabbit anti-human antibodies to AR (AR-N20 and AR-C19), normal rabbit IgG control (sc-2027) and mouse anti-human antibody to GAPDH (sc-47724) were purchased from Santa Cruz

66

Biotechnology (Santa Cruz, CA). Peroxidase or FITC conjugated secondary antibodies

were from Vector Laboratories (Burlingame, CA). Cell Line Nucleofector Kits (R) were

purchased from Amaxa Biosystems (Germany). Custom oligonucleotide primers were from Life Technologies (Carlsbad, CA). LipofectamineTM 2000 reagent was from

Invitrogen. FUGENE 6 was purchased from Roche Diagnostics (Indianapolis, IN). Vent

DNA polymerase was purchased from New England Biolabs (Beverly, MA). Custom

oligonucleotide primers were from Integrated DNA Technologies (Coralville, IA). The

reagents for RT-PCR and real-time PCR including inventoried TaqMan probes (for

RHOU, EAF2, IGF1R, TMPRSS2, TMEPAI, KLK3) were purchased from Applied

Biosystems (Branchburg, NJ). Custom made TaqMan probes (for AR, GAPDH, selected

genomic fragments) were ordered from Integrated DNA Technologies (Coralville, IA).

Pfu DNA polymerase was from Stratagene (La Jolla, CA).

Promoter constructs and expression plasmids. The PSA promoter-luciferase reporter construct (PSA Promoter-Luc) contains 6.1 kb of DNA sequence upstream from +12nt.

The delARE-PSA Promoter-Luc construct is derived from PSA Promoter-Luc by deletion of only the AREs that include -4366 nt to -3874 nt and an additional internal deletion of -

170nt to -159nt. (C/EBP)3-TATA-luc was made by cloning the appropriate annealed

oligos with the addition of KpnI(5’) and NheI(3’) terminal restriction sites into the large

segment of GAL4-TATA-Luc digested by KpnI and NheI. (C/EBP)3 is a 3-tandem repeated C/EBP consensus element, (TGCAGATTGCGCCAATCTGCA)3; the sequence underlined is the central binding motif. Genomic sequences corresponding to androgen- independent AR enrichment peaks identified by ChIP-chip analysis were amplified by

67

PCR and cloned upstream of the minimal promoter in the pG5luc plasmid (Promega,

Madison WI) by replacing its GAL4 element at KpnI and NheI restriction sites. The

Renilla luciferase transfection control in the pRL-null plasmid was from Promega

(Madison, WI). The expression plasmid for AR (pSG5-hAR) was kindly provided by Dr.

Lirim Shemshedini (University of Toledo). The AR-specific shRNA and non-targeting

shRNA control in the lentiviral expression vector, pLKO.1 puro, were purchased from

Sigma-Aldrich (St. Louis, MO). The shRNA sequence for AR is:

CCGGCACCAATGTCAACTCCAGGATCTCGAGCTCCTGGAGTTGACATTGGTGT

TTTT (TRCN0000003718, MISSIONTMTRC shRNA Target Set, Sigma). The control

non-targeting shRNA sequence is:

CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCA

TCTTGTTGTTTTT (MISSIONTM Non-Target shRNA Control Vector, Sigma). mutAR

was generated by site directed mutagenesis through a PCR strategy using Pfu DNA

polymerase. The cDNA for mutAR was inserted into the pcDNA3.1 expression plasmid

and contains the following mutations: (i) the natural T877A mutation in the endogenous

AR in LNCaP cells; (ii) a V581F mutation that disrupts DNA binding and (iii) silent

mutations within the target site for AR shRNA to disrupt recognition by the shRNA; the

AR sh RNA target sequence CACCAATGTCAACTCCAGGAT was mutated to

CACTAACGTTAATAGTCGAAT.

Cell culture and hormone depletion. Early passage LNCaP cells (EP-LNCaP, passage

17) were purchased from American Type Culture Collection (Rockville, MD). Cells were routinely cultured at 37°C and in 5% CO2 in RPMI 1640 medium supplemented with

68

FBS (10%), penicillin (100units/mL), streptomycin (100μg/mL), L-glutamine (2mM),

and sodium pyruvate (1mM). LP50 cells were derived from EP-LNCaP cells by growth

selection through 50 serial passages. To obtain hormone depletion, EP-LNCaP or LP50 cells were grown for 72h in phenol red-free RPMI 1640 medium containing 10%

(Dextran charcoal-stripped FBS) CS-FBS, transferrin (20 μg/mL), penicillin

(100units/mL), streptomycin (100μg/mL), L-glutamine (2mM), and sodium pyruvate

(1mM). Androgen-depletion in the cells was confirmed in parallel experiments by observing induction of PSA mRNA by a 6h treatment with R1881. HeLa cells (American

Type Culture Collection, Rockville, MD) were cultured in DMEM supplemented with

FBS (10%), penicillin (100 units/ml), streptomycin (100 mg/ml), and L-glutamine (2 mM). To obtain hormone depletion, HeLa cells were grown in phenol red-free DMEM supplemented with CS-FBS (5% v/v), L-glutamine (2 mM), insulin (1 µg/ml), and transferrin (20 µg/ml). 293 FT cells (American Type Culture Collection, Rockville, MD) were cultured in DMEM supplemented with FBS (10%), penicillin (100 units/ml), streptomycin (100 mg/ml), and L-glutamine (2 mM).

Plasmid transfection. EP-LNCaP and LP50 cells were transfected by nucleofection using

the Amaxa reagent kit R (Amaxa, Gaithersburg, MD) following the manufacturer- optimized protocol for LNCaP cells. Following nucleofection, the cells were plated in 12- well poly-D-Lysine coated plates from Becton Dickinson Labware (Bedford, MA).

Typically, each nucleofection was performed using 2 x 106 cells, and a total of 5 μg of

DNA. In all cases, the appropriate empty vector plasmids were used to equalize total

DNA for transfection. For promoter analysis 1μg of each promoter-luciferase reporter

69

construct was transfected. In the AR knockdown experiments 3μg of AR shRNA or non-

targeting control shRNA plasmids were transfected. Uniformity of transfection and

promoter specificity was confirmed using the pRL-null plasmid expressing Renilla luciferase and measurement of Renilla luciferase activity in the cell lysates. To measure transfection efficiency (percent of cells transfected) a GFP expression plasmid was co- transfected and the fluorescent cells counted by flow cytometry. Hela cells were transfected with DNA constructs in 6-well tissue culture plates (Corning, New York, NY) using FUGENE6 (Roche Diagnostics, Indianapolis, IN), according to manufacturer’s protocol. For transfection in each well (∼3×105 cells), 500ng of each promoter-luciferase

reporter construct and 300 ng of either the AR expression plasmid or a control plasmid

were used. Uniformity of transfection and promoter specificity was confirmed using the

pRL-null plasmid expressing Renilla luciferase and measurement of Renilla luciferase

activity in the cell lysates.

Lentiviral infection. The AR shRNA vector or the non-targeting shRNA control vector

was packaged into lentivirus. The virus particles were generated by transfecting 293 FT

cells using LipofectamineTM 2000 reagent. Lentivirus was harvested from the supernatant

48h and 72h after transfection. LP50 cells were plated in 12-well plates the day prior to

infection (1.5×105 cells/well); 0.5 ml virus of previously titrated supernatant combined

with polybrene (800μg/mL) was used for the infection of each well together with 0.5 ml

media (RPMI 1640 media containing 10% heat inactivated FBS, 2mM L-glutamine, and

1mM sodium pyruvate); 4-5h later, the infection procedure was repeated. About 4-5 h

after the second infection, the cells was placed in fresh media.

70

Cell count proliferation assay: LP50 cells were plated in a six well tissue culture plate at

4 a density of 3 X 10 cells per well in RPMI medium and placed in a CO2 incubator at 37

degrees for 48h. The cells were then hormone depleted as described above. The cells

were then treated with either R1881 (1nM) or vehicle for the duration of the growth

assay. The cells were counted in a coulter particle counter. The assays were conducted in

triplicate wells.

[3H]Thymidine incorporation assay: EP-LNCaP cells or LP50 cells in 12-well poly-D-

Lysine coated plates (1.5×105 cells/well), that were depleted of as described

above were treated with either R1881 (0.1nM) or vehicle. 18 h later, the cells were pulse- labeled with [3H]thymidine (1µCi/ml, specific activity 11.3Ci/mmol, Moravek

Biochemicals) for 6 h. Then the cells were washed with ice cold PBS followed by the

addition of 1mL of ice cold trichloroacetic acid and incubated at 4°C for 30 min. The

cells were again washed with cold PBS. [3H]thymidine-labeled DNA was then extracted in 0.5mL of 0.5M NaOH/0.5% SDS solution and the radioactivity was measured in a liquid scintillation counter. The cell numbers were monitored in parallel wells treated identically up to the DNA extraction step. The assays were conducted in sextuplicate wells.

Immunofluorescence and confocal microscopy. EP-LNCaP and LP50 cells ( 3 x 104), plated in chamber slides and depleted of hormones as described above, were treated with

R1881 (1nM) or vehicle for 12 h. The cells were washed twice with PBS (2mM KH2PO4,

71

10mM Na2HPO4, 2.7mMKCl, 137mM NaCl) and were fixed with freshly prepared 3.7 %

paraformaldehyde in PBS for 10 min at room temperature. Then the cells were

permeabilized in PBS containing 0.1 % BSA and 0.3 % Triton X-100 for 5 min at room temperature. The cells were then washed and blocked with PBS containing 5 % serum and 0.2 % Triton X-100 at room temperature for 1 h. The cells were incubated overnight at 4oC with the antibody to AR at a dilution of 1: 50. After washing three times with PBS

containing 5 % serum and 0.2 % Triton X-100 the cells were incubated with bovine anti- rabbit IgG conjugated to FITC for 1 h in the dark, at room temperature, at a dilution of 1:

100. After the final wash the cells were incubated for 2 min in DAPI, washed three times and mounted using Vectashield mounting medium. Images were acquired using the Leica

TCS SP5 Broad band confocal microscope system. The acquisition settings were kept constant between specimens and a negative control sample incubated with normal IgG primary antibody was used to adjust for background. Sub-cellular localization of AR was examined by acquiring 10 optical sections using 40x oil immersion with additional 3.5x optical zoom. The images were compiled as projections of using the Leica LAS software package.

Preparation of cell lysates and luciferase assay. Cells in each well of a 12-well tissue

culture plate were washed once with phosphate buffered saline (PBS) of pH 7.5 (2mM

KH2PO4, 10mM Na2HPO4, 2.7mM KCl, 137mM NaCl) and lysed in 200μL of reporter

lysis buffer, provided with the luciferase assay system (Promega, Madison, WI). The

samples were centrifuged at 12000 x g for 2 minutes at room temperature. The

supernatant was assayed for Firefly or Renilla luciferase activities using the appropriate

72

luciferase substrate from Promega (Madison, WI) in a luminometer (Lumat LB9501;

Berthold; Wildbad, Germany). All luciferase assays were performed at least in triplicate.

Western blots. Cells were harvested after washing twice with cold (4ºC) PBS. The cells

were lysed with High Salt buffer (400mM NaCl, 10mM Tris of pH 8.0, 1mM EDTA,

1mM EGTA, 1mM β-mercaptoethanol, 0.1% Triton X-100) containing a protease

inhibitor cocktail (1mM phenyl methyl sulfonyl fluoride, and 5μg/mL each of aprotinin,

leupeptin, and pepstatin A). Protein samples (20-50μg) were resolved by electrophoresis

on 8% sodium dodecylsulfate-polyacrylamide gels and electrophoretically transferred to

nitrocellulose membranes. The blots were probed with the appropriate primary antibodies

followed by goat anti-rabbit IgG or goat anti-mouse IgG conjugated to horseradish

peroxidase and visualized using the enhanced chemiluminescence method. The same

membranes were similarly re-probed with the primary mouse anti-GAPDH antibody and

secondary goat anti-mouse IgG conjugated to horseradish peroxidase.

RNA isolation, RT-PCR and real-time PCR. Total RNA was prepared using the RNeasy

Mini kit (Qiagen). Reverse transcription PCR (RT-PCR) followed by real-time PCR was used to measure mRNAs for PSA and for glyceraldehyde-3-phosphate dehydrogenase

(GAPDH). For the reverse transcription reaction, 200 ng of total RNA was reverse

transcribed with random primers using the High-Capacity cDNA Archive kit (Applied

Biosystems, Foster City, CA) according to the manufacturer’s protocol. The resulting

cDNA was measured by quantitative real-time PCR using the Real-time PCR master mix

(Applied Biosystems) in the StepOne Plus Real Time PCR System (Applied Biosystems,

73

Foster). The primers and TaqMan probe for PSA and GAPDH were obtained from

Integrated DNA Technologies, Inc. (Coralville, IA). To measure the mRNA for endogenous AR as distinct from transfected mutAR, the TaqMan probe was targeted to a

5’UTR sequence that was absent in mutAR. The sequences of the TaqMan probe and

PCR primers for AR are: 5’-FAM-TCCACCTCCTCCTGCCTTCCCC-TAM-3’; Forward primer–CCTCTGTTTTCCCCCACTCTCT; Reverse primer-

GACTGCCTTTTCATCTTTTGATCTC. All samples were assayed in triplicate and

normalized to GAPDH values in the same samples.

Chromatin immunoprecipitation (ChIP) and ChIP-chip analyses. LP50 cells were

depleted of hormones as described above. Then the cells were treated with either vehicle

or R1881 (1 nM) for 2h, washed with cold PBS and subjected to ChIP analysis for AR

using anti AR antibody (either AR-N20 or AR-C19) and negative control IgG (sc-2027) following the procedure described previously (55). The recruitment of AR to the major

ARE enhancer region of PSA promoter (-4366nt to -3874nt) was measured by real time

PCR. An irrelevant target sequence within the downstream coding region was used as a negative control. The primers and TaqMan probe used to target the PSA ARE enhancer region were: GCCTGGATCTGAGAGAGATATCATC (forward primer);

ACACCTTTTTTTTTCTGGATTGTTG (reverse primer); 56FAM-

TGCAAGGCCTGCTTTACAAACTTCC-36TAM (probe). The primers and TaqMan probe used to target the irrelevant coding sequence of PSA were:

CACACCCGCTCTACGATATGA (forward primer); GAGCTCGGCAGGCTCTGA

(reverse primer); 56-FAM-CTCCAGCCACGACCTCATGCTGCT-36TAM (probe). 10

74

ng of the immunoprecipitated DNA samples that were validated for PSA as well as

corresponding input DNA were amplified using the Sigma GenomePlex WGA2 kit

(Sigma-Aldrich, St. Louis, MO) to generate at least 4 µg of DNA for chip analysis using the Nimblegen 385K H18 tiling array platform. The labeling and hybridization of DNA

samples were performed by NimbleGen Systems, Inc (Madison, WI). As described in the

Nimblegen website, the data were analyzed using the Nimblescan software to identify peaks by searching for 4 or more probes whose signals were above the specified cutoff values, ranging from 90% to 15%, using a 500bp sliding window. The cutoff values are a percentage of a hypothetical maximum, which is the mean + 6[standard deviation]. The ratio data was then randomized 20 times to assign a false discovery rate (FDR) score. An

FDR of <0.05 was considered to be highly indicative of binding sites for AR. For

validation of ChIP-chip data and also to test the binding of mutAR by regular ChIP assay,

selected genomic fragments were targeted for quantitative PCR using custom made

TaqMan probes.

mRNA profiling. The Affymetrix DNA microarray analysis was performed as a full

service global gene expression study at the transcriptional profiling core facility of the

Cancer Institute of New Jersey. Total RNA samples were used to generate labeled cRNA which were hybridized to human U133 Plus2.0 Affymetrix microarrays. Scanned image

files were analyzed using the Gene Chip Operating System Version 1.4 software, and

standard thresholding and filtering operations were used. The data were normalized using

housekeeping genes. Normalization assumes that for a subset of genes (i.e., housekeeping

genes) the ratio of measured expression averaged over the set should be one. All data is

75

MIAME compliant and the raw data has been deposited in a MIAME compliant database

(GEO), as detailed on the MGED Society website

http://www.mged.org/Workgroups/MIAME/miame.html. The microarray gene expression data have been submitted to Gene Expression Omnibus (GEO) with the accession number GSE22483.

Statistical analyses. All experimental values in Figures 1, 3, 4, 6, 7 and 8 are presented as mean ± SD. The statistical significance of differences (P value) between values being

compared was determined using ANOVA. In all cases, differences noted in the text are

reflected by a P value < 0.001.

Acknowledgements

The authors are grateful to Dr. Lirim Shemshedini for providing plasmid

constructs, to Dr. David Weaver for assistance in the quantitative analysis of the mRNA

expression profiling data and to Dr. Andrea Nestor for assistance with confocal

microscopy.

References

1. Roy AK, Lavrovsky Y, Song CS, Chen S, Jung MH, Velu NK, Bi BY, Chatterjee B 1999 Regulation of androgen action. Vitam Horm 55:309-352

76

2. Gelmann EP 2002 Molecular biology of the androgen receptor. J Clin Oncol 20:3001-3015

3. Xu Y, Chen SY, Ross KN, Balk SP 2006 Androgens induce prostate cancer cell proliferation through mammalian target of rapamycin activation and post- transcriptional increases in cyclin D proteins. Cancer Res 66:7783-7792

4. Kousteni S, Bellido T, Plotkin LI, O'Brien CA, Bodenner DL, Han L, Han K, DiGregorio GB, Katzenellenbogen JA, Katzenellenbogen BS, Roberson PK, Weinstein RS, Jilka RL, Manolagas SC 2001 Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell 104:719-730

5. Sun M, Yang L, Feldman RI, Sun XM, Bhalla KN, Jove R, Nicosia SV, Cheng JQ 2003 Activation of phosphatidylinositol 3-kinase/Akt pathway by androgen through interaction of p85alpha, androgen receptor, and Src. J Biol Chem 278:42992-43000

6. Baron S, Manin M, Beaudoin C, Leotoing L, Communal Y, Veyssiere G, Morel L 2004 Androgen receptor mediates non-genomic activation of phosphatidylinositol 3-OH kinase in androgen-sensitive epithelial cells. J Biol Chem 279:14579-14586

7. Pratt WB, Toft DO 1997 Steroid receptor interactions with and immunophilin chaperones. Endocr Rev 18:306-360

8. Tsai MJ, O'Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451-486

9. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851-857

10. Glass CK, Rosenfeld MG 2000 The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14:121-141

11. McKenna NJ, O'Malley BW 2002 Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465-474

77

12. Bourguet W, Germain P, Gronemeyer H 2000 Nuclear receptor ligand-binding domains: three-dimensional structures, molecular interactions and pharmacological implications. Trends Pharmacol Sci 21:381-388

13. McEwan IJ 2004 Molecular mechanisms of androgen receptor-mediated gene regulation: structure-function analysis of the AF-1 domain. Endocr Relat Cancer 11:281-293

14. Berrevoets CA, Doesburg P, Steketee K, Trapman J, Brinkmann AO 1998 Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor2). Mol Endocrinol 12:1172- 1183

15. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci U S A 93:4948-4952

16. Jenster G, van der Korput HA, Trapman J, Brinkmann AO 1995 Identification of two transcription activation units in the N-terminal domain of the human androgen receptor. J Biol Chem 270:7341-7346

17. Shaffer PL, Jivan A, Dollins DE, Claessens F, Gewirth DT 2004 Structural basis of androgen receptor binding to selective androgen response elements. Proc Natl Acad Sci U S A 101:4758-4763

18. Ruizeveld de Winter JA, Janssen PJ, Sleddens HM, Verleun-Mooijman MC, Trapman J, Brinkmann AO, Santerse AB, Schroder FH, van der Kwast TH 1994 Androgen receptor status in localized and locally progressive hormone refractory human prostate cancer. Am J Pathol 144:735-746

19. Linja MJ, Savinainen KJ, Saramaki OR, Tammela TL, Vessella RL, Visakorpi T 2001 Amplification and overexpression of androgen receptor gene in hormone- refractory prostate cancer. Cancer Res 61:3550-3555

20. Zegarra-Moro OL, Schmidt LJ, Huang H, Tindall DJ 2002 Disruption of androgen receptor function inhibits proliferation of androgen-refractory prostate cancer cells. Cancer Res 62:1008-1013

78

21. Li TH, Zhao H, Peng Y, Beliakoff J, Brooks JD, Sun Z 2007 A promoting role of androgen receptor in androgen-sensitive and -insensitive prostate cancer cells. Nucleic Acids Res 35:2767-2776

22. Miyamoto H, Messing EM, Chang C 2004 Androgen deprivation therapy for prostate cancer: current status and future prospects. Prostate 61:332-353

23. Chen CD, Welsbie DS, Tran C, Baek SH, Chen R, Vessella R, Rosenfeld MG, Sawyers CL 2004 Molecular determinants of resistance to antiandrogen therapy. Nat Med 10:33-39

24. Edwards J, Bartlett JM 2005 The androgen receptor and signal-transduction pathways in hormone-refractory prostate cancer. Part 1: Modifications to the androgen receptor. BJU Int 95:1320-1326

25. Shand RL, Gelmann EP 2006 Molecular biology of prostate-cancer pathogenesis. Curr Opin Urol 16:123-131

26. Verrijdt G, Tanner T, Moehren U, Callewaert L, Haelens A, Claessens F 2006 The androgen receptor DNA-binding domain determines androgen selectivity of transcriptional response. Biochem Soc Trans 34:1089-1094

27. Wang Q, Li W, Liu XS, Carroll JS, Janne OA, Keeton EK, Chinnaiyan AM, Pienta KJ, Brown M 2007 A hierarchical network of transcription factors governs androgen receptor-dependent prostate cancer growth. Mol Cell 27:380-392

28. Bolton EC, So AY, Chaivorapol C, Haqq CM, Li H, Yamamoto KR 2007 Cell- and gene-specific regulation of primary target genes by the androgen receptor. Genes Dev 21:2005-2017

29. Veldscholte J, Ris-Stalpers C, Kuiper GG, Jenster G, Berrevoets C, Claassen E, van Rooij HC, Trapman J, Brinkmann AO, Mulder E 1990 A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem Biophys Res Commun 173:534-540

30. Culig Z, Hobisch A, Cronauer MV, Cato AC, Hittmair A, Radmayr C, Eberle J, Bartsch G, Klocker H 1993 Mutant androgen receptor detected in an advanced- stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol Endocrinol 7:1541-1550

79

31. Taplin ME, Bubley GJ, Shuster TD, Frantz ME, Spooner AE, Ogata GK, Keer HN, Balk SP 1995 Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N Engl J Med 332:1393-1398

32. Grossmann ME, Huang H, Tindall DJ 2001 Androgen receptor signaling in androgen-refractory prostate cancer. J Natl Cancer Inst 93:1687-1697

33. Heinlein CA, Chang C 2004 Androgen receptor in prostate cancer. Endocr Rev 25:276-308

34. Wang Q, Li W, Zhang Y, Yuan X, Xu K, Yu J, Chen Z, Beroukhim R, Wang H, Lupien M, Wu T, Regan MM, Meyer CA, Carroll JS, Manrai AK, Janne OA, Balk SP, Mehra R, Han B, Chinnaiyan AM, Rubin MA, True L, Fiorentino M, Fiore C, Loda M, Kantoff PW, Liu XS, Brown M 2009 Androgen receptor regulates a distinct transcription program in androgen-independent prostate cancer. Cell 138:245-256

35. Cleutjens KB, van der Korput HA, van Eekelen CC, van Rooij HC, Faber PW, Trapman J 1997 An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter. Mol Endocrinol 11:148-161

36. Kim J, Coetzee GA 2004 Prostate specific antigen gene regulation by androgen receptor. J Cell Biochem 93:233-241

37. Dehm SM, Tindall DJ 2006 Ligand-independent androgen receptor activity is activation function-2-independent and resistant to antiandrogens in androgen refractory prostate cancer cells. J Biol Chem 281:27882-27893

38. Jia L, Coetzee GA 2005 Androgen receptor-dependent PSA expression in androgen-independent prostate cancer cells does not involve androgen receptor occupancy of the PSA locus. Cancer Res 65:8003-8008

39. Liu AY, Brubaker KD, Goo YA, Quinn JE, Kral S, Sorensen CM, Vessella RL, Belldegrun AS, Hood LE 2004 Lineage relationship between LNCaP and LNCaP- derived prostate cancer cell lines. Prostate 60:98-108

40. Chodak GW, Kranc DM, Puy LA, Takeda H, Johnson K, Chang C 1992 Nuclear localization of androgen receptor in heterogeneous samples of normal, hyperplastic and neoplastic human prostate. J Urol 147:798-803

80

41. Tilley WD, Lim-Tio SS, Horsfall DJ, Aspinall JO, Marshall VR, Skinner JM 1994 Detection of discrete androgen receptor epitopes in prostate cancer by immunostaining: measurement by color video image analysis. Cancer Res 54:4096-4102

42. Huang da W, Sherman BT, Tan Q, Collins JR, Alvord WG, Roayaei J, Stephens R, Baseler MW, Lane HC, Lempicki RA 2007 The DAVID Gene Functional Classification Tool: a novel biological module-centric algorithm to functionally analyze large gene lists. Genome Biol 8:R183

43. Tomlins SA, Mehra R, Rhodes DR, Cao X, Wang L, Dhanasekaran SM, Kalyana- Sundaram S, Wei JT, Rubin MA, Pienta KJ, Shah RB, Chinnaiyan AM 2007 Integrative molecular concept modeling of prostate cancer progression. Nat Genet 39:41-51

44. Lobaccaro JM, Poujol N, Chiche L, Lumbroso S, Brown TR, Sultan C 1996 Molecular modeling and in vitro investigations of the human androgen receptor DNA-binding domain: application for the study of two mutations. Mol Cell Endocrinol 116:137-147

45. Zhang J, Gonit M, Salazar MD, Shatnawi A, Shemshedini L, Trumbly R, Ratnam M C/EBPalpha redirects androgen receptor signaling through a unique bimodal interaction. Oncogene 29:723-738

46. Safe S, Kim K 2004 Nuclear receptor-mediated transactivation through interaction with Sp proteins. Prog Nucleic Acid Res Mol Biol 77:1-36

47. Jakacka M, Ito M, Weiss J, Chien PY, Gehm BD, Jameson JL 2001 Estrogen receptor binding to DNA is not required for its activity through the nonclassical AP1 pathway. J Biol Chem 276:13615-13621

48. Fronsdal K, Engedal N, Slagsvold T, Saatcioglu F 1998 CREB binding protein is a coactivator for the androgen receptor and mediates cross-talk with AP-1. J Biol Chem 273:31853-31859

49. Aarnisalo P, Palvimo JJ, Janne OA 1998 CREB-binding protein in androgen receptor-mediated signaling. Proc Natl Acad Sci U S A 95:2122-2127

50. Vlahopoulos S, Zimmer WE, Jenster G, Belaguli NS, Balk SP, Brinkmann AO, Lanz RB, Zoumpourlis VC, Schwartz RJ 2005 Recruitment of the androgen

81

receptor via serum response factor facilitates expression of a myogenic gene. J Biol Chem 280:7786-7792

51. Norris JD, Chang CY, Wittmann BM, Kunder RS, Cui H, Fan D, Joseph JD, McDonnell DP 2009 The homeodomain protein HOXB13 regulates the cellular response to androgens. Mol Cell 36:405-416

52. Zhang J, Wilkinson JE, Gonit M, Keck R, Selman S, Ratnam M 2008 Expression and sub-cellular localization of the CCAAT/enhancer binding protein alpha in relation to postnatal development and malignancy of the prostate. Prostate 68:1206-1214

53. Mukhopadhyay NK, Ferdinand AS, Mukhopadhyay L, Cinar B, Lutchman M, Richie JP, Freeman MR, Liu BC 2006 Unraveling androgen receptor interactomes by an array-based method: discovery of proto-oncoprotein c-Rel as a negative regulator of androgen receptor. Exp Cell Res 312:3782-3795

54. Tran C, Ouk S, Clegg NJ, Chen Y, Watson PA, Arora V, Wongvipat J, Smith- Jones PM, Yoo D, Kwon A, Wasielewska T, Welsbie D, Chen CD, Higano CS, Beer TM, Hung DT, Scher HI, Jung ME, Sawyers CL 2009 Development of a second-generation antiandrogen for treatment of advanced prostate cancer. Science 324:787-790

55. Shatnawi A, Tran T, Ratnam M 2007 R5020 and RU486 act as agonists to enhance Sp1/Sp4-dependent gene transcription by an indirect mechanism. Mol Endocrinol 21:635-650

Figure Legends and Figures

Figure 1. Role of androgen and AR in the proliferation of EP-LNCaP and LP50

cells. Panel A: Hormone depleted LP50 cells were treated with R1881 (1nM) or vehicle.

The cells were counted in a coulter particle counter. Panel B: EP-LNCaP and LP50 cells were

hormone depleted. The endogenous AR protein levels or GAPDH (loading control) were

82

measured by western blot (inset). The mRNA for AR and PSA were measured by real time RT-

PCR. Panel C: Hormone depleted EP-LNCaP cells were treated with R1881 (1nM) or

vehicle. At 18h of the treatment, [3H]thymidine was added to the media and 6h later the incorporation of the radiolabel into DNA was measured. Panel D: LP50 cells were infected with AR shRNA lentivirus or non-target control lentivirus. 12h after infection the cells were treated to deplete them of hormone and to measure [3H]thymidine

incorporation in response to treatment with either vehicle or R1881, all exactly as

described for Panel C. Panel D, inset: Western blot showing the expression of AR or

GAPDH (loading control) in LP50 cells infected with AR shRNA lentivirus or non-target

control shRNA lentivirus and treated with vehicle or R1881.

Figure 2. Sub-cellular localization of AR in LP50 cells and in EP-LNCaP cells. LP50

cells (Panel A) or EP-LNCaP cells (Panel B) grown in chamber slides were depleted of

hormones and then treated with either vehicle or R1881 for 12h. Immunofluorescence

staining for AR was performed using a primary rabbit antibody to AR and a bovine anti-

rabbit IgG-FITC as the secondary antibody. The nuclei were stained with DAPI and

fluorescence images were captured by confocal microscopy. In Panel A, the

representative images show predominant nuclear localization of AR (green fluorescence)

in LP50 cells both with and without R1881 treatment. In panel B, the representative

images show a mixed distribution of AR (green fluorescence) between nuclear and

cytosolic compartments in the absence of hormone but a predominantly nuclear

distribution following R1881 treatment. Note that the brighter fluorescence staining of

AR in both panel A and panel B upon R1881 treatment is consistent with the expected

stabilization of AR by R1881.

83

Figure 3. Androgen-dependence for functional and physical association of AR with

classical response elements in LP50 cells. Panel A: Hormone-depleted LP50 cells were

transfected by nucleofection with either the PSA promoter (6.1kb fragment)-luciferase

reporter construct (PSA promoter-Luc) or with the same construct in which the multiple

dispersed AREs were removed by deletion of only the AREs that include -4366 nt to -3874 nt and an additional internal deletion of -170nt to -159nt (delARE-PSA Promoter-Luc) as indicated. The cells were co-transfected with AR shRNA or non-targeting shRNA

(negative control). In addition, all wells were co-transfected with the Renilla-luciferase control plasmid. R1881 (1nM) or vehicle was added to the culture media 12h after transfection. 72h after transfection, the samples were harvested either to measure luciferase activity or for western blot analysis. The promoter activity values are plotted as the ratio to the basal activity of the corresponding promoter in the non-targeting shRNA controls. Triplicate samples were included in each experimental set. Panel A, inset:

Western blot showing the expression of AR or GAPDH (loading control). Panel B:

Hormone-depleted LP50 cells were treated with R1881 (1nM) or vehicle for 2h and subjected to ChIP assay using either an AR-specific rabbit antibody or negative control rabbit IgG. The immunoprecipitated DNA fragments as well as input DNA were amplified. Enrichment for fragments covering the major ARE enhancer region of PSA (-

4366nt to -3874nt) within the immunoprecipited DNA compared to input DNA was measured by real time PCR targeting the enhancer region. Specificity of the immunoprecipitation was also confirmed by the lack of enrichment of an irrelevant target sequence within the open reading frame of the PSA gene.

