DOCSLIB.ORG

RNA-Binding Protein Hnrnpll Regulates Mrna Splicing and Stability During B-Cell to Plasma-Cell Differentiation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
RNA-Binding Protein Hnrnpll Regulates Mrna Splicing and Stability During B-Cell to Plasma-Cell Differentiation RNA-binding protein hnRNPLL regulates mRNA splicing and stability during B-cell to plasma-cell differentiation Xing Changa,b, Bin Lic, and Anjana Raoa,b,d,e,1 Divisions of aSignaling and Gene Expression and cVaccine Discovery, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037; bSanford Consortium for Regenerative Medicine, La Jolla, CA 92037; and dDepartment of Pharmacology and eMoores Cancer Center, University of California at San Diego, La Jolla, CA 92093 Contributed by Anjana Rao, December 2, 2014 (sent for review July 20, 2014) Posttranscriptional regulation is a major mechanism to rewire the RBP-binding sites, thus validating the specificity of RBP binding transcriptomes during differentiation. Heterogeneous nuclear to coprecipitating RNAs and mapping RBP-binding sites on the RNA-binding protein LL (hnRNPLL) is specifically induced in terminally validated RNAs at close to single-nucleotide resolution (8). differentiated lymphocytes, including effector T cells and plasma Heterogeneous nuclear RNA-binding proteins (hnRNPs) is cells. To study the molecular functions of hnRNPLL at a genome- the term applied to a collection of unrelated nuclear RBPs. wide level, we identified hnRNPLL RNA targets and binding sites in hnRNPLL was identified through a targeted lentiviral shRNA plasma cells through integrated Photoactivatable-Ribonucleoside- screen for regulators of CD45RA to CD45RO switching during Enhanced Cross-Linking and Immunoprecipitation (PAR-CLIP) and memory T-cell development (9) and independently through RNA sequencing. hnRNPLL preferentially recognizes CA dinucleo- two separate screens performed by different groups for exclusion tide-containing sequences in introns and 3′ untranslated regions of CD45 exon 4 in a minigene context (10) and for altered CD44 (UTRs), promotes exon inclusion or exclusion in a context-dependent and CD45R expression on T cells in N-ethyl-N-nitrosourea manner, and stabilizes mRNA when associated with 3′ UTRs. During (ENU)-mutagenized mice (11). Mice with an ENU-induced differentiation of primary B cells to plasma cells, hnRNPLL medi- mutant allele of Hnrpll (which encodes hnRNPLL) showed defects ates a genome-wide switch of RNA processing, resulting in loss of in T-cell survival and homeostasis (11). hnRNPLL is up-regulated B-cell lymphoma 6 (Bcl6) expression and increased Ig production— during T-cell activation; it also is highly expressed in plasma cells, both hallmarks of plasma-cell maturation. Our data identify pre- where it regulates the switching between membrane and secreted viously unknown functions of hnRNPLL in B-cell to plasma-cell differ- Ig in a plasma cell line (12). However, the role of hnRNPLL entiation and demonstrate that the RNA-binding protein hnRNPLL during primary plasma cell differentiation is not known. More- has a critical role in tuning transcriptomes of terminally differen- over, although exon arrays comparing wild-type and hnRNPLL- tiating B lymphocytes. deficient T cells have provided a global view of hnRNPLL- mediated alternative splicing events in T cells (9, 11), such RNA binding proteins | plasma cells | alternative splicing | PAR-CLIP | approaches are typically unable to discriminate direct and indirect hnRNP effects, because splicing factors are well known to regulate the processing of mRNAs encoding other splicing factors (13, 14). n response to pathogen challenge, lymphocytes undergo acti- Whether hnRNPLL is involved in RNA processing beyond in- Ivation and differentiation into effector cells to exert their ducing exon exclusion also remains to be determined. In this study, physiological