DOCSLIB.ORG

Supplemental Solier

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Solier Supplementary Figure 1. Importance of Exon numbers for transcript downregulation by CPT Numbers of down-regulated genes for four groups of comparable size genes, differing only by the number of exons. Supplementary Figure 2. CPT up-regulates the p53 signaling pathway genes A, List of the GO categories for the up-regulated genes in CPT-treated HCT116 cells (p<0.05). In bold: GO category also present for the genes that are up-regulated in CPT- treated MCF7 cells. B, List of the up-regulated genes in both CPT-treated HCT116 cells and CPT-treated MCF7 cells (CPT 4 h). C, RT-PCR showing the effect of CPT on JUN and H2AFJ transcripts. Control cells were exposed to DMSO. β2 microglobulin (β2) mRNA was used as control. Supplementary Figure 3. Down-regulation of RNA degradation-related genes after CPT treatment A, “RNA degradation” pathway from KEGG. The genes with “red stars” were down- regulated genes after CPT treatment. B, Affy Exon array data for the “CNOT” genes. The log2 difference for the “CNOT” genes expression depending on CPT treatment was normalized to the untreated controls. C, RT-PCR showing the effect of CPT on “CNOT” genes down-regulation. HCT116 cells were treated with CPT (10 µM, 20 h) and CNOT6L, CNOT2, CNOT4 and CNOT6 mRNA were analysed by RT-PCR. Control cells were exposed to DMSO. β2 microglobulin (β2) mRNA was used as control. D, CNOT6L down-regulation after CPT treatment. CNOT6L transcript was analysed by Q- PCR. Supplementary Figure 4. Down-regulation of ubiquitin-related genes after CPT treatment A, “Ubiquitin-mediated proteolysis” pathway from KEGG. The genes with “red stars” were down-regulated genes after CPT treatment. B, Affy Exon array data for ubiquitin- related genes. The log2 difference for the “ubiquitin” genes expression depending on CPT treatment normalized to the untreated controls. C, RT-PCR showing the effect of CPT on ubiquitin-related genes down-regulation. CUL1, CUL3, CUL5 and UBE2W mRNA were analysed by RT-PCR. Control cells were exposed to DMSO. β2 microglobulin (β2) mRNA was used as control. D, CUL1 down-regulation after CPT treatment. CUL1 transcript was analysed by Q-PCR. Supplementary Figure 5. Top1 down-regulation does not impacts gene expression for CUL5 and UBE2W HCT116 cells were transfected with negative control siRNA or siRNA against Top1. A, Western blotting showing