84

Figure 4. R1881 dose response of endogenous PSA expression in LP50 cells vs. EP-

LNCaP cells. LP50 cells and EP-LNCaP cells were depleted of hormone and then

treated with vehicle or R1881 (1pM - 500pM) in triplicate wells for 6 h. Total RNA was

extracted from the cells and the level of mRNA for PSA was measured by quantitative

real time RT-PCR. The values of the PSA mRNA levels were normalized to the

corresponding values for GAPDH mRNA.

Figure 5. Comparison of gene subsets up-regulated in clinical advanced prostate tumors with those up-regulated by AR in LP50 cells independently of androgen.

LP50 cells were infected with AR shRNA lentivirus or non-target control lentivirus; 12h after infection the cells were grown in hormone-free media to deplete androgen. The cells were then treated for 6h with either vehicle or R1881 (1nM) and harvested to obtain total

RNA. The mRNA profile was determined using replicate samples by Affymetrix microarray analysis. Complete knockdown of AR due to the AR shRNA lentivirus was confirmed by western blot analysis. mRNAs that were decreased by > 50% were

identified as those induced by AR independent of hormone. In the analysis in Panels A

and B, genes found to be consistently up-regulated in 19 advanced hormone ablation-

insensitive prostate tumors within a platform of ~10,000 annotated gene probes (Tomlins et al., 2007) were used. A subset of either the top 5% most consistently up-regulated

genes (Panel A) or the top 1% most consistently up-regulated genes (Panel B) was

compared with 593 genes contained in the same platform that were found to be up-

regulated by AR in an androgen-independent manner in LP50 cells. In Panel C, all of the

genes upregulated by Apo-AR (i.e., genes identified by Affymetrix DNA microarray

85

analysis of LP50 cells following AR knockdown) are compared with genes that were

upregulated in LP50 cells by a 6h treatment with R1881 (determined by Affymetrix DNA

microarray analysis).

Figure 6. Gene Regulation by a DNA binding mutant of AR. Panel A: Hormone- depleted EP-LNCaP cells were nucleofected with mutAR or control vector. 24h later, the cells were infected with AR shRNA lentivirus or non-target control lentivirus for 48h.

During the last 12h of the infection, the cells were treated with R1881 (1nM) or vehicle.

The cells were then harvested to measure mRNA levels for the indicated androgen target genes by real time RT-PCR. Panel B: HeLa cells were depleted of hormone and

transfected with the minimal ARE-driven promoter-luciferase reporter plasmid and co- transfected with wtAR or mutAR expression plasmid or with the vector control.

Testosterone (10nM) or vehicle was added to the culture media 24h after transfection;

24h later the cells were harvested to measure luciferase activity. Panel C: Hormone

depleted HeLa cells were transfected with the (C/EBP)3-TATA-Luc construct. The cells were co-transfected with expression plasmid for wild type AR (wtAR), DNA binding mutant AR (mutAR) or control plasmid as well as C/EBPα expression plasmid or control plasmid. The wtAR and mutAR plasmids were transfected at a dose (200ng plasmid/1 x

105 cells) at which AR has previously been shown (45) to enter the nucleus in HeLa cells

independent of hormone. In addition, all wells were co-transfected with the Renilla-

luciferase transfection control plasmid. 48h after transfection, the samples were harvested

either to measure luciferase activity or for western blot analysis. The promoter activity

values are plotted as the ratio to the basal activity of the control. Triplicate samples were

86

included in each experimental set. Panel C inset: western blot showing the expression of

wtAR, mutAR, C/EBPα and GAPDH (loading control). Panel D: Hormone-depleted

LP50 cells were nucleofected with mutAR or control vector. 24h later, the cells were

infected with AR shRNA lentivirus or non-target control lentivirus for 48h. The cells

were then harvested to measure mRNA levels for the TMPRSS2 gene by real time RT-

PCR.

Figure 7. The ability of a DNA binding mutant of AR to support proliferation in

LP50 cells. Panel A: LP50 cells were nucleofected with AR shRNA and co-transfected

with either mutAR or the vector control. Cells were also co-transfected with the control

shRNA plasmid and the vector control. Cells were harvested 72h post-transfection for

western blot analysis or to extract total RNA. The western blot was probed for AR and

for the GAPDH loading control (Panel A, inset). The RNA was reverse transcribed and the mRNAs for endogenous AR and GAPDH were measured by real time PCR. In panel

A, the endogenous AR was distinguished from that of mutAR by targeting the TaqMan

probe to its 5’UTR. Panel B: In the same experiment as in Panel A, 72h after transfection

[3H] thymidine incorporation was measured in the cells in separate sets of triplicate wells.

Figure 8. Validation and functional tests of hormone depletion-insensitive AR

recruitment sites in the chromatin. Panel A: Hormone depleted HeLa cells were

transfected with either a minimal promoter-luciferase reporter (pG5luc) in which the

indicated genomic DNA fragments were inserted upstream of the promoter. The

chromosomal locations of the insert sequences are indicated on the X-axis. The cells were

87

co-transfected with either an expression plasmid for wtAR, mutAR or the vector control.

48h post-transfection, the cells were harvested to measure lucifease activity. The promoter activities are plotted as the ratio of luciferase activities to that of the vector control. Triplicate samples were included in each experimental set. Panel B: Hormone- depleted LP50 cells were transfected with either AR shRNA or control shRNA in combination with mutAR or the vector control. Forty eight hours later, the cells were subjected to ChIP analysis using antibody to AR. TaqMan probes were used to quantify immunoprecipitation of the DNA fragments encompassing the indicated chromatin sites.

The TaqMan probe for GAPDH was used for the non-target control.

88

89

90

91

92

93

Figure 6

94

95

96

Chapter 3

Elk-1 Recruits the Androgen Receptor as a Coactivator and is Necessary for Androgen Receptor Dependent Growth of Advanced Prostate Cancer Cells

Mesfin Gonita, Suneethi Sivakumarana, Theodore Manolukasa, Robert Trumblya,b, Lirim Shemshedinic, Manohar Ratnama, ±

aDepartment of Biochemistry and Cancer Biology, bBioinformatics & Proteomics/Genomics Core Division, and cDepartment of Biological Sciences, University of Toledo, 3000 Arlington Avenue, Toledo, OH 43614

(Unpublished manuscript)

± To whom correspondence should be addressed at Department of Biochemistry and Cancer Biology, University of Toledo, 3000 Arlington Avenue, Toledo, OH 43614. Phone: 419-383-3862; Fax: 419-383-6228; E-mail: [email protected]

MG and SS are Equal contributors

Grant support: this work was supported by NIH grant CA103964 and an endowment from the Harold and Helen McMaster Foundation to M.R

97

Abstract

The Ets family transcription factor Elk-1 integrates several signaling pathways and regulates early growth response genes by undergoing changes in repressive

SUMOylation and activating phosphorylation. In both androgen receptor (AR) overexpressing and non-overexpressing models of advanced prostate cancer Elk-1

strongly supported growth as well as the expression of a gene pool enriched for cell

division functions, in the absence of hormone but interdependent with AR. The

cooperative gene activation by Elk-1 and AR was not affected by androgen or by the anti- androgen Casodex. AR physically associated with Elk-1 and also activated a minimal promoter through an Elk-1 binding element. Therefore, the Elk1-AR interaction is a potential target for tumor growth selective intervention in late stage prostate cancer.

98

Introduction

Both androgen responsive and advanced prostate tumors are generally dependent

on the androgen receptor (AR) for growth (1-4). The remarkable dependence of both

androgen dependent and androgen insensitive tumors on AR signaling has been exploited

for prostate cancer treatment. Although, androgen deprivation therapy is an effective

treatment in the early stage of prostate cancer, the majority of patients progress into

hormone refractory stage but continue to depend on AR (3-7). In the treatment of prostate cancer, it is desirable to selectively disrupt a functional aspect of AR that is required for tumor growth rather than the current paradigm of global attenuation of AR signaling using AR antagonists or through AR depletion. In cell culture models of advanced prostate cancer, robust growth of the cells in the complete absence of hormone is supported by AR in association with the activation of a gene set that is distinct from early androgen responsive genes; this set of genes strikingly overlapped the signature gene overexpression profile of castration resistant prostate cancer and was enriched for gene clusters principally supporting mitotic cell division (8, 9). Gene activation by the AR apoprotein has been shown to occur without the direct binding of AR to AREs and likely through tethered associations of the receptor with its target genes (9). Tethered association of AR with DNA has also been shown to be insensitive to anti-androgen which is a characteristic of the growth of advanced prostate cancer (10). Therefore, it may be possible to identify one or a few critical AR tethering proteins whose interaction with the receptor may be necessary, though not sufficient, for AR-dependent growth.

Such interactions could be targeted for functionally selective and tumor specific intervention in prostate cancer. Candidate DNA tethering proteins have been reported by

99

screening a synthetic cis-element array of transcription factor binding sites for hormone-

independent AR recruitment from a nuclear extract of LNCaP cells (11). Among the

candidate proteins we undertook to further investigate ELK1, which belongs to the

ternary complex factor (TCF) subgroup of the ETS family transcription factors.

ETS family proteins have in common a winged-helix-turn-helix DNA binding

domain and bind to a core GGA sequence (12). ETS proteins demonstrate diversity in

both tissue specificity and binding site (target gene) selectivity (13, 14). The TCF

proteins have the additional capability of associating with serum response elements by

binding to the serum response factor (SRF); they are activated by MAPK signaling to

control growth or to respond to stress (15). Several signaling pathways have been shown

to independently converge on ELK1 including all three MAPK cascades (16), Akt (17)

and hedgehog (Hh) signaling (18). Elk1 is also a target for SUMO modification, which confers a transcriptionally repressive state (19) and may reduce its nuclear localization

(20). Phosphorylation of ELK1 by MAP kinases results in its activation through loss of

SUMOylation (19). Thus ELK1 regulates a broad network of genes (21), coordinates

with signals that regulate SRF and its target immediate-early genes, is an important

mediator of MAPK and other signaling cascades and is also regulated through the SUMO

pathway.

There is some indication in the literature that deregulation of ELK1 may be associated with breast cancer (22, 23), and T-cell malignancies (24). As activated MAPK signaling is one of the hallmarks of advanced prostate cancer and is also linked to AR

100

activation (25, 26), it was of interest to further explore the potential role of ELK1 as a

critical AR tethering protein in prostate cancer.

Here, we have identified for the first time ELK1 as novel transcription factor that

tethers AR in prostate cancer cells. In this study, we aimed to examine the co-activator

action of AR for ELK1 in hormone refractory prostate cancer. We demonstrate, for the

first time, the recruitment of AR by Elk-1 to activate target genes that support growth in

androgen depletion insensitive prostate cancer cells.

Materials and methods

Cell culture and reagents: Early passage LNCaP and HeLa cells were purchased from

the American Type Culture Collection (Rockville, MD), LP50 androgen independent

LNCaP variant was generated from the early passage LNCaP as described before (9);

C81 and C4-2 androgen independent LNCaP variants were kindly provided by Dr Lirim

Shemshedini and Dr Edwin Sanchez (University of Toledo) respectively. 293FT cells

were from Invitrogen (Carlsbad, CA). Early passage LNCaP, LP50 and C4-2 cells were

routinely grown at 37°C and in 5% CO2 in RPMI-1640 supplemented with 10% FBS

(Invitrogen, Carlsbad, CA), 1x penicillin/streptomycin/L-glutamine stock mix

(Invitrogen, Carlsbad, CA) and 1x sodium pyruvate (Invitrogen, Carlsbad, CA). C81 cells

were grown at 37°C and in 5% CO2 in RPMI-1640 supplemented with 5% FBS, 1x penicillin/streptomycin/L-glutamine stock mix and 50 µg/ml gentamycin. HeLa cells were grown at 37°C and in 5% CO2 in DMEM supplemented with 10% FBS, 1x

101

penicillin/streptomycin/L-glutamine stock mix. 293FT cells were grown in DMEM

supplemented with 10% FBS, 1x non-essential amino acid (Invitrogen, Carlsbad, CA),

500 µg/ml geneticin and 1x penicillin/streptomycin/L-glutamine stock mix. Custom made oligonucleotides were from Integrated DNA Technologies (Coralville, IA). Affinity- purified rabbit anti-human antibodies to AR (AR-N20), Elk-1 (I-20) and mouse anti- human antibody to GAPDH (sc-47724) were purchased from Santa Cruz Biotechnology

(Santa Cruz, CA). R1881 and Casodex were kindly provided by Dr Lirim Shemshedini

(University of Toledo). FUGENE 6 was purchased from Roche Diagnostics

(Indianapolis, IN).

For hormone depletion, the C81 cells were grown at 37°C and in 5% CO2 in

phenol red free RPMI-1640 supplemented with 5 % charcoal-dextran coated FBS

(Invitrogen, Carlsbad, CA), 1x penicillin/streptomycin/L-glutamine stock mix and 50

µg/ml gentamycin for 48h; whereas EP-LNCaP, LP50 and C4-2 cells were grown at

37°C and in 5% CO2 in phenol red free RPMI-1640 supplemented with 10 % charcoal- dextran coated FBS, 1x penicillin/streptomycin/L-glutamine stock mix and 1x sodium pyruvate for 48h.

Plasmids, constructs and transfection: EMSA validated Oligonucleotide representing consensus binding site for Elk-1 transcription factor was custom designed with the

addition of 5ʹ KpnI and 3ʹ NheI site. The oligo was cloned into pG5luc vector (Promega

Madison, WI) between KpnI and NheI sites. pRL plasmid encoding Renilla luciferase

was purchased from Promega (Madison, WI). PSA-luc plasmid containing 6.1kb of the

102

PSA promoter region was from Dr Lirim Shemshedini at the University of Toledo. The

AR-specific shRNA ELK1- specific shRNA and non-targeting shRNA control in the

lentiviral expression vector, pLKO.1 puro, were purchased from Sigma-Aldrich (St.

Louis, MO). The shRNA sequence for AR is: CCGGCACCAATGTCAACT

CCAGGATCTCGAGCTCCTGGAGTTGACATTGGTGTTTTT (TRCN0000003718,

MISSIONTMTRC shRNA Target Set, Sigma) for ELK1 is:

CCGGCCCAAGAGTAACTCTCATTATCTCGAGATAATGAGAGTTACTCTTGGGT

TTTT (TRCN0000007450, MISSIONTMTRC shRNA Target Set, Sigma). The control

non-targeting shRNA sequence is:

CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCA

TCTTGTTGTTTTT (MISSIONTM Non-Target shRNA Control Vector, Sigma). GAL4-

TATA-Luc plasmid (pG5luc) and expression plasmid for VP16 and Gal4 were purchased

from Promega (CheckMateTM Mammalian Two-hybrid System).

Transient transfection of LP50, C81 and C4-2 were performed using Cell Line

Nucleofector Kits (R) from Amaxa Biosystems (Germany) following the manufacturer-

optimized protocol for LNCaP cells. Following nucleofection, the cells were plated in 12-

well poly-D-Lysine coated plates from Becton Dickinson Labware (Bedford, MA). In all

cases, the appropriate empty vector plasmids were used to equalize total DNA for

transfection. For promoter analysis 1μg of each promoter-luciferase reporter construct

was transfected. In the AR knockdown experiments 3μg of AR shRNA or non-targeting

control shRNA plasmids were transfected. Uniformity of transfection was confirmed

103

using the pRL-null plasmid expressing Renilla luciferase. HeLa cells were transfected

using FUGENE 6 transfection reagent.

RNA interference and lentiviral mediated transduction: For lentiviral mediated

knockdown, shRNAs for AR, ELK1 and non-target control were packaged in 293FT cells

using lentiviral packaging plasmids as described before (9). The virus containing

supernatant was harvested at 48h and 72 h after transfection, pooled, filtered and stored at

-80oC until the time of infection. Twenty four hours before infection, 6 x 105 C81 cells

were plated out in 6-well plates in phenol red free RPMI medium supplemented with heat

inactivated dextran-coated charcoal-stripped serum. The following day the cells were

infected sequentially, first with non-target control shRNA or AR shRNA lentivirus combined with polybrene (8μg/mL) for 5h duration followed by lentiviral shRNA for

ELK1 for additional 5h. Ten hours after the infection, the cells were fed with fresh

phenol red free RPMI medium containing dextran-coated charcoal-stripped serum. For

gene expression profile studies, hormone depleted C81, C4-2 and LP50 cells were

infected twice with non-target control shRNA or AR shRNA lentivirus combined with

polybrene (8μg/mL). The cells were treated with vehicle or R1881 (1nM) for additional 6

hours. After 72h of lentiviral infection, the cells were harvested and total RNA was

prepared for microarray analysis and RT-qPCR.

Proliferation assay: For proliferation assay, C81 and C4-2 cells were infected with

lentivirus to knockdown AR, Elk1 or both as described above. 72h after infection, the

cells were trypsinized and 5 x 104 cells were plated per six well plates in phenol red free

104

RPMI medium supplemented with dextran-coated charcoal-stripped serum and grown at

37°C and in 5% CO2 for different time period. At the end of each time points, the cells

were washed once with PBS, harvested and counted using coulter particle counter. The assay was conducted in triplicate wells and all values were normalized to day 1.

Reporter gene assay: For a reporter assay hormone depleted LP50, C81 or C4-2 cells (2

x 106/nucleofection) were used. Typically, 1µg of the reporter plasmid co-transfected

with 3ug of ARsh RNA or non-target control shRNA together with 10ng of pRL using

Amaxa nucleofector technology. After 48h of transfection, the cells were lysed with

reporter lysis buffer and the promoter activities were measured using the luciferase assay

system (promega) in a luminometer (Lumat LB9501; Berthold; Wildbad, Germany). The

Renilla luciferase values were used to correct for the variation due to transfection

efficiency. The data presented as mean (+/- sd) of triplicate values of representative

experiment and expressed as fold relative to the control plasmid.

RNA isolation and quantitative RT-PCR: Cells were washed with PBS, and total RNA

was isolated using RNeasy mini kit (Qiagen) following the manufacturer protocol. Total

RNA (1ug) was reverse transcribed using High-Capacity cDNA Archive kit (Applied

Biosystems, Foster City, CA). Real time PCR was done using StepOne Plus instrument and TaqMan Fast Universal PCR Master Mix (Applied Biosystems, Foster). Primer and

TaqMan probe mix for AR, KLK3, ELK1, NDC80, CDC5L, PTMA, RNASEH2B and

GAPDH were from Applied Biosystems (Foster City, CA). All real time reactions were

105

done in triplicate and normalized to GAPDH. The data expressed as fold relative to the

control.

Western blot analysis: Cells were lysed with nuclear lysis buffer (400mM NaCl, 10mM

Tris of pH 8.0, 1mM EDTA, 1mM EGTA, 1mM β-mercaptoethanol, 0.1% Triton X-

100) containing protease inhibitor cocktail (Thermo fisher scientific, Waltham, MA ) and

the total protein concentration was determined by Bradford assay. Total protein (25-

50ug) was resolved on SDS-PAGE and the protein was transferred onto nitrocellulose

membrane. Primary antibody for AR (N-20) or Elk-1 (I-20) was used to probe the

membrane. Following incubation with goat anti-rabbit IgG or goat anti-mouse IgG conjugated to horseradish peroxidase secondary antibody, the signal was detected using the HyGlo enhanced chemiluminescence kit (Denville scientific, Metuchen, NJ). The same membrane were stripped with a stripping buffer (50mM glycine, 34.6 mM SDS; equilibrated at pH 3.0) and reprobed for GAPDH as a loading control.

mRNA expression profiling and gene ontology analysis: The illumina DNA microarray analysis was performed as a full service global gene expression study at the genomics core facility of the Cleveland clinic of Ohio. Total RNA (250µg) was reverse transcribed into cRNA and biotin-UTP labeled using the Illumina TotalPrep RNA

Amplification Kit (Ambion). cRNA was quantified using a nanodrop spectrophotometer and the cRNA quality (size distribution) was further analyzed on a 1% agarose gel. cRNA was hybridized to the HumanHT12-v4 Expression BeadChip using standard protocols (provided by Illumina). Following hybridization the arrays were washed and

106

stained using standard protocols (provided by Illumina). The stained arrays were scanned using an Illumina BeadArray Reader and the data was imported into the Illumina

GenomeStudio software. Results were outputted in excel spreadsheet format. The average signal less than 50 and detection p values greater than 0.05 were filtered out.

Differentially expressed genes were identified by comparing Elk1 shRNA vs AR shRNA + Elk1 shRNA (AR only regulated genes), AR shRNA vs AR shRNA + Elk1 shRNA (Elk1 only regulated genes), and Ctrl shRNA vs AR shRNA + Elk1 shRNA (AR

+ Elk1 regulated genes) data set. To identify genes regulated by AR in Elk1 dependent manner, Ctrl shRNA vs AR shRNA data set were compared. Then, AR only regulated genes (Elk1 shRNA vs AR shRNA + Elk1 shRNA) with threshold value greater than 1.2 were filtered out from Ctrl shRNA vs AR shRNA gene list to identify genes that were upregulated by the synergistic action only. Gene ontology analysis was performed using

DAVID server. The top 100 upregulated genes identified in the microarray analysis were used to determine the gene ontology.

Coimmunoprecipitation: In vivo coimmunoprecipitation assays were done using C4-2 cells for the endogenous protein as described before (27). Briefly, the cells were grown in a hormone depleted medium to achieve 75 % confluence and harvested in RIPA lysis buffer (50 mM Tris-HCl at pH 7.5, 50 mM NaCl, 2.5 mM EGTA, 1% Triton X-100, 50 mM NaF, 10 mM Na4P2O7, 10 mM Na3VO4, 1x protease inhibitor cocktail). Total protein concentration was determined by Bradford assay and 350 µg of whole cell lysate was precleared using protein A agarose (Millipore, Temecula, CA). Immunoprecipitation

107

was performed using 2 µg of anti-AR(N-20), anti-Elk1(I-20) or normal rabbit IgG

followed by immunoblot with anti-AR and anti-Elk1 antibody. The signal was detected using using the HyGlo enhanced chemiluminescence kit (Denville scientific, Metuchen,

NJ).

Statistical analysis: Statistical significance was determined using one way ANOVA. The error bars in all graphs represent standard deviation of the mean. The P values, where indicated, were less than 0.05.

Results

In hormone depleted C81 and C4-2 cells, the apo-AR activated gene set are largely distinct from early androgen responsive genes. The C81 and C4-2 androgen ablation insensitive cell line models were used in the present study. C81 cells are derived from

LNCaP cells through extended passage in vitro in under androgen non-deprived condition and shows more aggressive growth and less responsive to androgen (28). The C4-2 cells are generated from parental LNCaP cells through in vivo serial transplantation in castrated mice and over express the androgen receptor(29). These two experimental cell model systems represent the salient feature of clinical prostatic tumor. To establish the androgen independent proliferation of these cells, C81 and C4-2 cells were grown in phenol red free RPMI supplemented with dextran-coated charcoal-stripped serum and the proliferation was monitored in the presence or absence of R1881 (1nM). Both the C81

(Fig 1A) and C4-2 (Fig 1 B) cells showed largely androgen independent growth in a

108

totally hormone depleted medium. Then, to examine and compare the apo-AR regulated genes in C81 and C4-2 cells, mRNA expression profiling was performed after knocking down the endogenous AR using lentiviral shRNA under hormone depleted condition.

Illumina microarray analysis was done using RNA samples obtained from AR shRNA or control shRNA lentivirus infected cells and the AR shRNA gene set was compared with control shRNA gene set. Using 1.5 fold threshold, a decrease in the basal expression for total of 525 genes in C81 cells and 792 genes in C4-2 cells were found. The top 100 genes that were down-regulated (≥2 fold) were submitted for Gene Ontology (GO) analysis. The top enriched GO biological process in C81 and C4-2 cells was cell cycle with P < 3.23 x 10-8 and P < 3.62 x 10-8 respectively. The GO analysis of C81 and C4-2 cells was consistent with our previous finding in LP50 cells, derived from parental

LNCaP cells through extended passage in vitro (9).

Then, we examined the mRNA expression profiles of early androgen regulated genes in hormone depleted C81 and C4-2 cells after treatment with R1881 (1nM) for 6 h.

The expression of a total of 93 genes in C81 cells and 58 genes in C4-2 cells were increased by androgen by more than 1.5 fold. Comparisons of the early androgen regulated genes to apo-AR regulated genes in the same cells have shown that only 3.4 % of C81 (Fig 1C) and 0.1 % of C4-2 (Fig 1D) apo-AR regulated genes also activated by androgen. This indicates that the apo-AR gene expression program in both cells were largely distinct from early androgen responsive gene program.

109

Elk-1 supports the growth of androgen depletion insensitive prostate cancer cells. To test the role of Elk-1 for the growth of androgen depletion insensitive prostate cancer cells, lentiviral mediated shRNA were used to knockdown AR or Elk-1. Knocking down of AR and ELK1 either individually or in combination virtually completely abolished the proliferation of C81 (Fig. 2A) and C4-2 (Fig. 2B) cells. These findings suggest that Elk-1 is necessary for apo-AR dependent proliferation.

Elk-1 supports AR dependent promoter activity in androgen depletion insensitive prostate cancer cells. To test whether AR and Elk-1 functionally interact to support the growth of androgen depletion insensitive cells, a promoter assay was used to investigate the AR dependence of Elk-1 action. Luciferase reporter plasmid driven by Elk-1 cis- element was used to examine the effect of AR on the promoter activity. The role of AR was tested by depletion of its expression by short hairpin RNA (shRNA) using transient transfection. The initial experiment was done in LP50 cells that were co-transfected with

AR shRNA or control shRNA along with luciferase reporter plasmid using Amaxa nucleofector kit (Gaithersburg, MD). AR shRNA decreased the level of AR by about 50

% but the level of Elk-1 was unaffected (Fig. 3B). Upon AR knockdown, the promoter activity of Elk-1 decreased significantly (Fig. 3A). To test whether the decrease in promoter activity is a general non-specific effect of AR knockdown, the promoter activities of other factors were measured under the same condition and didn’t show reduction in activity (Fig. 3A).

110

Then, we examined this AR dependent promoter activity in C81 (Fig. 3C) and

C4-2 (Fig. 3D) cells of hormone depletion insensitive prostate cancer cell line models. In both C81 and C4-2 cells AR knockdown significantly decreased promoter activity (Fig.

3C & 3D).

In conclusion, the above data showed that Elk-1 activates the luciferase reporter

gene in AR dependent manner in all three prostate cancer cell lines.

Elk-1 physically associates with AR. To demonstrate the physical interaction between the endogenous AR and Elk-1, coimmunoprecipitation assay was performed in C4-2

cells. C4-2 cells were selected because of the higher expression levels of AR which

facilitated efficient immunoprecipitation of endogenous AR or Elk-1. AR was efficiently

immunopreciptated by Elk-1 antibody and vice versa (Fig 4). In conclusion, the data

strongly suggest the direct interaction between AR and Elk-1.

Genes involved in proliferation and cell cycle are regulated by AR in Elk-1

dependent manner. To identify target genes regulated by AR in Elk-1 dependent

manner, we used C81 cells for gene expression profiling. We hypothesized that AR

supports proliferation as a co-activator of Elk-1 for genes involved in cell cycle. To

identify genes whose induction was dependent on the presence of both AR and Elk-1,

illumina expression profile platform was used. The levels of Elk-1 and AR were depleted

by RNA interference (RNAi) using lentiviral approach (Fig. 5A inset). The transcriptome

111

of control shRNA-C81, AR shRNA-C81, Elk1 shRNA-C81 and AR shRNA + Elk1

shRNA-C81 cells were compared. Using 1.5 fold as a threshold and P < 0.05, the

expression of a total of 478 genes was up-regulated by AR in Elk-1 dependent manner

(Fig. 5A). Gene Ontology (GO) analysis of the top 100 up-regulated genes revealed that

cell cycle (P < 1.13 x 10-4), DNA replication, recombination & repair (P < 1.13 x 10-4) and lipid metabolism (P < 4.03 x 10-4) as the top significantly enriched biological processes (Fig. 5B).

Taken together these data showed that AR promotes the growth of androgen ablation insensitive prostate cancer cells by acting as a co-activator of the transcriptional

activity of Elk-1.

AR co-activates novel genes that are repressed by Elk-1. DNA microarray analysis in

C81 cells showed that AR further upregulates and downregulates Elk-1 dependent genes.

Even though, the majority of the genes regulated by the synergistic interaction of these

two proteins showed further activation of target genes (Fig. 5A), derepression and

repression of target genes were also observed. The microarray analysis revealed unique

mode of transcriptional modulation whereby AR derepress genes that were repressed by

Elk-1. To test the functional effect of knocking down AR and Elk-1 on Elk-1 repressed

genes, PTMA, CDC5L, NDC80, RNASEH2B and HDGFR genes were chosen from the

microarray data set. These genes were among the top 100 up-regulated genes in the

microarray data analysis, and their expression level was measured by quantitative real

time PCR. Depletion of AR in hormone deprived C81 cells decreased the basal

112

expression of these genes (Fig. 6A). This showed that in the absence of AR the basal expression of these genes were repressed by Elk-1. As expected, knocking down of Elk-1 restored the expression of these genes to the basal state (Fig. 6A). The knockdown of AR and Elk-1 was confirmed by RT-qPCR (Fig. 6B). Our finding showed that these genes were Elk-1 target genes whose basal expression dependent on AR. This demonstrated that AR co-activates the basal expression of these genes that would, otherwise, be repressed in the presence of Elk-1 alone.

Trans-activation per se by Elk1-AR occurs without androgen-dependence or sensitivity to Casodex in castration resistant cells. The mRNA profile of C81 cells treated with R1881 was determined by illumina DNA microarray analysis. A total of 93 unique annotated genes showed≥ a 1.5 -fold increase in expression within 6h of treatment. Among the Elk1-AR regulated genes only 12 genes (1.7%) were androgen- responsive whose expression increased by androgen. Then, we examined the sensitivity of AR dependent Elk-1 action to androgen and antiandrogen. To test the sensitivity, C81 and C4-2 cells were treated with vehicle, R1881 or Bicalutamide (Casodex) for 48h. The mRNA level of PSA, PTMA, CDC5L, NDC80, RNASEH2B and HDGFR genes was quantified by RT-qPCR. R1881 increased the expression of PSA, and this induction was significantly decreased by Casodex treatment in both C81 (Fig. 7A) and C4-2 (Fig. 7B) cells which underscore the fact that AR activation of genes dependent entirely on AREs is predominantly androgen-dependent, and the ARE-mediated promoter activation is sensitive to antiandrogen (9, 10). However, in C81 (Fig 7A) and C4-2 (Fig. 7B) cells

R1881 treatment failed to activate these genes. These genes were also insensitive for

113

Casodex treatment (Fig. 7A- B). This demonstrated AR dependent Elk-1 activation was

insensitive to Casodex and accompanied by androgen-independence in C81 and C4-2

cells.

Collectively, these data showed that AR regulates the activity of Elk-1 in

androgen depletion insensitive prostate cancer cells in a manner that is insensitive to the

androgen antagonist, Casodex.

