Comparative Use of Indel and SSR Markers in Deciphering The

Mol Genet Genomics (2012) 287:77–94 DOI 10.1007/s00438-011-0658-4

ORIGINAL PAPER

Comparative use of InDel and SSR markers in deciphering the interspeciﬁc structure of cultivated citrus genetic diversity: a perspective for genetic association studies

Andre´s Garcı´a-Lor • Franc¸ois Luro • Luis Navarro • Patrick Ollitrault

Received: 12 July 2011 / Accepted: 3 November 2011 / Published online: 11 December 2011 Ó Springer-Verlag 2011

Abstract Genetic stratification associated with domesti- species and modern cultivars and (3) the description of the cation history is a key parameter for estimating the perti- organisation of the Citrus gene pool, to evaluate how nence of genetic association study within a gene pool. genetic association studies should be done at the cultivated Previous molecular and phenotypic studies have shown Citrus gene pool level. InDel markers appear to be better that most of the diversity of cultivated citrus results phylogenetic markers for tracing the contributions of the from recombination between three main species: C. medica three ancestral species, whereas SSR markers are more (citron), C. reticulata (mandarin) and C. maxima (pum- useful for intraspecific diversity analysis. Most of the melo). However, the precise contribution of each of these genetic organisation of the Citrus gene pool is related to basic species to the genomes of secondary cultivated spe- the differentiation between C. reticulata, C. maxima and cies, such as C. sinensis (sweet orange), C. limon (lemon), C. medica. High and generalised LD was observed, prob- C. aurantium (sour orange), C. paradisi (grapefruit) and ably due to the initial differentiation between the basic recent hybrids is unknown. Our study focused on: (1) the species and a limited number of interspecific recombina- development of insertion–deletion (InDel) markers and tions. This structure precludes association genetic studies at their comparison with SSR markers for use in genetic the genus level without developing additional recombinant diversity and phylogenetic studies; (2) the analysis of the populations from interspecific hybrids. Association genetic contributions of basic taxa to the genomes of secondary studies should also be affordable at intraspecific level in a less structured pool such as C. reticulata. Communicated by S. Hohmann. Keywords Citrus Genetic diversity Linkage Electronic supplementary material The online version of this disequilibrium Association genetics InDels SSRs article (doi:10.1007/s00438-011-0658-4) contains supplementary material, which is available to authorized users.

A. Garcıá-Lor L. Navarro (&) P. Ollitrault Introduction Centro de Proteccioń Vegetal y Biotecnologıá, Instituto Valenciano de Investigaciones Agrarias (IVIA), Genetic association studies based on linkage disequilibrium 46113 Moncada, Valencia, Spain e-mail: [email protected] (LD) are similar to quantitative trait locus (QTL) mapping. However, whereas QTL mapping considers only variations F. Luro between two crossed individuals, LD mapping exploits the Unite´ de Recherche GEQA, Institut National de la Recherche phenotypic and genetic variation present across a natural Agronomique (INRA), 20230 San Giuliano, France population. This method has been successfully applied P. Ollitrault (&) in studies of cultivated plants (Thornsberry et al. 2001; Department BIOS, TGU AGAP, International Center Casa et al. 2008; Zhu et al. 2008). However, the presence for of Agricultural Research for Development (CIRAD), of population stratification and an unequal distribution Avenue Agropolis, TA A-75/02, 34398 Montpellier Cedex 5, France of alleles within these groups can result in spurious e-mail: [email protected] associations (Abdurakhmonov and Abdukarimov 2008). 123 78 Mol Genet Genomics (2012) 287:77–94