the efficiency of Top1 down-regulation by siRNA. Top1 was analysed by Western blotting. GAPDH was used as loading control. B, CUL5 and UBE2W mRNA were analysed by RT-PCR. β2 microglobulin (β2) mRNA was used as - Ct control. C, CUL5 and UBE2W mRNA were analysed by Q-RT-PCR (2 ΔΔ ± standard deviation). A 120 100 80 60 Viability (%) Viability 40 20 0 Negative Control siRNA hsa-miR-142-3p B control si BCL2L1 si-Qiagen BCL2L1si-Ambion ~25$fold) Viability (%) Viability CPT (Log M) C control si MAP3K7IP2 si-Qiagen MAP3K7IP2 si-Ambion Viability (%) Viability ~25$fold) CPT (Log M) Supplementary Figure 6. miR-142-3p decreases cell survival, and down-regulation of its target genes BCL2L1 and MAP3K7IP2 sensitize to CPT A, Overexpression of miR-142-3p decreases cell survival. MDA-MB-231 cells were transfected with hsa-miR-142-3p mimic or negative control siRNA. Viability assays were performed 5 days post-transfection. Y-axes represent cell viability (% of controls). B & C, Down-regulation of two target genes of miR-142-3p sensitizes to CPT. MDA-MB-231 cells were transfected with siRNAs against BCL2L1 (B) or MAP3K7IP2 (C), and full CPT concentration responses performed. X-axes indicate CPT concentration (Log M) and Y-axes represent cell viability (%). oligonucleotide name sequence (5' to 3') β2 s CTCACGTCATCCAGCAGAGA β2 as TCTTTTTCAGTGGGGGTGAA CNOT2 1680s AGCAGAGACAGACCCAGGAA CNOT2 1982as CGGTTAAAAAGCTCCACTGC CNOT4 1555s TCGAAAAGCCTTAGCAGACC CNOT4 1847as TGATGCTATTGCGTGGAAAG CNOT6 1374s CGTCTGGAAAGCCACATCTT CNOT6 1729as TCCATTGGTGGTTCCATTCT CNOT6L 8343s CATCCCTGGAGAAAGTGGTT CNOT6L 8727as AGGTGCAAGGAAACAAGCAT CUL1 1399s CAGCCATTGAAAAGTGTGGA CUL1 1880 as GTCTTGAAACATGCGCTGAA CUL3 1180s AGGGAACTCATTTCCAAGCA CUL3 1591as GCCCTTTGACTCCCTTTTTC CUL5 1840s GAAGGGGGTGGGATTAAAAA CUL5 2337as TCCGGTATCAAGTCCTCCAG H2AFJ 1943s GTGAATGAGGCCAACCAGAT H2AFJ 2432as TTGTTCCACTGACCCCAAGT JUN 768s AGTGAGTGACCGCGACTTTT JUN 1163as CAGGGTCATGCTCTGTTTCA UBE2W 173s CATGGAAGGTGCACCAGGTA UBE2W 428as TGGTCGTCTCTTTTCCTTGC Supplementary Table 1. List of primers gene name AADAC AADAT AARS AASDH AASDHPPT AASS AATF ABCA11P ABCA5 ABCB1 ABCB7 ABCC1 ABCC2 ABCC4 ABCC5 ABCD3 ABCE1 ABCF1 ABHD10 ABHD5 ABHD6 ABI1 ABI2 ABL1 ACAA2 ACACA ACAD11 ACAP2 ACAT2 ACBD6 ACER3 ACLY ACN9 ACOXL ACP6 ACPL2 ACSL1 ACSL3 ACSL4 ACTL6A ACTR10 ACTR3 ACTR3B ACTR8 ACVR1 ACVR2A ACVR2B ADAL ADAM10 ADAM17 ADAM19 ADAM22 ADAMTS14 ADAR ADCY3 ADD3 ADIPOR2 ADNP ADNP2 ADORA2B ADRBK2 ADSS AEBP2 