Discussion

Chromosomal translocation involving the Ets transcription factor is a common

genetic alteration in the majority of prostate tumors and implicated in tumor progression

(30, 31). Members of the ETS transcription factor ETV1, ETV4, ETV5 and ETS related

gene (ERG) forms fusion with various genes in prostate tumors which indicate the

substantial deregulation of the ETS transcription factor and its role in the development of

carcinoma (30, 31). ETS proteins including ERG and ETV1 promote early steps of

prostate oncogenesis particularly as androgen-induced fusion proteins (32, 33). ERG,

ETV1 and ETS1 may also directly associate with the androgen receptor to facilitate synergy between ETS binding sites and androgen response elements (AREs) in androgen responsive genes (33, 34).

Here, we reported Elk-1 as prototype AR tethering protein and have shown for the first time a novel interaction between AR and Elk-1 in androgen ablation insensitive 114

prostate cancer cells. This is supported by AR-Elk1 complex immunoprecipitation by

CoIP (Fig. 4).

In the present study the C81 and C4-2 LNCaP variants were used as model for

androgen ablation insensitive tumor. Serial passage of the androgen sensitive LNCaP

cells for extended period of time in vitro under normal culture condition (28, 35, 36) or

through serial transplantation in vivo as xenograft (28, 29) selects for a subpopulations of

cells that have the ability to grow equally in intact or castrated mice. In the present study

we showed that these cells exhibit a robust proliferation in an in vitro culture medium

completely deprived of hormone (Fig 1). These cell lines were chosen as appropriate

model to represent androgen ablation insensitive cancer cells with elevated levels of

androgen receptor (C4-2) as well as non-overexpressing cells (C81).

Characterization of AR-Elk1 interaction has revealed that AR act as a novel transcriptional co-activator of Elk-1 which co-activates the expression of genes involved in cell cycle, DNA recombination, replication and repair (Fig 5B). The co-activator function of AR was found to be insensitive to both androgen and bicalutamide in the androgen depletion insensitive C81 and C4-2 cells (Fig. 7). The insensitivity of AR recruitment to DNA bound factor to bicalutamide is consistent with a previous report

(10). Of note, AP1 dependent action of ER, for example, is sensitive to antagonist (37).

This highlights the effect of ligands on non-classical steroid receptor mechanism of action could be receptor, cell or gene specific.

115

Elk1 is an effector molecule that integrates signals from ERK1/2, JNK, p38

MAPK pathways as well as MAPK independent pathways to regulate diverse set of genes

(16). Earlier studies using the prototype c-Fos gene promoter have shown SRF as an essential partner of Elk-1 (38, 39). However, SRF dependent gene regulation is account, for instance, for only 22 % of the Elk-1 target genes in HeLa cells (21). Here, we also observed that promoter analysis of the top 100 AR dependent Elk-1 target genes lack binding sites for SRF. Here, we showed that Elk-1 regulates target genes independent of

SRF or other ETS-domain family members but requires the co-activator function of AR

(21, 40-43). This is the first demonstration of a critical aspect of AR function that underlies tumorigenesis in androgen ablation insensitive advanced prostate cancers.

The data presented here show that the AR functions as a coregulator of Elk-1; the interesting aspect of this regulatory mechanism was the ability of AR to de-repress some set of genes that were repressed by Elk-1. The findings underlie that transcriptional output of AR-Elk-1 interaction is dependent on gene and cell specific context. Elk-1 is function as a transcriptional activator or repressor depending on the cellular context. In the absence of activation signal, it acts as a transcriptional repressor through the recruitment of co-repressor mSin3A-HDAC complex (44, 45). Such repression is also mediated by SUMO modification of Elk-1 (19). Up on activation by MAPK or other novel kinases, the phosphorylated Elk-1 activates transcription through the removal of

HDAC complex and recruitment of HAT such as CBP, p300 (19, 38, 44-46). The present data showed that Elk-1 in the basal state regulates target gene in a variety of ways including through transcriptional repression and this repression relived by co-activator

116

function of AR. Even though the mechanism that triggers this transcriptional activity was not formally tested in the present study, the autoinhibition of Elk-1 could have been relieved by prostate stromal factor that activate the ERK pathway that could converge on both Elk-1 and AR (47). However, we cannot rule out the possibility of AR recruitment to a DNA bound Elk-1 independent of Elk-1 phosphorylation status. Of note, phosphorylation independent physical association between CBP and Elk-1 has been demonstrated at Elk-1 target gene promoter (48). Alternatively, the predominantly nuclear localized AR recruited by Elk-1 able to overcome SUMO mediated repression of

Elk-1 to activate target genes. Yang et al (2005) have shown that the E3 ligase PIASxa act as a transcriptional co-activator of Elk-1 that facilitate the derepression of Elk-1 activity. The co-activator property of PIASxa is independent of its E3 ligase activity but requires SUMO modified Elk-1 (49).

To our knowledge this is the first mechanistic study to report the interaction of

AR and Elk-1 which are two critical proteins in prostate oncogenesis. To dissect the biological significance of Elk-1 dependent AR action in prostate cancer, we examined its role in cell proliferation. For proliferation assay Elk-1 and AR were depleted in C81 and

C4-2 cells using lentiviral shRNA. The dependence of C81 and C4-2 cells on the AR for growth is well established (28). Surprisingly, knocking down Elk-1 inhibits the proliferation of both C81 and C4-2 cells (Fig. 2). The combined knockdown of AR and

Elk-1 also significantly decreased the proliferation of these cells. These demonstrate that

AR-Elk-1 interaction is necessary for the proliferation of androgen ablation insensitive prostate cancer cells. This is the first demonstration of the necessary role of Elk-1 and AR

117

for the growth of prostate cancer. Notwithstanding previous report where Gene

expression profiling utilizing molecular concept modeling demonstrates the significant

enrichment of gene sets that contain the Elk-1 binding sites in the progression of prostate cancer (8).

Gene expression profile study of apo-AR regulated genes in C4-2 and C81 have shown substantial enrichment of gene ontology for cell cycle. In addition, several lines of evidence have shown that the growth and progression of prostate cancer is dependent on

AR. Aberrant activation of signaling pathways that converge on AR promotes its nuclear import and enables the recruitment of AR by DNA bound transcription factors. Hence in

light of our finding a strategy for intervention in prostate cancer that selectively targets a

critical aspect of AR function in the tumor rather than total and non-targeted ablation of

AR signaling conceptually novel approach.

In summary, the data presented here shows for the first time the novel interaction

between AR and Elk-1 in androgen ablation insensitive prostate cancer cells. This mode

of AR transcriptional regulation is refractory to ligand and regulates targets genes that are

involved in tumor progression in Elk-1 dependent manner. Future studies will map the

interaction domains to design peptidomimetics that enable the functional disruption of the

interaction. Finally, targeting the AR:Elk1 interaction interface will be a potential

therapeutic strategy for the treatment of castration resistant prostate cancer.

118

Acknowledgement

The authors are grateful to Dr. Peter Faber at the Cleveland clinic genomic core for assistance in the quantitative analysis of the mRNA expression profiling data.

References

1. Ruizeveld de Winter JA, Janssen PJ, Sleddens HM, Verleun-Mooijman MC, Trapman J, Brinkmann AO, Santerse AB, Schroder FH, van der Kwast TH 1994 Androgen receptor status in localized and locally progressive hormone refractory human prostate cancer. Am J Pathol 144:735-746

2. Linja MJ, Savinainen KJ, Saramaki OR, Tammela TL, Vessella RL, Visakorpi T 2001 Amplification and overexpression of androgen receptor gene in hormone- refractory prostate cancer. Cancer Res 61:3550-3555

3. Zegarra-Moro OL, Schmidt LJ, Huang H, Tindall DJ 2002 Disruption of androgen receptor function inhibits proliferation of androgen-refractory prostate cancer cells. Cancer Res 62:1008-1013

4. Li TH, Zhao H, Peng Y, Beliakoff J, Brooks JD, Sun Z 2007 A promoting role of androgen receptor in androgen-sensitive and -insensitive prostate cancer cells. Nucleic Acids Res 35:2767-2776

5. Debes JD, Tindall DJ 2002 The role of androgens and the androgen receptor in prostate cancer. Cancer Lett 187:1-7

6. Snoek R, Cheng H, Margiotti K, Wafa LA, Wong CA, Wong EC, Fazli L, Nelson CC, Gleave ME, Rennie PS 2009 In vivo knockdown of the androgen receptor results in growth inhibition and regression of well-established, castration-resistant prostate tumors. Clin Cancer Res 15:39-47

7. Taplin ME, Balk SP 2004 Androgen receptor: a key molecule in the progression of prostate cancer to hormone independence. J Cell Biochem 91:483-490

119

8. Tomlins SA, Mehra R, Rhodes DR, Cao X, Wang L, Dhanasekaran SM, Kalyana- Sundaram S, Wei JT, Rubin MA, Pienta KJ, Shah RB, Chinnaiyan AM 2007 Integrative molecular concept modeling of prostate cancer progression. Nat Genet 39:41-51

9. Gonit M, Zhang J, Salazar M, Cui H, Shatnawi A, Trumbly R, Ratnam M 2011 Hormone depletion-insensitivity of prostate cancer cells is supported by the AR without binding to classical response elements. Mol Endocrinol 25:621-634

10. Zhang J, Gonit M, Salazar MD, Shatnawi A, Shemshedini L, Trumbly R, Ratnam M 2010 C/EBPalpha redirects androgen receptor signaling through a unique bimodal interaction. Oncogene 29:723-738

11. Mukhopadhyay NK, Ferdinand AS, Mukhopadhyay L, Cinar B, Lutchman M, Richie JP, Freeman MR, Liu BC 2006 Unraveling androgen receptor interactomes by an array-based method: discovery of proto-oncoprotein c-Rel as a negative regulator of androgen receptor. Exp Cell Res 312:3782-3795

12. Sharrocks AD 2001 The ETS-domain transcription factor family. Nat Rev Mol Cell Biol 2:827-837

13. Hollenhorst PC, Shah AA, Hopkins C, Graves BJ 2007 Genome-wide analyses reveal properties of redundant and specific promoter occupancy within the ETS gene family. Genes Dev 21:1882-1894

14. Wei GH, Badis G, Berger MF, Kivioja T, Palin K, Enge M, Bonke M, Jolma A, Varjosalo M, Gehrke AR, Yan J, Talukder S, Turunen M, Taipale M, Stunnenberg HG, Ukkonen E, Hughes TR, Bulyk ML, Taipale J 2010 Genome- wide analysis of ETS-family DNA-binding in vitro and in vivo. EMBO J 29:2147-2160

15. Shaw PE, Saxton J 2003 Ternary complex factors: prime nuclear targets for mitogen-activated protein kinases. Int J Biochem Cell Biol 35:1210-1226

16. Yordy JS, Muise-Helmericks RC 2000 and the Ets family of transcription factors. Oncogene 19:6503-6513

17. Figueroa C, Vojtek AB 2003 Akt negatively regulates translation of the ternary complex factor Elk-1. Oncogene 22:5554-5561

120

18. Ohta H, Aoyagi K, Fukaya M, Danjoh I, Ohta A, Isohata N, Saeki N, Taniguchi H, Sakamoto H, Shimoda T, Tani T, Yoshida T, Sasaki H 2009 Cross talk between hedgehog and epithelial-mesenchymal transition pathways in gastric pit cells and in diffuse-type gastric cancers. Br J Cancer 100:389-398

19. Yang SH, Jaffray E, Hay RT, Sharrocks AD 2003 Dynamic interplay of the SUMO and ERK pathways in regulating Elk-1 transcriptional activity. Mol Cell 12:63-74

20. Salinas S, Briancon-Marjollet A, Bossis G, Lopez MA, Piechaczyk M, Jariel- Encontre I, Debant A, Hipskind RA 2004 SUMOylation regulates nucleo- cytoplasmic shuttling of Elk-1. J Cell Biol 165:767-773

21. Boros J, Donaldson IJ, O'Donnell A, Odrowaz ZA, Zeef L, Lupien M, Meyer CA, Liu XS, Brown M, Sharrocks AD 2009 Elucidation of the ELK1 target gene network reveals a role in the coordinate regulation of core components of the gene regulation machinery. Genome Res 19:1963-1973

22. Duan R, Xie W, Burghardt RC, Safe S 2001 Estrogen receptor-mediated activation of the serum response element in MCF-7 cells through MAPK- dependent phosphorylation of Elk-1. J Biol Chem 276:11590-11598

23. Duan R, Xie W, Li X, McDougal A, Safe S 2002 Estrogen regulation of c-fos gene expression through phosphatidylinositol-3-kinase-dependent activation of serum response factor in MCF-7 breast cancer cells. Biochem Biophys Res Commun 294:384-394

24. Rao VN, Huebner K, Isobe M, ar-Rushdi A, Croce CM, Reddy ES 1989 elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints. Science 244:66-70

25. Edwards J, Bartlett JM 2005 The androgen receptor and signal-transduction pathways in hormone-refractory prostate cancer. Part 1: Modifications to the androgen receptor. BJU Int 95:1320-1326

26. Shand RL, Gelmann EP 2006 Molecular biology of prostate-cancer pathogenesis. Curr Opin Urol 16:123-131

27. Chattopadhyay S, Gong EY, Hwang M, Park E, Lee HJ, Hong CY, Choi HS, Cheong JH, Kwon HB, Lee K 2006 The CCAAT enhancer-binding protein-alpha

121

negatively regulates the transactivation of androgen receptor in prostate cancer cells. Mol Endocrinol 20:984-995

28. Igawa T, Lin FF, Lee MS, Karan D, Batra SK, Lin MF 2002 Establishment and characterization of androgen-independent human prostate cancer LNCaP cell model. Prostate 50:222-235

29. Wu HC, Hsieh JT, Gleave ME, Brown NM, Pathak S, Chung LW 1994 Derivation of androgen-independent human LNCaP prostatic cancer cell sublines: role of bone stromal cells. Int J Cancer 57:406-412

30. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta KJ, Rubin MA, Chinnaiyan AM 2005 Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310:644-648

31. Tomlins SA, Mehra R, Rhodes DR, Smith LR, Roulston D, Helgeson BE, Cao X, Wei JT, Rubin MA, Shah RB, Chinnaiyan AM 2006 TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer. Cancer Res 66:3396- 3400

32. Zong Y, Xin L, Goldstein AS, Lawson DA, Teitell MA, Witte ON 2009 ETS family transcription factors collaborate with alternative signaling pathways to induce carcinoma from adult murine prostate cells. Proc Natl Acad Sci U S A 106:12465-12470

33. Shin S, Kim TD, Jin F, van Deursen JM, Dehm SM, Tindall DJ, Grande JP, Munz JM, Vasmatzis G, Janknecht R 2009 Induction of prostatic intraepithelial neoplasia and modulation of androgen receptor by ETS variant 1/ETS-related protein 81. Cancer Res 69:8102-8110

34. Massie CE, Adryan B, Barbosa-Morais NL, Lynch AG, Tran MG, Neal DE, Mills IG 2007 New androgen receptor genomic targets show an interaction with the ETS1 transcription factor. EMBO Rep 8:871-878

35. Denmeade SR, Sokoll LJ, Dalrymple S, Rosen DM, Gady AM, Bruzek D, Ricklis RM, Isaacs JT 2003 Dissociation between androgen responsiveness for malignant growth vs. expression of prostate specific differentiation markers PSA, hK2, and PSMA in human prostate cancer models. Prostate 54:249-257

122

36. Lin MF, Meng TC, Rao PS, Chang C, Schonthal AH, Lin FF 1998 Expression of human prostatic correlates with androgen-stimulated cell proliferation in prostate cancer cell lines. J Biol Chem 273:5939-5947

37. Jakacka M, Ito M, Weiss J, Chien PY, Gehm BD, Jameson JL 2001 Estrogen receptor binding to DNA is not required for its activity through the nonclassical AP1 pathway. J Biol Chem 276:13615-13621

38. Buchwalter G, Gross C, Wasylyk B 2004 Ets ternary complex transcription factors. Gene 324:1-14

39. Treisman R 1992 The serum response element. Trends Biochem Sci 17:423-426

40. Boros J, O'Donnell A, Donaldson IJ, Kasza A, Zeef L, Sharrocks AD 2009 Overlapping promoter targeting by Elk-1 and other divergent ETS-domain transcription factor family members. Nucleic Acids Res 37:7368-7380

41. Sharrocks AD 1995 ERK2/p42 MAP kinase stimulates both autonomous and SRF-dependent DNA binding by Elk-1. FEBS Lett 368:77-80

42. Mo Y, Vaessen B, Johnston K, Marmorstein R 2000 Structure of the elk-1-DNA complex reveals how DNA-distal residues affect ETS domain recognition of DNA. Nat Struct Biol 7:292-297

43. S, Treisman R 1992 Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element. Cell 68:597-612

44. Yang SH, Vickers E, Brehm A, Kouzarides T, Sharrocks AD 2001 Temporal recruitment of the mSin3A-histone deacetylase complex to the ETS domain transcription factor Elk-1. Mol Cell Biol 21:2802-2814

45. Yang SH, Bumpass DC, Perkins ND, Sharrocks AD 2002 The ETS domain transcription factor Elk-1 contains a novel class of repression domain. Mol Cell Biol 22:5036-5046

46. Chung KC, Gomes I, Wang D, Lau LF, Rosner MR 1998 Raf and fibroblast growth factor phosphorylate Elk1 and activate the serum response element of the immediate early gene pip92 by mitogen-activated protein kinase-independent as well as -dependent signaling pathways. Mol Cell Biol 18:2272-2281

123

47. Shigemura K, Isotani S, Wang R, Fujisawa M, Gotoh A, Marshall FF, Zhau HE, Chung LW 2009 Soluble factors derived from stroma activated androgen receptor phosphorylation in human prostate LNCaP cells: roles of ERK/MAP kinase. Prostate 69:949-955

48. Janknecht R, Nordheim A 1996 MAP kinase-dependent transcriptional coactivation by Elk-1 and its cofactor CBP. Biochem Biophys Res Commun 228:831-837

49. Yang SH, Sharrocks AD 2005 PIASx acts as an Elk-1 coactivator by facilitating derepression. EMBO J 24:2161-2171

Figure Legends and Figures

Figure 1. Characterization of the growth and expression profiles of C81 and C4-2

cells. Panel A, B: Hormone depleted C81 cells (Panel A) and C4-2 cells (Panel B) were treated with R1881 (1nM) or vehicle. The cells were counted in a coulter particle counter.

Panel C, D: C81 and C4-2 cells were infected with AR shRNA lentivirus or non-target

control lentivirus for 72 h and in a parallel experiment the cells were treated with vehicle

or R1881 (1nM) for 6h and harvested to obtain total mRNA. The mRNA profile was

determined using replicate samples by illumina microarray analysis. The knockdown of

AR due to the AR shRNA lentivirus was confirmed by western blot analysis. mRNAs

that were decreased by > 50% (i.e., genes identified by illumina DNA microarray

analysis following AR knockdown) were identified as those induced by AR independent of hormone (apo-AR regulated) and mRNA that were increased by > 1.5 fold (determined

by ilumina DNA microarray analysis following androgen treatment) were identified as

those induced by androgen (androgen regulated). In Panel C, all of the genes upregulated

124

by Apo-AR in C81 cells are compared with genes that were upregulated in C81 cells by a

6h treatment with R1881. In Panel D, all of the genes upregulated by Apo-AR in C4-2

cells are compared with genes that were upregulated in C4-2 cells by a 6h treatment with

R1881.

Figure 2. The role of AR-Elk1 interaction in the proliferation of androgen ablation

insensitive prostate cancer cells. C81 cells (Panel A) and C4-2 cells (Panel B) were

infected with AR shRNA, Elk1 shRNA or AR shRNA + Elk shRNA lentivirus or non-

target control shRNA for 72h. Lentivirus infected cells (5 x 104) were seeded on 6-well

plate in hormone depleted RPMI and the cells were counted using the coulter particle

counter at the indicated time points. The values are plotted as fold after normalized to day

1. Triplicate samples were included in each experimental set. For panels A-B, P values for the differences noted in the text were < 0.01.

Figure 3. AR activates Elk1 driven reporter in androgen ablation insensitive

prostate cancer cells. Panel A. Hormone depleted LP50 cells were transfected with

Elk1, HIF or SRF driven luciferase reporter construct. Hormone depleted C81 (panel C)

and C4-2 (panel D) were transfected with Elk1 driven luciferase reporter plasmid. The

cells were cotransfected with control shRNA or AR shRNA plasmid using Amaxa

nucleofector kit. In addition, all wells were also cotransfected with Renilla luciferase

control plasmid. 48h after transfection the cells were harvested either to measure

luciferase activity or for western blot analysis. The promoter activity values are plotted

as the ratio to the basal activity of the corresponding promoter in the non-targeting

125

shRNA controls. Triplicate samples were included in each experimental set. Panel B.

Western blot showing the expression of AR, Elk1 or GAPDH (loading control). For

panels A, C and D, P values for the differences noted in the text were < 0.05.

Figure 4. AR physically associates with Elk-1. C4-2 cells were seeded on 10 cm plates

and hormone depleted for 48h. The cells were harvested and nuclear protein was prepared

for immunoprecipitation. Panel A. IP was done using antibody for Elk-1 antibody or IgG negative control and the complex was resolved on SDS-PAGE and the protein was transferred onto nitrocellulose membrane and probed with primary antibody for AR.

Panel B. IP was done using AR antibody or IgG negative control and was resolved on

SDS-PAGE and the protein was transferred onto nitrocellulose membrane and probed

with primary antibody for Elk-1.

Figure 5. The interaction between AR and Elk1 regulate target genes that were

enriched for cell cycle in synergistic manner in androgen ablation insensitive cells.

Panel A: C81 cells (6 x 105) were infected in 6 well plates with Elk1 shRNA, AR

shRNA, AR shRNA + Elk1shRNA lentivirus or non-target control lentivirus. 72h after

infection the cells were harvested to obtain total RNA or total protein. The mRNA profile

was determined using replicate samples by illumina microarray analysis. The knockdown

of AR and Elk1 due to the AR or Elk1 shRNA lentivirus was confirmed by western blot

analysis (Panel A inset). The genes up-regulated by both AR and Elk1 in synergistic

manner were plotted with 1.5 fold cutoff value. Panel B: The top 100 genes regulated by

126

Elk1 in AR dependent manner were submitted to DAVID server for gene ontology

analysis and the top enriched GO terms were plotted.

Figure 6. AR-Elk1 interaction activates target genes repressed by Elk1. Hormone

depleted C81 cells were seeded in 6 well plates and infected with Elk1 shRNA, AR

shRNA, AR shRNA + Elk1shRNA lentivirus or non-target control lentivirus. 72h after

infection the cells were harvested to obtain total RNA. Panel A. RT-qPCR was

performed using Taqman probes for Elk-1 repressed genes that were determined by

ilumina DNA microarray. Panel B. RT-qPCR was performed using Taqman probes for

AR and Elk-1 to confirm the knockdown. For panels A-B, P values for the differences noted in the text were < 0.01.

Figure 7. AR-Elk1 interaction is ligand insensitive.C81 cells (Panel A) and C4-2 cells

(Panel B) were seeded on 6 well plates and hormone depleted for 48h. The cells were

treated with R1881 (1 nM), Casodex (10 uM), vehicle or the combination of R1881 (1 nM) and Casodex (10 uM) for 48 h. The cells were harvested for total RNA and RT- qPCR were done in triplicate. The data were plotted as mRNA fold induction compared to vehicle control. For panels A-B, P values for the differences noted in the text were <

0.001.

127

128

129

130

Figure 4

131

132

133

134

Chapter 4

Summary and Conclusion

This dissertation explores the non-classical mechanism of AR transcriptional activity in androgen depletion insensitive prostate cancer cells. Epidemiological data indicate that prostate cancer is the second leading cause of cancer related death among men in the US. The American Cancer Society estimates 217,730 new cases of prostate cancer in the United States in 2010 and about 32, 050 deaths due to this disease in the same year (4). When prostatectomy and radiation therapy are not viable initial treatment options or when the cancer has recurred after initial treatment or is more advanced or metastatic, the option is to use different types of androgen ablation therapy (2). However, androgen ablation is generally not curative and patients eventually develop resistance to it

(androgen ablation insensitive prostate cancer); at this stage, chemotherapy is the remaining option, but it has limited efficacy.

The exact mechanisms underlying hormone-refractory prostate cancer and their contribution to the disease in clinical situations remain unclear although androgen

135

receptor (AR) overexpression that leads to hypersensitization to low levels of androgen

(8, 164, 166), AR mutations that confer activation by non-androgenic ligands (151, 181,

182) and an altered co-regulator expression as well as aberrant activation of AR by

growth signaling pathways via cross talk that deregulate the phosphorylation or

acetylation status of AR have been implicated (187, 189, 192). Several lines of evidence have shown the continued activation of AR and its pivotal roles in the survival, growth and progression of both androgen dependent and castration resistant prostate cancer (2,

14, 169, 170).

Recent studies suggest that in many if not most tumors the apparent hormone- refractoriness reflects hypersensitation of the tumors to post-ablation levels of androgen due to upregulation of AR (14, 177, 178) suggesting that a new generation of androgen antagonists may be used to treat them (220). However, cancer cells within advanced prostate tumors are heterogeneous with respect to AR expression and many cells within the tumors do not over-express AR (152). The present study formulated a molecular mechanism of how AR activates genes when the tumor cells are totally androgen- independent.

In the classical view of AR signaling, ligand bound AR binds to the androgen response elements (AREs) of promoters/enhancers of the target genes for transcriptional activation (29, 30, 100). It is assumed that AR exerts its transcriptional activity in androgen depletion insensitive cells using a mechanism that mimics its hormone dependent action. This dissertation challenged this long held assumption and put forward

136

an alternative mechanism of transcriptional modulation by AR in androgen depletion

insensitive cancer cells. Most of the mechanistic studies characterizing the mode of AR

action were studied using limited numbers of genes such as the prototype prostate-

specific antigen (PSA) gene (30, 100). Even in PSA, studies that compared androgen

sensitive and resistant prostate cancer cells have shown a higher basal expression of PSA

in androgen resistant prostate cancer cells with an apparent lack of AR occupancy to the

PSA enhancer/promoter region (33). Furthermore, the demonstration of two distinct gene

expression programs between androgen sensitive and resistant cells (172) as well as

within androgen depletion insensitive cells (173) has uncoupled the androgen mediated action from that of apo-AR action. The ability of a DNA binding mutant of AR to support the proliferation and activation of genes in androgen ablation insensitive prostate cancer cells depleted of the wild type AR corroborated ARE independent action.

The data presented in this dissertation have demonstrated that in androgen depletion insensitive cancer cells ARE-mediated gene activation remains entirely androgen-dependent. Hence, it is important to note that in tumors that are hypersensitized to low levels of androgen, AR signals through ARE. On the other hand, the collection of data presented in this study corroborate the lack of direct binding of AR on the androgen response elements in the basal (hormone free) state and points to ARE independent action of the AR in truly androgen independent prostate cancer cells. These findings posit that advanced prostate tumors depend on the non-classical transcriptional mechanisms of AR to support proliferation.

137

Using LP50, C81 and C4-2 cell culture models of androgen ablation insensitive

prostate cancer, we showed that apo-AR employed non-classical/tethering mechanisms to

activate a largely different set of target genes. In the same cells, in the presence of

androgen, AR activates its classical target genes. The present study suggests that

advanced tumors retain both ARE dependent and ARE independent AR transcriptional

programs. Activation of either set of target genes may support tumor progression. Thus in

androgen ablation insensitive prostate cancer, AR-dependent proliferation may be supported by either ARE dependent gene activation in the presence of androgen or by non-classical ARE independent gene activation in the absence of androgen. An alternative pathway of AR signaling may thus support growth in hormone-refractory

tumors. It should be interesting to examine any distinctive physiological characteristics of

hormone-refractory tumors in the presence vs. the absence of androgen that may be

related to the contribution of either pathways of AR signaling.

However, in the context of tumor progression under androgen ablation therapy,

ARE independent (non-classical) transcriptional signaling confers selective proliferative

advantage for subpopulations of cells that are truly androgen independent. This finding

has a profound significance in the management of androgen ablation insensitive prostate

cancer. Even though tumors that over-express the AR could be hyper-sensitized to post-

ablation levels of androgen and could be targeted by new generation of antiandrogens

(220), the heterogeneous nature of prostatic tumors with respect to the AR expression

level will allow subpopulations of cells to circumvent ligand dependent transcriptional

modulation of AR to become truly androgen independent. Hence the development of

138

durable therapeutic strategies for castration resistant prostate cancer should target ARE

independent action of AR.

Here we showed that ARE independent action of AR occurs through interaction

with other DNA binding transcription factors. A non-classical (tethering) mode of transcriptional regulation is well established for ER and GR (34, 35, 119, 120, 125). Even though a prototype AR tethering protein has not been identified in the context of prostate tumorigenesis, previous studies in this laboratory and others have shown the significance of ARE independent AR actions in supporting prostate development (39, 40). However, in this dissertation we have reported seminal findings that establish ARE independent transcriptional regulation of genes by AR through tethering in the context of prostate cancer progression.

Here we extended our study and identified candidate transcription factors that modulate the transcriptional activity of AR in a truly androgen independent context. In this dissertation candidate AR tethering proteins for which the DNA binding sites were greatly enriched in the hormone-independent binding of AR to chromatin in LP50 cells

(chip-chip) were included in the screen. In addition, DNA binding proteins identified in

DNA-bound interactomes of AR using a high throughput transcription factor array were also included as candidate tethering proteins (45). Because AR is predominantly localized in the nucleus in advanced tumors, we speculated that a complement of AR interacting proteins allows the regulation of genes in the absence of androgen through tethering. We have discovered that Elk-1 is a novel transcription factor that tethers AR in prostate

139

cancer cells. Elk-1 is member of the ternary complex factor (TCF) subfamily of an ETS domain transcription factor (47, 48, 236). Elk1 is a modular phosphoprotein activated by

mitogenic signals to regulate the transcription of immediate early genes (47, 48, 236).

Prostate tumors show increased expression levels of pElk-1 compared to normal prostate

(267). We demonstrated that Elk-1 is required for proliferation in advanced prostate

cancer cells. Elk-1 is a central molecule that coordinating mitogenic signals from a

variety of signaling pathways (46, 55, 56). Furthermore, the ETS transcription factors are

frequently rearranged and overexpressed in prostate cancer (233, 234). The

demonstration of a unique function for Elk-1 in the context of totally androgen independent cancer growth creates unique avenues for therapeutic targeting.

The findings in this dissertation underscores the view that a complement of DNA

binding transcription factors tethers the nuclear localized AR to activate target genes

distinct from the classic early androgen response genes to support the progression of the

tumor during androgen ablation. Most importantly the co-activator function of AR was

insensitive to antiandrogen; this suggests the invariable failure of antiandrogen therapy in

advanced prostate cancer may be attributed to the selection of subpopulations of cells that

rely on ligand insensitive AR co-activator function.

Here we showed functional and physical association between AR and Elk-1 in

advanced cancer cells. This interaction regulates gene clusters that were enriched for cell

division function. The insensitivity of this interaction to androgen or antiandrogen

underscores the significance of the non-classical pathway of AR action in truly ligand 140

independent cells. The demonstration of Elk-1 as a prototype AR tethering protein which

is necessary for the growth of androgen ablation insensitive tumors has strong

implications. Even though Elk-1 is an oncogenic member of Ets transcription factor,

disruption of Elk-1 in mouse shows minor phenotypic abnormalities probably due to the

functional redundancy of TCF transcription factors (47, 48, 148, 236). Therefore,

therapeutic strategies targeting AR-Elk-1 interactions should have no unwanted side

effects. Future studies dissecting the interaction domains will facilitate the design and

development of peptidomimetics to disrupt the interaction. Hence the development of

therapeutic strategies aimed at selectively disrupting the tumor growth promoting

function of AR-Elk-1 would avoid targeting other physiological functions of AR and

would overcome the limitations of currently available adjuvant therapy for androgen

insensitive prostate cancer.