Breeding systems and domestication history are determinant crosses with the C. reticulata gene pool. Analysis of chlo- factors of the LD structure in cultivated species germplasm. roplastic (Green et al. 1986; Nicolosi et al. 2000) and The extent of LD is generally higher for species with selfing mitochondrial genomes (Froelicher et al. 2011) indicate a mating system (Arabidopsis, Nordborg et al. 2002; rice, C. maxima maternal phylogeny. (2) C. paradisi Macf. Garris et al. 2003; and sorghum, Deu and Glaszmann 2004) (grapefruits) is close to C. maxima, and could result from than for outcrossing organisms (maize, Remington et al. hybridization between C. maxima and C. sinensis (Barrett 2001; populus, Ingvarsson 2005; and Norway spruce, and Rhodes 1976; Scora et al. 1982; De Moraes et al. 2007). Rafalski and Morgante 2004). To our knowledge, no data (3) C. medica is clearly a progenitor of C. aurantifolia are available for LD in agamic complexes. (Christm.) Swing (limes) and C. limon Osb. (lemons). Citrus is one of the most important fruit crops in the Chloroplast and nuclear data analysis indicate that the world, and its diversity (Krueger and Navarro 2007) and genetic pools of C. reticulata and C. maxima also contrib- origin (Webber et al. 1967; Calabrese 1992) have been uted to the genesis of C. limon. Nicolosi et al. (2000) pro- widely studied. The taxonomy of citrus remain controver- posed that this species resulted from direct hybridisation sial, due to the conjunction of broad morphological between C. aurantium and C. medica. This assumption is diversity, total sexual interspecific compatibility within the supported by Gulsen and Roose (2001) and Fanciullino genus and partial apomixis of many cultivars. Fixing et al. (2007). The origin of C. aurantifolia is more contro- complex genetic structures through seedling propagation versial. However, molecular data (Federici et al. 1998; via apomixis has led some taxonomists to consider clonal Nicolosi et al. 2000) support the hypothesis of Torres et al. families of interspecific origin as new species (Scora 1975). (1978) that the Mexican lime is a hybrid between C. medica Two major systems are widely used to classify Citrus and a Papeda species. Nicolosi et al. (2000) proposed that species: the Swingle and Reece (1967) classification that C. micrantha might be the parental Papeda. These previous considers 16 species and Tanaka’s (1961) one that identi- molecular studies have provided a better understanding of fies 156 species. More recently, Mabberley (1997) pro- citrus maternal phylogeny, hybrid origin and parentage posed a new classification of edible citrus recognising three determination of many species. However, little is known species and four hybrid groups. In this paper, we will use about the precise contribution of the basic edible species to the Swingle and Reece (1967) classification system. the nuclear genome constitution of secondary cultivated Indeed, this taxonomic system is widely used in the citrus species (C. sinensis, C. limon, C. aurantium, C. paradisi and scientist community and, as mentioned below, mostly C. aurantifolia) and recent hybrids from twentieth century agrees with molecular data. breeding programs. Furthermore, the impact of this Despite the difficulties involved in establishing a con- domestication history on global genetic organisation and sensual classification of edible citrus, most authors now the extent of linkage disequilibrium (LD) on the Citrus gene agree on the origins of most cultivated forms. Early studies pool have not been studied. The distance over which LD by Scora (1975) and Barrett and Rhodes (1976) based on persists is a fundamental parameter to determine how biochemical and morphological polymorphisms, respec- association studies may be conducted on a gene pool. tively, suggested that most of the cultivated citrus origi- Regarding the important phenotypic differentiation nated from three main species (C. medica L., citrons; between the basic taxa and the interspecific origin of most C. reticulata Blanco, mandarins; and C. maxima L. Osbeck, cultivated citrus, a better knowledge of the contribution of pummelos). More recent studies involving the diversity of the nuclear genome of the basic taxa to the secondary morphological characteristics (Ollitrault et al. 2003) and species and modern cultivated citrus, as well as the analysis secondary metabolites (Fanciullino et al. 2006) confirmed of the LD extent, appear as prerequisites to undergo asso- that the majority of the phenotypic diversity of edible citrus ciation studies in the Citrus gene pool. results from the differentiation between these three basic Among the codominant