functions. This process is accompanied by dramatic therefore, we generated a transcriptome-wide map of the direct changes in cellular transcriptomes and proteomes. Although sites of interaction of hnRNPLL with RNA, so as to increase our many of these changes occur through alterations in gene tran- understanding of the roles of hnRNPLL in RNA alternative pro- scription, posttranscriptional regulation of mRNA expression is cessing during lymphocyte differentiation. also a major mechanism for rewiring the transcriptome and in- creasing proteome diversity during cell differentiation (1). Post- Significance transcriptional regulation is mediated through diverse mechanisms of mRNA processing, including alternative splicing of pre-mRNA, Plasma cells produce immunoglobulin and provide long-lasting 3′ UTR regulation, and translational control—all typically medi- protective immunity. Differentiation of B cells to plasma cells is ated through interactions between RNA-binding proteins (RBPs) accompanied by major changes in gene expression, which are and their target sequences on RNA (2). The accurate mapping of regulated at both transcriptional and posttranscriptional levels. RBP-binding sites on mRNA is critical for elucidating the func- We have used genome-wide methods to identify the binding tions of RBPs and the mechanisms by which they regulate pre- sites and RNA targets of heterogeneous nuclear RNA-binding mRNA processing. protein LL (hnRNPLL), whose expression is up-regulated during The emergence of genome-wide approaches has greatly facili- B-cell to plasma-cell differentiation. In addition to its recog- tated our ability to map RBP-binding sites on RNA and explore nized function in promoting exon splicing, hnRNPLL shapes the mechanisms regulating mRNA alternative processing. RNA– the transcriptome of plasma cells by regulating exon inclusion protein interactions have been explored through RNA cross- and promoting mRNA stability. hnRNPLL binds to preferred linking and immunoprecipitation (RNA-CLIP), a method that sequences in RNA and is critical for complete plasma-cell differ- uses UV irradiation to cross-link RNA to its binding proteins, entiation, by mediating the down-regulation of B-cell–specific followed by immunoprecipitation of selected RBPs and next- transcription factors and maximizing immunoglobulin production. generation sequencing to identify RNAs bound to those RBPs at – Author contributions: X.C. and A.R. designed research; X.C. performed research; X.C., B.L., a genome-/transcriptome-wide level (3 7). A recent improvement and A.R. analyzed data; and X.C. and A.R. wrote the paper. known as PAR-CLIP (Photoactivatable-Ribonucleoside-Enhanced The authors declare no conflict of interest. Cross-Linking and Immunoprecipitation) uses a photoactive ribo- Data deposition: The sequence reported in this paper has been deposited in the Sequence nucleotide analog to increase the efficiency of RNA/protein cross- Read Archive (SRA) database (accession no. SRP056204). linking (8). A further advantage of PAR-CLIP is that the poly- 1To whom correspondence should be addressed. Email: [email protected]. merases used to reverse-transcribe the cross-linked RNAs tend to This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. introduce specific T-to-C mutations within or in the near vicinity of 1073/pnas.1422490112/-/DCSupplemental. E1888–E1897 | PNAS | Published online March 30, 2015 www.pnas.org/cgi/doi/10.1073/pnas.1422490112 Downloaded by guest on September 26, 2021 Plasma cells are terminally differentiated B lymphocytes that AB PNAS PLUS lose their B-cell characteristics and acquire the capacity to pro- IP:hnRNPLL mm9 kDa Chr 2: 102,690,890 102,690,870 duce large quantities of antibodies. Plasma cells are the major RNA Protein TGTACTATACCTCACTTACCTACTTTTGG 150 C C source of antibodies for humoral immunity. The differentiation C C C C of plasma cells from