Even though Elk-1 is one transcription factor that tethers AR to support

proliferation, a number of other tethering proteins could exert a similar action depending

on the cell and gene context. The major implication of the present finding is it allows

selective targeting of the growth promoting function of AR mediated by the non-classical

pathway. Thus the findings of this dissertation represent a paradigm shift in the current understanding of AR signaling in androgen ablation insensitive prostate cancer and the

approach that should be taken in treating hormone-refractory prostate cancer.

141

References

1. Yeh S, Tsai MY, Xu Q, Mu XM, Lardy H, Huang KE, Lin H, Yeh SD, Altuwaijri S, Zhou X, Xing L, Boyce BF, Hung MC, Zhang S, Gan L, Chang C 2002 Generation and characterization of androgen receptor knockout (ARKO) mice: an in vivo model for the study of androgen functions in selective tissues. Proc Natl Acad Sci U S A 99:13498-13503

2. Feldman BJ, Feldman D 2001 The development of androgen-independent prostate cancer. Nat Rev Cancer 1:34-45

3. Stanbrough M, Leav I, Kwan PW, Bubley GJ, Balk SP 2001 Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium. Proc Natl Acad Sci U S A 98:10823-10828

4. Jemal A, Siegel R, Xu J, Ward E 2010 Cancer statistics, 2010. CA Cancer J Clin 60:277-300

5. Debes JD, Tindall DJ 2002 The role of androgens and the androgen receptor in prostate cancer. Cancer Lett 187:1-7

6. Scher HI, Sawyers CL 2005 Biology of progressive, castration-resistant prostate cancer: directed therapies targeting the androgen-receptor signaling axis. J Clin Oncol 23:8253-8261

7. Miyamoto H, Messing EM, Chang C 2004 Androgen deprivation therapy for prostate cancer: current status and future prospects. Prostate 61:332-353

8. Koivisto P, Kononen J, Palmberg C, Tammela T, Hyytinen E, Isola J, Trapman J, Cleutjens K, Noordzij A, Visakorpi T, Kallioniemi OP 1997 Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res 57:314-319

142

9. Brooke GN, Parker MG, Bevan CL 2008 Mechanisms of androgen receptor activation in advanced prostate cancer: differential co-activator recruitment and gene expression. Oncogene 27:2941-2950

10. Han G, Buchanan G, Ittmann M, Harris JM, Yu X, Demayo FJ, Tilley W, Greenberg NM 2005 Mutation of the androgen receptor causes oncogenic transformation of the prostate. Proc Natl Acad Sci U S A 102:1151-1156

11. Veldscholte J, Ris-Stalpers C, Kuiper GG, Jenster G, Berrevoets C, Claassen E, van Rooij HC, Trapman J, Brinkmann AO, Mulder E 1990 A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem Biophys Res Commun 173:534-540

12. Gregory CW, He B, Johnson RT, Ford OH, Mohler JL, French FS, Wilson EM 2001 A mechanism for androgen receptor-mediated prostate cancer recurrence after androgen deprivation therapy. Cancer Res 61:4315-4319

13. McKenna NJ, Lanz RB, O'Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321-344

14. Chen CD, Welsbie DS, Tran C, Baek SH, Chen R, Vessella R, Rosenfeld MG, Sawyers CL 2004 Molecular determinants of resistance to antiandrogen therapy. Nat Med 10:33-39

15. Gregory CW, Johnson RT, Jr., Mohler JL, French FS, Wilson EM 2001 Androgen receptor stabilization in recurrent prostate cancer is associated with hypersensitivity to low androgen. Cancer Res 61:2892-2898

16. Linja MJ, Savinainen KJ, Saramaki OR, Tammela TL, Vessella RL, Visakorpi T 2001 Amplification and overexpression of androgen receptor gene in hormone- refractory prostate cancer. Cancer Res 61:3550-3555

17. Sakr WA, Haas GP, Cassin BF, Pontes JE, Crissman JD 1993 The frequency of carcinoma and intraepithelial neoplasia of the prostate in young male patients. J Urol 150:379-385

18. Lin HK, Hu YC, Yang L, Altuwaijri S, Chen YT, Kang HY, Chang C 2003 Suppression versus induction of androgen receptor functions by the

143

phosphatidylinositol 3-kinase/Akt pathway in prostate cancer LNCaP cells with different passage numbers. J Biol Chem 278:50902-50907

19. Edwards J, Bartlett JM 2005 The androgen receptor and signal-transduction pathways in hormone-refractory prostate cancer. Part 1: Modifications to the androgen receptor. BJU Int 95:1320-1326

20. Shand RL, Gelmann EP 2006 Molecular biology of prostate-cancer pathogenesis. Curr Opin Urol 16:123-131

21. Komiya A, Suzuki H, Imamoto T, Kamiya N, Nihei N, Naya Y, Ichikawa T, Fuse H 2009 Neuroendocrine differentiation in the progression of prostate cancer. Int J Urol 16:37-44

22. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ 2005 Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 65:10946- 10951

23. Craft N, Chhor C, Tran C, Belldegrun A, DeKernion J, Witte ON, Said J, Reiter RE, Sawyers CL 1999 Evidence for clonal outgrowth of androgen-independent prostate cancer cells from androgen-dependent tumors through a two-step process. Cancer Res 59:5030-5036

24. Myers MP, Pass I, Batty IH, Van der Kaay J, Stolarov JP, Hemmings BA, Wigler MH, Downes CP, Tonks NK 1998 The lipid phosphatase activity of PTEN is critical for its tumor supressor function. Proc Natl Acad Sci U S A 95:13513- 13518

25. McDonnell TJ, Troncoso P, Brisbay SM, Logothetis C, Chung LW, Hsieh JT, Tu SM, Campbell ML 1992 Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Res 52:6940-6944

26. Colombel M, Symmans F, Gil S, O'Toole KM, Chopin D, Benson M, Olsson CA, Korsmeyer S, Buttyan R 1993 Detection of the apoptosis-suppressing oncoprotein bc1-2 in hormone-refractory human prostate cancers. Am J Pathol 143:390-400

27. Tsai MJ, O'Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451-486

144

28. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851-857

29. Cleutjens KB, van der Korput HA, van Eekelen CC, van Rooij HC, Faber PW, Trapman J 1997 An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter. Mol Endocrinol 11:148-161

30. Kim J, Coetzee GA 2004 Prostate specific antigen gene regulation by androgen receptor. J Cell Biochem 93:233-241

31. Dehm SM, Tindall DJ 2006 Ligand-independent androgen receptor activity is activation function-2-independent and resistant to antiandrogens in androgen refractory prostate cancer cells. J Biol Chem 281:27882-27893

32. Li TH, Zhao H, Peng Y, Beliakoff J, Brooks JD, Sun Z 2007 A promoting role of androgen receptor in androgen-sensitive and -insensitive prostate cancer cells. Nucleic Acids Res 35:2767-2776

33. Jia L, Coetzee GA 2005 Androgen receptor-dependent PSA expression in androgen-independent prostate cancer cells does not involve androgen receptor occupancy of the PSA locus. Cancer Res 65:8003-8008

34. Safe S, Kim K 2004 Nuclear receptor-mediated transactivation through interaction with Sp proteins. Prog Nucleic Acid Res Mol Biol 77:1-36

35. Jakacka M, Ito M, Weiss J, Chien PY, Gehm BD, Jameson JL 2001 Estrogen receptor binding to DNA is not required for its activity through the nonclassical AP1 pathway. J Biol Chem 276:13615-13621

36. Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R, Gass P, Schmid W, Herrlich P, Angel P, Schutz G 1998 DNA binding of the glucocorticoid receptor is not essential for survival. Cell 93:531-541

37. Jonat C, Rahmsdorf HJ, Park KK, Cato AC, Gebel S, Ponta H, Herrlich P 1990 Antitumor promotion and antiinflammation: down-modulation of AP-1 (Fos/Jun) activity by glucocorticoid hormone. Cell 62:1189-1204

145

38. Vlahopoulos S, Zimmer WE, Jenster G, Belaguli NS, Balk SP, Brinkmann AO, Lanz RB, Zoumpourlis VC, Schwartz RJ 2005 Recruitment of the androgen receptor via serum response factor facilitates expression of a myogenic gene. J Biol Chem 280:7786-7792

39. Zhang J, Gonit M, Salazar MD, Shatnawi A, Shemshedini L, Trumbly R, Ratnam M 2010 C/EBPalpha redirects androgen receptor signaling through a unique bimodal interaction. Oncogene 29:723-738

40. Norris JD, Chang CY, Wittmann BM, Kunder RS, Cui H, Fan D, Joseph JD, McDonnell DP 2009 The homeodomain protein HOXB13 regulates the cellular response to androgens. Mol Cell 36:405-416

41. Igawa T, Lin FF, Lee MS, Karan D, Batra SK, Lin MF 2002 Establishment and characterization of androgen-independent human prostate cancer LNCaP cell model. Prostate 50:222-235

42. Wu HC, Hsieh JT, Gleave ME, Brown NM, Pathak S, Chung LW 1994 Derivation of androgen-independent human LNCaP prostatic cancer cell sublines: role of bone stromal cells. Int J Cancer 57:406-412

43. Culig Z, Hobisch A, Cronauer MV, Cato AC, Hittmair A, Radmayr C, Eberle J, Bartsch G, Klocker H 1993 Mutant androgen receptor detected in an advanced- stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol Endocrinol 7:1541-1550

44. Taplin ME, Bubley GJ, Shuster TD, Frantz ME, Spooner AE, Ogata GK, Keer HN, Balk SP 1995 Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N Engl J Med 332:1393-1398

45. Mukhopadhyay NK, Ferdinand AS, Mukhopadhyay L, Cinar B, Lutchman M, Richie JP, Freeman MR, Liu BC 2006 Unraveling androgen receptor interactomes by an array-based method: discovery of proto-oncoprotein c-Rel as a negative regulator of androgen receptor. Exp Cell Res 312:3782-3795

46. Yordy JS, Muise-Helmericks RC 2000 Signal transduction and the Ets family of transcription factors. Oncogene 19:6503-6513

47. Sharrocks AD 2001 The ETS-domain transcription factor family. Nat Rev Mol Cell Biol 2:827-837

146

48. Buchwalter G, Gross C, Wasylyk B 2004 Ets ternary complex transcription factors. Gene 324:1-14

49. Treisman R 1992 The serum response element. Trends Biochem Sci 17:423-426

50. Boros J, Donaldson IJ, O'Donnell A, Odrowaz ZA, Zeef L, Lupien M, Meyer CA, Liu XS, Brown M, Sharrocks AD 2009 Elucidation of the ELK1 target gene network reveals a role in the coordinate regulation of core components of the gene regulation machinery. Genome Res 19:1963-1973

51. Boros J, O'Donnell A, Donaldson IJ, Kasza A, Zeef L, Sharrocks AD 2009 Overlapping promoter targeting by Elk-1 and other divergent ETS-domain transcription factor family members. Nucleic Acids Res 37:7368-7380

52. Li QJ, Vaingankar S, Sladek FM, Martins-Green M 2000 Novel nuclear target for thrombin: activation of the Elk1 transcription factor leads to chemokine gene expression. Blood 96:3696-3706

53. Li Q, Vaingankar SM, Green HM, Martins-Green M 1999 Activation of the 9E3/cCAF chemokine by phorbol esters occurs via multiple signal transduction pathways that converge to MEK1/ERK2 and activate the Elk1 transcription factor. J Biol Chem 274:15454-15465

54. Tomlins SA, Mehra R, Rhodes DR, Cao X, Wang L, Dhanasekaran SM, Kalyana- Sundaram S, Wei JT, Rubin MA, Pienta KJ, Shah RB, Chinnaiyan AM 2007 Integrative molecular concept modeling of prostate cancer progression. Nat Genet 39:41-51

55. Figueroa C, Vojtek AB 2003 Akt negatively regulates translation of the ternary complex factor Elk-1. Oncogene 22:5554-5561

56. Ohta H, Aoyagi K, Fukaya M, Danjoh I, Ohta A, Isohata N, Saeki N, Taniguchi H, Sakamoto H, Shimoda T, Tani T, Yoshida T, Sasaki H 2009 Cross talk between hedgehog and epithelial-mesenchymal transition pathways in gastric pit cells and in diffuse-type gastric cancers. Br J Cancer 100:389-398

57. Chung KC, Gomes I, Wang D, Lau LF, Rosner MR 1998 Raf and fibroblast growth factor phosphorylate Elk1 and activate the serum response element of the immediate early gene pip92 by mitogen-activated protein kinase-independent as well as -dependent signaling pathways. Mol Cell Biol 18:2272-2281

147

58. Lubahn DB, Joseph DR, Sar M, Tan J, Higgs HN, Larson RE, French FS, Wilson EM 1988 The human androgen receptor: complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in prostate. Mol Endocrinol 2:1265-1275

59. Faber PW, van Rooij HC, van der Korput HA, Baarends WM, Brinkmann AO, Grootegoed JA, Trapman J 1991 Characterization of the human androgen receptor transcription unit. J Biol Chem 266:10743-10749

60. Baarends WM, Themmen AP, Blok LJ, Mackenbach P, Brinkmann AO, Meijer D, Faber PW, Trapman J, Grootegoed JA 1990 The androgen receptor gene promoter. Mol Cell Endocrinol 74:75-84

61. Tilley WD, Marcelli M, McPhaul MJ 1990 Expression of the human androgen receptor gene utilizes a common promoter in diverse human tissues and cell lines. J Biol Chem 265:13776-13781

62. Mizokami A, Yeh SY, Chang C 1994 Identification of 3',5'-cyclic adenosine monophosphate response element and other cis-acting elements in the human androgen receptor gene promoter. Mol Endocrinol 8:77-88

63. Varriale B, Esposito T 2005 The hamster androgen receptor promoter: a molecular analysis. J Steroid Biochem Mol Biol 94:103-110

64. Jenster G, van der Korput HA, van Vroonhoven C, van der Kwast TH, Trapman J, Brinkmann AO 1991 Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 5:1396-1404

65. Jenster G, van der Korput JA, Trapman J, Brinkmann AO 1992 Functional domains of the human androgen receptor. J Steroid Biochem Mol Biol 41:671- 675

66. Jenster G, van der Korput HA, Trapman J, Brinkmann AO 1995 Identification of two transcription activation units in the N-terminal domain of the human androgen receptor. J Biol Chem 270:7341-7346

67. Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW, Mulder E, Brinkmann AO, Trapman J 1997 Functional in vivo interaction between the

148

amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry 36:1052-1064

68. Thompson J, Saatcioglu F, Janne OA, Palvimo JJ 2001 Disrupted amino- and carboxyl-terminal interactions of the androgen receptor are linked to androgen insensitivity. Mol Endocrinol 15:923-935

69. Bubulya A, Chen SY, Fisher CJ, Zheng Z, Shen XQ, Shemshedini L 2001 c-Jun potentiates the functional interaction between the amino and carboxyl termini of the androgen receptor. J Biol Chem 276:44704-44711

70. He B, Wilson EM 2002 The NH(2)-terminal and carboxyl-terminal interaction in the human androgen receptor. Mol Genet Metab 75:293-298

71. Claessens F, Denayer S, Van Tilborgh N, Kerkhofs S, Helsen C, Haelens A 2008 Diverse roles of androgen receptor (AR) domains in AR-mediated signaling. Nucl Recept Signal 6:e008

72. Haelens A, Tanner T, Denayer S, Callewaert L, Claessens F 2007 The hinge region regulates DNA binding, nuclear translocation, and transactivation of the androgen receptor. Cancer Res 67:4514-4523

73. Jenster G, Spencer TE, Burcin MM, Tsai SY, Tsai MJ, O'Malley BW 1997 Steroid receptor induction of gene transcription: a two-step model. Proc Natl Acad Sci U S A 94:7879-7884

74. Wilson CM, McPhaul MJ 1994 A and B forms of the androgen receptor are present in human genital skin fibroblasts. Proc Natl Acad Sci U S A 91:1234- 1238

75. Gregory CW, He B, Wilson EM 2001 The putative androgen receptor-A form results from in vitro . J Mol Endocrinol 27:309-319

76. van der Vaart M, Schaaf MJ 2009 Naturally occurring C-terminal splice variants of nuclear receptors. Nucl Recept Signal 7:e007

77. Hu R, Dunn TA, Wei S, Isharwal S, Veltri RW, Humphreys E, Han M, Partin AW, Vessella RL, Isaacs WB, Bova GS, Luo J 2009 Ligand-independent

149

androgen receptor variants derived from splicing of cryptic exons signify hormone-refractory prostate cancer. Cancer Res 69:16-22

78. Guo Z, Yang X, Sun F, Jiang R, Linn DE, Chen H, Kong X, Melamed J, Tepper CG, Kung HJ, Brodie AM, Edwards J, Qiu Y 2009 A novel androgen receptor splice variant is up-regulated during prostate cancer progression and promotes androgen depletion-resistant growth. Cancer Res 69:2305-2313

79. Watson PA, Chen YF, Balbas MD, Wongvipat J, Socci ND, Viale A, Kim K, Sawyers CL 2010 Constitutively active androgen receptor splice variants expressed in castration-resistant prostate cancer require full-length androgen receptor. Proc Natl Acad Sci U S A 107:16759-16765

80. Grad JM, Dai JL, Wu S, Burnstein KL 1999 Multiple androgen response elements and a consensus site in the androgen receptor (AR) coding region are involved in androgen-mediated up-regulation of AR messenger RNA. Mol Endocrinol 13:1896-1911

81. Burnstein KL 2005 Regulation of androgen receptor levels: implications for prostate cancer progression and therapy. J Cell Biochem 95:657-669

82. Blok LJ, Themmen AP, Peters AH, Trapman J, Baarends WM, Hoogerbrugge JW, Grootegoed JA 1992 Transcriptional regulation of androgen receptor gene expression in Sertoli cells and other cell types. Mol Cell Endocrinol 88:153-164

83. Wolf DA, Herzinger T, Hermeking H, Blaschke D, Horz W 1993 Transcriptional and posttranscriptional regulation of human androgen receptor expression by androgen. Mol Endocrinol 7:924-936

84. Krongrad A, Wilson CM, Wilson JD, Allman DR, McPhaul MJ 1991 Androgen increases androgen receptor protein while decreasing receptor mRNA in LNCaP cells. Mol Cell Endocrinol 76:79-88

85. Zhou ZX, Lane MV, Kemppainen JA, French FS, Wilson EM 1995 Specificity of ligand-dependent androgen receptor stabilization: receptor domain interactions influence ligand dissociation and receptor stability. Mol Endocrinol 9:208-218

86. Burnstein KL, Maiorino CA, Dai JL, Cameron DJ 1995 Androgen and glucocorticoid regulation of androgen receptor cDNA expression. Mol Cell Endocrinol 115:177-186

150

87. Wang LG, Johnson EM, Kinoshita Y, Babb JS, Buckley MT, Liebes LF, Melamed J, Liu XM, Kurek R, Ossowski L, Ferrari AC 2008 Androgen receptor overexpression in prostate cancer linked to Pur alpha loss from a novel repressor complex. Cancer Res 68:2678-2688

88. Ostling P, Leivonen SK, Aakula A, Kohonen P, Makela R, Hagman Z, Edsjo A, Kangaspeska S, Edgren H, Nicorici D, Bjartell A, Ceder Y, Perala M, Kallioniemi O 2011 Systematic analysis of targeting the androgen receptor in prostate cancer cells. Cancer Res 71:1956-1967

89. Glass CK, Rosenfeld MG 2000 The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14:121-141

90. Gioeli D, Ficarro SB, Kwiek JJ, Aaronson D, Hancock M, Catling AD, White FM, Christian RE, Settlage RE, Shabanowitz J, Hunt DF, Weber MJ 2002 Androgen receptor phosphorylation. Regulation and identification of the phosphorylation sites. J Biol Chem 277:29304-29314

91. Kemppainen JA, Lane MV, Sar M, Wilson EM 1992 Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. Specificity for steroids and antihormones. J Biol Chem 267:968-974

92. Agoulnik IU, Weigel NL 2008 Androgen receptor coactivators and prostate cancer. Adv Exp Med Biol 617:245-255

93. Burd CJ, Morey LM, Knudsen KE 2006 Androgen receptor and prostate cancer. Endocr Relat Cancer 13:979-994

94. Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:43-48

95. Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL, Evans RM 1997 Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373-380

96. O'Malley BW 2007 Coregulators: from whence came these "master genes". Mol Endocrinol 21:1009-1013

151

97. Peterson TJ, Karmakar S, Pace MC, Gao T, Smith CL 2007 The silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) corepressor is required for full transcriptional activity. Mol Cell Biol 27:5933-5948

98. Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkmann AO, Trapman J 1996 Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. J Biol Chem 271:6379-6388

99. Pang S, Dannull J, Kaboo R, Xie Y, Tso CL, Michel K, deKernion JB, Belldegrun AS 1997 Identification of a positive regulatory element responsible for tissue- specific expression of prostate-specific antigen. Cancer Res 57:495-499

100. Wang Q, Li W, Liu XS, Carroll JS, Janne OA, Keeton EK, Chinnaiyan AM, Pienta KJ, Brown M 2007 A hierarchical network of transcription factors governs androgen receptor-dependent prostate cancer growth. Mol Cell 27:380-392

101. Massie CE, Adryan B, Barbosa-Morais NL, Lynch AG, Tran MG, Neal DE, Mills IG 2007 New androgen receptor genomic targets show an interaction with the ETS1 transcription factor. EMBO Rep 8:871-878

102. Shang Y, Myers M, Brown M 2002 Formation of the androgen receptor transcription complex. Mol Cell 9:601-610

103. Claessens F, Verrijdt G, Schoenmakers E, Haelens A, Peeters B, Verhoeven G, Rombauts W 2001 Selective DNA binding by the androgen receptor as a mechanism for hormone-specific gene regulation. J Steroid Biochem Mol Biol 76:23-30

104. Bolton EC, So AY, Chaivorapol C, Haqq CM, Li H, Yamamoto KR 2007 Cell- and gene-specific regulation of primary target genes by the androgen receptor. Genes Dev 21:2005-2017

105. Scher HI, Buchanan G, Gerald W, Butler LM, Tilley WD 2004 Targeting the androgen receptor: improving outcomes for castration-resistant prostate cancer. Endocr Relat Cancer 11:459-476

106. Wong CI, Zhou ZX, Sar M, Wilson EM 1993 Steroid requirement for androgen receptor dimerization and DNA binding. Modulation by intramolecular

152

interactions between the NH2-terminal and steroid-binding domains. J Biol Chem 268:19004-19012

107. Karvonen U, Kallio PJ, Janne OA, Palvimo JJ 1997 Interaction of androgen receptors with androgen response element in intact cells. Roles of amino- and carboxyl-terminal regions and the ligand. J Biol Chem 272:15973-15979

108. Xie YB, Sui YP, Shan LX, Palvimo JJ, Phillips DM, Janne OA 1992 Expression of androgen receptor in insect cells. Purification of the receptor and renaturation of its steroid- and DNA-binding functions. J Biol Chem 267:4939-4948

109. Luke MC, Coffey DS 1994 Human androgen receptor binding to the androgen response element of prostate specific antigen. J Androl 15:41-51

110. Huang ZQ, Li J, Wong J 2002 AR possesses an intrinsic hormone-independent transcriptional activity. Mol Endocrinol 16:924-937

111. Kallio PJ, Poukka H, Moilanen A, Janne OA, Palvimo JJ 1995 Androgen receptor-mediated transcriptional regulation in the absence of direct interaction with a specific DNA element. Mol Endocrinol 9:1017-1028

112. Palvimo JJ, Reinikainen P, Ikonen T, Kallio PJ, Moilanen A, Janne OA 1996 Mutual transcriptional interference between RelA and androgen receptor. J Biol Chem 271:24151-24156

113. Schneikert J, Peterziel H, Defossez PA, Klocker H, Launoit Y, Cato AC 1996 Androgen receptor-Ets protein interaction is a novel mechanism for steroid hormone-mediated down-modulation of matrix metalloproteinase expression. J Biol Chem 271:23907-23913

114. Riegman PH, Vlietstra RJ, van der Korput JA, Brinkmann AO, Trapman J 1991 The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol Endocrinol 5:1921-1930

115. Heck S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P, Cato AC 1994 A distinct modulating domain in glucocorticoid receptor monomers in the repression of activity of the transcription factor AP-1. EMBO J 13:4087-4095

153

116. Dahlman-Wright K, Wright A, Gustafsson JA, Carlstedt-Duke J 1991 Interaction of the glucocorticoid receptor DNA-binding domain with DNA as a dimer is mediated by a short segment of five amino acids. J Biol Chem 266:3107-3112

117. Ray A, Prefontaine KE 1994 Physical association and functional antagonism between the p65 subunit of transcription factor NF-kappa B and the glucocorticoid receptor. Proc Natl Acad Sci U S A 91:752-756

118. Scheinman RI, Gualberto A, Jewell CM, Cidlowski JA, Baldwin AS, Jr. 1995 Characterization of mechanisms involved in transrepression of NF-kappa B by activated glucocorticoid receptors. Mol Cell Biol 15:943-953

119. Caldenhoven E, Liden J, Wissink S, Van de Stolpe A, Raaijmakers J, Koenderman L, Okret S, Gustafsson JA, Van der Saag PT 1995 Negative cross- talk between RelA and the glucocorticoid receptor: a possible mechanism for the antiinflammatory action of . Mol Endocrinol 9:401-412

120. Yang-Yen HF, Chambard JC, Sun YL, Smeal T, Schmidt TJ, Drouin J, Karin M 1990 Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. Cell 62:1205-1215

121. Stoner M, Wormke M, Saville B, Samudio I, Qin C, Abdelrahim M, Safe S 2004 Estrogen regulation of vascular endothelial growth factor gene expression in ZR- 75 breast cancer cells through interaction of estrogen receptor alpha and SP proteins. Oncogene 23:1052-1063

122. Nakajima Y, Akaogi K, Suzuki T, Osakabe A, Yamaguchi C, Sunahara N, Ishida J, Kako K, Ogawa S, Fujimura T, Homma Y, Fukamizu A, Murayama A, Kimura K, Inoue S, Yanagisawa J 2011 Estrogen Regulates Tumor Growth Through a Nonclassical Pathway that Includes the Transcription Factors ER{beta} and KLF5. Sci Signal 4:ra22

123. Bellido T, Jilka RL, Boyce BF, Girasole G, Broxmeyer H, Dalrymple SA, Murray R, Manolagas SC 1995 Regulation of interleukin-6, osteoclastogenesis, and bone mass by androgens. The role of the androgen receptor. J Clin Invest 95:2886-2895

124. Shin S, Kim TD, Jin F, van Deursen JM, Dehm SM, Tindall DJ, Grande JP, Munz JM, Vasmatzis G, Janknecht R 2009 Induction of prostatic intraepithelial neoplasia and modulation of androgen receptor by ETS variant 1/ETS-related protein 81. Cancer Res 69:8102-8110 154

125. Sinisi AA, Pasquali D, Notaro A, Bellastella A 2003 Sexual differentiation. J Endocrinol Invest 26:23-28

126. Mooradian AD, Morley JE, Korenman SG 1987 Biological actions of androgens. Endocr Rev 8:1-28

127. Tuck SP, Francis RM 2009 Testosterone, bone and osteoporosis. Front Horm Res 37:123-132

128. Wu CT, Altuwaijri S, Ricke WA, Huang SP, Yeh S, Zhang C, Niu Y, Tsai MY, Chang C 2007 Increased prostate cell proliferation and loss of cell differentiation in mice lacking prostate epithelial androgen receptor. Proc Natl Acad Sci U S A 104:12679-12684

129. Cunha GR, Donjacour AA, Cooke PS, Mee S, Bigsby RM, Higgins SJ, Sugimura Y 1987 The endocrinology and developmental biology of the prostate. Endocr Rev 8:338-362

130. Heinlein CA, Chang C 2004 Androgen receptor in prostate cancer. Endocr Rev 25:276-308

131. Walters KA, Simanainen U, Handelsman DJ 2010 Molecular insights into androgen actions in male and female reproductive function from androgen receptor knockout models. Hum Reprod Update 16:543-558

132. Sinha-Hikim I, Taylor WE, Gonzalez-Cadavid NF, Zheng W, Bhasin S 2004 Androgen receptor in human skeletal muscle and cultured muscle satellite cells: up-regulation by androgen treatment. J Clin Endocrinol Metab 89:5245-5255

133. Bhasin S, Storer TW, Berman N, Callegari C, Clevenger B, Phillips J, Bunnell TJ, Tricker R, Shirazi A, Casaburi R 1996 The effects of supraphysiologic doses of testosterone on muscle size and strength in normal men. N Engl J Med 335:1-7

134. Singh R, Artaza JN, Taylor WE, Braga M, Yuan X, Gonzalez-Cadavid NF, Bhasin S 2006 Testosterone inhibits adipogenic differentiation in 3T3-L1 cells: nuclear translocation of androgen receptor complex with beta-catenin and T-cell factor 4 may bypass canonical Wnt signaling to down-regulate adipogenic transcription factors. Endocrinology 147:141-154

155

135. Zuloaga DG, Puts DA, Jordan CL, Breedlove SM 2008 The role of androgen receptors in the masculinization of and behavior: what we've learned from the testicular feminization mutation. Horm Behav 53:613-626

136. Litvinov IV, De Marzo AM, Isaacs JT 2003 Is the Achilles' heel for prostate cancer therapy a gain of function in androgen receptor signaling? J Clin Endocrinol Metab 88:2972-2982

137. Hayward SW, Del Buono R, Deshpande N, Hall PA 1992 A functional model of adult human prostate epithelium. The role of androgens and stroma in architectural organisation and the maintenance of differentiated secretory function. J Cell Sci 102 ( Pt 2):361-372

138. Lu W, Luo Y, Kan M, McKeehan WL 1999 Fibroblast growth factor-10. A second candidate stromal to epithelial cell andromedin in prostate. J Biol Chem 274:12827-12834

139. Isaacs JT, Isaacs WB 2004 Androgen receptor outwits prostate cancer drugs. Nat Med 10:26-27

140. Whitacre DC, Chauhan S, Davis T, Gordon D, Cress AE, Miesfeld RL 2002 Androgen induction of in vitro prostate cell differentiation. Cell Growth Differ 13:1-11

141. Ling MT, Chan KW, Choo CK 2001 Androgen induces differentiation of a human papillomavirus 16 E6/E7 immortalized prostate epithelial cell line. J Endocrinol 170:287-296

142. Berger R, Febbo PG, Majumder PK, Zhao JJ, Mukherjee S, Signoretti S, Campbell KT, Sellers WR, Roberts TM, Loda M, Golub TR, Hahn WC 2004 Androgen-induced differentiation and tumorigenicity of human prostate epithelial cells. Cancer Res 64:8867-8875

143. Simanainen U, Allan CM, Lim P, McPherson S, Jimenez M, Zajac JD, Davey RA, Handelsman DJ 2007 Disruption of prostate epithelial androgen receptor impedes prostate lobe-specific growth and function. Endocrinology 148:2264- 2272

156

144. Cesari F, Rennekampff V, Vintersten K, Vuong LG, Seibler J, Bode J, Wiebel FF, Nordheim A 2004 Elk-1 knock-out mice engineered by Flp recombinase- mediated cassette exchange. Genesis 38:87-92

145. Bielas JH, Loeb KR, Rubin BP, True LD, Loeb LA 2006 Human cancers express a mutator phenotype. Proc Natl Acad Sci U S A 103:18238-18242

146. Loeb LA, Bielas JH, Beckman RA 2008 Cancers exhibit a mutator phenotype: clinical implications. Cancer Res 68:3551-3557; discussion 3557