AFAP1 AFF1 AFF4 AFG3L2 AFTPH AGAP1 AGFG1 AGGF1 AGK AGL AGPAT5 AGPAT9 AGPS AGTPBP1 AHCTF1 AHCYL2 AHI1 AHNAK AHR AHSA2 AIG1 AIM1 AK3L1 AKAP1 AKAP10 AKAP11 AKAP12 AKAP13 AKAP9 AKT3 AKTIP ALAS1 ALCAM ALDH3A2 ALG11 ALG13 ALG14 ALG6 ALKBH8 ALMS1 ALOX12P2 ALPK1 ALS2 ALS2CR4 AMD1 AMOTL1 ANAPC1 ANAPC10 ANAPC13 ANAPC4 ANGEL2 ANKFY1 ANKH ANKHD1 ANKIB1 ANKMY2 ANKRD12 ANKRD13C ANKRD17 ANKRD22 ANKRD26 ANKRD27 ANKRD28 ANKRD32 ANKRD36 ANKRD36B ANKRD50 ANKS1A ANLN ANO10 ANO5 ANO6 ANP32A ANP32B ANP32E ANTXR2 ANUBL1 ANXA10 AP1AR AP1G1 AP1S3 AP3B1 AP3M2 AP3S1 AP4E1 AP4S1 APAF1 APBB2 APC APH1B API5 APIP APOOL APPBP2 APPL1 APPL2 AQR ARAP2 ARCN1 AREG ARF6 ARFGEF1 ARFGEF2 ARFIP1 ARGLU1 ARHGAP10 ARHGAP11A ARHGAP12 ARHGAP18 ARHGAP19 ARHGAP21 ARHGAP24 ARHGAP26 ARHGAP29 ARHGAP5 ARHGEF10 ARHGEF11 ARHGEF12 ARHGEF2 ARHGEF3 ARHGEF5L ARHGEF7 ARID1A ARID1B ARID2 ARID4A ARID4B ARID5B ARIH1 ARL1 ARL13B ARL15 ARL4A ARL4C ARL5A ARL6 ARL8B ARMC1 ARMC10 ARMC4 ARMC8 ARMC9 ARNT ARNTL ARNTL2 ARRB1 ARRDC1 ARRDC3 ARSK ASAP1 ASAP2 ASCC1 ASCC3 ASF1A ASH1L ASH2L ASPM ASXL1 ASXL2 ATAD1 ATAD2 ATAD2B ATAD5 ATE1 ATF1 ATF2 ATF6 ATF7IP ATG10 ATG16L1 ATG3 ATG4A ATG4C ATG5 ATG7 ATL2 ATM ATP10D ATP11A ATP11B ATP11C ATP13A3 ATP1B1 ATP1B3 ATP2A2 ATP2B1 ATP2B4 ATP2C1 ATP6AP1L ATP6V0A2 ATP6V1A ATP6V1B2 ATP6V1C1 ATP6V1H ATP7A ATP8B1 ATP8B2 ATP9A ATPBD4 ATR ATRN ATRX ATXN2 ATXN3 ATXN7 AUH AURKA AVL9 AZI2 AZIN1 B3GALNT1 B3GALT1 B3GALTL B3GNT2 B3GNT5 B4GALT4 B4GALT5 BACH1 BAG2 BAG4 BAIAP2L1 BARD1 BAT2D1 BAT2L BAZ1A BAZ1B BAZ2B BBS10 BBS2 BBS7 BBS9 BBX BCAP29 BCAR3 BCAS2 BCAS3 BCKDHB BCL2L1 BCL9 BCLAF1 BCO2 BCOR BDNF BDP1 BEND3 BEND6 BICD1 BIRC2 BIRC6 BIVM BLID BLM BLVRA BLZF1 BMI1 BMP2K BMP4 BMPR1A BMPR2 BMS1 BNIP2 BNIP3L BOD1L BPTF BRAF BRAP BRCA1 BRCA2 BRCC3 BRD7 BRE BRI3BP BRIP1 BRIX1 BRP44 BRWD1 BRWD2 BRWD3 BTAF1 BTBD10 BTBD3 BTBD7 BTBD8 BTBD9 BTF3L4 BTN3A1 BTN3A2 BTRC BUB1 BUB1B BUB3 BZW2 C10orf118 C10orf119 C10orf12 C10orf18 C10orf28 C10orf4 C10orf46 C10orf76 C11orf30 C11orf49 C11orf54 C11orf60 C11orf73 C11orf74 C12orf11 C12orf23 C12orf27 C12orf30 C12orf35 C12orf4 C12orf48 C12orf51 C13orf23 C13orf27 C13orf34 C14orf106 C14orf126 C14orf133 C14orf135 C14orf145 C15orf23 C15orf29 C15orf41 C15orf42 C15orf44 C16orf52 C16orf63 C16orf87 C17orf75 C17orf85 C17orf95 C18orf25 C18orf45 C18orf54 C18orf8 C19orf2 C19orf61 C1GALT1 C1orf103 C1orf112 C1orf135 C1orf163 C1orf198 C1orf201 C1orf25 C1orf26 C1orf27 C1orf58 C1orf71 C1orf83 C1orf9 C20orf94 C21orf63 C21orf66 C21orf82 C21orf91 