B cells requires an extensive reorganization 100 C C C C C C C of transcriptional programs, a process mainly mediated by two C reads P C C C C antagonistic transcription factors, B-cell lymphoma 6 (Bcl6) and C 75 C C hnRNPLL – C B-lymphocyte induced maturation protein 1 (Blimp1) (15). C C C C PAR- CLI PAR- During plasma-cell differentiation, the differentiating B cells C C acquire plasma-cell–specific transcription factors, such as Blimp1 50 & and X-box–binding protein 1 (Xbp1), and terminate the ex- pression of B-cell–specific transcription factors, including Bcl6 CDCommon Pathways hnRNPLL binding genes and Pax5 (16). Plasma-cell differentiation is also accompanied by Pre mRNA splicing 4609 6317 alteration of mRNA alternative processing: The mRNA encod- (exp 2) RNA processing (exp1) Mitotic M-M/G1 phase ing the transmembrane phosphatase CD45 undergoes alternative 3997 splicing to exclude exons 4–6, thus switching the CD45 protein (63%) DNA replication from its highest-molecular-weight isoform, CD45RABC (also Metabolism of RNA 0 100 200 300 400 knownasB220inBcells),tothelowest-molecular-weight isoform, -Log10(Binomial p Value) CD45RO (17, 18). However, the role of posttranscriptional regu- lation in plasma-cell differentiation is less well characterized than Fig. 1. PAR-CLIP identifies hnRNPLL-associated RNAs in MPC11 cells. (A) Iso- the analogous process in T cells (1, 6, 9–11, 19). lation of hnRNPLL/RNA complex by immunoprecipitation. (A) hnRNPLL was immunoprecipitated from MPC11 cells, and the immunoprecipitated proteins In the B-cell lineage, hnRNPLL is minimally expressed at the were resolved on SDS/PAGE and stained with SYBR-Green II to visualize cross- naïve B-cell stage, but is up-regulated significantly after B-cell linked RNA (Left) or immunoblotted with the anti-hnRNPLL antibody (Right). differentiation into plasma cells (12). In this study, we have The double arrow indicates the band corresponding to the canonical isoform carried out PAR-CLIP analysis of hnRNPLL in
Load more

Recommended publications
  • TGF-Β1 Signaling Targets Metastasis-Associated Protein 1, a New Effector in Epithelial Cells
    Oncogene (2011) 30, 2230–2241 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE TGF-b1 signaling targets metastasis-associated protein 1, a new effector in epithelial cells SB Pakala1, K Singh1,3, SDN Reddy1, K Ohshiro1, D-Q Li1, L Mishra2 and R Kumar1 1Department of Biochemistry and Molecular Biology and Institute of Coregulator Biology, The George Washington University Medical Center, Washington, DC, USA and 2Department of Gastroenterology, Hepatology and Nutrition, The University of Texas MD Anderson Cancer Center, Houston, TX, USA In spite of a large number of transforming growth factor b1 gene chromatin in response to upstream signals. The (TGF-b1)-regulated genes, the nature of its targets with TGF-b1-signaling is largely mediated by Smad proteins roles in transformation continues to be poorly understood. (Massague et al., 2005) where Smad2 and Smad3 are Here, we discovered that TGF-b1 stimulates transcription phosphorylated by TGF-b1-receptors and associate with of metastasis-associated protein 1 (MTA1), a dual master the common mediator Smad4, which translocates to the coregulator, in epithelial cells, and that MTA1 status is a nucleus to participate in the expression of TGF-b1-target determinant of TGF-b1-induced epithelial-to-mesenchymal genes (Deckers et al., 2006). Previous studies have shown transition (EMT) phenotypes. In addition, we found that that CUTL1, also known as CDP (CCAAT displacement MTA1/polymerase II/activator protein-1 (AP-1) co-activator protein), a target of TGF-b1, is needed for its short-term complex interacts with the FosB-gene chromatin and stimu- effects of TGF-b1 on cell motility involving Smad4- lates its transcription, and FosB in turn, utilizes FosB/histone dependent pathway (Michl et al.,2005).