markers used for citrus genetic taxa. Isoenzymes (Herrero et al. 1996; Ollitrault et al. studies, simple sequence repeats (SSRs) (Luro et al. 2001, 2003), RFLP (Federici et al. 1998), RAPD, SCAR (Nicolosi 2008; Gulsen and Roose 2001; Barkley et al. 2006; Olli- et al. 2000), AFLP (Liang et al. 2007) and SSR (Luro et al. trault et al. 2010) are regarded as powerful tools because 2001; Barkley et al. 2006) molecular markers generally they are highly polymorphic, codominant, generally locus- support the following conclusions for the origin of the other specific and randomly dispersed throughout the plant gen- cultivated Citrus species (Nicolosi 2007): (1) C. sinensis ome. Thus, the use of mapped SSR markers should be (L.) Osb. (sweet oranges) and C. aurantium L. (sour oran- particularly useful to analyse the extent of LD. However, ges) are related with C. reticulata but display introgressed Barkley et al. (2009) showed that homoplasy may limit traits and markers of C. maxima. The closer relation with the usefulness of SSR markers in identifying the phyloge- C. reticulata suggests that they are not direct hybrids but are netic origin of DNA fragments in citrus. Insertion or dele- probably backcrossed hybrids of first or second generation tion (InDel) markers generally have low frequency of 123 Mol Genet Genomics (2012) 287:77–94 79 homoplasy. Indeed, there is a sufficiently low probability of [Chalcone isomerase (CHI), Chalcone synthase (CHS), two InDel mutations of exactly the same length occurring at Flavonol synthase (FLS), Malic enzyme (EMA), Malate the same genomic position, that shared InDels can confidently dehydrogenase (MDH), Vacuolar citrate/H? symporter be related to identity-by-descent. In general, InDels arise from (TRPA), Phosphoenolpyruvate carboxylase (PEPC), Phos- the insertion of retroposons or other mobile elements, slippage phofructokinase (PKF), Lycopene b-cyclase (LCY2), in simple sequence replication or unequal crossover events b-Carotene hydroxylase (Hy-b), Phytoene synthase (PSY), (Britten et al. 2003). At the technical level, InDels can be 1-deoxyxylulose 5-phosphate synthase (DXS) and Lyco- genotyped with simple procedures based on size separation pene b-cyclase (LCYB)] are involved in primary and sec- after targeted PCR (Vasema¨gi et al. 2010). InDels have been ondary metabolite biosynthesis pathways that determine used successfully for genetic studies in wheat (Raman et al. the quality of citrus fruit (sugars, acids, flavonoids and 2006), rice (Hayashi et al. 2006) and natural populations carotenoids). In addition, three candidate genes for salt tol- (Va¨li et al. 2008). erance [CAX1 (cation/H? membrane antiporter), AtGRC Our study focused on three basic species (C. medica, (raffinose synthase) and AVP (vacuolar H? pyrophospha- C. reticulata and C. maxima), the secondary species that tase)] were used. Primers (Table 1) were designed to amplify they generated (C. sinensis, C. aurantium, C. paradisi and fragments with a length between 166 and 1,201 bp. The C. lemon) and some known or putative interspecific PCR mixture consisted of 1 ng/ll template DNA, 0.2 mM hybrids. Twelve InDel markers were developed from gene dNTPs, 0.2 lM forward primer, 0.2 lM reverse primer, sequencing, and their polymorphism organisation was 109 PCR buffer (Fermentas), 1.5 mM MgCl2 and 0.027 compared with 50 SSR markers. Next, the complete set of U/ll Taq DNA polymerase (Fermentas), in a final volume of markers was used to answer the following three questions: 15 ll. PCR reactions were carried out with the following (1) what is the intraspecific diversity of InDel markers and program: 5 min at 94°C; 40 cycles of 30 s at 94°C, 30 s are they more useful than SSRs as tag of DNA fragments in at 50–58°C and 2 min at 72°C with a final extension of 4 min studies of phylogenetic origin? (2) What is the contribution at 72°C. of the three basic edible taxa to the genomes of secondary Amplicons of the six selected genotypes were sequenced species and modern cultivars? (3) Are the genetic organi- by the Sanger method from the 50 end using dideoxynu- sation of the Citrus gene pool and the extent of linkage cleotides labelled by fluorescence (Big Dye Terminator disequilibrium adapted for association genetics? Further- Cycle Sequencing Kit v3.1). The sequencing reaction was more, we propose a subset of markers (core markers) for carried out in a thermal cycler (ABI GeneAmp PCR Sys- quick and inexpensive systematic germplasm genotyping tem 9700), and the resolution and analysis of the labelled that maintains most of the organisation and intraspecific products were performed in a capillary sequencer (ABI polymorphism information. 3100).