147. Steinkamp MP, O'Mahony OA, Brogley M, Rehman H, Lapensee EW, Dhanasekaran S, Hofer MD, Kuefer R, Chinnaiyan A, Rubin MA, Pienta KJ, Robins DM 2009 Treatment-dependent androgen receptor mutations in prostate cancer exploit multiple mechanisms to evade therapy. Cancer Res 69:4434-4442

148. Shah RB, Mehra R, Chinnaiyan AM, Shen R, Ghosh D, Zhou M, Macvicar GR, Varambally S, Harwood J, Bismar TA, Kim R, Rubin MA, Pienta KJ 2004 Androgen-independent prostate cancer is a heterogeneous group of diseases: lessons from a rapid autopsy program. Cancer Res 64:9209-9216

149. Karhadkar SS, Bova GS, Abdallah N, Dhara S, Gardner D, Maitra A, Isaacs JT, Berman DM, Beachy PA 2004 Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 431:707-712

150. Stecca B, Mas C, Ruiz i Altaba A 2005 Interference with HH-GLI signaling inhibits prostate cancer. Trends Mol Med 11:199-203

151. Bhowmick NA, Chytil A, Plieth D, Gorska AE, Dumont N, Shappell S, Washington MK, Neilson EG, Moses HL 2004 TGF-beta signaling in fibroblasts modulates the oncogenic potential of adjacent epithelia. Science 303:848-851

152. Gounari F, Signoretti S, Bronson R, Klein L, Sellers WR, Kum J, Siermann A, Taketo MM, von Boehmer H, Khazaie K 2002 Stabilization of beta-catenin induces lesions reminiscent of prostatic intraepithelial neoplasia, but terminal squamous of other secretory epithelia. Oncogene 21:4099- 4107

153. Dickinson SI 2010 Premalignant and malignant prostate lesions: pathologic review. Cancer Control 17:214-222

157

154. De Marzo AM, Platz EA, Sutcliffe S, Xu J, Gronberg H, Drake CG, Nakai Y, Isaacs WB, Nelson WG 2007 Inflammation in prostate carcinogenesis. Nat Rev Cancer 7:256-269

155. De Marzo AM, Marchi VL, Epstein JI, Nelson WG 1999 Proliferative inflammatory atrophy of the prostate: implications for prostatic carcinogenesis. Am J Pathol 155:1985-1992

156. D'Antonio JM, Vander Griend DJ, Antony L, Ndikuyeze G, Dalrymple SL, Koochekpour S, Isaacs JT 2010 Loss of androgen receptor-dependent growth suppression by prostate cancer cells can occur independently from acquiring oncogenic to androgen receptor signaling. PLoS One 5:e11475

157. Hobisch A, Culig Z, Radmayr C, Bartsch G, Klocker H, Hittmair A 1996 Androgen receptor status of lymph node metastases from prostate cancer. Prostate 28:129-135

158. van der Kwast TH, Schalken J, Ruizeveld de Winter JA, van Vroonhoven CC, Mulder E, Boersma W, Trapman J 1991 Androgen receptors in endocrine- therapy-resistant human prostate cancer. Int J Cancer 48:189-193

159. Latil A, Bieche I, Vidaud D, Lidereau R, Berthon P, Cussenot O, Vidaud M 2001 Evaluation of androgen, estrogen (ER alpha and ER beta), and progesterone receptor expression in human prostate cancer by real-time quantitative reverse transcription-polymerase chain reaction assays. Cancer Res 61:1919-1926

160. Ford OH, 3rd, Gregory CW, Kim D, Smitherman AB, Mohler JL 2003 Androgen receptor gene amplification and protein expression in recurrent prostate cancer. J Urol 170:1817-1821

161. Edwards J, Krishna NS, Grigor KM, Bartlett JM 2003 Androgen receptor gene amplification and protein expression in hormone refractory prostate cancer. Br J Cancer 89:552-556

162. Visakorpi T, Hyytinen E, Koivisto P, Tanner M, Keinanen R, Palmberg C, Palotie A, Tammela T, Isola J, Kallioniemi OP 1995 In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat Genet 9:401-406

158

163. Raffo AJ, Perlman H, Chen MW, Day ML, Streitman JS, Buttyan R 1995 Overexpression of bcl-2 protects prostate cancer cells from apoptosis in vitro and confers resistance to androgen depletion in vivo. Cancer Res 55:4438-4445

164. Gregory CW, Hamil KG, Kim D, Hall SH, Pretlow TG, Mohler JL, French FS 1998 Androgen receptor expression in androgen-independent prostate cancer is associated with increased expression of androgen-regulated genes. Cancer Res 58:5718-5724

165. de Vere White R, Meyers F, Chi SG, Chamberlain S, Siders D, Lee F, Stewart S, Gumerlock PH 1997 Human androgen receptor expression in prostate cancer following androgen ablation. Eur Urol 31:1-6

166. Zhang L, Johnson M, Le KH, Sato M, Ilagan R, Iyer M, Gambhir SS, Wu L, Carey M 2003 Interrogating androgen receptor function in recurrent prostate cancer. Cancer Res 63:4552-4560

167. Vellaichamy A, Dezso Z, JeBailey L, Chinnaiyan AM, Sreekumar A, Nesvizhskii AI, Omenn GS, Bugrim A 2010 "Topological significance" analysis of gene expression and proteomic profiles from prostate cancer cells reveals key mechanisms of androgen response. PLoS One 5:e10936

168. Wang Q, Li W, Zhang Y, Yuan X, Xu K, Yu J, Chen Z, Beroukhim R, Wang H, Lupien M, Wu T, Regan MM, Meyer CA, Carroll JS, Manrai AK, Janne OA, Balk SP, Mehra R, Han B, Chinnaiyan AM, Rubin MA, True L, Fiorentino M, Fiore C, Loda M, Kantoff PW, Liu XS, Brown M 2009 Androgen receptor regulates a distinct transcription program in androgen-independent prostate cancer. Cell 138:245-256

169. Gonit M, Zhang J, Salazar M, Cui H, Shatnawi A, Trumbly R, Ratnam M 2011 Hormone depletion-insensitivity of prostate cancer cells is supported by the AR without binding to classical response elements. Mol Endocrinol 25:621-634

170. Palmberg C, Koivisto P, Hyytinen E, Isola J, Visakorpi T, Kallioniemi OP, Tammela T 1997 Androgen receptor gene amplification in a recurrent prostate cancer after monotherapy with the potent antiandrogen Casodex (bicalutamide) with a subsequent favorable response to maximal androgen blockade. Eur Urol 31:216-219

171. Jarrard DF, Kinoshita H, Shi Y, Sandefur C, Hoff D, Meisner LF, Chang C, Herman JG, Isaacs WB, Nassif N 1998 of the androgen receptor 159

promoter CpG island is associated with loss of androgen receptor expression in prostate cancer cells. Cancer Res 58:5310-5314

172. Takahashi S, Inaguma S, Sakakibara M, Cho YM, Suzuki S, Ikeda Y, Cui L, Shirai T 2002 DNA methylation in the androgen receptor gene promoter region in rat prostate cancers. Prostate 52:82-88

173. Kokontis J, Takakura K, Hay N, Liao S 1994 Increased androgen receptor activity and altered c-myc expression in prostate cancer cells after long-term androgen deprivation. Cancer Res 54:1566-1573

174. Waltering KK, Helenius MA, Sahu B, Manni V, Linja MJ, Janne OA, Visakorpi T 2009 Increased expression of androgen receptor sensitizes prostate cancer cells to low levels of androgens. Cancer Res 69:8141-8149

175. Gottlieb B, Lehvaslaiho H, Beitel LK, Lumbroso R, Pinsky L, Trifiro M 1998 The Androgen Receptor Gene Mutations Database. Nucleic Acids Res 26:234-238

176. Chandra S, Shao J, Li JX, Li M, Longo FM, Diamond MI 2008 A common motif targets and the androgen receptor to the . J Biol Chem 283:23950-23955

177. Middleman MN, Lush RM, Figg WD 1996 The mutated androgen receptor and its implications for the treatment of metastatic carcinoma of the prostate. Pharmacotherapy 16:376-381

178. Hara T, Miyazaki J, Araki H, Yamaoka M, Kanzaki N, Kusaka M, Miyamoto M 2003 Novel mutations of androgen receptor: a possible mechanism of bicalutamide withdrawal syndrome. Cancer Res 63:149-153

179. Haapala K, Hyytinen ER, Roiha M, Laurila M, Rantala I, Helin HJ, Koivisto PA 2001 Androgen receptor alterations in prostate cancer relapsed during a combined androgen blockade by orchiectomy and bicalutamide. Lab Invest 81:1647-1651

180. Dehm SM, Schmidt LJ, Heemers HV, Vessella RL, Tindall DJ 2008 Splicing of a novel androgen receptor exon generates a constitutively active androgen receptor that mediates prostate cancer therapy resistance. Cancer Res 68:5469-5477

160

181. Sun S, Sprenger CC, Vessella RL, Haugk K, Soriano K, Mostaghel EA, Page ST, Coleman IM, Nguyen HM, Sun H, Nelson PS, Plymate SR 2010 Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant. J Clin Invest 120:2715-2730

182. Blom N, Gammeltoft S, Brunak S 1999 Sequence and structure-based prediction of eukaryotic sites. J Mol Biol 294:1351-1362

183. Berger R, Lin DI, Nieto M, Sicinska E, Garraway LA, Adams H, Signoretti S, Hahn WC, Loda M 2006 Androgen-dependent regulation of Her-2/neu in prostate cancer cells. Cancer Res 66:5723-5728

184. Bartlett JM, Brawley D, Grigor K, Munro AF, Dunne B, Edwards J 2005 Type I receptor tyrosine kinases are associated with hormone escape in prostate cancer. J Pathol 205:522-529

185. Di Lorenzo G, Tortora G, D'Armiento FP, De Rosa G, Staibano S, Autorino R, D'Armiento M, De Laurentiis M, De Placido S, Catalano G, Bianco AR, Ciardiello F 2002 Expression of epidermal growth factor receptor correlates with disease relapse and progression to androgen-independence in human prostate cancer. Clin Cancer Res 8:3438-3444

186. Ueda T, Mawji NR, Bruchovsky N, Sadar MD 2002 Ligand-independent activation of the androgen receptor by interleukin-6 and the role of steroid receptor coactivator-1 in prostate cancer cells. J Biol Chem 277:38087-38094

187. Mellinghoff IK, Vivanco I, Kwon A, Tran C, Wongvipat J, Sawyers CL 2004 HER2/neu kinase-dependent modulation of androgen receptor function through effects on DNA binding and stability. Cancer Cell 6:517-527

188. Craft N, Shostak Y, Carey M, Sawyers CL 1999 A mechanism for hormone- independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med 5:280-285

189. Ponguta LA, Gregory CW, French FS, Wilson EM 2008 Site-specific androgen receptor serine phosphorylation linked to epidermal growth factor-dependent growth of castration-recurrent prostate cancer. J Biol Chem 283:20989-21001

190. Ghosh PM, Malik S, Bedolla R, Kreisberg JI 2003 Akt in prostate cancer: possible role in androgen-independence. Curr Drug Metab 4:487-496

161

191. Zhu ML, Kyprianou N 2008 Androgen receptor and growth factor signaling cross-talk in prostate cancer cells. Endocr Relat Cancer 15:841-849

192. Chi KN, Bjartell A, Dearnaley D, Saad F, Schroder FH, Sternberg C, Tombal B, Visakorpi T 2009 Castration-resistant prostate cancer: from new pathophysiology to new treatment targets. Eur Urol 56:594-605

193. McCall P, Gemmell LK, Mukherjee R, Bartlett JM, Edwards J 2008 Phosphorylation of the androgen receptor is associated with reduced survival in hormone-refractory prostate cancer patients. Br J Cancer 98:1094-1101

194. Guo Z, Dai B, Jiang T, Xu K, Xie Y, Kim O, Nesheiwat I, Kong X, Melamed J, Handratta VD, Njar VC, Brodie AM, Yu LR, Veenstra TD, Chen H, Qiu Y 2006 Regulation of androgen receptor activity by tyrosine phosphorylation. Cancer Cell 10:309-319

195. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, Arora VK, Kaushik P, Cerami E, Reva B, Antipin Y, Mitsiades N, Landers T, Dolgalev I, Major JE, Wilson M, Socci ND, Lash AE, Heguy A, Eastham JA, Scher HI, Reuter VE, Scardino PT, Sander C, Sawyers CL, Gerald WL 2010 Integrative genomic profiling of human prostate cancer. Cancer Cell 18:11-22

196. Fujimoto N, Miyamoto H, Mizokami A, Harada S, Nomura M, Ueta Y, Sasaguri T, Matsumoto T 2007 Prostate cancer cells increase androgen sensitivity by increase in nuclear androgen receptor and androgen receptor coactivators; a possible mechanism of hormone-resistance of prostate cancer cells. Cancer Invest 25:32-37

197. Dai Y, Ngo D, Jacob J, Forman LW, Faller DV 2008 Prohibitin and the SWI/SNF ATPase subunit BRG1 are required for effective androgen antagonist-mediated transcriptional repression of androgen receptor-regulated genes. Carcinogenesis 29:1725-1733

198. Dart DA, Spencer-Dene B, Gamble SC, Waxman J, Bevan CL 2009 Manipulating prohibitin levels provides evidence for an in vivo role in androgen regulation of prostate tumours. Endocr Relat Cancer 16:1157-1169

199. Zhu P, Baek SH, Bourk EM, Ohgi KA, Garcia-Bassets I, Sanjo H, Akira S, Kotol PF, Glass CK, Rosenfeld MG, Rose DW 2006 Macrophage/cancer cell interactions mediate hormone resistance by a nuclear receptor derepression pathway. Cell 124:615-629 162

200. Belandia B, Powell SM, Garcia-Pedrero JM, Walker MM, Bevan CL, Parker MG 2005 Hey1, a mediator of notch signaling, is an androgen receptor corepressor. Mol Cell Biol 25:1425-1436

201. Zhang Y, Linn D, Liu Z, Melamed J, Tavora F, Young CY, Burger AM, Hamburger AW 2008 EBP1, an ErbB3-binding protein, is decreased in prostate cancer and implicated in hormone resistance. Mol Cancer Ther 7:3176-3186

202. Kinoshita H, Shi Y, Sandefur C, Meisner LF, Chang C, Choon A, Reznikoff CR, Bova GS, Friedl A, Jarrard DF 2000 Methylation of the androgen receptor minimal promoter silences transcription in human prostate cancer. Cancer Res 60:3623-3630

203. Hobisch A, Culig Z, Radmayr C, Bartsch G, Klocker H, Hittmair A 1995 Distant metastases from prostatic carcinoma express androgen receptor protein. Cancer Res 55:3068-3072

204. Mostaghel EA, Page ST, Lin DW, Fazli L, Coleman IM, True LD, Knudsen B, Hess DL, Nelson CC, Matsumoto AM, Bremner WJ, Gleave ME, Nelson PS 2007 Intraprostatic androgens and androgen-regulated gene expression persist after testosterone suppression: therapeutic implications for castration-resistant prostate cancer. Cancer Res 67:5033-5041

205. Mohler JL, Gregory CW, Ford OH, 3rd, Kim D, Weaver CM, Petrusz P, Wilson EM, French FS 2004 The androgen axis in recurrent prostate cancer. Clin Cancer Res 10:440-448

206. Holzbeierlein J, Lal P, LaTulippe E, Smith A, Satagopan J, Zhang L, Ryan C, Smith S, Scher H, Scardino P, Reuter V, Gerald WL 2004 Gene expression analysis of human prostate carcinoma during hormonal therapy identifies androgen-responsive genes and mechanisms of therapy resistance. Am J Pathol 164:217-227

207. Platz EA, De Marzo AM, Giovannucci E 2004 Failure to detect prostate cancer in the PSA era: comments on N Engl J Med 2003; 349: 215-224 and N Engl J Med 2003; 349: 335-342. Cancer Causes Control 15:91-94

208. Attard G, Reid AH, A'Hern R, Parker C, Oommen NB, Folkerd E, Messiou C, Molife LR, Maier G, Thompson E, Olmos D, Sinha R, Lee G, Dowsett M, Kaye SB, Dearnaley D, Kheoh T, Molina A, de Bono JS 2009 Selective inhibition of

163

CYP17 with is highly active in the treatment of castration- resistant prostate cancer. J Clin Oncol 27:3742-3748

209. Singh J, Trabulsi EJ, Gomella LG 2010 Is there an optimal management for localized prostate cancer? Clin Interv Aging 5:187-197

210. Schwartz RS 2009 Clinical decisions. Management of prostate cancer--polling results. N Engl J Med 360:e4

211. Labrie F, Dupont A, Belanger A, Lacoursiere Y, Raynaud JP, Husson JM, Gareau J, Fazekas AT, Sandow J, Monfette G, et al. 1983 New approach in the treatment of prostate cancer: complete instead of partial withdrawal of androgens. Prostate 4:579-594

212. Tannock IF, de Wit R, Berry WR, Horti J, Pluzanska A, Chi KN, Oudard S, Theodore C, James ND, Turesson I, Rosenthal MA, Eisenberger MA 2004 Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med 351:1502-1512

213. Lipton A, Small E, Saad F, Gleason D, Gordon D, Smith M, Rosen L, Kowalski MO, Reitsma D, Seaman J 2002 The new bisphosphonate, Zometa (zoledronic acid), decreases skeletal complications in both osteolytic and osteoblastic lesions: a comparison to pamidronate. Cancer Invest 20 Suppl 2:45-54

214. Culig Z, Hobisch A, Cronauer MV, Radmayr C, Trapman J, Hittmair A, Bartsch G, Klocker H 1994 Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer Res 54:5474-5478

215. Ittmann MM 1998 alterations in prostate adenocarcinoma (review). Oncol Rep 5:1329-1335

216. Scher HI, Beer TM, Higano CS, Anand A, Taplin ME, Efstathiou E, Rathkopf D, Shelkey J, Yu EY, Alumkal J, Hung D, Hirmand M, Seely L, Morris MJ, Danila DC, Humm J, Larson S, Fleisher M, Sawyers CL 2010 Antitumour activity of MDV3100 in castration-resistant prostate cancer: a phase 1-2 study. Lancet 375:1437-1446

217. Attard G, Reid AH, Yap TA, Raynaud F, Dowsett M, Settatree S, Barrett M, Parker C, Martins V, Folkerd E, Clark J, Cooper CS, Kaye SB, Dearnaley D, Lee

164

G, de Bono JS 2008 Phase I clinical trial of a selective inhibitor of CYP17, abiraterone acetate, confirms that castration-resistant prostate cancer commonly remains hormone driven. J Clin Oncol 26:4563-4571

218. Majumder PK, Febbo PG, Bikoff R, Berger R, Xue Q, McMahon LM, Manola J, Brugarolas J, McDonnell TJ, Golub TR, Loda M, Lane HA, Sellers WR 2004 mTOR inhibition reverses Akt-dependent prostate intraepithelial neoplasia through regulation of apoptotic and HIF-1-dependent pathways. Nat Med 10:594- 601

219. Cao C, Subhawong T, Albert JM, Kim KW, Geng L, Sekhar KR, Gi YJ, Lu B 2006 Inhibition of mammalian target of rapamycin or apoptotic pathway induces autophagy and radiosensitizes PTEN null prostate cancer cells. Cancer Res 66:10040-10047

220. Morgan TM, Koreckij TD, Corey E 2009 Targeted therapy for advanced prostate cancer: inhibition of the PI3K/Akt/mTOR pathway. Curr Cancer Drug Targets 9:237-249

221. Picus J, Halabi S, Kelly WK, Vogelzang NJ, Whang YE, Kaplan EB, Stadler WM, Small EJ 2011 A phase 2 study of , docetaxel, and bevacizumab in men with castrate-resistant prostate cancer: results from Cancer and Leukemia Group B Study 90006. Cancer 117:526-533

222. Fizazi K, Lipton A, Mariette X, Body JJ, Rahim Y, Gralow JR, Gao G, Wu L, Sohn W, Jun S 2009 Randomized phase II trial of denosumab in patients with bone metastases from prostate cancer, breast cancer, or other after intravenous bisphosphonates. J Clin Oncol 27:1564-1571

223. Fizazi K, Bosserman L, Gao G, Skacel T, Markus R 2009 Denosumab treatment of prostate cancer with bone metastases and increased urine N-telopeptide levels after therapy with intravenous bisphosphonates: results of a randomized phase II trial. J Urol 182:509-515; discussion 515-506

224. Wasylyk B, Hagman J, Gutierrez-Hartmann A 1998 Ets transcription factors: nuclear effectors of the Ras-MAP-kinase signaling pathway. Trends Biochem Sci 23:213-216

225. Zong Y, Xin L, Goldstein AS, Lawson DA, Teitell MA, Witte ON 2009 ETS family transcription factors collaborate with alternative signaling pathways to

165

induce carcinoma from adult murine prostate cells. Proc Natl Acad Sci U S A 106:12465-12470

226. Cai C, Hsieh CL, Omwancha J, Zheng Z, Chen SY, Baert JL, Shemshedini L 2007 ETV1 is a novel androgen receptor-regulated gene that mediates prostate cancer cell invasion. Mol Endocrinol 21:1835-1846

227. Hermans KG, van der Korput HA, van Marion R, van de Wijngaart DJ, Ziel-van der Made A, Dits NF, Boormans JL, van der Kwast TH, van Dekken H, Bangma CH, Korsten H, Kraaij R, Jenster G, Trapman J 2008 Truncated ETV1, fused to novel tissue-specific genes, and full-length ETV1 in prostate cancer. Cancer Res 68:7541-7549

228. Oettgen P, Finger E, Sun Z, Akbarali Y, Thamrongsak U, Boltax J, Grall F, Dube A, Weiss A, Brown L, Quinn G, Kas K, Endress G, Kunsch C, Libermann TA 2000 PDEF, a novel prostate epithelium-specific ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. J Biol Chem 275:1216-1225

229. Tomlins SA, Mehra R, Rhodes DR, Smith LR, Roulston D, Helgeson BE, Cao X, Wei JT, Rubin MA, Shah RB, Chinnaiyan AM 2006 TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer. Cancer Res 66:3396- 3400

230. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta KJ, Rubin MA, Chinnaiyan AM 2005 Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310:644-648

231. Yu J, Mani RS, Cao Q, Brenner CJ, Cao X, Wang X, Wu L, Li J, Hu M, Gong Y, Cheng H, Laxman B, Vellaichamy A, Shankar S, Li Y, Dhanasekaran SM, Morey R, Barrette T, Lonigro RJ, Tomlins SA, Varambally S, Qin ZS, Chinnaiyan AM 2010 An integrated network of androgen receptor, polycomb, and TMPRSS2- ERG gene fusions in prostate cancer progression. Cancer Cell 17:443-454

232. Shaw PE, Saxton J 2003 Ternary complex factors: prime nuclear targets for mitogen-activated protein kinases. Int J Biochem Cell Biol 35:1210-1226

233. Yang SH, Vickers E, Brehm A, Kouzarides T, Sharrocks AD 2001 Temporal recruitment of the mSin3A-histone deacetylase corepressor complex to the ETS domain transcription factor Elk-1. Mol Cell Biol 21:2802-2814 166

234. Sharrocks AD, Yang SH, Galanis A 2000 Docking domains and substrate- specificity determination for MAP kinases. Trends Biochem Sci 25:448-453

235. Yang SH, Bumpass DC, Perkins ND, Sharrocks AD 2002 The ETS domain transcription factor Elk-1 contains a novel class of repression domain. Mol Cell Biol 22:5036-5046

236. Rao VN, Reddy ES 1993 Delta elk-1, a variant of elk-1, fails to interact with the serum response factor and binds to DNA with modulated specificity. Cancer Res 53:215-220

237. Vanhoutte P, Nissen JL, Brugg B, Gaspera BD, Besson MJ, Hipskind RA, Caboche J 2001 Opposing roles of Elk-1 and its brain-specific isoform, short Elk- 1, in -induced PC12 differentiation. J Biol Chem 276:5189- 5196

238. Wei GH, Badis G, Berger MF, Kivioja T, Palin K, Enge M, Bonke M, Jolma A, Varjosalo M, Gehrke AR, Yan J, Talukder S, Turunen M, Taipale M, Stunnenberg HG, Ukkonen E, Hughes TR, Bulyk ML, Taipale J 2010 Genome- wide analysis of ETS-family DNA-binding in vitro and in vivo. EMBO J 29:2147-2160

239. Hollenhorst PC, Shah AA, Hopkins C, Graves BJ 2007 Genome-wide analyses reveal properties of redundant and specific promoter occupancy within the ETS gene family. Genes Dev 21:1882-1894

240. Sharrocks AD 1995 ERK2/p42 MAP kinase stimulates both autonomous and SRF-dependent DNA binding by Elk-1. FEBS Lett 368:77-80

241. Shore P, Whitmarsh AJ, Bhaskaran R, Davis RJ, Waltho JP, Sharrocks AD 1996 Determinants of DNA-binding specificity of ETS-domain transcription factors. Mol Cell Biol 16:3338-3349

242. Mo Y, Vaessen B, Johnston K, Marmorstein R 2000 Structure of the elk-1-DNA complex reveals how DNA-distal residues affect ETS domain recognition of DNA. Nat Struct Biol 7:292-297

243. Yang SH, Shore P, Willingham N, Lakey JH, Sharrocks AD 1999 The mechanism of phosphorylation-inducible activation of the ETS-domain transcription factor Elk-1. EMBO J 18:5666-5674

167

244. Yates PR, Atherton GT, Deed RW, Norton JD, Sharrocks AD 1999 Id helix-loop- helix proteins inhibit complex formation by the TCF ETS-domain transcription factors. EMBO J 18:968-976

245. Janknecht R, Nordheim A 1996 MAP kinase-dependent transcriptional coactivation by Elk-1 and its cofactor CBP. Biochem Biophys Res Commun 228:831-837

246. Boyer TG, Martin ME, Lees E, Ricciardi RP, Berk AJ 1999 Mammalian Srb/Mediator complex is targeted by adenovirus E1A protein. Nature 399:276- 279

247. Nissen LJ, Gelly JC, Hipskind RA 2001 Induction-independent recruitment of CREB-binding protein to the c-fos serum response element through interactions between the bromodomain and Elk-1. J Biol Chem 276:5213-5221

248. Li QJ, Yang SH, Maeda Y, Sladek FM, Sharrocks AD, Martins-Green M 2003 MAP kinase phosphorylation-dependent activation of Elk-1 leads to activation of the co-activator p300. EMBO J 22:281-291

249. Yang SH, Jaffray E, Hay RT, Sharrocks AD 2003 Dynamic interplay of the SUMO and ERK pathways in regulating Elk-1 transcriptional activity. Mol Cell 12:63-74

250. Sugimoto T, Stewart S, Han M, Guan KL 1998 The kinase suppressor of Ras (KSR) modulates growth factor and Ras signaling by uncoupling Elk-1 phosphorylation from MAP kinase activation. EMBO J 17:1717-1727

251. Tian J, Karin M 1999 Stimulation of Elk1 transcriptional activity by mitogen- activated protein kinases is negatively regulated by protein phosphatase 2B (). J Biol Chem 274:15173-15180

252. Macleod K, Leprince D, Stehelin D 1992 The ets gene family. Trends Biochem Sci 17:251-256

253. Cammarota M, Bevilaqua LR, Ardenghi P, Paratcha G, Levi de Stein M, Izquierdo I, Medina JH 2000 -associated activation of nuclear MAPK, CREB and Elk-1, along with Fos production, in the rat after a one- trial avoidance learning: abolition by NMDA receptor blockade. Brain Res Mol Brain Res 76:36-46

168

254. Maniccia AW, Lewis C, Begum N, Xu J, Cui J, Chipitsyna G, Aysola K, Reddy V, Bhat G, Fujimura Y, Henderson B, Reddy ES, Rao VN 2009 Mitochondrial localization, ELK-1 transcriptional regulation and growth inhibitory functions of BRCA1, BRCA1a, and BRCA1b proteins. J Cell Physiol 219:634-641

255. Demir O, Kurnaz IA 2008 Wildtype Elk-1, but not a SUMOylation mutant, represses egr-1 expression in SH-SY5Y neuroblastomas. Neurosci Lett 437:20-24

256. Ng MH, Ng RK, Kong CT, Jin DY, Chan LC 2010 Activation of Ras-dependent Elk-1 activity by MLL-AF4 family fusion oncoproteins. Exp Hematol 38:481-488

257. Ying TH, Hsieh YH, Hsieh YS, Liu JY 2008 Antisense oligonucleotide Elk-1 suppresses the tumorigenicity of human hepatocellular carcinoma cells. Cell Biol Int 32:210-216

258. Wyrzykowska P, Stalinska K, Wawro M, Kochan J, Kasza A 2010 Epidermal growth factor regulates PAI-1 expression via activation of the transcription factor Elk-1. Biochim Biophys Acta 1799:616-621

259. Hellawell GO, Turner GD, Davies DR, Poulsom R, Brewster SF, Macaulay VM 2002 Expression of the type 1 insulin-like growth factor receptor is up-regulated in primary prostate cancer and commonly persists in metastatic disease. Cancer Res 62:2942-2950

260. Renehan AG, Zwahlen M, Minder C, O'Dwyer ST, Shalet SM, Egger M 2004 Insulin-like growth factor (IGF)-I, IGF binding protein-3, and cancer risk: systematic review and meta-regression analysis. Lancet 363:1346-1353

261. Uehara H, Kim SJ, Karashima T, Shepherd DL, Fan D, Tsan R, Killion JJ, Logothetis C, Mathew P, Fidler IJ 2003 Effects of blocking platelet-derived growth factor-receptor signaling in a mouse model of experimental prostate cancer bone metastases. J Natl Cancer Inst 95:458-470

262. Ricote M, Garcia-Tunon I, Bethencourt F, Fraile B, Onsurbe P, Paniagua R, Royuela M 2006 The p38 transduction pathway in prostatic neoplasia. J Pathol 208:401-407

169

Appendix A

SUPPLEMENT 1

Table 1. Affymetrix probe sets showing > 2-fold gene expression in control LP50 cells compared to LP50 cells infected with AR shRNA lentivirus.