C22orf30 C2CD3 C2orf29 C2orf3 C2orf34 C2orf43 C2orf56 C2orf63 C2orf65 C2orf67 C3orf17 C3orf23 C3orf26 C3orf31 C3orf33 C3orf52 C3orf59 C3orf63 C3orf64 C3orf67 C4orf21 C4orf27 C4orf29 C4orf41 C4orf43 C5orf22 C5orf25 C5orf28 C5orf30 C5orf33 C5orf34 C5orf36 C5orf37 C5orf42 C5orf43 C5orf44 C5orf51 C6orf106 C6orf115 C6orf130 C6orf145 C6orf153 C6orf162 C6orf163 C6orf167 C6orf170 C6orf182 C6orf192 C6orf211 C6orf70 C6orf72 C7orf30 C7orf44 C7orf54 C7orf60 C7orf66 C8orf37 C8orf41 C8orf83 C9orf102 C9orf21 C9orf41 C9orf72 C9orf82 C9orf85 C9orf93 CA13 CAB39 CACHD1 CACYBP CAD CADPS2 CALCOCO2 CALM2 CALU CAMK1D CAMK2D CAMK4 CAMSAP1 CAMSAP1L1 CAND1 CAP2 CAPN7 CAPRIN1 CAPRIN2 CAPS2 CAPZA2 CARS CASC4 CASC5 CASD1 CASK CASP2 CASP4 CASP6 CASP8 CASP8AP2 CASP9 CAST CATSPER3 CAV1 CBFB CBL CBLB CBWD2 CBWD5 CBX3 CBX6 CC2D2A CCAR1 CCBL2 CCDC104 CCDC109A CCDC109B CCDC111 CCDC112 CCDC12 CCDC125 CCDC126 CCDC132 CCDC138 CCDC14 CCDC146 CCDC150 CCDC18 CCDC21 CCDC25 CCDC28A CCDC29 CCDC41 CCDC46 CCDC50 CCDC52 CCDC55 CCDC58 CCDC59 CCDC6 CCDC66 CCDC68 CCDC77 CCDC82 CCDC88A CCDC91 CCDC93 CCDC99 CCNA2 CCNB1 CCNB2 CCNC CCNE2 CCNF CCNG2 CCNH CCNT2 CCNYL1 CCPG1 CCT6A CD109 CD164 CD2AP CD46 CD47 CD58 CD97 CDC123 CDC14A CDC16 CDC2 CDC20 CDC23 CDC25A CDC25B CDC25C CDC27 CDC2L5 CDC2L6 CDC40 CDC42BPA CDC42BPB CDC42SE2 CDC5L CDC6 CDC7 CDC73 CDCA2 CDCA3 CDCA7 CDCA7L CDCA8 CDCP1 CDK5RAP2 CDK6 CDK7 CDK8 CDKAL1 CDKN3 CDON CDS1 CDS2 CDYL CEBPZ CENPC1 CENPE CENPF CENPI CENPJ CENPK CENPO CENPQ CEP110 CEP120 CEP135 CEP152 CEP170 CEP192 CEP290 CEP350 CEP55 CEP57 CEP63 CEP70 CEP78 CEP97 CEPT1 CETN3 CFL2 CHAC2 CHAF1A CHAF1B CHCHD3 CHD1 CHD1L CHD2 CHD4 CHD6 CHD7 CHD8 CHD9 CHEK1 CHEK2 CHKA CHM CHML CHMP2B CHN1 CHORDC1 CHRNA5 CHUK CIRH1A CISD2 CIT CKAP2 CKAP2L CKAP5 CKLF CLASP1 CLASP2 CLCC1 CLCN3 CLCN4 CLCN5 CLDN12 CLDN4 CLDND1 CLINT1 CLIP1 CLIP2 CLIP4 CLOCK CLPB CLPX CLSPN CLTC CLUAP1 CMAS CMC1 CMTM4 CMTM7 CMTM8 CNKSR3 CNNM2 CNOT1 CNOT10 CNOT2 CNOT4 CNOT6 CNOT6L CNOT7 CNOT8 CNTLN CNTNAP3 COG2 COG3 COG5 COG6 COL12A1 COL4A3BP COMMD1 COMMD10 COMMD2 COMMD8 COPB1 COPB2 COPG2 COPS2 COPS4 COQ5 COQ7 CORIN COX10 CP110 CPD CPNE3 CPNE8 CPOX CPS1 CPSF2 CPSF3 CPSF6 CPT1A CRBN CRCP CREB1 CREB3L2 CREBBP CRIM1 CRIPT CRKRS CRLF3 CRNDE CRTC3 CRY1 CRYBG3 CRYZ CSE1L CSNK1A1 CSNK1G1 CSNK1G3 CSNK2A1 CSNK2A2 CSPP1 CSRP2BP CSTF2 CSTF3 CTBP2 CTBS CTCF CTDSPL2 CTH CTNNB1 CTNND1 CTPS CTPS2 CTR9
Load more

Recommended publications
  • Targeted Genes and Methodology Details for Neuromuscular Genetic Panels