InDel identiﬁcation and design of new primers Materials and methods for diversity studies

Interspecific InDel polymorphism research BioEdit (Hall 1999) was used to align sequences from which InDel polymorphisms were identified. For genes Plant material and DNA extraction with InDel polymorphisms, new primer pairs in conserved regions flanking the InDel polymorphism were designed With the objective to identify InDel polymorphism differ- using Primer3 software (http://biotools.umassmed.edu/ ences between the basic citrus taxa, we selected two cul- bioapps/primer3) (Table 2) to amplify fragments smaller tivars of C. medica (Corsican and Buddha’s hand citrons), than 350 bp that were subsequently analysed in a capillary two cultivars of C. reticulata (Cleopatra and Willow Leaf fragment analyser (see below). mandarins) and two cultivars of C. maxima (Chandler and Pink pummelos). High molecular weight genomic DNA Diversity analysis was extracted from leaf samples using the DNeasy Plant Mini Kit (Qiagen S.A.; Madrid, Spain) according to the Plant material manufacturer’s instructions. Ninety genotypes from the citrus germplasm bank of IVIA Gene sequence amplification and sequencing (Spain) and INRA/CIRAD (France) were used for the diversity study with SSR and InDel markers (Online Primers were designed from EST sequences corresponding Resource 1). According to the Swingle and Reece classi- to 16 genes available in public databases. Thirteen genes fication system (1967), 45 genotypes belong to the three 123 80 Mol Genet Genomics (2012) 287:77–94

Table 1 Primers of candidate genes Process Gene Primers AT High- EST Genomic Genebank involved quality size size (bp) accessions sequence (bp) (bp)

Flavonoids Chalcone isomerase F:TTGTTCTGATGGCCTAATGG 55 647 721 721 aCL6103Contig1 biosynthesis R:AAAGGCTGTCACCGATGAAT Chalcone synthase F:GATGTTGGCCGAGTAATGCT 55 565 659 659 aCL6909Contig1 R:ATGCCAGGTCCAAAAGCTAA Flavonol synthase F:GGAGGTGGAGAGGGTCCAAG 55 710 763 763 AB011796 R:GGGCCACCACTCCAAGAGC Acids Malic enzyme F:ACATGACGACATGCTTCTGG 55 420 166 420 CB417399 biosynthesis R:CGTAGCCACGCCTAGTTCAT Malate dehydrogenase F:ATGGCCGCTACATCAGCTAC 55 705 1,209 1,250 DQ901430 R:TGCAACCCCCTTTTCAATAC Vacuolar citrate/H? F:GGCGCCACTCCTACCTTCCC 58 715 987 1,300 EF028327 symporter R:CGGTCATTGAAGAGTGCTCCCC Sugars Phosphoenolpyruvate F:AGCCAATGGGATTTCTGACA 55 669 1,201 2,000 EF058158 biosynthesis carboxylase R:GCCAAGCCACACAGGTAAAT Phosphofructokinase F:CGCCGACCTCAGTCCCGTC 58 630 807 1,650 AF095520 R:GCTGCACGCCCCATAAGCCG Carotenes Lycopene b-cyclase 2 F:GCATGGCAACTCTTCTTAGCCCG 55 725 850 850 FJ516403 biosynthesis R:AGCTCGCAAGTAAGGCTCATTCCC b-Carotene hydroxylase F:AGCCCTTCTGTCTCCTCACA 55 675 787 1,600 AF315289 R:CCGTGGAATTTATCCGAGTG AF296158 Phytoene synthase F:GCTCGTTGATGGGCCTAATGC 58 560 727 2,100 AB037975 R:CGGGCGTAAGAGGGATTTTGC AF220218 AF152892 1-Deoxyxylulose F:GGCGAGGAAGCGACGAAGATGG 58 590 935 1,500 aCL303Contig1 5-phosphate synthase R:GGATCAGAACTGGCCCTGGCG Lycopene b-cyclase F:GAATTCTTGCCCCAAGTTCA 55 710 1,206 1,500 AY166796 R:TATGGGCCACAAATCTTTCC AF152246 AY644699 Salt stress Cation/H? membrane F:GTTGCTGATGCTACAGATG 50 840 805 1,800 aCL1735Contig1 tolerance antiporter R:CCTCTCTCTCTTCTTTACCG Raffinose synthase F:CATGCGGAAAAGATGTACC 52 740 804 1,800 aCL3302Contig1 R:CAGCAAGGCTGTCCATAAC Vacuolar H? F:GCATATGCTCCCATCAGTG 53 800 831 1,650 aCL5319Contig1 pyrophosphatase R:CAGGCTCCTGTCTGTTTGAG High-quality sequence resulted from cleaning the alignments. aCLxxxxContig1, sequences were obtained from the Citrus Functional Genomics Project (CFGP), http://bioinfo.ibmcp.upv.es/genomics/cfgpDB/; the rest of the sequences were obtained from the National Center for Bio- technology Information (NCBI) AT annealing temperature ancestral species (29 C. reticulata,10C. maxima and 6 species. The last 17 accessions are hybrids from twentieth C. medica) and 11 genotypes represented the secondary century breeding projects (67–80, 82, 83, 90). species (2 C. aurantium,4C. sinensis,2C. paradisi and 3 C. limon). Seventeen accessions are supposed of interspe- Genotyping cific origin from their morphology or previous molecular data (46–50, 53–55, 65–66, 81, 84–89) even some of them Sixty-seven SSR markers were tested on the citrus popu- were classified by Swingle and Reece (1967) as pure lation selected for our study. Fifty markers presented