Average Fold Probe Set ID Gene Symbol Change 228275_at --- 41.28 229103_at WNT3 30.19 207245_at UGT2B17 25.96 229490_s_at --- 24.86 227211_at PHF19 24.67 239410_at --- 23.59 209869_at ADRA2A 21.96 206505_at UGT2B4 21.96 229177_at MGC45438 21.65 1555097_a_at PTGFR 20.59 204126_s_at CDC45L 20.04 235737_at TSLP 19.93 1556912_at GIT2 19.53 223820_at RBP5 18.94 231130_at --- 18.09 227725_at ST6GALNAC1 16.20 243283_at --- 15.92 243483_at TRPM8 15.86 241866_at SLC16A7 15.79 1554264_at CKAP2 15.62 1555800_at ZNF385B 15.20 201136_at PLP2 14.81 212949_at NCAPH 14.43 201710_at MYBL2 13.42 170

227169_at DNAJC18 12.97 228273_at --- 12.48 204582_s_at KLK3 12.15 211753_s_at RLN1 11.97 209680_s_at KIFC1 11.83 221911_at ETV1 11.76 213844_at HOXA5 11.62 204695_at CDC25A 11.28 206457_s_at DIO1 11.26 204583_x_at KLK3 11.16 219990_at E2F8 11.16 218542_at CEP55 10.98 202112_at VWF 10.89 1564371_a_at CASC2 10.73 228729_at CCNB1 10.66 228836_at SLC25A35 10.42 203799_at CD302 10.07 230924_at TTLL6 9.98 226308_at NY-SAR-48 9.97 204162_at NDC80 9.91 202870_s_at CDC20 9.89 214519_s_at RLN2 9.84 212019_at RSL1D1 9.70 220651_s_at MCM10 9.66 230577_at --- 9.63 237083_at --- 9.63 209854_s_at KLK2 9.62 204822_at TTK 9.53 225834_at FAM72A 9.52 212657_s_at IL1RN 9.49 241772_at --- 9.42 232278_s_at DEPDC1 9.34 204444_at KIF11 9.31 204318_s_at GTSE1 9.30 232921_at KIAA1549 9.25 218663_at NCAPG 9.16 211227_s_at LOC730420 9.01 204962_s_at CENPA 8.91 202580_x_at FOXM1 8.87 218755_at KIF20A 8.83 218662_s_at NCAPG 8.82 218585_s_at DTL 8.75 208368_s_at BRCA2 8.67 231990_at USP15 8.66 201292_at TOP2A 8.65 207165_at HMMR 8.64 218039_at NUSAP1 8.57 209172_s_at CENPF 8.56 171

1561969_at ZPLD1 8.52 206501_x_at ETV1 8.52 201291_s_at TOP2A 8.49 1557624_at --- 8.43 228919_at --- 8.38 205186_at DNALI1 8.37 219148_at PBK 8.33 211080_s_at NEK2 8.30 229019_at ZNF385B 8.22 223381_at NUF2 8.20 202095_s_at BIRC5 8.12 213258_at TFPI 8.11 235892_at --- 8.11 209709_s_at HMMR 8.10 231883_at FBXW8 8.07 207828_s_at CENPF 8.07 210738_s_at SLC4A4 7.97 228918_at --- 7.92 222958_s_at DEPDC1 7.91 206023_at NMU 7.87 209408_at KIF2C 7.78 225687_at FAM83D 7.76 219978_s_at NUSAP1 7.72 209676_at TFPI 7.71 204641_at NEK2 7.71 222962_s_at MCM10 7.67 223274_at TCF19 7.66 214332_s_at TSFM 7.64 222680_s_at DTL 7.64 206364_at KIF14 7.61 223307_at CDCA3 7.59 219855_at NUDT11 7.53 203764_at DLG7 7.51 207177_at PTGFR 7.51 202705_at CCNB2 7.50 210334_x_at BIRC5 7.46 212023_s_at MKI67 7.44 223700_at MND1 7.41 204709_s_at KIF23 7.38 203438_at STC2 7.37 203967_at CDC6 7.35 222305_at HK2 7.34 207262_at APOF 7.32 228033_at E2F7 7.26 221436_s_at CDCA3 7.19 209773_s_at RRM2 7.19 209387_s_at TM4SF1 7.19 227692_at GNAI1 7.15 172

225926_at VTI1B 7.14 209754_s_at TMPO 7.11 219918_s_at ASPM 7.09 238953_at --- 7.09 216028_at DKFZP564C152 7.06 1552619_a_at ANLN 7.06 217061_s_at ETV1 7.04 219476_at C1orf116 6.98 219663_s_at TMEM121 6.97 203755_at BUB1B 6.97 210339_s_at KLK2 6.95 215285_s_at PHTF1 6.94 225028_at LOC550643 6.92 209464_at AURKB 6.86 203908_at SLC4A4 6.86 204825_at MELK 6.78 229610_at CKAP2L 6.76 1554768_a_at MAD2L1 6.72 235588_at ESCO2 6.69 201818_at LPCAT1 6.67 209891_at SPC25 6.66 1554918_a_at ABCC4 6.62 210664_s_at TFPI 6.61 202503_s_at KIAA0101 6.61 222608_s_at ANLN 6.59 216247_at --- 6.56 231192_at --- 6.53 230053_at --- 6.52 204531_s_at BRCA1 6.47 214727_at BRCA2 6.47 220295_x_at DEPDC1 6.43 209623_at MCCC2 6.43 229544_at --- 6.41 225081_s_at CDCA7L 6.39 1569190_at SCLT1 6.39 1556081_at --- 6.39 225655_at UHRF1 6.35 226980_at DEPDC1B 6.34 218355_at KIF4A 6.34 210052_s_at TPX2 6.34 210910_s_at LOC100101267 6.31 224753_at CDCA5 6.30 215034_s_at TM4SF1 6.26 203968_s_at CDC6 6.25 203554_x_at PTTG1 6.25 226789_at LOC647121 6.20 218349_s_at ZWILCH 6.19 203637_s_at MID1 6.16 173

1564372_s_at CASC2 6.16 206102_at GINS1 6.15 217053_x_at ETV1 6.15 226253_at LRRC45 6.15 210665_at TFPI 6.14 208782_at FSTL1 6.13 1553970_s_at CEL 6.08 202903_at LSM5 6.04 208920_at SRI 6.02 236641_at KIF14 6.02 218726_at HJURP 6.02 201890_at RRM2 6.00 224773_at NAV1 6.00 238695_s_at RAB39B 5.96 230150_at BCAP29 5.94 202431_s_at MYC 5.90 1554405_a_at C21orf100 5.89 219493_at SHCBP1 5.85 219777_at GIMAP6 5.85 1555515_a_at C1orf2 5.80 230570_at --- 5.80 224596_at SLC44A1 5.75 241925_x_at --- 5.75 217640_x_at C18orf24 5.69 228559_at CENPN 5.68 203362_s_at MAD2L1 5.67 1556261_a_at --- 5.65 229551_x_at ZNF367 5.64 224428_s_at CDCA7 5.60 204148_s_at POMZP3 5.59 222077_s_at RACGAP1 5.58 223095_at MARVELD1 5.58 224595_at SLC44A1 5.57 203636_at MID1 5.57 240838_s_at LOC145837 5.55 202094_at BIRC5 5.54 235545_at DEPDC1 5.54 225355_at DKFZP761M1511 5.51 1555039_a_at ABCC4 5.49 238915_at --- 5.46 1569729_a_at ASZ1 5.45 202954_at UBE2C 5.44 211519_s_at KIF2C 5.43 236774_at --- 5.41 222848_at CENPK 5.37 219502_at NEIL3 5.36 239594_at LOC145837 5.34 218741_at CENPM 5.34 174

202338_at TK1 5.32 230738_at --- 5.32 207524_at ST7 5.31 204886_at PLK4 5.29 217010_s_at CDC25C 5.29 205046_at CENPE 5.27 211494_s_at SLC4A4 5.27 220937_s_at ST6GALNAC4 5.26 220999_s_at CYFIP2 5.26 209576_at GNAI1 5.24 231534_at CDC2 5.24 204072_s_at FRY 5.22 220816_at EDG7 5.19 239680_at --- 5.18 221031_s_at APOLD1 5.18 228066_at --- 5.17 230764_at --- 5.16 204521_at C12orf24 5.14 1556666_a_at TTC6 5.11 228594_at C5orf33 5.10 202016_at MEST 5.09 219306_at KIF15 5.09 229094_at LOC401431 5.09 219105_x_at ORC6L 5.07 229305_at MLF1IP 5.07 203196_at ABCC4 5.05 1556665_at TTC6 5.02 204607_at HMGCS2 5.02 208808_s_at HMGB2 5.02 221910_at --- 5.02 205167_s_at CDC25C 5.01 220116_at KCNN2 4.98 207918_s_at LOC653174 4.98 230766_at --- 4.98 244534_at --- 4.94 1556913_a_at GIT2 4.94 205158_at RNASE4 4.93 1555772_a_at CDC25A 4.93 1569777_a_at ZPLD1 4.92 204887_s_at PLK4 4.92 211110_s_at AR 4.90 200684_s_at UBE2L3 4.90 1557129_a_at FAM111B 4.90 204394_at SLC43A1 4.89 236312_at --- 4.89 229097_at DIAPH3 4.89 208079_s_at AURKA 4.86 210559_s_at CDC2 4.86 175

227117_at --- 4.86 238520_at TRERF1 4.86 201516_at SRM 4.85 212573_at ENDOD1 4.85 203418_at CCNA2 4.84 209386_at TM4SF1 4.84 209642_at BUB1 4.84 204146_at RAD51AP1 4.83 211088_s_at PLK4 4.83 1555912_at ST7OT1 4.83 237273_at KCNU1 4.82 205910_s_at CEL 4.81 221521_s_at GINS2 4.80 228323_at CASC5 4.79 1554696_s_at TYMS 4.79 229126_at TMEM19 4.75 228955_at --- 4.75 232362_at CCDC18 4.75 242138_at DLX1 4.74 229824_at --- 4.73 203214_x_at CDC2 4.73 1554408_a_at TK1 4.71 229768_at OR51E1 4.71 202779_s_at LOC731049 4.71 213750_at RSL1D1 4.70 203062_s_at MDC1 4.69 213970_at LOC653256 4.69 1563498_s_at SLC25A45 4.68 223570_at MCM10 4.68 200965_s_at ABLIM1 4.67 225435_at SSR1 4.66 1554027_a_at SLC4A4 4.65 1555758_a_at CDKN3 4.65 225426_at --- 4.61 212295_s_at SLC7A1 4.59 224783_at FAM100B 4.59 227053_at PACSIN1 4.57 231270_at CA13 4.56 204033_at TRIP13 4.56 214051_at MGC39900 4.55 225928_at VTI1B 4.54 226197_at --- 4.54 218009_s_at PRC1 4.53 230856_at --- 4.53 213397_x_at RNASE4 4.53 226364_at HIP1 4.53 238418_at SLC35B4 4.52 201896_s_at PSRC1 4.51 176

221551_x_at ST6GALNAC4 4.49 208657_s_at 9-Sep 4.49 204315_s_at GTSE1 4.49 236775_s_at --- 4.48 225853_at GNPNAT1 4.48 203145_at SPAG5 4.47 202240_at PLK1 4.47 1552587_at CNBD1 4.45 214710_s_at CCNB1 4.44 235719_at CYP4V2 4.44 229969_at --- 4.43 209917_s_at TP53AP1 4.40 202855_s_at SLC16A3 4.39 226446_at HES6 4.38 230136_at LOC400099 4.38 222606_at ZWILCH 4.38 230003_at --- 4.38 204480_s_at C9orf16 4.36 221520_s_at CDCA8 4.35 221909_at TMEM118 4.35 211272_s_at DGKA 4.34 215509_s_at BUB1 4.34 209522_s_at CRAT 4.33 216243_s_at IL1RN 4.32 230782_at LOC653381 4.31 232252_at DUSP27 4.31 208963_x_at FADS1 4.31 202589_at TYMS 4.30 236813_at C10orf83 4.30 239072_at LOC647121 4.28 1570430_at --- 4.27 201302_at ANXA4 4.27 213847_at PRPH 4.26 1554423_a_at FBXO7 4.26 218313_s_at GALNT7 4.25 202986_at ARNT2 4.24 207425_s_at SEP9 4.24 229402_at SAMD13 4.24 217868_s_at METTL9 4.23 231772_x_at CENPH 4.22 241352_at HEATR2 4.21 210292_s_at PCDH11X 4.21 224944_at TMPO 4.18 235113_at PPIL5 4.17 202052_s_at RAI14 4.15 223575_at KIAA1549 4.15 229491_at NHEDC2 4.14 205756_s_at F8 4.14 177

227578_at --- 4.14 212619_at TMEM194 4.13 214744_s_at --- 4.13 201774_s_at NCAPD2 4.12 205085_at ORC1L 4.12 209624_s_at MCCC2 4.12 200683_s_at UBE2L3 4.11 225429_at --- 4.11 238529_at --- 4.10 209035_at MDK 4.10 208964_s_at FADS1 4.09 238833_at LOC729088 4.09 216623_x_at TOX3 4.09 229715_at --- 4.09 233413_at --- 4.09 214774_x_at TOX3 4.09 1553812_at TLE6 4.08 209714_s_at CDKN3 4.08 204254_s_at VDR 4.08 212621_at TMEM194 4.07 235572_at SPC24 4.07 201188_s_at ITPR3 4.07 225881_at SLC35B4 4.06 212741_at MAOA 4.06 1568838_at --- 4.06 229538_s_at IQGAP3 4.05 226192_at --- 4.05 228479_at --- 4.05 217944_at POMGNT1 4.05 221908_at TMEM118 4.04 203213_at CDC2 4.04 215108_x_at TOX3 4.03 227165_at C13orf3 4.03 201178_at FBXO7 4.02 210241_s_at TP53AP1 4.01 204493_at BID 4.01 230460_at --- 4.01 203061_s_at MDC1 4.00 211621_at AR 3.99 1570572_at LOC729291 3.99 1555801_s_at ZNF385B 3.99 224650_at MAL2 3.98 229304_s_at MLF1IP 3.98 229167_at --- 3.98 208962_s_at FADS1 3.97 214804_at --- 3.96 206204_at GRB14 3.96 228093_at ZNF599 3.95 178

203435_s_at MME 3.95 223557_s_at TMEFF2 3.94 1558750_a_at --- 3.94 224496_s_at TMEM107 3.94 1563147_at --- 3.92 235497_at LOC643837 3.91 212022_s_at MKI67 3.90 227350_at --- 3.89 201560_at CLIC4 3.89 228485_s_at SLC44A1 3.89 226017_at CMTM7 3.89 234314_at C20orf74 3.88 203871_at SENP3 3.88 227812_at TNFRSF19 3.87 223649_s_at SLC25A39 3.87 224728_at ATPAF1 3.87 229964_at C9orf152 3.86 236957_at CDCA2 3.86 224772_at NAV1 3.86 227166_at DNAJC18 3.86 216641_s_at LAD1 3.86 236277_at --- 3.86 207833_s_at HLCS 3.85 201189_s_at ITPR3 3.85 221880_s_at LOC400451 3.85 220354_at MGC2780 3.85 218308_at TACC3 3.84 222441_x_at SLMO2 3.84 204855_at SERPINB5 3.84 213058_at TTC28 3.84 228355_s_at NDUFA12L 3.83 228865_at C1orf116 3.81 215128_at --- 3.81 223229_at UBE2T 3.81 213181_s_at MOCS1 3.81 222824_at --- 3.81 205393_s_at CHEK1 3.80 207871_s_at ST7 3.80 201894_s_at SSR1 3.80 37512_at HSD17B6 3.79 204026_s_at ZWINT 3.79 222587_s_at GALNT7 3.79 205024_s_at RAD51 3.78 204165_at WASF1 3.78 242787_at --- 3.78 223614_at C8orf57 3.78 1568997_at --- 3.77 204092_s_at AURKA 3.77 179

219787_s_at ECT2 3.76 228783_at BVES 3.76 220269_at FLJ23049 3.76 226771_at ATP8B2 3.76 229975_at --- 3.76 223087_at ECHDC1 3.76 1559141_s_at FAM87A 3.75 215731_s_at MPHOSPH9 3.75 242051_at --- 3.75 203284_s_at HS2ST1 3.75 204170_s_at CKS2 3.75 210534_s_at B9D1 3.74 229005_at --- 3.74 228906_at CXXC6 3.73 223741_s_at TTYH2 3.73 210886_x_at TP53AP1 3.72 208433_s_at LRP8 3.72 208814_at HSPA4 3.71 230164_at ZNF621 3.70 230075_at RAB39B 3.70 205891_at ADORA2B 3.70 226360_at ZNRF3 3.70 208762_at SUMO1 3.69 201897_s_at CKS1B 3.69 213253_at SMC2 3.68 213599_at OIP5 3.68 1552632_a_at ARSG 3.68 219869_s_at SLC39A8 3.67 208166_at MMP16 3.67 236121_at OR51E2 3.67 242826_at --- 3.66 239730_at DGCR14 3.66 236076_at LOC257396 3.66 213523_at CCNE1 3.66 222447_at METTL9 3.66 205347_s_at TMSL8 3.65 1568696_at ARMETL1 3.65 235505_s_at --- 3.64 212290_at SLC7A1 3.64 209515_s_at RAB27A 3.64 228281_at C11orf82 3.63 230522_s_at C9orf100 3.63 1552466_x_at C21orf100 3.63 208931_s_at ILF3 3.63 228045_at --- 3.63 228889_at C14orf128 3.62 227448_at ARGLU1 3.62 1569025_s_at FAM13A1 3.62 180

201555_at MCM3 3.60 217851_s_at SLMO2 3.60 1559006_at --- 3.60 227458_at --- 3.60 235940_at C9orf64 3.60 228245_s_at LOC728715 3.59 222155_s_at GPR172A 3.58 1554067_at FLJ32549 3.58 227506_at SLC16A9 3.57 226712_at --- 3.57 209267_s_at SLC39A8 3.57 222673_x_at FAM122B 3.56 41047_at C9orf16 3.56 212775_at OBSL1 3.56 226358_at LOC145842 3.56 221591_s_at FAM64A 3.56 219872_at C4orf18 3.56 1554868_s_at PCNP 3.55 226591_at --- 3.55 221276_s_at SYNC1 3.54 213226_at CCNA2 3.53 236798_at --- 3.53 205394_at CHEK1 3.53 219856_at C1orf116 3.53 221727_at --- 3.53 219547_at COX15 3.52 225887_at C13orf23 3.52 210909_x_at LPAL2 3.52 217816_s_at PCNP 3.51 215990_s_at BCL6 3.51 235766_x_at --- 3.50 208165_s_at PRSS16 3.50 228959_at --- 3.49 203504_s_at ABCA1 3.49 242649_x_at C15orf21 3.49 205531_s_at GLS2 3.49 218383_at C14orf94 3.49 215735_s_at TSC2 3.49 212279_at TMEM97 3.48 232752_at --- 3.48 212020_s_at MKI67 3.47 209737_at MAGI2 3.47 215596_s_at ZNF294 3.47 226809_at FLJ30428 3.47 238686_at FBXO3 3.46 205311_at DDC 3.46 206448_at ZNF365 3.45 242671_at --- 3.45 181

239277_at --- 3.45 204835_at POLA1 3.44 203733_at DEXI 3.44 225361_x_at FAM122B 3.44 242560_at FANCD2 3.43 225108_at --- 3.42 214240_at GAL 3.42 244819_x_at PSPH 3.42 212021_s_at MKI67 3.41 223598_at RAD23B 3.41 204728_s_at WDHD1 3.41 230748_at SLC16A6 3.41 224694_at ANTXR1 3.41 238898_at --- 3.41 235452_at --- 3.41 210739_x_at SLC4A4 3.41 213906_at MYBL1 3.40 230521_at C9orf100 3.40 210006_at ABHD14A 3.40 1552904_at NETO1 3.40 236016_at --- 3.39 225079_at EMP2 3.39 222471_s_at KCMF1 3.39 229876_at PHKA1 3.39 242579_at --- 3.38 205774_at F12 3.38 238576_at --- 3.37 216504_s_at SLC39A8 3.37 228696_at SLC45A3 3.37 230054_at PRRT1 3.37 225008_at --- 3.37 206351_s_at PEX10 3.36 201755_at MCM5 3.36 225182_at TMEM50B 3.35 204942_s_at ALDH3B2 3.35 214794_at PA2G4 3.35 238975_at MMAB 3.34 238015_at LOC201725 3.34 211071_s_at MLLT11 3.34 224578_at RCC2 3.34 204717_s_at SLC29A2 3.33 239696_at --- 3.33 224763_at RPL37 3.32 204768_s_at FEN1 3.31 213959_s_at RPGRIP1L 3.31 226610_at PRR6 3.31 221480_at HNRPD 3.31 212570_at ENDOD1 3.31 182

231986_at RIMS1 3.30 212282_at TMEM97 3.30 213032_at NFIB 3.30 1564706_s_at GLS2 3.30 240566_at --- 3.29 206070_s_at EPHA3 3.29 212913_at C6orf26 3.29 209488_s_at RBPMS 3.28 204317_at GTSE1 3.28 205296_at RBL1 3.28 224896_s_at TTL 3.28 206732_at SLITRK3 3.28 1565759_at RPL13 3.28 218709_s_at IFT52 3.28 207590_s_at CENPI 3.28 229068_at CCT5 3.27 225823_at P117 3.27 213008_at FANCI 3.27 224716_at SLC35B2 3.26 222118_at CENPN 3.26 227085_at H2AFV 3.25 244754_at --- 3.25 1558620_at ZNF621 3.25 227862_at LOC388610 3.25 236174_at --- 3.24 220723_s_at FLJ21511 3.24 236256_at --- 3.23 226546_at --- 3.23 206352_s_at PEX10 3.23 205204_at NMB 3.23 227522_at CMBL 3.23 212281_s_at TMEM97 3.23 227446_s_at C14orf167 3.23 225973_at TAP2 3.23 204610_s_at CCDC85B 3.22 1561396_at EPHA6 3.22 230956_at FLJ45803 3.22 228013_at --- 3.22 203140_at BCL6 3.22 231120_x_at PKIB 3.21 216237_s_at MCM5 3.21 222731_at ZDHHC2 3.21 208167_s_at MMP16 3.21 223378_at GLIS2 3.20 231232_at --- 3.20 235603_at HNRNPU 3.19 211767_at GINS4 3.19 202963_at RFX5 3.19 183

224062_x_at KLK4 3.18 203287_at LAD1 3.18 227156_at TNRC8 3.18 221637_s_at C11orf48 3.17 225898_at WDR54 3.17 200749_at 3.17 221773_at ELK3 3.17 218927_s_at CHST12 3.17 205433_at BCHE 3.16 201037_at PFKP 3.16 216680_s_at EPHB4 3.16 204244_s_at DBF4 3.16 204623_at TFF3 3.16 232291_at MIRH1 3.15 200052_s_at ILF2 3.15 214331_at TSFM 3.15 236834_at SCFD2 3.15 214319_at FRY 3.15 207057_at SLC16A7 3.15 235685_at --- 3.15 232071_at MRPL19 3.14 218252_at CKAP2 3.14 1555808_a_at EXDL2 3.14 201969_at NASP 3.14 204389_at MAOA 3.14 219588_s_at NCAPG2 3.14 1552740_at C2orf15 3.13 218883_s_at MLF1IP 3.13 227382_at CYB5B 3.13 209050_s_at RALGDS 3.13 230696_at --- 3.13 1552680_a_at CASC5 3.13 216228_s_at WDHD1 3.13 239744_at --- 3.13 228584_at SGCB 3.12 218875_s_at FBXO5 3.12 213288_at MBOAT2 3.11 232397_at --- 3.11 220441_at FLJ13236 3.11 215113_s_at SENP3 3.11 238824_at --- 3.10 238704_at --- 3.10 244546_at CYCS 3.10 228899_at CUL1 3.10 230479_at --- 3.09 204767_s_at FEN1 3.09 243918_at --- 3.09 238443_at --- 3.09 184

235919_at --- 3.09 205733_at BLM 3.09 211967_at TMEM123 3.09 224767_at RPL37 3.08 231878_at C16orf53 3.08 232679_at --- 3.08 38158_at ESPL1 3.08 201634_s_at CYB5B 3.08 230449_x_at --- 3.08 204603_at EXO1 3.07 200979_at MAP3K15 3.07 221965_at MPHOSPH9 3.07 210410_s_at MSH5 3.07 206685_at HCG4 3.06 217645_at C14orf112 3.06 231180_at --- 3.05 224002_s_at FKBP7 3.05 221932_s_at GLRX5 3.05 221258_s_at KIF18A 3.05 239343_at LOC728705 3.05 203117_s_at PAN2 3.05 227409_at PPP1R3E 3.05 204727_at WDHD1 3.04 235030_at FAM55C 3.04 239300_at --- 3.04 227657_at RNF150 3.04 203388_at ARRB2 3.04 203022_at RNASEH2A 3.04 236476_at --- 3.04 1562245_a_at ZNF578 3.03 228401_at --- 3.03 200843_s_at EPRS 3.03 221703_at BRIP1 3.02 223361_at C6orf115 3.02 208703_s_at APLP2 3.02 224865_at MLSTD2 3.02 231102_at CROT 3.02 228502_at --- 3.02 208916_at SLC1A5 3.02 227974_at --- 3.02 204278_s_at EBAG9 3.01 218544_s_at RCL1 3.01 227722_at RPS23 3.01 200841_s_at EPRS 3.01 214164_x_at CA12 3.01 222740_at ATAD2 3.00 232390_at NCAM2 3.00 235429_at --- 3.00 185

1554068_s_at FLJ32549 2.99 201753_s_at ADD3 2.99 242705_x_at --- 2.99 227425_at REPS2 2.99 217604_at --- 2.99 205893_at NLGN1 2.99 237159_x_at AP1S3 2.99 228354_at C10orf83 2.98 47560_at LPHN1 2.98 201614_s_at RUVBL1 2.98 212448_at NEDD4L 2.98 223044_at SLC40A1 2.98 231855_at KIAA1524 2.98 239896_at --- 2.98 200891_s_at SSR1 2.97 205425_at HIP1 2.97 234976_x_at SLC4A5 2.97 233887_at GPR126 2.97 225078_at EMP2 2.96 203550_s_at C1orf2 2.96 231207_at --- 2.96 226982_at ELL2 2.96 226611_s_at PRR6 2.96 1558369_at MPHOSPH9 2.96 224720_at MIB1 2.96 200783_s_at STMN1 2.96 224780_at RBM17 2.96 226974_at --- 2.95 213568_at OSR2 2.95 225509_at LOC56757 2.95 204274_at EBAG9 2.95 227126_at --- 2.94 202611_s_at MED14 2.94 212128_s_at DAG1 2.94 201034_at ADD3 2.94 207621_s_at PEMT 2.94 212543_at AIM1 2.93 230896_at CCDC4 2.93 238514_at TMEM25 2.93 213029_at NFIB 2.93 224996_at --- 2.93 238696_at RP11-78J21.1 2.93 226007_at ISCA2 2.92 239790_s_at --- 2.92 236046_at FLJ44896 2.92 230178_s_at --- 2.92 213094_at GPR126 2.92 225578_at RP11-11C5.2 2.91 186

224908_s_at TTL 2.91 208763_s_at TSC22D3 2.91 223641_at --- 2.91 226177_at GLTP 2.90 203402_at KCNAB2 2.90 220724_at FLJ21511 2.90 224580_at SLC38A1 2.90 214812_s_at MOBKL1B 2.90 236503_at --- 2.90 239154_at --- 2.90 208905_at CYCS 2.90 33850_at MAP4 2.90 228990_at C1orf79 2.90 205677_s_at DLEU1 2.90 235532_at --- 2.89 233136_at PABPC5 2.89 1568629_s_at PIK3R2 2.89 225021_at ZNF532 2.89 208955_at DUT 2.89 228639_at --- 2.89 223759_s_at GSG2 2.89 210567_s_at SKP2 2.89 234107_s_at DTD1 2.89 226860_at TMEM19 2.89 212675_s_at CEP68 2.89 232309_at LOC202181 2.89 226776_at ENY2 2.88 226377_at --- 2.88 206752_s_at DFFB 2.88 206261_at ZNF239 2.88 209409_at GRB10 2.88 227929_at --- 2.88 217540_at --- 2.88 226157_at TFDP2 2.88 214378_at TFPI 2.88 230139_at --- 2.88 229415_at CYCS 2.87 226993_at --- 2.87 209289_at NFIB 2.87 223256_at KIAA1333 2.87 203963_at CA12 2.87 205121_at SGCB 2.87 210186_s_at FKBP1A 2.86 227008_at HDDC3 2.86 223837_at GULP1 2.86 240255_at --- 2.86 201988_s_at CREBL2 2.86 227628_at LOC493869 2.86 187

239253_at --- 2.86 238624_at NLK 2.85 208999_at SEP8 2.85 230165_at SGOL2 2.85 228758_at BCL6 2.85 233638_s_at POMGNT1 2.85 213803_at --- 2.84 226548_at SBK1 2.84 229705_at --- 2.84 1552275_s_at PXK 2.84 226112_at SGCB 2.84 223774_at C1orf79 2.84 1558686_at --- 2.84 226224_at FOXK2 2.84 230845_at PRAC2 2.83 213223_at RPL28 2.83 218888_s_at NETO2 2.83 234055_s_at GZF1 2.83 225473_at C20orf117 2.83 212935_at MCF2L 2.83 204255_s_at VDR 2.82 1568633_a_at --- 2.82 232251_at NUDT16P 2.82 226587_at --- 2.82 239280_at --- 2.82 222010_at TCP1 2.81 240344_x_at LYRM7 2.81 209679_s_at LOC57228 2.81 219546_at BMP2K 2.81 219974_x_at ECHDC1 2.81 230467_at TMEM52 2.81 209290_s_at NFIB 2.81 235192_at TP53RK 2.81 202712_s_at CKMT1A 2.81 204766_s_at NUDT1 2.81 215535_s_at AGPAT1 2.81 218903_s_at OBFC2B 2.81 212118_at TRIM27 2.80 203439_s_at STC2 2.80 209610_s_at SLC1A4 2.80 228868_x_at CDT1 2.80 213007_at FANCI 2.79 65585_at FAM86B1 2.79 228603_at --- 2.79 227925_at FLJ39051 2.78 206316_s_at KNTC1 2.78 204510_at CDC7 2.78 212810_s_at SLC1A4 2.78 188

201611_s_at ICMT 2.78 244324_at C18orf54 2.78 239425_at --- 2.78 219249_s_at FKBP10 2.78 218653_at SLC25A15 2.77 225485_at TSGA14 2.77 228859_at LOC91431 2.77 229254_at MFSD4 2.77 237675_at --- 2.77 203285_s_at HS2ST1 2.77 212677_s_at CEP68 2.77 51158_at LOC400451 2.76 218651_s_at LARP6 2.76 229512_at FAM120C 2.76 215867_x_at CA12 2.75 203680_at PRKAR2B 2.75 205339_at STIL 2.75 222777_s_at WHSC1 2.75 225036_at C9orf105 2.75 231579_s_at TIMP2 2.75 1553743_at FAM119A 2.74 239893_at --- 2.74 207012_at MMP16 2.74 209215_at TETRAN 2.74 1554761_a_at HEATR2 2.74 202610_s_at MED14 2.74 1556794_at --- 2.74 236194_at --- 2.74 239579_at ABHD7 2.74 235425_at SGOL2 2.73 221539_at EIF4EBP1 2.73 209051_s_at RALGDS 2.73 209055_s_at CDC5L 2.73 238554_at CYB5B 2.73 243735_at --- 2.73 211951_at NOLC1 2.73 218128_at NFYB 2.73 238598_s_at --- 2.73 221620_s_at APOO 2.73 222666_s_at RCL1 2.73 235609_at --- 2.72 231853_at TUBD1 2.72 209021_x_at KIAA0652 2.72 203119_at CCDC86 2.72 219650_at ERCC6L 2.72 209153_s_at TCF3 2.72 204455_at DST 2.72 1554541_a_at GPRIN2 2.72 189

229129_at --- 2.72 209646_x_at ALDH1B1 2.72 238782_at --- 2.71 214119_s_at FKBP1A 2.71 221235_s_at LOC644617 2.71 213686_at --- 2.71 225046_at LOC389831 2.71 216952_s_at LMNB2 2.71 205882_x_at ADD3 2.71 1556097_at --- 2.71 244043_at --- 2.71 229267_at --- 2.71 219264_s_at PPP2R3B 2.70 1555733_s_at AP1S3 2.70 210461_s_at ABLIM1 2.70 223148_at PIGS 2.70 218777_at REEP4 2.70 205698_s_at MAP2K6 2.70 212229_s_at FBXO21 2.70 212836_at POLD3 2.70 230194_at --- 2.69 1560683_at BCL8 2.69 239885_at --- 2.69 204128_s_at RFC3 2.69 1559776_at --- 2.69 228361_at 2.69 228089_x_at TMEM179B 2.69 235168_at PIGM 2.68 204817_at ESPL1 2.68 224722_at MIB1 2.68 213567_at --- 2.68 205141_at ANG 2.68 207001_x_at TSC22D3 2.68 228039_at DDX46 2.68 1553813_s_at TLE6 2.67 235309_at RPS15A 2.67 223413_s_at LYAR 2.67 212464_s_at FN1 2.67 209524_at HDGFRP3 2.67 224560_at TIMP2 2.67 243397_at --- 2.67 213270_at MPP2 2.67 202442_at AP3S1 2.67 244246_at MIPOL1 2.67 219267_at GLTP 2.67 222161_at NAALAD2 2.66 228971_at --- 2.66 205129_at NPM3 2.66 190