    Targeted Genes and Methodology Details for Neuromuscular Genetic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Neuromuscular Genetic Panels Next-generation sequencing (NGS) and/or Sanger sequencing is performed Motor Neuron Disease Panel to test for the presence of a mutation in these genes. Gene GenBank Accession Number Regions of homology, high GC-rich content, and repetitive sequences may ALS2 NM_020919 not provide accurate sequence. Therefore, all reported alterations detected ANG NM_001145 by NGS are confirmed by an independent reference method based on laboratory developed criteria. However, this does not rule out the possibility CHMP2B NM_014043 of a false-negative result in these regions. ERBB4 NM_005235 Sanger sequencing is used to confirm alterations detected by NGS when FIG4 NM_014845 appropriate.(Unpublished Mayo method) FUS NM_004960 HNRNPA1 NM_031157 OPTN NM_021980 PFN1 NM_005022 SETX NM_015046 SIGMAR1 NM_005866 SOD1 NM_000454 SQSTM1 NM_003900 TARDBP NM_007375 UBQLN2 NM_013444 VAPB NM_004738 VCP NM_007126 ©2018 Mayo Foundation for Medical Education and Research Page 1 of 14 MC4091-83rev1018 Muscular Dystrophy Panel Muscular Dystrophy Panel Gene GenBank Accession Number Gene GenBank Accession Number ACTA1 NM_001100 LMNA NM_170707 ANO5 NM_213599 LPIN1 NM_145693 B3GALNT2 NM_152490 MATR3 NM_199189 B4GAT1 NM_006876 MYH2 NM_017534 BAG3 NM_004281 MYH7 NM_000257 BIN1 NM_139343 MYOT NM_006790 BVES NM_007073 NEB NM_004543 CAPN3 NM_000070 PLEC NM_000445 CAV3 NM_033337 POMGNT1 NM_017739 CAVIN1 NM_012232 POMGNT2
    [Show full text]
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • Supplementary Table S1. Upregulated Genes Differentially
    Supplementary Table S1. Upregulated genes differentially expressed in athletes (p < 0.05 and 1.3-fold change) Gene Symbol p Value Fold Change 221051_s_at NMRK2 0.01 2.38 236518_at CCDC183 0.00 2.05 218804_at ANO1 0.00 2.05 234675_x_at 0.01 2.02 207076_s_at ASS1 0.00 1.85 209135_at ASPH 0.02 1.81 228434_at BTNL9 0.03 1.81 229985_at BTNL9 0.01 1.79 215795_at MYH7B 0.01 1.78 217979_at TSPAN13 0.01 1.77 230992_at BTNL9 0.01 1.75 226884_at LRRN1 0.03 1.74 220039_s_at CDKAL1 0.01 1.73 236520_at 0.02 1.72 219895_at TMEM255A 0.04 1.72 201030_x_at LDHB 0.00 1.69 233824_at 0.00 1.69 232257_s_at 0.05 1.67 236359_at SCN4B 0.04 1.64 242868_at 0.00 1.63 1557286_at 0.01 1.63 202780_at OXCT1 0.01 1.63 1556542_a_at 0.04 1.63 209992_at PFKFB2 0.04 1.63 