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • Cross-Family Dimerization of Transcription Factors Fos/Jun
    Proc. Nati. Acad. Sci. USA Vol. 88, pp. 3720-3724, May 9, 1991 Biochemistry Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity (gene regulation/oncogenes/leucine zipper/protein dimerization/transcription) TSONWIN HAI*t AND ToM CURRANt of Medical Biochemistry and Ohio State Biotechnology Center, Ohio State University, 1060 Carmack Road, Columbus, OH 43210; and tDepartment*Department of Molecular Oncology and Virology, Roche Institute of Molecular Biology, Roche Research Center, Nutley, NJ 07110 Communicated by Herbert Weissbach, January 31, 1991 ABSTRACT The Fos/Jun and ATF/CREB families of Table 1. Mammalian Fos/Jun and ATF/CREB families transcription factors function in coupling extracellular signals Family Subfamily Gene(s) to alterations in expression of specific target genes. Like many eukaryotic transcription factors, these proteins bind to DNA as Fos/Jun Fos fos, fra-), fra-2, fosB dimers. Dimerization is mediated by a structure known as the Jun c-jun, junB, junD "leucine-zipper" motif. Although Fos/Jun and ATF/CREB ATF/CREB CREB CREB, ATF-I were previously thought to interact preferentially with differ- CRE-BP1 CRE-BPI, ATF-a ent DNA regulatory elements (the AP-1/TRE and ATF/CRE ATF-3 ATF-3* sites, respectively), we rind that members of these two families ATF-4 ATF4* form selective cross-family heterodimers. The resulting het- Alternative names for CRE-BPI are ATF-2 and HB16. ACREB is erodimers display distinguishable DNA binding speclfcities a spliced variant ofCREB, ATF-aA is a spliced variant ofATF-a, and from each other and from their parental homodimers.
    [Show full text]
  • Detection of Enhancer-Associated Rearrangements Reveals Mechanisms of Oncogene Dysregulation in B-Cell Lymphoma
    Published OnlineFirst July 30, 2015; DOI: 10.1158/2159-8290.CD-15-0370 ReseaRch aRticle Detection of Enhancer-Associated Rearrangements Reveals Mechanisms of Oncogene Dysregulation in B-cell Lymphoma Russell J.H. Ryan1,2, Yotam Drier1,2, Holly Whitton2, M. Joel Cotton1,2, Jasleen Kaur1,2, Robbyn Issner2, Shawn Gillespie1,2, Charles B. Epstein2, Valentina Nardi1, Aliyah R. Sohani1, Ephraim P. Hochberg3, and Bradley E. Bernstein1,2 abstRact B-cell lymphomas frequently contain genomic rearrangements that lead to onco- gene activation by heterologous distal regulatory elements. We used a novel approach called “pinpointing enhancer-associated rearrangements by chromatin immunoprecipitation,” or PEAR- ChIP, to simultaneously map enhancer activity and proximal rearrangements in lymphoma cell lines and patient biopsies. This method detects rearrangements involving known cancer genes, including CCND1, BCL2, MYC, PDCD1LG2, NOTCH1, CIITA, and SGK1, as well as novel enhancer duplication events of likely oncogenic significance. We identify lymphoma subtype–specific enhancers in the MYC locus that are silenced in lymphomas with MYC-activating rearrangements and are associated with germline polymorphisms that alter lymphoma risk. We show that BCL6-locus enhancers are acetylated by the BCL6-activating transcription factor MEF2B, and can undergo genomic duplication, or target the MYC promoter for activation in the context of a “pseudo-double-hit” t(3;8)(q27;q24) rearrangement linking the BCL6 and MYC loci. Our work provides novel insights regarding enhancer-driven oncogene activa- tion in lymphoma. SIGNIFICANCE: We demonstrate a novel approach for simultaneous detection of genomic rearrange- ments and enhancer activity in tumor biopsies. We identify novel mechanisms of enhancer-driven regu- lation of the oncogenes MYC and BCL6, and show that the BCL6 locus can serve as an enhancer donor in an “enhancer hijacking” translocation.
