RNA-binding protein hnRNPLL regulates mRNA splicing and stability during B-cell to plasma-cell differentiation Xing Changa,b, Bin Lic, and Anjana Raoa,b,d,e,1 Divisions of aSignaling and Gene Expression and cVaccine Discovery, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037; bSanford Consortium for Regenerative Medicine, La Jolla, CA 92037; and dDepartment of Pharmacology and eMoores Cancer Center, University of California at San Diego, La Jolla, CA 92093 Contributed by Anjana Rao, December 2, 2014 (sent for review July 20, 2014) Posttranscriptional regulation is a major mechanism to rewire the RBP-binding sites, thus validating the specificity of RBP binding transcriptomes during differentiation. Heterogeneous nuclear to coprecipitating RNAs and mapping RBP-binding sites on the RNA-binding protein LL (hnRNPLL) is specifically induced in terminally validated RNAs at close to single-nucleotide resolution (8). differentiated lymphocytes, including effector T cells and plasma Heterogeneous nuclear RNA-binding proteins (hnRNPs) is cells. To study the molecular functions of hnRNPLL at a genome- the term applied to a collection of unrelated nuclear RBPs. wide level, we identified hnRNPLL RNA targets and binding sites in hnRNPLL was identified through a targeted lentiviral shRNA plasma cells through integrated Photoactivatable-Ribonucleoside- screen for regulators of CD45RA to CD45RO switching during Enhanced Cross-Linking and Immunoprecipitation (PAR-CLIP) and memory T-cell development (9) and independently through RNA sequencing. hnRNPLL preferentially recognizes CA dinucleo- two separate screens performed by different groups for exclusion tide-containing sequences in introns and 3′ untranslated regions of CD45 exon 4 in a minigene context (10) and for altered CD44 (UTRs), promotes exon inclusion or exclusion in a context-dependent and CD45R expression on T cells in N-ethyl-N-nitrosourea manner, and stabilizes mRNA when associated with 3′ UTRs. During (ENU)-mutagenized mice (11). Mice with an ENU-induced differentiation of primary B cells to plasma cells, hnRNPLL medi- mutant allele of Hnrpll (which encodes hnRNPLL) showed defects ates a genome-wide switch of RNA processing, resulting in loss of in T-cell survival and homeostasis (11). hnRNPLL is up-regulated B-cell lymphoma 6 (Bcl6) expression and increased Ig production— during T-cell activation; it also is highly expressed in plasma cells, both hallmarks of plasma-cell maturation. Our data identify pre- where it regulates the switching between membrane and secreted viously unknown functions of hnRNPLL in B-cell to plasma-cell differ- Ig in a plasma cell line (12). However, the role of hnRNPLL entiation and demonstrate that the RNA-binding protein hnRNPLL during primary plasma cell differentiation is not known. More- has a critical role in tuning transcriptomes of terminally differen- over, although exon arrays comparing wild-type and hnRNPLL- tiating B lymphocytes. deficient T cells have provided a global view of hnRNPLL- mediated alternative splicing events in T cells (9, 11), such RNA binding proteins | plasma cells | alternative splicing | PAR-CLIP | approaches are typically unable to discriminate direct and indirect hnRNP effects, because splicing factors are well known to regulate the processing of mRNAs encoding other splicing factors (13, 14). n response to pathogen challenge, lymphocytes undergo acti- Whether hnRNPLL is involved in RNA processing beyond in- Ivation and differentiation into effector cells to exert their ducing exon exclusion also remains to be determined. In this study, physiological functions. This process is accompanied by dramatic therefore, we generated a transcriptome-wide map of the direct changes in cellular transcriptomes and proteomes. Although sites of interaction of hnRNPLL with RNA, so as to increase our many of these changes occur through alterations in gene tran- understanding of the roles of hnRNPLL in RNA alternative pro- scription, posttranscriptional regulation of mRNA expression is cessing during lymphocyte differentiation. also a major mechanism for rewiring the transcriptome and in- creasing proteome diversity during cell differentiation (1). Post- Significance transcriptional regulation is mediated through diverse mechanisms of mRNA processing, including alternative splicing of pre-mRNA, Plasma cells produce immunoglobulin and provide long-lasting 3′ UTR regulation, and translational control—all typically medi- protective immunity. Differentiation of B cells to plasma cells is ated through interactions between RNA-binding proteins (RBPs) accompanied by major changes in gene expression, which are and their target sequences on RNA (2). The accurate mapping of regulated at both transcriptional