211725_s_at BID 2.66 204649_at TROAP 2.66 230168_at --- 2.66 204508_s_at CA12 2.66 1552359_at C8orf45 2.65 218983_at C1RL 2.65 227565_at --- 2.65 239413_at CEP152 2.65 236439_at --- 2.65 228841_at LYRM7 2.65 225448_at NAPG 2.65 225747_at COQ10A 2.65 208723_at USP11 2.65 201752_s_at ADD3 2.65 223773_s_at C1orf79 2.65 225062_at LOC389831 2.64 60474_at FERMT1 2.64 202107_s_at MCM2 2.64 200720_s_at ACTR1A 2.64 230520_at AIG1 2.64 212166_at XPO7 2.64 243747_at ZNF599 2.63 228805_at C5orf25 2.63 208511_at PTTG3 2.63 1553284_s_at LMLN 2.63 235736_at --- 2.63 235274_at --- 2.63 1552573_s_at MIPOL1 2.63 204388_s_at MAOA 2.63 238081_at C4orf12 2.63 41220_at SEP9 2.63 227295_at IKIP 2.63 202544_at GMFB 2.63 227928_at C12orf48 2.63 233124_s_at ECHDC1 2.62 238690_at --- 2.62 205937_at CGREF1 2.62 201207_at TNFAIP1 2.62 230369_at GPR161 2.62 229757_at --- 2.62 200962_at RPL31 2.62 204288_s_at SORBS2 2.62 224410_s_at LMBR1 2.62 216969_s_at KIF22 2.62 235428_at --- 2.62 201505_at LAMB1 2.62 224582_s_at --- 2.62 222506_at LMBR1 2.62 191

203946_s_at ARG2 2.62 227022_at GNPDA2 2.61 212518_at PIP5K1C 2.61 226594_at --- 2.61 224015_s_at MRPS25 2.61 202934_at HK2 2.61 229393_at L3MBTL3 2.61 201801_s_at SLC29A1 2.61 1552572_a_at MIPOL1 2.61 222665_at FAM82B 2.60 231233_at --- 2.60 213283_s_at SALL2 2.60 222275_at --- 2.60 226287_at CCDC34 2.60 222006_at LETM1 2.60 234672_s_at TMEM48 2.60 214834_at PAR-SN 2.60 213954_at KIAA0888 2.60 222504_s_at COX4NB 2.60 239960_x_at LYRM7 2.60 230727_at CISD3 2.60 223551_at PKIB 2.60 52164_at C11orf24 2.60 222883_at C1orf163 2.59 205034_at CCNE2 2.59 225438_at NUDCD1 2.59 226936_at C6orf173 2.59 218264_at BCCIP 2.59 205516_x_at CIZ1 2.59 1564907_s_at MATR3 2.59 230728_at --- 2.59 200842_s_at EPRS 2.58 235088_at LOC201725 2.58 218291_at MAPBPIP 2.58 210735_s_at CA12 2.58 208704_x_at APLP2 2.58 205053_at PRIM1 2.58 220085_at HELLS 2.58 231840_x_at LYRM7 2.58 209106_at NCOA1 2.58 1554271_a_at CENPL 2.58 211964_at COL4A2 2.58 224036_s_at LMBR1 2.58 1552617_a_at RFWD2 2.58 227116_at --- 2.58 1564911_at SNHG4 2.57 212231_at FBXO21 2.57 225906_at --- 2.57 192

243013_at --- 2.57 226456_at C16orf75 2.57 208248_x_at APLP2 2.57 225029_at LOC550643 2.57 235965_at --- 2.57 1552455_at PRUNE2 2.56 235644_at CCDC138 2.56 221326_s_at TUBD1 2.56 223665_at ARPM1 2.56 225553_at --- 2.56 230676_s_at TMEM19 2.56 211954_s_at RANBP5 2.56 218127_at NFYB 2.56 212805_at PRUNE2 2.56 243707_at --- 2.56 228280_at ZC3HAV1L 2.56 224901_at SCD5 2.56 1562012_at --- 2.56 204753_s_at HLF 2.56 202475_at TMEM147 2.55 220587_s_at GBL 2.55 238485_at --- 2.55 41037_at TEAD4 2.55 1556308_at PRRT3 2.55 225202_at RHOBTB3 2.55 213573_at --- 2.55 228057_at DDIT4L 2.55 238075_at --- 2.55 217226_s_at SFXN3 2.55 218992_at C9orf46 2.55 219259_at SEMA4A 2.54 226585_at NEIL2 2.54 238038_at --- 2.54 221922_at GPSM2 2.54 209514_s_at RAB27A 2.54 206299_at TMEM28 2.54 227963_at --- 2.54 224579_at SLC38A1 2.54 227185_at LOC643988 2.54 222505_at LMBR1 2.54 214948_s_at TMF1 2.54 234950_s_at RFWD2 2.54 241401_at C4orf12 2.53 202752_x_at SLC7A8 2.53 230301_at --- 2.53 225728_at SORBS2 2.53 227079_at DHX8 2.53 200928_s_at RAB14 2.53 193

226647_at TMEM25 2.53 211804_s_at CDK2 2.53 203953_s_at CLDN3 2.53 212170_at RBM12 2.53 224156_x_at IL17RB 2.53 228046_at LOC152485 2.53 214036_at --- 2.52 218692_at GOLSYN 2.52 209147_s_at PPAP2A 2.52 209084_s_at RAB28 2.52 218168_s_at CABC1 2.52 1558250_s_at --- 2.52 226158_at KLHL24 2.52 219537_x_at DLL3 2.52 230630_at --- 2.52 209645_s_at ALDH1B1 2.52 242260_at MATR3 2.52 222778_s_at WHSC1 2.52 224361_s_at IL17RB 2.52 242289_at --- 2.51 202754_at R3HDM1 2.51 203856_at VRK1 2.51 212338_at MYO1D 2.51 218151_x_at GPR172A 2.51 226338_at TMEM55A 2.51 213321_at BCKDHB 2.51 228069_at FAM54A 2.51 210448_s_at P2RX5 2.51 209068_at HNRPDL 2.51 228384_s_at C10orf33 2.51 218045_x_at PTMS 2.51 218363_at EXDL2 2.51 205942_s_at ACSM3 2.51 232103_at BPNT1 2.51 218935_at EHD3 2.51 235886_at --- 2.51 205862_at GREB1 2.50 224766_at RPL37 2.50 220380_at DNASE2B 2.50 229156_s_at --- 2.50 208848_at ADH5 2.50 224688_at C7orf42 2.50 1554712_a_at GLYATL2 2.50 220007_at METTL8 2.50 220936_s_at H2AFJ 2.50 204807_at TMEM5 2.50 209625_at PIGH 2.50 216442_x_at FN1 2.50 194

213600_at SIPA1L3 2.50 232088_x_at --- 2.50 230752_at --- 2.50 1555888_at UBR5 2.49 216693_x_at HDGFRP3 2.49 225516_at SLC7A2 2.49 226748_at LYSMD2 2.49 202489_s_at FXYD3 2.49 242273_at --- 2.49 214949_at --- 2.49 208617_s_at PTP4A2 2.48 212806_at PRUNE2 2.48 240466_at --- 2.48 202976_s_at RHOBTB3 2.48 228763_at CHMP4A 2.48 224785_at FAM100B 2.48 223165_s_at IHPK2 2.48 216396_s_at EI24 2.48 211762_s_at KPNA2 2.48 242890_at --- 2.48 218051_s_at NT5DC2 2.47 223079_s_at GLS 2.47 1568596_a_at TROAP 2.47 242586_at FSD1L 2.47 204065_at CHST10 2.47 211955_at RANBP5 2.47 205417_s_at DAG1 2.47 238034_at CANX 2.47 236440_at --- 2.47 223304_at SLC37A3 2.47 1556121_at --- 2.47 218898_at FAM57A 2.47 218789_s_at C11orf71 2.47 214045_at LIAS 2.47 209487_at RBPMS 2.47 209684_at RIN2 2.46 224468_s_at C19orf48 2.46 243109_at MCTP2 2.46 230560_at STXBP6 2.46 209118_s_at TUBA1A 2.46 239275_at FRMPD2 2.46 1552735_at PCDHGA4 2.46 217248_s_at SLC7A8 2.46 1560577_at --- 2.46 217837_s_at VPS24 2.46 204836_at GLDC 2.46 241730_at --- 2.46 204928_s_at SLC10A3 2.46 195

1556827_at LOC339929 2.45 226301_at C6orf192 2.45 224581_s_at --- 2.45 220055_at ZNF287 2.45 212934_at LOC137886 2.45 238805_at C11orf52 2.45 235026_at FLJ32549 2.45 224603_at --- 2.45 244080_at --- 2.45 243948_at --- 2.45 211935_at ARL6IP1 2.45 243495_s_at --- 2.45 204023_at RFC4 2.45 202259_s_at RP11-298P3.3 2.44 204127_at RFC3 2.44 225342_at AK3L1 2.44 219094_at ARMC8 2.44 203564_at FANCG 2.44 219255_x_at IL17RB 2.44 212771_at C10orf38 2.44 226837_at SPRED1 2.43 226863_at FAM110C 2.43 228709_at TPR 2.43 204347_at LOC645619 2.43 213320_at PRMT3 2.43 212206_s_at H2AFV 2.43 229299_at C5orf33 2.43 238459_x_at SPATA6 2.43 213425_at WNT5A 2.43 223827_at TNFRSF19 2.43 227921_at --- 2.43 1555062_s_at GTPBP3 2.43 222037_at MCM4 2.43 213473_at BRAP 2.43 213574_s_at KPNB1 2.42 227620_at --- 2.42 230192_at TRIM13 2.42 227356_at --- 2.42 210896_s_at ASPH 2.42 236350_at --- 2.42 229446_at --- 2.42 208502_s_at PITX1 2.42 207039_at CDKN2A 2.42 230787_at --- 2.42 227679_at --- 2.42 213701_at C12orf29 2.42 211719_x_at FN1 2.42 223593_at AADAT 2.42 196

1555731_a_at AP1S3 2.42 226265_at QSER1 2.41 224713_at MKI67IP 2.41 243661_at ZNF273 2.41 208361_s_at POLR3D 2.41 1053_at RFC2 2.41 239098_at KCNRG 2.41 218237_s_at SLC38A1 2.41 203954_x_at CLDN3 2.41 210983_s_at MCM7 2.41 215629_s_at DLEU2 2.41 211949_s_at NOLC1 2.41 226625_at TGFBR3 2.41 226309_at DNAL1 2.41 1570482_at --- 2.41 214306_at OPA1 2.41 202894_at EPHB4 2.41 225098_at ABI2 2.41 203521_s_at ZNF318 2.41 222542_x_at CABC1 2.40 227144_at C22orf9 2.40 234978_at SLC36A4 2.40 204301_at KBTBD11 2.40 201195_s_at SLC7A5 2.40 214268_s_at MTMR4 2.40 202080_s_at TRAK1 2.40 211814_s_at CCNE2 2.40 218893_at ISOC2 2.40 235363_at --- 2.40 213967_at RALYL 2.40 200900_s_at M6PR 2.40 212277_at MTMR4 2.39 228569_at PAPOLA 2.39 224649_x_at --- 2.39 200901_s_at M6PR 2.39 219555_s_at CENPN 2.39 227678_at XRCC6BP1 2.39 210495_x_at FN1 2.39 238867_at TMEM182 2.39 223500_at CPLX1 2.39 229886_at C5orf34 2.39 226254_s_at KIAA1430 2.39 210609_s_at TP53I3 2.39 213360_s_at LOC100101267 2.39 234936_s_at CC2D2A 2.39 217899_at FLJ20254 2.39 238491_at --- 2.39 218394_at ROGDI 2.38 197

209683_at FAM49A 2.38 209932_s_at DUT 2.38 226987_at RBM15B 2.38 228433_at FLJ11236 2.38 1555973_at --- 2.38 204240_s_at SMC2 2.38 229498_at --- 2.38 214193_s_at C1orf107 2.38 226619_at SENP1 2.38 238578_at TMEM182 2.38 1560684_x_at BCL8 2.38 203283_s_at HS2ST1 2.38 212360_at AMPD2 2.38 236622_at PIGM 2.38 226488_at RCCD1 2.38 228239_at C21orf51 2.38 236236_at --- 2.38 236042_at RAD52 2.38 218588_s_at C5orf3 2.37 1555974_a_at --- 2.37 226482_s_at hCG_20857 2.37 242300_at --- 2.37 241823_at --- 2.37 1568609_s_at FAM91A2 2.37 225520_at MTHFD1L 2.37 234863_x_at FBXO5 2.37 212563_at BOP1 2.37 226671_at LAMP2 2.37 212327_at LIMCH1 2.37 208795_s_at MCM7 2.37 200001_at CAPNS1 2.37 218590_at C10orf2 2.36 203758_at CTSO 2.36 219145_at LPHN1 2.36 226215_s_at FBXL10 2.36 237515_at RWDD3 2.36 242224_at GPATCH2 2.36 236122_at --- 2.36 230222_at --- 2.36 203173_s_at C16orf62 2.36 204147_s_at TFDP1 2.36 220617_s_at ZNF532 2.36 202856_s_at SLC16A3 2.36 209243_s_at PEG3 2.36 210389_x_at TUBD1 2.36 235573_at --- 2.36 228854_at --- 2.36 206852_at EPHA7 2.36 198

1557137_at TMEM17 2.36 209526_s_at HDGFRP3 2.36 221510_s_at GLS 2.36 213196_at ZNF629 2.36 202384_s_at TCOF1 2.35 1559681_a_at TRIM16L 2.35 1552921_a_at FIGNL1 2.35 216307_at DGKB 2.35 229431_at RFXAP 2.35 228035_at STK33 2.35 243016_at --- 2.35 210377_at ACSM3 2.35 228775_at --- 2.35 243742_at --- 2.35 204407_at TTF2 2.35 227285_at C1orf51 2.35 202964_s_at RFX5 2.34 231944_at ERO1LB 2.34 225665_at ZAK 2.34 228452_at C17orf39 2.34 231846_at FOXRED2 2.34 223255_at KIAA1333 2.34 203023_at HSPC111 2.34 218108_at C14orf130 2.34 226258_at AMN1 2.34 236380_at --- 2.34 204215_at C7orf23 2.34 238756_at GAS2L3 2.34 229333_at --- 2.34 202562_s_at C14orf1 2.33 208289_s_at EI24 2.33 215913_s_at GULP1 2.33 227120_at FOXP4 2.33 229442_at C18orf54 2.33 1569827_at ATG7 2.33 223854_at PCDHB10 2.33 202463_s_at MBD3 2.33 223022_s_at VTA1 2.33 224870_at KIAA0114 2.33 205883_at ZBTB16 2.33 236616_at --- 2.33 235230_at --- 2.33 201309_x_at C5orf13 2.32 223089_at VEZT 2.32 230300_at --- 2.32 208902_s_at RPS28 2.32 205593_s_at PDE9A 2.32 210951_x_at RAB27A 2.32 199

222761_at BIVM 2.32 205016_at TGFA 2.32 223785_at FANCI 2.32 222735_at --- 2.32 223513_at CENPJ 2.32 229685_at LOC100134937 2.32 207664_at ADAM2 2.32 235450_at FBXL4 2.32 202609_at EPS8 2.32 205501_at --- 2.32 219806_s_at C11orf75 2.31 243702_at --- 2.31 223397_s_at NIP7 2.31 235744_at PPTC7 2.31 210871_x_at SSX2IP 2.31 201223_s_at RAD23B 2.31 226082_s_at SFRS15 2.31 204021_s_at PURA 2.31 223454_at CXCL16 2.31 235266_at ATAD2 2.31 211220_s_at HSF2 2.31 206445_s_at PRMT1 2.31 202564_x_at ARL2 2.31 220974_x_at SFXN3 2.31 208885_at LCP1 2.31 226644_at MIB2 2.30 219987_at LOC728193 2.30 222647_at SLC35C1 2.30 1556194_a_at --- 2.30 229590_at RPL13 2.30 218942_at PIP4K2C 2.30 218361_at GOLPH3L 2.30 227143_s_at BID 2.30 208615_s_at PTP4A2 2.30 236026_at GPATCH2 2.30 217427_s_at HIRA 2.30 212421_at C22orf9 2.30 231472_at FBXO15 2.30 225805_at HNRNPU 2.30 218236_s_at PRKD3 2.30 243063_at --- 2.30 209657_s_at HSF2 2.29 203276_at LMNB1 2.29 227461_at STON2 2.29 209111_at RNF5 2.29 211851_x_at BRCA1 2.29 229838_at NUCB2 2.29 228217_s_at C6orf86 2.29 200

236527_at --- 2.29 226473_at CBX2 2.29 237530_at --- 2.29 227582_at KLHDC9 2.29 219742_at PRR7 2.29 226692_at SERF2 2.29 1557915_s_at GSTO1 2.28 201761_at MTHFD2 2.28 227368_at --- 2.28 204775_at CHAF1B 2.28 222437_s_at VPS24 2.28 239316_at LOC751071 2.28 201664_at SMC4 2.28 214785_at VPS13A 2.28 213668_s_at SOX4 2.28 204020_at PURA 2.28 206074_s_at HMGA1 2.28 1555737_a_at KLK4 2.28 235427_at --- 2.28 228706_s_at CLDN23 2.28 213461_at NUDT21 2.28 230673_at PKHD1L1 2.28 1568597_at LOC646762 2.27 225220_at SNHG8 2.27 222889_at DCLRE1B 2.27 223257_at KIAA1333 2.27 242292_at CXorf50B 2.27 227146_at QSOX2 2.27 201990_s_at CREBL2 2.27 219324_at NOL12 2.27 212978_at LRRC8B 2.27 212566_at MAP4 2.27 226044_at TDP1 2.27 243309_at FLJ27352 2.27 227708_at EEF1A1 2.27 206747_at GPRIN2 2.26 214577_at MAP1B 2.26 201470_at GSTO1 2.26 239143_x_at RNF138 2.26 228820_at XPNPEP3 2.26 213861_s_at FAM119B 2.26 227848_at PEBP4 2.26 1558508_a_at C1orf53 2.26 201673_s_at GYS1 2.26 235850_at WDR5B 2.26 226561_at LOC285086 2.26 223661_at --- 2.26 201242_s_at ATP1B1 2.26 201

220167_s_at LOC729264 2.26 223655_at CD163L1 2.26 222604_at GTF3C3 2.26 219330_at VANGL1 2.26 224744_at IMPAD1 2.26 238590_x_at TMEM107 2.25 230285_at SVIP 2.25 203919_at TCEA2 2.25 201363_s_at IVNS1ABP 2.25 224513_s_at UBQLN4 2.25 233803_s_at MYBBP1A 2.25 226764_at LOC152485 2.25 244407_at CYP39A1 2.25 218086_at NPDC1 2.25 200793_s_at ACO2 2.25 219703_at MNS1 2.25 228266_s_at HDGFRP3 2.25 225302_at TXNDC10 2.25 228412_at LOC643072 2.25 231927_at ATF6 2.25 224368_s_at NDRG3 2.25 1553710_at C4orf39 2.25 225484_at TSGA14 2.24 224608_s_at VPS25 2.24 224830_at NUDT21 2.24 230177_at --- 2.24 1568873_at ZNF519 2.24 1561939_at DYNC2H1 2.24 216267_s_at TMEM115 2.24 218926_at MYNN 2.24 216299_s_at XRCC3 2.24 225796_at PXK 2.24 221685_s_at CCDC99 2.24 235577_at ZNF652 2.24 210946_at PPAP2A 2.24 212528_at --- 2.24 208745_at ATP5L 2.24 224743_at IMPAD1 2.24 41160_at MBD3 2.24 209753_s_at TMPO 2.23 220520_s_at NUP62CL 2.23 227988_s_at VPS13A 2.23 214283_at TMEM97 2.23 220591_s_at EFHC2 2.23 227926_s_at NBPF11 2.23 202975_s_at RHOBTB3 2.23 1564139_at LOC144571 2.23 203017_s_at SSX2IP 2.23 202

217188_s_at C14orf1 2.23 201989_s_at CREBL2 2.23 243606_at --- 2.23 213852_at RBM8A 2.23 1556613_s_at LOC203107 2.23 203212_s_at MTMR2 2.23 1558507_at C1orf53 2.23 203608_at ALDH5A1 2.23 216253_s_at PARVB 2.22 32836_at AGPAT1 2.22 201370_s_at CUL3 2.22 201008_s_at TXNIP 2.22 237510_at --- 2.22 212234_at ASXL1 2.22 201362_at IVNS1ABP 2.22 217896_s_at NIP30 2.22 213626_at CBR4 2.22 227617_at TMEM201 2.22 232800_at --- 2.22 228205_at TKT 2.22 212502_at ADO 2.22 236837_x_at LOC650794 2.22 227762_at --- 2.22 225266_at ZNF652 2.22 226629_at SLC43A2 2.22 222843_at FIGNL1 2.22 230068_s_at PEG3 2.22 1557014_a_at C9orf122 2.21 202483_s_at RANBP1 2.21 204791_at NR2C1 2.21 230006_s_at SVIP 2.21 203895_at PLCB4 2.21 218550_s_at LRRC20 2.21 201013_s_at PAICS 2.21 200762_at DPYSL2 2.21 243023_at --- 2.21 223519_at ZAK 2.21 1555734_x_at AP1S3 2.21 230606_at GJD3 2.21 201663_s_at SMC4 2.21 225836_s_at C12orf32 2.21 225587_at TMEM129 2.21 225662_at ZAK 2.21 213133_s_at GCSH 2.21 225777_at C9orf140 2.21 235048_at KIAA0888 2.21 228977_at LOC729680 2.21 203254_s_at TLN1 2.21 203

202740_at ACY1 2.21 204700_x_at C1orf107 2.21 209129_at TRIP6 2.21 235581_at --- 2.21 227556_at NME7 2.21 208754_s_at NAP1L1 2.20 208152_s_at DDX21 2.20 200713_s_at MAPRE1 2.20 228520_s_at APLP2 2.20 224437_s_at VTA1 2.20 217905_at C10orf119 2.20 224732_at CTF8 2.20 225947_at MYO19 2.20 217833_at SYNCRIP 2.20 201030_x_at LDHB 2.20 234290_x_at MYH14 2.20 232297_at --- 2.20 1558044_s_at EXOSC6 2.20 227908_at TBC1D24 2.20 239069_s_at --- 2.20 222081_at --- 2.20 232007_at AGPAT5 2.20 209832_s_at CDT1 2.20 209733_at LOC286440 2.20 1553147_at RANBP3L 2.20 209187_at DR1 2.20 229189_s_at --- 2.20 209544_at RIPK2 2.19 240236_at --- 2.19 209056_s_at CDC5L 2.19 235935_at C6orf154 2.19 228370_at SNRPN 2.19 224921_at SCAMP2 2.19 226923_at SCFD2 2.19 225324_at CRLS1 2.19 238533_at EPHA7 2.19 215481_s_at PEX5 2.19 203696_s_at RFC2 2.19 203625_x_at SKP2 2.19 241455_at --- 2.19 229611_at LMLN 2.19 214011_s_at HSPC111 2.19 235286_at --- 2.19 238803_at HECTD2 2.19 227746_at ELAVL1 2.18 221777_at C12orf52 2.18 227471_at HACE1 2.18 223362_s_at SEP3 2.18 204

204276_at TK2 2.18 212605_s_at --- 2.18 221788_at --- 2.18 36830_at MIPEP 2.18 238127_at FLJ41484 2.18 202972_s_at FAM13A1 2.18 244779_at --- 2.18 234464_s_at EME1 2.18 212872_s_at MED20 2.18 219357_at GTPBP1 2.18 211358_s_at CIZ1 2.18 238026_at RPL35A 2.18 220397_at MDM1 2.18 221512_at C1orf160 2.18 229948_at --- 2.18 212608_s_at --- 2.18 218835_at SFTPA2 2.17 213259_s_at SARM1 2.17 226775_at ENY2 2.17 212298_at NRP1 2.17 222752_s_at C1orf75 2.17 203270_at DTYMK 2.17 235459_at --- 2.17 225695_at C2orf18 2.17 218481_at EXOSC5 2.17 230211_at --- 2.17 225116_at HIPK2 2.17 219443_at TASP1 2.17 225629_s_at ZBTB4 2.17 244189_at KIAA1648 2.17 217856_at RBM8A 2.17 202070_s_at IDH3A 2.17 209263_x_at TSPAN4 2.17 209283_at CRYAB 2.17 227987_at VPS13A 2.17 216092_s_at SLC7A8 2.16 1552928_s_at MAP3K7IP3 2.16 1552427_at ZNF485 2.16 228255_at ALS2CR4 2.16 1557331_at POLR1B 2.16 223678_s_at SFTPA1 2.16 204062_s_at ULK2 2.16 205895_s_at NOLC1 2.16 203488_at LPHN1 2.16 1557383_a_at --- 2.16 200890_s_at SSR1 2.16 231894_at --- 2.16 202330_s_at UNG 2.16 205

228856_at --- 2.16 227298_at FLJ37798 2.16 224610_at SNHG1 2.16 201115_at POLD2 2.16 209407_s_at DEAF1 2.16 201130_s_at CDH1 2.16 208940_at SEPHS1 2.16 213629_x_at MT1F 2.16 211300_s_at TP53 2.16 225300_at C15orf23 2.16 200721_s_at ACTR1A 2.16 204305_at MIPEP 2.16 228845_at P76 2.16 238332_at ANKRD29 2.15 218495_at UXT 2.15 216262_s_at TGIF2 2.15 201433_s_at PTDSS1 2.15 1861_at BAD 2.15 209307_at SWAP70 2.15 242900_at ALG10B 2.15 226420_at EVI1 2.15 242082_at MMAB 2.15 211478_s_at DPP4 2.15 1558487_a_at TMED4 2.15 201487_at CTSC 2.15 228615_at LOC286161 2.15 1560258_a_at --- 2.15 1552927_at MAP3K7IP3 2.15 1553140_at PELO 2.15 222736_s_at TMEM38B 2.15 209556_at NCDN 2.15 1557128_at FAM111B 2.15 226549_at SBK1 2.15 220060_s_at C12orf48 2.15 226223_at --- 2.14 210224_at MR1 2.14 209176_at SEC23IP 2.14 212205_at H2AFV 2.14 239824_s_at TMEM107 2.14 227003_at RAB28 2.14 205525_at CALD1 2.14 222875_at DHX33 2.14 231866_at LNPEP 2.13 212458_at SPRED2 2.13 212930_at ATP2B1 2.13 226670_s_at PABPC1L 2.13 236196_at --- 2.13 209740_s_at PNPLA4 2.13 206

213685_at --- 2.13 226346_at MEX3A 2.13 44065_at C12orf52 2.13 235083_at FLJ38359 2.13 229116_at --- 2.13 212811_x_at SLC1A4 2.13 229190_at --- 2.12 218526_s_at RANGRF 2.12 218772_x_at TMEM38B 2.12 215723_s_at PLD1 2.12 213704_at RABGGTB 2.12 228560_at --- 2.12 218010_x_at C20orf149 2.12 209135_at ASPH 2.11 218866_s_at POLR3K 2.11 230569_at KIAA1430 2.11 227752_at SPTLC3 2.11 239038_at C1orf52 2.11 223414_s_at LYAR 2.11 218285_s_at BDH2 2.11 212198_s_at TM9SF4 2.11 235150_at --- 2.11 225781_at MAPK9 2.11 225696_at COPS7B 2.11 226996_at LYCAT 2.11 1555461_at --- 2.11 206499_s_at RCC1 2.11 218575_at ANAPC1 2.11 242648_at KLHL8 2.11 230452_at FLJ42351 2.11 225619_at SLAIN1 2.11 225591_at FBXO25 2.10 234985_at --- 2.10 226016_at CD47 2.10 228100_at C1orf88 2.10 227794_at GLYATL1 2.10 238389_s_at --- 2.10 1556147_at --- 2.10 224867_at C1orf151 2.10 223113_at TMEM138 2.10 232262_at PIGL 2.10 226874_at KLHL8 2.10 202633_at TOPBP1 2.10 227936_at TMEM68 2.10 1562013_a_at --- 2.10 225343_at TMED8 2.09 243209_at KCNQ4 2.09 232231_at RUNX2 2.09 207

205235_s_at MPHOSPH1 2.09 200708_at GOT2 2.09 218235_s_at UTP11L 2.09 228488_at TBC1D16 2.09 219188_s_at MACROD1 2.09 235606_at LOC344595 2.09 227865_at C9orf103 2.09 236990_at --- 2.09 231955_s_at HIBADH 2.09 236989_at --- 2.09 203492_x_at CEP57 2.09 231727_s_at MIF4GD 2.09 217819_at GOLGA7 2.09 244881_at LMLN 2.09 212567_s_at MAP4 2.09 227932_at ARIH2 2.08 242470_at EID2B 2.08 200791_s_at IQGAP1 2.08 235203_at --- 2.08 225193_at KIAA1967 2.08 225617_at ODF2 2.08 225837_at C12orf32 2.08 227536_at ZC3H13 2.08 208968_s_at CIAPIN1 2.08 207170_s_at LETMD1 2.08 227607_at STAMBPL1 2.08 201962_s_at RNF41 2.08 222554_s_at NOL6 2.08 244411_at --- 2.08 217367_s_at ZHX3 2.08 220603_s_at MCTP2 2.08 226934_at --- 2.08 1557487_at --- 2.08 202470_s_at CPSF6 2.08 1554167_a_at GOLGA7 2.08 225335_at ZNF496 2.08 1568593_a_at NUDT16P 2.08 217478_s_at HLA-DMA 2.08 223810_at KLHL1 2.08 210933_s_at FSCN1 2.08 226820_at ZNF362 2.08 203896_s_at PLCB4 2.08 226810_at --- 2.08 217014_s_at AZGP1 2.08 221541_at CRISPLD2 2.07 200709_at FKBP1A 2.07 232618_at CYorf15A 2.07 226431_at ALS2CR13 2.07 208

215982_s_at DOM3Z 2.07 203156_at AKAP11 2.07 227162_at ZBTB26 2.07 224735_at CYBASC3 2.07 235109_at --- 2.07 203570_at LOXL1 2.07 203364_s_at KIAA0652 2.07 213043_s_at MED24 2.07 213454_at APITD1 2.07 205594_at ZNF652 2.07 214857_at --- 2.07 208956_x_at DUT 2.07 1562091_at --- 2.07 229500_at SLC30A9 2.07 243009_at LOC441242 2.07 1554020_at BICD1 2.07 214701_s_at FN1 2.07 203044_at CHSY1 2.07 238164_at USP6NL 2.06 218294_s_at NUP50 2.06 218528_s_at RNF38 2.06 225767_at --- 2.06 223419_at FBXW9 2.06 208712_at CCND1 2.06 218696_at EIF2AK3 2.06 224651_at CCNY 2.06 203866_at NLE1 2.06 227293_at --- 2.06 218708_at NXT1 2.06 201264_at COPE 2.06 224715_at WDR34 2.06 226889_at WDR35 2.06 226946_at C5orf33 2.06 215011_at SNHG3 2.06 227164_at SFRS1 2.06 225255_at MRPL35 2.06 225972_at TMEM64 2.06 229144_at RP1-21O18.1 2.06 224977_at C6orf89 2.06 218447_at C16orf61 2.06 203019_x_at SSX2IP 2.06 225126_at MRRF 2.06 238854_at --- 2.06 224784_at MLLT6 2.06 223630_at C7orf13 2.06 218500_at C8orf55 2.05 224932_at C22orf16 2.05 206422_at GCG 2.05 209