    [Show full text]
  • Neurobiological Functions of the Period Circadian Clock 2 Gene, Per2
    Review Biomol Ther 26(4), 358-367 (2018) Neurobiological Functions of the Period Circadian Clock 2 Gene, Per2 Mikyung Kim, June Bryan de la Peña, Jae Hoon Cheong and Hee Jin Kim* Department of Pharmacy, Uimyung Research Institute for Neuroscience, Sahmyook University, Seoul 01795, Republic of Korea Abstract Most organisms have adapted to a circadian rhythm that follows a roughly 24-hour cycle, which is modulated by both internal (clock-related genes) and external (environment) factors. In such organisms, the central nervous system (CNS) is influenced by the circadian rhythm of individual cells. Furthermore, the period circadian clock 2 (Per2) gene is an important component of the circadian clock, which modulates the circadian rhythm. Per2 is mainly expressed in the suprachiasmatic nucleus (SCN) of the hypothalamus as well as other brain areas, including the midbrain and forebrain. This indicates that Per2 may affect various neurobiological activities such as sleeping, depression, and addiction. In this review, we focus on the neurobiological functions of Per2, which could help to better understand its roles in the CNS. Key Words: Circadian rhythm, Per2 gene, Sleep, Depression, Addiction, Neurotransmitter INTRODUCTION and lives in organisms because it can impart effects from the level of cells to organs including the brain. Thus, it is neces- A circadian rhythm is any physiological process that displays sary to understand clock-related genes that are controlling the a roughly 24 hour cycle in living beings, such as mammals, circadian rhythm endogenously. plants, fungi and cyanobacteria (Albrecht, 2012). In organ- The Period2 (Per2) gene is a member of the Period family isms, most biological functions such as sleeping and feeding of genes consisting of Per1, Per2, and Per3, and is mainly patterns are adapted to the circadian rhythm.
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • Fosb Induction in Nucleus Accumbens by Cocaine Is Regulated by E2f3a
    New Research Disorders of the Nervous System Fosb Induction in Nucleus Accumbens by Cocaine Is Regulated by E2F3a Hannah M. Cates,1 Casey K. Lardner,1 Rosemary C. Bagot,1 Rachael L. Neve,2 and Eric J. Nestler1 https://doi.org/10.1523/ENEURO.0325-18.2019 1Nash Family Department of Neuroscience and Friedman Brain Institute, Icahn School of Medicine at Mount Sinai, New York, New York 10029 and 2Gene Delivery Technology Core, Massachusetts General Hospital, Cambridge, Massachusetts 02139 Abstract The transcription factor ⌬FosB has been proposed as a molecular switch for the transition from casual, volitional drug use into a chronically addicted state, but the upstream regulatory mechanisms governing ⌬FosB expression are incompletely understood. In this study, we find a novel regulatory role for the transcription factor E2F3, recently implicated in transcriptional regulation by cocaine, in controlling ⌬FosB induction in the mouse nucleus accumbens (NAc) following cocaine administration. We find that an E2F consensus sequence 500 bp upstream of the Fosb transcription start site is enriched for E2F3 specifically over other E2F isoforms. We further conclude that ⌬FosB expression is regulated specifically by E2F3a, not E2F3b, that E2f3a expression is specific to D1 receptor-expressing medium spiny neurons, and that E2F3a overexpression in NAc recapitulates the induction of Fosb and ⌬Fosb mRNA expression observed after chronic cocaine exposure. E2F3a knockdown in NAc does not abolish ⌬Fosb induction by cocaine, a result consistent with previously published data showing that singular knockdown of upstream regulators of ⌬FosB is insufficient to block cocaine-induced expression. Finally, to elucidate potential combinatorial epigenetic mechanisms involved in E2F3a’s regulation of Fosb, we explore H3K4me3 enrichment at the Fosb promoter and find that it is not enhanced by E2F3a overexpression, suggesting that it may instead be a pre-existing permissive mark allowing for E2F3a to interact with Fosb.