and posttranscriptional levels. RBP-binding sites on mRNA is critical for elucidating the func- We have used genome-wide methods to identify the binding tions of RBPs and the mechanisms by which they regulate pre- sites and RNA targets of heterogeneous nuclear RNA-binding mRNA processing. protein LL (hnRNPLL), whose expression is up-regulated during The emergence of genome-wide approaches has greatly facili- B-cell to plasma-cell differentiation. In addition to its recog- tated our ability to map RBP-binding sites on RNA and explore nized function in promoting exon splicing, hnRNPLL shapes the mechanisms regulating mRNA alternative processing. RNA– the transcriptome of plasma cells by regulating exon inclusion protein interactions have been explored through RNA cross- and promoting mRNA stability. hnRNPLL binds to preferred linking and immunoprecipitation (RNA-CLIP), a method that sequences in RNA and is critical for complete plasma-cell differ- uses UV irradiation to cross-link RNA to its binding proteins, entiation, by mediating the down-regulation of B-cell–specific followed by immunoprecipitation of selected RBPs and next- transcription factors and maximizing immunoglobulin production. generation sequencing to identify RNAs bound to those RBPs at – Author contributions: X.C. and A.R. designed research; X.C. performed research; X.C., B.L., a genome-/transcriptome-wide level (3 7). A recent improvement and A.R. analyzed data; and X.C. and A.R. wrote the paper. known as PAR-CLIP (Photoactivatable-Ribonucleoside-Enhanced The authors declare no conflict of interest. Cross-Linking and Immunoprecipitation) uses a photoactive ribo- Data deposition: The sequence reported in this paper has been deposited in the Sequence nucleotide analog to increase the efficiency of RNA/protein cross- Read Archive (SRA) database (accession no. SRP056204). linking (8). A further advantage of PAR-CLIP is that the poly- 1To whom correspondence should be addressed. Email: [email protected]. merases used to reverse-transcribe the cross-linked RNAs tend to This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. introduce specific T-to-C mutations within or in the near vicinity of 1073/pnas.1422490112/-/DCSupplemental. E1888–E1897 | PNAS | Published online March 30, 2015 www.pnas.org/cgi/doi/10.1073/pnas.1422490112 Downloaded by guest on September 26, 2021 Plasma cells are terminally differentiated B lymphocytes that AB PNAS PLUS lose their B-cell characteristics and acquire the capacity to pro- IP:hnRNPLL mm9 kDa Chr 2: 102,690,890 102,690,870 duce large quantities of antibodies. Plasma cells are the major RNA Protein TGTACTATACCTCACTTACCTACTTTTGG 150 C C source of antibodies for humoral immunity. The differentiation C C C C of plasma cells from B cells requires an extensive reorganization 100 C C C C C C C of transcriptional programs, a process mainly mediated by two C reads P C C C C antagonistic transcription factors, B-cell lymphoma 6 (Bcl6) and C 75 C C hnRNPLL – C B-lymphocyte induced maturation protein 1 (Blimp1) (15). C C C C PAR- CLI PAR- During plasma-cell differentiation, the differentiating B cells C C acquire plasma-cell–specific transcription factors, such as Blimp1 50 & and X-box–binding protein 1 (Xbp1), and terminate the ex- pression of B-cell–specific transcription factors, including Bcl6 CDCommon Pathways hnRNPLL binding genes and Pax5 (16). Plasma-cell differentiation is also accompanied by Pre mRNA splicing 4609 6317 alteration of mRNA alternative processing: The mRNA encod- (exp 2) RNA processing (exp1) Mitotic M-M/G1 phase ing the transmembrane phosphatase CD45 undergoes alternative 3997 splicing to exclude exons 4–6, thus switching the CD45 protein (63%) DNA replication from its highest-molecular-weight isoform, CD45RABC (also Metabolism of RNA 0 100 200 300 400 knownasB220inBcells),tothelowest-molecular-weight isoform, -Log10(Binomial p Value) CD45RO (17, 18). However, the role of posttranscriptional regu- lation in plasma-cell differentiation is less well characterized than Fig. 1. PAR-CLIP identifies hnRNPLL-associated RNAs in MPC11 cells. (A) Iso- the analogous process in T cells (1, 6, 9–11, 19). lation of hnRNPLL/RNA complex by immunoprecipitation. (A) hnRNPLL was immunoprecipitated from MPC11 cells, and the immunoprecipitated proteins In the B-cell lineage, hnRNPLL is minimally expressed at the were resolved on SDS/PAGE and stained with SYBR-Green II to visualize cross- naïve B-cell stage, but is up-regulated significantly after B-cell linked RNA (Left) or immunoblotted with the anti-hnRNPLL antibody (Right). differentiation into plasma cells (12). In this study, we have The double arrow indicates the band corresponding to the canonical isoform carried out PAR-CLIP analysis of hnRNPLL in