123 Mol Genet Genomics (2012) 287:77–94 81

Table 2 Characteristics of InDel markers Marker name Gene Primers AT Fragment size (bp)

IDCHI Chalcone isomerase F:TTTCCTCTTGCTTTACGTGT 55 146–196 R:GTCACAGGTAACGGATTTTC IDEMA Malic enzyme F:CTCTTTCTGCTTCCTGACATC 55 263–277 R:GCCGGTGAATAAAACACAAC IDTRPA Vacuolar citrate/H? symporter F:CCCTCGTTCTTGGTAGCTTT 55 306–309 R:TTATGCATCCACATGCTCAC IDLCY2 Lycopene b-cyclase F:CGCAAATAATTGATTCAACA 50 220–226 R:GATGATCACGTCATATCGAA IDHYB1 b-Carotene hydroxylase F:AAAAACAAAGCACCCAGAT 53 192–213 R:GCCACCAGAACCTGTAATAA IDHYB2 b-Carotene hydroxylase F:TTTGGCACATTTGCTCTCTCT 55 305–307 R:AAAGAAGCATGCCACAGAGC IDPSY Phytoene synthase F:CCTGTCGACATTCAGGTTAG 55 246–249 R:CTCATCACATCTTCGGTCTC IDPEPC1 Phosphoenolpyruvate carboxylase F:TTTTGAACAATCGGCTAATGG 55 231–259 R:TTGCTGGAAGAGAGACTCCAA IDPEPC2 Phosphoenolpyruvate carboxylase F:TTGGAGTCTCTCTTCCAGCAA 55 128–153 R:GTGAGAGCCACAATGCAAAA IDCAX Cation/H? membrane antiporter F:TAAGCTGCATTTAACCCTTT 55 237–243 R:GCAATTGGGAGATAGTCAAT IDAtGRC Rafﬁnose synthase F:GGCAATGAAAACAATGAGAT 55 208–225 R:TTTCAAGATTGTTGGTCCTC IDAPV Vacuolar H? pyrophosphatase F:CAGCTATTGGAAAGGTTTGT 55 156–163 R:GGAGACAGGCATAAAACATC AT annealing temperature