    [Show full text]
  • BCL6 Repression of EP300 in Human Diffuse Large B Cell Lymphoma Cells Provides a Basis for Rational Combinatorial Therapy Leandro C
    Research article BCL6 repression of EP300 in human diffuse large B cell lymphoma cells provides a basis for rational combinatorial therapy Leandro C. Cerchietti,1,2 Katerina Hatzi,1,2 Eloisi Caldas-Lopes,3 Shao Ning Yang,1,2 Maria E. Figueroa,1,2 Ryan D. Morin,4 Martin Hirst,4 Lourdes Mendez,1 Rita Shaknovich,5 Philip A. Cole,6 Kapil Bhalla,7 Randy D. Gascoyne,8 Marco Marra,4 Gabriela Chiosis,3 and Ari Melnick1,2 1Hematology and Oncology Division, and 2Department of Pharmacology, Weill Cornell Medical College, New York, New York, USA. 3Department of Molecular Pharmacology and Chemistry, Sloan-Kettering Institute, New York, New York, USA. 4Genome Sciences Centre, British Columbia Cancer Agency, Vancouver, British Columbia, Canada. 5Department of Pathology, Weill Cornell Medical College, New York, New York, USA. 6Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA. 7The University of Kansas Cancer Center, Kansas University Medical Center, Kansas City, Kansas, USA. 8Centre for Lymphoid Cancers and the Departments of Pathology and Experimental Therapeutics, British Columbia Cancer Agency, British Columbia Cancer Research Centre, Vancouver, British Columbia, Canada. B cell lymphoma 6 (BCL6), which encodes a transcriptional repressor, is a critical oncogene in diffuse large B cell lymphomas (DLBCLs). Although a retro-inverted BCL6 peptide inhibitor (RI-BPI) was recently shown to potently kill DLBCL cells, the underlying mechanisms remain unclear. Here, we show that RI-BPI induces a particular gene expression signature in human DLBCL cell lines that included genes associated with the actions of histone deacetylase (HDAC) and Hsp90 inhibitors.
    [Show full text]
  • AP-1 in Cell Proliferation and Survival
    Oncogene (2001) 20, 2390 ± 2400 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc AP-1 in cell proliferation and survival Eitan Shaulian1 and Michael Karin*,1 1Laboratory of Gene Regulation and Signal Transduction, Department of Pharmacology, University of California San Diego, 9500 Gilman Drive, La Jolla, California, CA 92093-0636, USA A plethora of physiological and pathological stimuli extensively discussed previously (Angel and Karin, induce and activate a group of DNA binding proteins 1991; Karin, 1995). that form AP-1 dimers. These proteins include the Jun, The mammalian AP-1 proteins are homodimers and Fos and ATF subgroups of transcription factors. Recent heterodimers composed of basic region-leucine zipper studies using cells and mice de®cient in individual AP-1 (bZIP) proteins that belong to the Jun (c-Jun, JunB proteins have begun to shed light on their physiological and JunD), Fos (c-Fos, FosB, Fra-1 and Fra-2), Jun functions in the control of cell proliferation, neoplastic dimerization partners (JDP1 and JDP2) and the closely transformation and apoptosis. Above all such studies related activating transcription factors (ATF2, LRF1/ have identi®ed some of the target genes that mediate the ATF3 and B-ATF) subfamilies (reviewed by (Angel eects of AP-1 proteins on cell proliferation and death. and Karin, 1991; Aronheim et al., 1997; Karin et al., There is evidence that AP-1 proteins, mostly those that 1997; Liebermann et al., 1998; Wisdom, 1999). In belong to the Jun group, control cell life and death addition, some of the Maf proteins (v-Maf, c-Maf and through their ability to regulate the expression and Nrl) can heterodimerize with c-Jun or c-Fos (Nishiza- function of cell cycle regulators such as Cyclin D1, p53, wa et al., 1989; Swaroop et al., 1992), whereas other p21cip1/waf1, p19ARF and p16.