205247_at NOTCH4 0.01 1.62 1554182_at TRIM73///TRIM74 0.00 1.61 232892_at MIR1-1HG 0.02 1.61 204726_at CDH13 0.01 1.6 1561167_at 0.01 1.6 1565821_at 0.01 1.6 210169_at SEC14L5 0.01 1.6 236963_at 0.02 1.6 1552880_at SEC16B 0.02 1.6 235228_at CCDC85A 0.02 1.6 1568623_a_at SLC35E4 0.00 1.59 204844_at ENPEP 0.00 1.59 1552256_a_at SCARB1 0.02 1.59 1557283_a_at ZNF519 0.02 1.59 1557293_at LINC00969 0.03 1.59 231644_at 0.01 1.58 228115_at GAREM1 0.01 1.58 223687_s_at LY6K 0.02 1.58 231779_at IRAK2 0.03 1.58 243332_at LOC105379610 0.04 1.58 232118_at 0.01 1.57 203423_at RBP1 0.02 1.57 AMY1A///AMY1B///AMY1C///AMY2A///AMY2B// 208498_s_at 0.03 1.57 /AMYP1 237154_at LOC101930114 0.00 1.56 1559691_at 0.01 1.56 243481_at RHOJ 0.03 1.56 238834_at MYLK3 0.01 1.55 213438_at NFASC 0.02 1.55 242290_at TACC1 0.04 1.55 ANKRD20A1///ANKRD20A12P///ANKRD20A2///
    [Show full text]
  • The Role of RNA Editing in Cancer Development and Metabolic Disorders
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2018 The oler of RNA editing in cancer development and metabolic disorders Che-Pei Kung Washington University School of Medicine in St. Louis Leonard B. Maggi Jr. Washington University School of Medicine in St. Louis Jason D. Weber Washington University School of Medicine in St. Louis Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Kung, Che-Pei; Maggi, Leonard B. Jr.; and Weber, Jason D., ,"The or le of RNA editing in cancer development and metabolic disorders." Frontiers in endocrinology.9,. 762. (2018). https://digitalcommons.wustl.edu/open_access_pubs/7400 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. REVIEW published: 18 December 2018 doi: 10.3389/fendo.2018.00762 The Role of RNA Editing in Cancer Development and Metabolic Disorders Che-Pei Kung 1,2*, Leonard B. Maggi Jr. 1,2 and Jason D. Weber 1,2,3* 1 ICCE Institute, Washington University School of Medicine, Saint Louis, MO, United States, 2 Division of Molecular Oncology, Department of Medicine, Washington University School of Medicine, Saint Louis, MO, United States, 3 Siteman Cancer Center, Department of Cell Biology and Physiology, Washington University School of Medicine, Saint Louis, MO, United States Numerous human diseases arise from alterations of genetic information, most notably DNA mutations. Thought to be merely the intermediate between DNA and protein, changes in RNA sequence were an afterthought until the discovery of RNA editing 30 years ago.