proper and clear results (Online Resource 2; Kijas et al. of 30 s at 94°C, 30 s at 55 or 50°C (depending on the 1997; Froelicher et al. 2008; Luro et al. 2008; Aleza et al. primer) and 1 min at 72°C with a final extension of 4 min 2011; Cuenca et al. 2011; Kamiri et al. 2011) and were at 72°C. used for the diversity study. Forty-seven of them were Denaturation and capillary electrophoresis were carried included in the Clementine genetic map (Ollitrault et al. out on a Capillary Gel Electrophoresis CEQTM 8000 Genetic 2011) and were well distributed between and within all Analysis System using linear polyacrylamide according to linkage groups. In addition, 12 InDel markers were ana- the manufacturer’s instructions (Beckman Coulter Inc.). lysed. One of them (TRPA) is located in the Clementine Genetic analysis system software (GenomeLabTM GeXP genetic map (linkage group 2). version 10.0) was used for data collection and analysis. Amplification by polymerase chain reaction (PCR) was Alleles were sized based on a DNA size standard (400 bp). performed using wellRED forward oligonucleotides (Sigma-Aldrich; Saint-Louis, USA) for analysis with a Data analysis capillary genetic fragment analyser (CEQ/GeXP Genetic Analysis Systems; Beckman Coulter; Fullerton, USA). Neighbour-joining (NJ) analysis PCR was performed in a final volume of 15 ll. Each PCR reaction consisted of 1 ng/ll template DNA, 0.2 mM Population diversity organisation was analysed with dNTPs, 0.2 lM wellRED dye-labelled forward primer, DARwin software (Perrier and Jacquemoud-Collet 2006). 0.2 lM of non-dye-labelled reverse primer, 109 PCR For each primer, bands were scored as allelic data to cal- buffer (Fermentas), 1.5 mM MgCl2 and 0.027 U/ll Taq culate the genetic dissimilarity matrix using the simple DNA polymerase (Fermentas). PCR reactions were carried matching dissimilarity index (di–j) between pairs of accessions out with the following program: 5 min at 94°C; 40 cycles (units):

123 82 Mol Genet Genomics (2012) 287:77–94

XL Linkage disequilibrium dij ¼ 1 1=L ml=2 l¼1 For multi-allelic loci, LD between two loci is commonly 0 0 where di–j is the dissimilarity between units i and j, L is the measured by the D estimate (Gupta et al. 2005). D values number of loci and ml is the number of matching alleles for for each pair of markers were estimated on the whole data locus l. From the dissimilarity matrix obtained, a weighted set using the software program PowerMarker v. 3.25 (Liu NJ tree (Saitou and Nei 1987) was computed using the and Muse 2005). D0 values vary from 0 (total random Dissimilarity Analysis and Representation for Windows association between alleles of the two considered loci) to 1 (DARwin5) software version 5.0.159, and the robustness of (total LD). The p value for obtaining the significance of D0 branches was tested using 10,000 bootstraps. was estimated by the exact test. To establish the genetic structure with the core set of markers, NJ under topological constraints was used. It is a Selection of a subset of markers for quick genotyping modified version that forces the a priori known topology of a subset of samples and positions additional subsets on the The methodology described by Jombart et al. (2010) was previous organisation. Secondary species and modern cul- employed to obtain a small number of markers (core set) tivars were positioned under the constraint of a tree based with good interspecific and intraspecific differentiation for on basic taxa. quick and accurate genotyping. The procedure is based on Severinia buxifolia (Poir.) Ten, a species related to cit- a discriminant analysis of principal components (DAPC). rus, was used to root NJ trees. Data from molecular markers are transformed with a PCoA, and the matrix obtained is employed to perform a Principal coordinates analysis (PCoA) discriminant analysis (DA). These results are used to calculate the allele contribution to the main axes, and the It was performed using the software GENEALEX6 (Peakall alleles with the highest contribution are selected. Expected and Smouse 2006). The data from molecular markers was heterozygosity was used as an extra parameter to select used to obtain the pairwise genetic distance matrix, which primers that allow good intraspecific differentiation. was standardised and used for PCoA analysis.