    [Show full text]
  • Supplementary Table 5. Clover Results Indicate the Number Of
    Supplementary Table 5. Clover results indicate the number of chromosomes with transcription factor binding motifs statistically over‐ or under‐represented in HTE DHS within intergenic sequence (more than 2kb outside of any gene). Analysis was divided into three groups (all DHS, HTE‐selective DHS, and ubiquitous DHS). Motifs with more than one entry in the databases utilized were edited to retain only the first occurrence of the motif. All DHS x Intergenic TE­selective DHS x Intergenic Ubiquitous DHS x Intergenic ID Name p < 0.01 p > 0.99 ID Name p < 0.01 p > 0.99 ID Name p < 0.01 p > 0.99 MA0002.2 RUNX1 23 0 MA0080.2 SPI1 23 0 MA0055.1 Myf 23 0 MA0003.1 TFAP2A 23 0 MA0089.1 NFE2L1::MafG 23 0 MA0068.1 Pax4 23 0 MA0039.2 Klf4 23 0 MA0098.1 ETS1 23 0 MA0080.2 SPI1 23 0 MA0055.1 Myf 23 0 MA0099.2 AP1 23 0 MA0098.1 ETS1 23 0 MA0056.1 MZF1_1‐4 23 0 MA0136.1 ELF5 23 0 MA0139.1 CTCF 23 0 MA0079.2 SP1 23 0 MA0145.1 Tcfcp2l1 23 0 V$ALX3_01 ALX‐3 23 0 MA0080.2 SPI1 23 0 MA0150.1 NFE2L2 23 0 V$ALX4_02 Alx‐4 23 0 myocyte enhancer MA0081.1 SPIB 23 0 MA0156.1 FEV 23 0 V$AMEF2_Q6 factor 23 0 MA0089.1 NFE2L1::MafG 23 0 V$AP1FJ_Q2 activator protein 1 23 0 V$AP1_01 AP‐1 23 0 MA0090.1 TEAD1 23 0 V$AP4_Q5 activator protein 4 23 0 V$AP2_Q6_01 AP‐2 23 0 MA0098.1 ETS1 23 0 V$AR_Q6 half‐site matrix 23 0 V$ARX_01 Arx 23 0 BTB and CNC homolog MA0099.2 AP1 23 0 V$BACH1_01 1 23 0 V$BARHL1_01 Barhl‐1 23 0 BTB and CNC homolog MA0136.1 ELF5 23 0 V$BACH2_01 2 23 0 V$BARHL2_01 Barhl2 23 0 MA0139.1 CTCF 23 0 V$CMAF_02 C‐MAF 23 0 V$BARX1_01 Barx1 23 0 MA0144.1 Stat3 23 0
    [Show full text]
  • Coexpression and Relative Abundance Defined by B Cell
    Stages of Germinal Center Transit Are Defined by B Cell Transcription Factor Coexpression and Relative Abundance This information is current as Giorgio Cattoretti, Rita Shaknovich, Paula M. Smith, of September 27, 2021. Hans-Martin Jäck, Vundavalli V. Murty and Bachir Alobeid J Immunol 2006; 177:6930-6939; ; doi: 10.4049/jimmunol.177.10.6930 http://www.jimmunol.org/content/177/10/6930 Downloaded from References This article cites 63 articles, 28 of which you can access for free at: http://www.jimmunol.org/content/177/10/6930.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Stages of Germinal Center Transit Are Defined by B Cell Transcription Factor Coexpression and Relative Abundance Giorgio Cattoretti,1*† Rita Shaknovich,‡ Paula M. Smith,† Hans-Martin Ja¨ck,§ Vundavalli V. Murty,*† and Bachir Alobeid* The transit of T cell-activated B cells through the germinal center (GC) is controlled by sequential activation and repression of key transcription factors, executing the pre- and post-GC B cell program.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]