    [Show full text]
  • The Endocytic Membrane Trafficking Pathway Plays a Major Role
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of Liverpool Repository RESEARCH ARTICLE The Endocytic Membrane Trafficking Pathway Plays a Major Role in the Risk of Parkinson’s Disease Sara Bandres-Ciga, PhD,1,2 Sara Saez-Atienzar, PhD,3 Luis Bonet-Ponce, PhD,4 Kimberley Billingsley, MSc,1,5,6 Dan Vitale, MSc,7 Cornelis Blauwendraat, PhD,1 Jesse Raphael Gibbs, PhD,7 Lasse Pihlstrøm, MD, PhD,8 Ziv Gan-Or, MD, PhD,9,10 The International Parkinson’s Disease Genomics Consortium (IPDGC), Mark R. Cookson, PhD,4 Mike A. Nalls, PhD,1,11 and Andrew B. Singleton, PhD1* 1Molecular Genetics Section, Laboratory of Neurogenetics, National Institute on Aging, National Institutes of Health, Bethesda, Maryland, USA 2Instituto de Investigación Biosanitaria de Granada (ibs.GRANADA), Granada, Spain 3Transgenics Section, Laboratory of Neurogenetics, National Institute on Aging, National Institutes of Health, Bethesda, Maryland, USA 4Cell Biology and Gene Expression Section, Laboratory of Neurogenetics, National Institute on Aging, National Institutes of Health, Bethesda, Maryland, USA 5Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, University of Liverpool, Liverpool, United Kingdom 6Department of Pathophysiology, University of Tartu, Tartu, Estonia 7Computational Biology Group, Laboratory of Neurogenetics, National Institute on Aging, National Institutes of Health, Bethesda, Maryland, USA 8Department of Neurology, Oslo University Hospital, Oslo, Norway 9Department of Neurology and Neurosurgery, Department of Human Genetics, McGill University, Montréal, Quebec, Canada 10Department of Neurology and Neurosurgery, Montreal Neurological Institute, McGill University, Montréal, Quebec, Canada 11Data Tecnica International, Glen Echo, Maryland, USA ABSTRACT studies, summary-data based Mendelian randomization Background: PD is a complex polygenic disorder.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Clinicopathological and Molecular Genetic Analysis of Low-Grade Glioma in Adults
    A CLINICOPATHOLOGICAL AND MOLECULAR GENETIC ANALYSIS OF LOW-GRADE GLIOMA IN ADULTS Presented by ANUSHREE SINGH MSc A thesis submitted in partial fulfilment of the requirements of the University of Wolverhampton for the degree of Doctor of Philosophy Brain Tumour Research Centre Research Institute in Healthcare Sciences Faculty of Science and Engineering University of Wolverhampton November 2014 i DECLARATION This work or any part thereof has not previously been presented in any form to the University or to any other body whether for the purposes of assessment, publication or for any other purpose (unless otherwise indicated). Save for any express acknowledgments, references and/or bibliographies cited in the work, I confirm that the intellectual content of the work is the result of my own efforts and of no other person. The right of Anushree Singh to be identified as author of this work is asserted in accordance with ss.77 and 78 of the Copyright, Designs and Patents Act 1988. At this date copyright is owned by the author. Signature: Anushree Date: 30th November 2014 ii ABSTRACT The aim of the study was to identify molecular markers that can determine progression of low grade glioma. This was done using various approaches such as IDH1 and IDH2 mutation analysis, MGMT methylation analysis, copy number analysis using array comparative genomic hybridisation and identification of differentially expressed miRNAs using miRNA microarray analysis. IDH1 mutation was present at a frequency of 71% in low grade glioma and was identified as an independent marker for improved OS in a multivariate analysis, which confirms the previous findings in low grade glioma studies.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Conserved and Novel Properties of Clathrin-Mediated Endocytosis in Dictyostelium Discoideum" (2012)