201807_at VPS26A 2.05 219201_s_at TWSG1 2.05 211682_x_at UGT2B28 2.05 229699_at --- 2.05 213658_at --- 2.05 216215_s_at RBM9 2.05 225985_at PRKAA1 2.05 229810_at --- 2.05 209940_at PARP3 2.05 226941_at --- 2.05 1553711_a_at C4orf39 2.05 209529_at PPAP2C 2.05 225030_at FAM44B 2.05 1553971_a_at GATS 2.05 232235_at DSEL 2.05 236728_at LNPEP 2.05 221865_at C9orf91 2.05 227585_at --- 2.05 201310_s_at C5orf13 2.05 219031_s_at NIP7 2.05 238431_at --- 2.05 241972_at LOC401588 2.05 227357_at MAP3K7IP3 2.05 239302_s_at --- 2.04 219763_at DENND1A 2.04 212051_at WIPF2 2.04 228630_at ZNF84 2.04 225605_at TP53I13 2.04 222013_x_at FAM86B1 2.04 215001_s_at GLUL 2.04 218754_at NOL9 2.04 215785_s_at CYFIP2 2.04 201418_s_at SOX4 2.04 210249_s_at NCOA1 2.04 238448_at MRPL19 2.04 226990_at CAPRIN1 2.04 219071_x_at C8orf30A 2.04 214672_at TTLL5 2.04 225918_at LOC146346 2.04 212664_at TUBB4 2.03 230774_at ZADH1 2.03 225530_at MOBKL2A 2.03 201764_at TMEM106C 2.03 225012_at HDLBP 2.03 228565_at KIAA1804 2.03 209309_at AZGP1 2.03 226041_at NAPE-PLD 2.03 208990_s_at HNRPH3 2.03 210

201853_s_at CDC25B 2.03 236400_at --- 2.03 219396_s_at NEIL1 2.03 226452_at PDK1 2.03 226566_at TRIM11 2.03 219785_s_at FBXO31 2.03 228744_at CEP27 2.03 227994_x_at C20orf149 2.03 224622_at TBC1D14 2.03 225722_at --- 2.03 224647_at --- 2.03 212969_x_at EML3 2.03 228622_s_at DNAJC4 2.03 228395_at GLT8D1 2.03 206103_at RAC3 2.03 203576_at BCAT2 2.03 218167_at AMZ2 2.03 209107_x_at NCOA1 2.02 1552274_at PXK 2.02 202787_s_at MAPKAPK3 2.02 219028_at HIPK2 2.02 224446_at C12orf31 2.02 41512_at --- 2.02 231056_at LOC339352 2.02 225252_at SRXN1 2.02 242475_at --- 2.02 205909_at POLE2 2.02 203109_at UBE2M 2.02 212214_at OPA1 2.02 230846_at AKAP5 2.02 203442_x_at EML3 2.02 238256_at --- 2.02 226986_at WIPI2 2.02 219630_at PDZK1IP1 2.02 223021_x_at VTA1 2.02 209406_at BAG2 2.01 202561_at TNKS 2.01 203493_s_at CEP57 2.01 223290_at PDXP 2.01 35147_at MCF2L 2.01 201985_at KIAA0196 2.01 225219_at SMAD5 2.01 212330_at TFDP1 2.01 232067_at C6orf168 2.01 59644_at BMP2K 2.01 217047_s_at FAM13A1 2.01 243924_at --- 2.01 234749_s_at WDR51A 2.01 211

200617_at KIAA0152 2.01 236665_at CCDC18 2.01 210878_s_at JMJD1B 2.01 225711_at ARL6IP6 2.01 237158_s_at MPHOSPH9 2.01 212328_at LIMCH1 2.01 204975_at EMP2 2.01 209731_at NTHL1 2.01 231979_at --- 2.01 227207_x_at ZNF213 2.01 213564_x_at LDHB 2.01 204993_at GNAZ 2.01 225729_at C6orf89 2.00 225213_at PPTC7 2.00 217904_s_at BACE1 2.00 213913_s_at KIAA0984 2.00 219510_at POLQ 2.00 227733_at TMEM63C 2.00 206245_s_at IVNS1ABP 2.00 218689_at FANCF 2.00 213129_s_at GCSH 2.00 1559450_at --- 2.00 225625_at ALKBH2 2.00

212

Appendix B

SUPPLEMENT 2

Table 2. Genes activated by AR in LP50 cells independent of androgen and also up- regulated in clinical metastatic prostate tumors

Avg Fold Affy probe set Gene Change Top % in tumors 200783_s_at STMN1 2.96 1% 201013_s_at PAICS 2.21 1% 201188_s_at ITPR3 4.07 1% 201189_s_at ITPR3 3.85 1% 201223_s_at RAD23B 2.31 1% 201418_s_at SOX4 2.04 1% 201555_at MCM3 3.60 1% 202240_at PLK1 4.47 1% 202431_s_at MYC 5.90 1% 202754_at R3HDM1 2.51 1% 203418_at CCNA2 4.84 1% 203438_at STC2 7.37 1% 203439_s_at STC2 2.80 1% 203554_x_at PTTG1 6.25 1% 203625_x_at SKP2 2.19 1% 204092_s_at AURKA 3.77 1% 204170_s_at CKS2 3.75 1% 208079_s_at AURKA 4.86 1% 208905_at CYCS 2.90 1% 209642_at BUB1 4.84 1% 210448_s_at P2RX5 2.51 1% 210567_s_at SKP2 2.89 1% 211935_at ARL6IP1 2.45 1% 212930_at ATP2B1 2.13 1% 213226_at CCNA2 3.53 1%

213

213668_s_at SOX4 2.28 1% 215509_s_at BUB1 4.34 1% 218009_s_at PRC1 4.53 1% 222037_at MCM4 2.43 1% 223551_at PKIB 2.60 1% 223598_at RAD23B 3.41 1% 224578_at RCC2 3.34 1% 225126_at MRRF 2.06 1% 225520_at MTHFD1L 2.37 1% 226946_at C5orf33 2.06 1% 228594_at C5orf33 5.10 1% 229299_at C5orf33 2.43 1% 229415_at CYCS 2.87 1% 231120_x_at PKIB 3.21 1% 235309_at RPS15A 2.67 1% 244546_at CYCS 3.10 1% 1553140_at PELO 2.15 5% 1555515_a_at C1orf2 5.80 5% 1555772_a_at CDC25A 4.93 5% 1568597_at LOC646762 2.27 5% 201291_s_at TOP2A 8.49 5% 201292_at TOP2A 8.65 5% 201309_x_at C5orf13 2.32 5% 201310_s_at C5orf13 2.05 5% 201710_at MYBL2 13.42 5% 201761_at MTHFD2 2.28 5% 202503_s_at KIAA0101 6.61 5% 203550_s_at C1orf2 2.96 5% 203564_at FANCG 2.44 5% 203764_at DLG7 7.51 5% 203856_at VRK1 2.51 5% 204026_s_at ZWINT 3.79 5% 204254_s_at VDR 4.08 5% 204255_s_at VDR 2.82 5% 204444_at KIF11 9.31 5% 204695_at CDC25A 11.28 5% 204709_s_at KIF23 7.38 5% 204791_at NR2C1 2.21 5% 204993_at GNAZ 2.01 5% 205393_s_at CHEK1 3.80 5% 205394_at CHEK1 3.53 5% 205433_at BCHE 3.16 5% 206501_x_at ETV1 8.52 5% 207524_at ST7 5.31 5% 207828_s_at CENPF 8.07 5% 207871_s_at ST7 3.80 5% 209172_s_at CENPF 8.56 5% 209408_at KIF2C 7.78 5% 211519_s_at KIF2C 5.43 5% 211964_at COL4A2 2.58 5%

214

215723_s_at PLD1 2.12 5% 217053_x_at ETV1 6.15 5% 217061_s_at ETV1 7.04 5% 217367_s_at ZHX3 2.08 5% 218039_at NUSAP1 8.57 5% 218542_at CEP55 10.98 5% 219588_s_at NCAPG2 3.14 5% 219978_s_at NUSAP1 7.72 5% 220055_at ZNF287 2.45 5% 221911_at ETV1 11.76 5% 222777_s_at WHSC1 2.75 5% 222778_s_at WHSC1 2.52 5% 223575_at KIAA1549 4.15 5% 224650_at MAL2 3.98 5% 224753_at CDCA5 6.30 5% 224772_at NAV1 3.86 5% 224773_at NAV1 6.00 5% 224977_at C6orf89 2.06 5% 225617_at ODF2 2.08 5% 225687_at FAM83D 7.76 5% 225729_at C6orf89 2.00 5% 225881_at SLC35B4 4.06 5% 226158_at KLHL24 2.52 5% 226548_at SBK1 2.84 5% 226549_at SBK1 2.15 5% 226647_at TMEM25 2.53 5% 226936_at C6orf173 2.59 5% 227164_at SFRS1 2.06 5% 227409_at PPP1R3E 3.05 5% 227908_at TBC1D24 2.20 5% 228217_s_at C6orf86 2.29 5% 228706_s_at CLDN23 2.28 5% RP1- 229144_at 21O18.1 2.06 5% 230520_at AIG1 2.64 5% 232921_at KIAA1549 9.25 5% 234314_at C20orf74 3.88 5% 238418_at SLC35B4 4.52 5% 238514_at TMEM25 2.93 5% 238624_at NLK 2.85 5%

215

Appendix C

SUPPLEMENT 3

Table 3. Genes induced more than two-fold in LP50 cells 6 h after treatment with R1881.

Avg Fold Gene Symbol Gene Title Change STEAP4 STEAP family member 4 68.75 F5 coagulation factor V (proaccelerin, labile factor) 39.96 TBX15 T-box 15 33.02 LAMA1 laminin, alpha 1 31.59 SNAI2 snail homolog 2 (Drosophila) 31.31 CCDC141 coiled-coil domain containing 141 28.91 TMCC3 transmembrane and coiled-coil domain family 3 19.30 LOC285026 hypothetical protein LOC285026 18.55 ORM1 orosomucoid 1 17.16 NPPC natriuretic peptide precursor C 16.70 TTN 14.54 SLC38A4 solute carrier family 38, member 4 13.29 ORM1 /// ORM2 orosomucoid 1 /// orosomucoid 2 12.96 SGK1 serum/glucocorticoid regulated kinase 1 12.31 KLK2 kallikrein-related peptidase 2 10.58 LOC285463 hypothetical protein LOC285463 9.78 FKBP5 FK506 binding protein 5 7.08 LOC339260 Hypothetical protein LOC339260 6.98 TMPRSS2 transmembrane protease, serine 2 6.42 RFXDC1 regulatory factor X domain containing 1 6.05 TIPARP TCDD-inducible poly(ADP-ribose) polymerase 5.86 LIFR leukemia inhibitory factor receptor alpha 5.55 PTGER4 prostaglandin E receptor 4 (subtype EP4) 5.51 solute carrier family 2 (facilitated glucose SLC2A3 transporter), member 3 5.44 PHLDB2 pleckstrin -like domain, family B, 5.38

216

member 2 FAM105A family with sequence similarity 105, member A 5.34 HPGD hydroxyprostaglandin dehydrogenase 15-(NAD) 5.33 ERRFI1 ERBB receptor feedback inhibitor 1 5.07 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta- galactosyl-1,3)- N-acetylgalactosaminide alpha- ST6GALNAC1 2,6-sialyltransferase 1 4.86 v- musculoaponeurotic fibrosarcoma MAF oncogene homolog (avian) 4.79 EAF2 ELL associated factor 2 4.63 chondroitin beta1,4 N- ChGn acetylgalactosaminyltransferase 4.45 RHOU ras homolog gene family, member U 4.29 transient receptor potential cation channel, TRPM8 subfamily M, member 8 4.06 cytochrome P450, family 2, subfamily U, CYP2U1 polypeptide 1 3.95 MAK male germ cell-associated kinase 3.86 NKX3-1 NK3 homeobox 1 3.65 potassium voltage-gated channel, subfamily G, KCNG3 member 3 3.47 WWTR1 WW domain containing transcription regulator 1 3.41 C1orf85 open reading frame 85 3.39 SLC45A3 solute carrier family 45, member 3 3.37 FAM110B family with sequence similarity 110, member B 3.37 solute carrier family 16, member 6 SLC16A6 (monocarboxylic acid transporter 7) 3.34 transmembrane, prostate androgen induced TMEPAI RNA 3.32 IGF1R insulin-like growth factor 1 receptor 3.28 PRAGMIN homolog of rat pragma of Rnd2 3.05 FZD5 frizzled homolog 5 (Drosophila) 3.05 MTMR9 myotubularin related protein 9 3.02 C1orf116 chromosome 1 open reading frame 116 2.98 KLF5 Kruppel-like factor 5 (intestinal) 2.88 guanine binding protein (G protein), GNB4 beta polypeptide 4 2.83 LOC344595 hypothetical LOC344595 2.78 CENPN centromere protein N 2.74 ZBTB16 zinc finger and BTB domain containing 16 2.73 NCAPD3 non-SMC condensin II complex, subunit D3 2.72 PIK3AP1 phosphoinositide-3-kinase adaptor protein 1 2.70 TBC1 domain family, member 8 (with GRAM TBC1D8 domain) 2.69 GRHL2 grainyhead-like 2 (Drosophila) 2.66 growth arrest and DNA-damage-inducible, GADD45G gamma 2.65 NNMT nicotinamide N- 2.64 GREB1 GREB1 protein 2.64 SLITRK6 SLIT and NTRK-like family, member 6 2.63 associated monoxygenase, MICAL1 calponin and LIM domain containing 1 2.59 IRS2 insulin receptor substrate 2 2.58

217

STK17B serine/threonine kinase 17b 2.55 ERN1 Endoplasmic reticulum to nucleus signaling 1 2.55 C3orf25 open reading frame 25 2.55 CLDN8 claudin 8 2.53 mucosa associated lymphoid tissue MALT1 translocation gene 1 2.51 NDRG1 N-myc downstream regulated gene 1 2.49 transmembrane and tetratricopeptide repeat TMTC2 containing 2 2.49 SYNJ1 1 2.48 ALDH1A3 aldehyde dehydrogenase 1 family, member A3 2.45 ELOVL family member 7, elongation of long ELOVL7 chain fatty acids (yeast) 2.45 ZBTB10 zinc finger and BTB domain containing 10 2.43 solute carrier family 2 (facilitated glucose SLC2A12 transporter), member 12 2.40 TNFAIP8 , alpha-induced protein 8 2.36 calcium/calmodulin-dependent protein kinase CAMKK2 kinase 2, beta 2.36 PAK1IP1 PAK1 interacting protein 1 2.33 membrane bound O-acyltransferase domain MBOAT2 containing 2 2.32 SLC41A1 solute carrier family 41, member 1 2.32 LRRFIP2 rich repeat (in FLII) interacting protein 2 2.29 leucine-rich repeats and immunoglobulin-like LRIG1 domains 1 2.26 N-acetyltransferase 1 (arylamine N- NAT1 acetyltransferase) 2.26 ANKH ankylosis, progressive homolog (mouse) 2.21 WD repeat domain, phosphoinositide interacting WIPI1 1 2.18 PPAP2A phosphatidic acid phosphatase type 2A 2.17 ELL2 elongation factor, RNA polymerase II, 2 2.17 KLHL29 kelch-like 29 (Drosophila) 2.16 MPHOSPH9 M-phase phosphoprotein 9 2.15 cat eye syndrome chromosome region, CECR6 candidate 6 2.15 C17orf48 chromosome 17 open reading frame 48 2.14 ZBTB24 zinc finger and BTB domain containing 24 2.13 FZD8 frizzled homolog 8 (Drosophila) 2.12 C6orf201 open reading frame 201 2.12 KLK4 kallikrein-related peptidase 4 2.12 DOCK4 dedicator of 4 2.10 beta precursor protein (cytoplasmic tail) APPBP2 binding protein 2 2.10 MAP2 microtubule-associated protein 2 2.10 CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 2.09 C3orf58 chromosome 3 open reading frame 58 2.08 C1orf21 chromosome 1 open reading frame 21 2.08 HERC3 hect domain and RLD 3 2.08 PRKCA protein kinase C, alpha 2.07 PCTP transfer protein 2.05

218

AFF3 AF4/FMR2 family, member 3 2.04 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 2.04 TBRG1 transforming growth factor beta regulator 1 2.04 HES6 hairy and enhancer of split 6 (Drosophila) 2.04 ZNF385B zinc finger protein 385B 2.03 KLK3 kallikrein-related peptidase 3 2.03 REPS2 RALBP1 associated Eps domain containing 2 2.02 DNM1L 1-like 2.01 ATP-binding cassette, sub-family C ABCC4 (CFTR/MRP), member 4 2.00

219

Appendix D

SUPPLEMENT 4

Table 4. Peak genomic sequences bound by AR in LP50 cells in the absence of hormone determined by ChIP-chip analysis.

chrom Peak Start Peak End PEAK_FDR chr20 29359299 29359748 0.00E+00 chr20 43612319 43612773 0.00E+00 chrX 49223250 49223699 0.00E+00 chrX 102398796 1.02E+08 0.00E+00 chr20 25938589 25938938 0.00E+00 chr9 69485513 69485763 0.00E+00 chr10 48546044 48546693 0.00E+00 chr14 18447393 18448245 0.00E+00 chr17 36210761 36211310 0.00E+00 chr16 22397345 22398101 0.00E+00 chr12 9739062 9739818 0.00E+00 chr22 20991235 20991993 0.00E+00 chr17 31660643 31660892 0.00E+00 chr16 31726925 31727186 0.00E+00 chr5 69835482 69835931 0.00E+00 chr17 40951904 40953553 0.00E+00 chr9 68507207 68507667 0.00E+00 chr1 146424511 1.46E+08 0.00E+00 chr2 113953569 1.14E+08 0.00E+00 chr7 22517456 22518205 0.00E+00 chr8 7263432 7265083 0.00E+00 chr8 12647823 12648272 0.00E+00 chr8 86888637 86889186 0.00E+00 chr9 125639 126297 0.00E+00 chr19 45885792 45887041 0.00E+00 chr1 147129191 1.47E+08 0.00E+00 chr1 246553843 2.47E+08 0.00E+00

220

chr8 86877147 86877509 0.00E+00 chr1 114971059 1.15E+08 0.00E+00 chr1 144004289 1.44E+08 0.00E+00 chr1 204288606 2.04E+08 0.00E+00 chr5 70105212 70105461 0.00E+00 chr16 18322612 18323661 0.00E+00 chr7 128840714 1.29E+08 0.00E+00 chr9 42659716 42659968 0.00E+00 chr4 8972251 8973700 0.00E+00 chr9 70088068 70088326 0.00E+00 chr1 246679856 2.47E+08 0.00E+00 chr2 97494194 97494954 0.00E+00 chr17 40947304 40949053 0.00E+00 chr7 151566872 1.52E+08 0.00E+00 chr8 102447757 1.02E+08 0.00E+00 chr9 68712575 68713835 0.00E+00 chr1 143326015 1.43E+08 0.00E+00 chr9 134884638 1.35E+08 0.00E+00 chr1 120622512 1.21E+08 0.00E+00 chr1 144540013 1.45E+08 0.00E+00 chr2 95620392 95621441 0.00E+00 chr7 143619105 1.44E+08 0.00E+00 chr2 91492389 91493544 0.00E+00 chr4 8941980 8944230 0.00E+00 chr8 7786108 7787657 0.00E+00 chr10 39029833 39030989 0.00E+00 chr7 103753039 1.04E+08 0.00E+00 chr10 1372266 1373215 0.00E+00 chr1 146061937 1.46E+08 0.00E+00 chr7 120825727 1.21E+08 9.23E-04 chr7 143588510 1.44E+08 9.23E-04 chr8 12219446 12220095 9.23E-04 chr1 143700465 1.44E+08 9.23E-04 chr1 147005827 1.47E+08 9.23E-04 chr1 246432992 2.46E+08 9.23E-04 chr2 97274809 97275372 1.32E-03 chr8 108274 108823 1.32E-03 chr8 12478485 12479045 1.32E-03 chr8 86901251 86901700 1.32E-03 chr1 108591046 1.09E+08 2.02E-03 chr5 34221687 34222136 2.36E-03 chr8 12034228 12034877 2.36E-03 chr4 8939333 8939886 2.51E-03 chr1 246409910 2.46E+08 2.51E-03 chr2 132098663 1.32E+08 2.60E-03 chr5 147668682 1.48E+08 2.60E-03 chr1 169421137 1.69E+08 2.60E-03 chr1 176207723 1.76E+08 2.60E-03 chr1 246375072 2.46E+08 2.60E-03 chr1 246468753 2.46E+08 2.60E-03

221

chr3 44890106 44890455 2.60E-03 chr7 143589838 1.44E+08 2.60E-03 chr7 73938592 73939349 3.19E-03 chrX 49199939 49200496 4.39E-03 chr13 31709497 31709846 4.39E-03 chr11 18150259 18150612 4.39E-03 chr11 110629616 1.11E+08 4.39E-03 chr14 19513521 19513973 4.39E-03 chr11 7906135 7906791 4.58E-03 chr11 57727579 57728130 4.58E-03 chr16 22432497 22433051 4.58E-03 chr16 29424103 29424559 4.58E-03 chr22 14829054 14829403 4.58E-03 chr7 143685265 1.44E+08 4.58E-03 chr1 13511461 13511718 5.01E-03 chr1 163683892 1.64E+08 5.01E-03 chr7 66401665 66401922 5.01E-03 chr7 120826427 1.21E+08 5.01E-03 chrX 49204139 49204588 5.26E-03 chrX 49184827 49185476 5.26E-03 chr16 30147401 30147750 5.26E-03 chr11 71244895 71245652 5.26E-03 chr22 15347380 15348434 5.26E-03 chr10 1373466 1373915 6.35E-03 chr2 95618492 95619541 6.35E-03 chr1 613147 613596 6.35E-03 chr1 91262168 91262817 6.35E-03 chr4 8948025 8948474 6.65E-03 chr8 11966018 11966674 6.65E-03 chr1 16791930 16792379 6.65E-03 chrX 49219050 49219710 7.52E-03 chr16 29407431 29407980 7.52E-03 chr1 156526039 1.57E+08 7.52E-03 chrX 49180827 49181487 8.77E-03 chr16 21759342 21760091 8.77E-03 chr16 16391452 16392601 8.77E-03 chr17 40949404 40950253 1.05E-02 chr7 74775564 74776413 1.08E-02 chr7 157048466 1.57E+08 1.08E-02 chr10 13257477 13257826 1.21E-02 chr8 107806377 1.08E+08 1.21E-02 chr1 11004829 11005278 1.21E-02 chr1 16791030 16791779 1.21E-02 chr1 23986732 23987185 1.21E-02 chr1 103915049 1.04E+08 1.21E-02 chr1 104093863 1.04E+08 1.21E-02 chr1 245736740 2.46E+08 1.21E-02 chr16 30145401 30146150 1.32E-02 chr19 24744 25493 1.32E-02 chr2 95977559 95978017 1.32E-02

222

chr1 156702382 1.57E+08 1.32E-02 chrY 18504043 18504394 1.37E-02 chrX 49238146 49238806 1.37E-02 chr16 21788059 21788508 1.37E-02 chr16 21837528 21837886 1.37E-02 chr16 21841128 21841677 1.37E-02 chr17 42481457 42481906 1.37E-02 chr19 48977212 48977661 1.37E-02 chr1 21650570 21652026 1.39E-02 chr6 52776209 52777063 1.39E-02 chr1 108719382 1.09E+08 1.39E-02 chr1 144006164 1.44E+08 1.39E-02 chr1 146104321 1.46E+08 1.39E-02 chr1 156936316 1.57E+08 1.39E-02 chr7 74332995 74334144 1.39E-02 chr8 77926345 77927097 1.39E-02 chr9 97774169 97774726 1.39E-02 chr7 74747244 74748393 1.63E-02 chr8 7115850 7116899 1.63E-02 chr8 93144317 93145474 1.63E-02 chr11 6772940 6773489 1.64E-02 chrX 49194583 49195032 1.75E-02 chr17 23961615 23962864 1.75E-02 chrX 49100781 49101340 1.97E-02 chr15 83467185 83467534 1.97E-02 chr11 123685122 1.24E+08 1.97E-02 chr20 62359637 62360188 1.97E-02 chr16 33168622 33168971 1.97E-02 chr4 74495532 74495887 2.21E-02 chr4 77215386 77215736 2.21E-02 chr2 101871983 1.02E+08 2.21E-02 chr2 178194390 1.78E+08 2.21E-02 chr5 54640972 54641526 2.21E-02 chr6 29187646 29188297 2.21E-02 chr6 135806867 1.36E+08 2.21E-02 chr9 21179000 21179550 2.21E-02 chr9 70158134 70158491 2.21E-02 chr1 143565401 1.44E+08 2.21E-02 chr1 144768729 1.45E+08 2.21E-02 chr1 144807422 1.45E+08 2.21E-02 chr1 246871732 2.47E+08 2.21E-02 chr7 6009713 6010164 2.21E-02 chr8 7727864 7728320 2.21E-02 chr4 8935641 8936190 2.24E-02 chr2 113940031 1.14E+08 2.24E-02 chr1 111658583 1.12E+08 2.24E-02 chr1 146065537 1.46E+08 2.24E-02 chr1 146843740 1.47E+08 2.24E-02 chr1 204300365 2.04E+08 2.24E-02 chr8 7717896 7718455 2.24E-02

223

chr16 22449321 22449670 2.49E-02 chr16 46738432 46738681 2.49E-02 chr4 17494511 17495461 2.52E-02 chr5 85612617 85613574 2.52E-02 chr1 155376852 1.55E+08 2.52E-02 chr9 68504784 68504942 2.63E-02 chr9 68509309 68509669 2.63E-02 chr7 39795124 39795379 2.63E-02 chr7 102711258 1.03E+08 2.63E-02 chr1 104039134 1.04E+08 2.68E-02 chr1 147009927 1.47E+08 2.68E-02 chr7 143560701 1.44E+08 2.68E-02 chr11 123181617 1.23E+08 2.74E-02 chr15 40426992 40427441 2.92E-02 chr15 40651748 40652199 2.92E-02 chr10 45665977 45666332 2.92E-02 chr11 57738992 57739455 2.92E-02 chr11 123757899 1.24E+08 2.92E-02 chr16 21760542 21760891 2.92E-02 chr16 32171143 32171892 2.92E-02 chr16 69448704 69449453 2.92E-02 chr17 26385461 26385810 2.92E-02 chr19 42260376 42261025 2.92E-02 chr19 58208540 58209097 2.92E-02 chr20 43269387 43269744 2.92E-02 chr22 19864702 19865751 2.92E-02 chrX 49062563 49063222 2.94E-02 chr14 62638687 62639444 2.94E-02 chr17 40951004 40951859 2.94E-02 chr19 9220047 9221303 2.94E-02 chr19 44886785 44887634 2.94E-02 chr4 8961860 8962809 3.01E-02 chr4 101066521 1.01E+08 3.01E-02 chr4 144576886 1.45E+08 3.01E-02 chr2 27970588 27971447 3.01E-02 chr2 100126219 1E+08 3.01E-02 chr2 227478709 2.27E+08 3.01E-02 chr5 177988286 1.78E+08 3.01E-02 chr1 6663234 6663983 3.01E-02 chr1 109201761 1.09E+08 3.01E-02 chr1 111655383 1.12E+08 3.01E-02 chr1 120736967 1.21E+08 3.01E-02 chr1 146055111 1.46E+08 3.01E-02 chr1 182929157 1.83E+08 3.01E-02 chr1 210072952 2.1E+08 3.01E-02 chr3 199088078 1.99E+08 3.01E-02 chr8 7154377 7155031 3.01E-02 chr9 2828168 2828923 3.01E-02 chr9 124032023 1.24E+08 3.01E-02 chr5 64529698 64529960 3.11E-02

224

chr9 69487313 69487566 3.11E-02 chr1 109893255 1.1E+08 3.11E-02 chr1 144323792 1.44E+08 3.11E-02 chr7 141265544 1.41E+08 3.11E-02 chrX 49096063 49096314 3.20E-02 chrX 49185727 49185976 3.20E-02 chrX 49204839 49205088 3.20E-02 chr17 31559077 31559326 3.20E-02 chr19 59453318 59453567 3.20E-02 chr19 59987204 59987655 3.20E-02 chr16 77749733 77749982 3.20E-02 chr11 18240348 18241394 3.32E-02 chr19 47191036 47191685 3.32E-02 chr2 91276639 91277199 3.53E-02 chr5 58332666 58333017 3.53E-02 chr6 160826202 1.61E+08 3.53E-02 chr9 38567954 38568506 3.53E-02 chr9 42688000 42688561 3.53E-02 chr9 43622480 43623039 3.53E-02 chr9 118201586 1.18E+08 3.53E-02 chr9 124522889 1.25E+08 3.53E-02 chr1 32157131 32157780 3.53E-02 chr1 92312857 92313416 3.53E-02 chr1 108587946 1.09E+08 3.53E-02 chr1 145839259 1.46E+08 3.53E-02 chr1 146703270 1.47E+08 3.53E-02 chr1 169506150 1.7E+08 3.53E-02 chr1 246701797 2.47E+08 3.53E-02 chr1 246882658 2.47E+08 3.53E-02 chr3 20028699 20029152 3.53E-02 chr7 18035235 18035593 3.53E-02 chr7 35189322 35189871 3.53E-02 chr7 104729112 1.05E+08 3.53E-02 chr8 39287866 39288515 3.53E-02 chr17 35035304 35036353 3.76E-02 chrX 47815183 47815432 3.78E-02 chrX 49067463 49067714 3.78E-02 chrX 49242346 49242795 3.78E-02 chr13 81162461 81162710 3.78E-02 chr11 48467320 48467569 3.78E-02 chr18 42805946 42806295 3.91E-02 chr14 19414366 19414815 3.91E-02 chr14 106155795 1.06E+08 3.91E-02 chr11 123771707 1.24E+08 3.91E-02 chr17 16038002 16038961 3.91E-02 chr17 40954604 40954953 3.91E-02 chr17 42480657 42481306 3.91E-02 chr19 53560368 53560717 3.91E-02 chr19 53941478 53942027 3.91E-02 chr19 57748221 57748779 3.91E-02

225

chr19 58462480 58462829 3.91E-02 chr16 21324891 21325544 3.91E-02 chr16 29405431 29405880 3.91E-02 chr22 40420292 40420741 3.91E-02 chr12 30742168 30742922 3.92E-02 chr11 61713363 61713913 3.92E-02 chr15 26673152 26673901 3.92E-02 chr16 22450921 22451678 3.92E-02 chr17 25982169 25982818 3.92E-02 chr19 61608029 61608678 3.92E-02 chr22 37522327 37522876 3.92E-02 chr12 11105410 11106274 4.17E-02 chr9 106306364 1.06E+08 4.19E-02 chr1 152445483 1.52E+08 4.19E-02 chr3 130890722 1.31E+08 4.19E-02 chr7 25235180 25235834 4.19E-02 chr7 143626105 1.44E+08 4.19E-02 chrX 49095563 49095812 4.21E-02 chr17 8303319 8303468 4.21E-02 chr11 66822822 66823871 4.31E-02 chr2 27707906 27708856 4.43E-02 chr6 111604840 1.12E+08 4.43E-02 chr3 47927257 47928317 4.43E-02 chr3 99089330 99090484 4.43E-02 chr9 106338165 1.06E+08 4.43E-02 chr19 14088242 14089191 4.61E-02 chr2 84796395 84796653 4.80E-02 chr2 87829018 87829367 4.80E-02 chr3 187812062 1.88E+08 4.80E-02

226