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2012 Conserved and Novel Properties of Clathrin- Mediated Endocytosis in Dictyostelium Discoideum Laura Macro Follow this and additional works at: http://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons Recommended Citation Macro, Laura, "Conserved and Novel Properties of Clathrin-Mediated Endocytosis in Dictyostelium Discoideum" (2012). Student Theses and Dissertations. Paper 163. This Thesis is brought to you for free and open access by Digital Commons @ RU. It has been accepted for inclusion in Student Theses and Dissertations by an authorized administrator of Digital Commons @ RU. For more information, please contact [email protected]. CONSERVED AND NOVEL PROPERTIES OF CLATHRIN- MEDIATED ENDOCYTOSIS IN DICTYOSTELIUM DISCOIDEUM A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Laura Macro June 2012 © Copyright by Laura Macro 2012 CONSERVED AND NOVEL PROPERTIES OF CLATHRIN- MEDIATED ENDOCYTOSIS IN DICTYOSTELIUM DISCOIDEUM Laura Macro, Ph.D. The Rockefeller University 2012 The protein clathrin mediates one of the major pathways of endocytosis from the extracellular milieu and plasma membrane. Clathrin functions with a network of interacting accessory proteins, one of which is the adaptor complex AP-2, to co-ordinate vesicle formation. Disruption of genes involved in clathrin-mediated endocytosis causes embryonic lethality in multicellular animals suggesting that clathrin-mediated endocytosis is a fundamental cellular process. However, loss of clathrin-mediated endocytosis genes in single cell eukaryotes, such as S.cerevisiae (yeast), does not cause lethality, suggesting that clathrin may convey specific advantages for multicellularity.
    [Show full text]
  • Mohammad Karbaschi Thesis
    STRUCTURAL, PHYSIOLOGICAL AND MOLECULAR CHARACTERISATION OF THE AUSTRALIAN NATIVE RESURRECTION GRASS TRIPOGON LOLIIFORMIS (F.MUELL.) C.E.HUBB. DURING DEHYDRATION AND REHYDRATION Mohammad Reza Karbaschi Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Centre for Tropical Crops and Biocommodities Science and Engineering Faculty Queensland University of Technology November 2015 Keywords Arabidopsis thaliana; Agrobacterium-mediated transformation; Anatomy; Anti-apoptotic proteins; BAG4; Escherichia coli; Bulliform cells; C4 photosynthesis; Cell wall folding; Cell membrane integrity; Chaperone-mediated autophagy; Chlorophyll fluorescence; Hsc70/Hsp70; Desiccation tolerance, Dehydration; Drought; Electrolyte leakage; Freehand sectioning; Homoiochlorophyllous; Leaf structure; Leaf folding; Reactive oxygen species (ROS); Resurrection plant; Morphology; Monocotyledon; Nicotiana benthamiana; Photosynthesis; Physiology; Plant tissue; Programed cell death (PCD); Propidium iodide staining; Protein microarray chip; Sclerenchymatous tissue; Stress; Structure; Tripogon loliiformis; Ubiquitin; Vacuole fragmentation; Kranz anatomy; XyMS+; Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration i Abstract Plants, as sessile organisms must continually adapt to environmental changes. Water deficit is one of the major environmental stresses that affects plants. While most plants can tolerate moderate dehydration
    [Show full text]
  • Redefining the Specificity of Phosphoinositide-Binding by Human
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Redefining the specificity of phosphoinositide-binding by human PH domain-containing proteins Nilmani Singh1†, Adriana Reyes-Ordoñez1†, Michael A. Compagnone1, Jesus F. Moreno Castillo1, Benjamin J. Leslie2, Taekjip Ha2,3,4,5, Jie Chen1* 1Department of Cell & Developmental Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801; 2Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD 21205; 3Department of Biophysics, Johns Hopkins University, Baltimore, MD 21218; 4Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD 21205; 5Howard Hughes Medical Institute, Baltimore, MD 21205, USA †These authors contributed equally to this work. *Correspondence: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. ABSTRACT Pleckstrin homology (PH) domains are presumed to bind phosphoinositides (PIPs), but specific interaction with and regulation by PIPs for most PH domain-containing proteins are unclear. Here we employed a single-molecule pulldown assay to study interactions of lipid vesicles with full-length proteins in mammalian whole cell lysates.
    [Show full text]