Population structure Results

It was inferred with the Structure version 2.3.3 program Interspecific InDel polymorphism research (http://cbsuapps.tc.cornell.edu/structure), which implements and InDel marker development a model-based clustering method using genotype data (Pritchard et al. 2000; Falush et al. 2003). According to the For the 16 genes a total of 10,701 bp by genotypes were general agreement on the origin of cultivated species successfully sequenced and aligned (Table 1), allowing the (Scora (1975); Barrett and Rhodes (1976)), we considered identification of 12 InDel polymorphic loci in 10 genes. an initial structure between three populations (K = 3): Specific InDel polymorphisms were encountered in four mandarin (29 samples), pummelo (10 samples) and citron loci in C. medica and another four loci in C. maxima, (6 samples), assuming that the analysed genotypes are whereas the other InDel polymorphisms were detected in derived from these three ancestral taxa. The relative pro- different groups. portion of these ancestral populations in the secondary New primers were designed to analyse the InDel species and hybrids was assigned based on this assumption diversity of these 12 loci (Table 2). In this diversity study, of an admixture model. Correlated allele frequencies were four loci (IDCHI, IDEMA, IDHYB1 and IDLCY2) had determined from the estimates of the three ancestral pop- novel alleles not present in the six genotypes initially ulations defined in this work. Ten runs of structure were sequenced. Amplicons of genotypes with these new alleles performed with 500,000 steps of burning followed by were sequenced, as described previously, to analyse the 1,000,000 Monte Carlo Markov chain (MCMC) repetitions. origin of this pluri-allelism (Online Resource 3). At locus IDCHI, a new polymorphism was found in heterozygosis in

Fstat parameters C. sunki, another one was found in IDEMA (genotype C. sunki and others in heterozygosis), one at IDHYB1 in

Fis, Fit and Fst were calculated with the software program Cleopatra mandarin and other genotypes in heterozygosis GENETIX v. 4.03 based on the parameters of Wright and the last polymorphism was found in homozygosis at (1969) and Weir and Cockerham (1984). locus IDLCY2 in C. sunki and other genotypes in

123 Mol Genet Genomics (2012) 287:77–94 83 heterozygosis. InDel allele sequences of the ten analysed which is 38% lower than the expected heterozygosity genes are given in Online Resource 3. For multi-allelic (0.29), suggesting an organisation in differentiated sub- loci, the variation of amplicon size is due to variation in gene pools with limited gene ﬂows. Individually, the dif- size of the same InDel (IDCHI, IDHYB1 and IDLCY2) ferent taxa had an observed heterozygosity similar to the or several InDels between the two primer sites (IDCHI, expected. C. reticulata was the most polymorphic (He = IDHYB2 and IDCAX). Three loci (IDPSY, IDPEPC2 and 0.13) and heterozygous (Ho = 0.14) ancestral taxon, and IDAVP) displayed intra-taxon polymorphisms only in C. maxima was the least polymorphic and heterozygous

C. medica, and the other three loci (IDHYB2, IDPEPC1 (Ho = He = 0.07) ancestral taxon. and IDATGRC) displayed intra-taxon polymorphisms only in C. maxima. Polymorphisms in loci IDTRPA, IDLCY2 SSR analysis and IDHYB1 may be due to copy number variations of SSRs. The same genetic diversity parameters were calculated for each individual SSR marker, the entire population and for InDel analysis the different speciﬁed citrus groups (Online Resource 5). A total of 405 alleles were detected with the SSR markers.

A total of 32 alleles were detected from the InDel markers. The average number of alleles and He per locus was 8.1 The average number of alleles per locus was 2.67. Genetic and 0.71, respectively. The allele number varied between diversity statistics were calculated for each InDel marker 3 (for loci MEST107, CAC15 and CAC23) and 14 in the entire population and for different citrus groups, (MEST56). TAA41 was the most informative marker with including C. reticulata, C. medica and C. maxima (Online a He of 0.86, and CAC15 was the least informative marker Resource 4) The allele number varied between 2 (for 7 (He = 0.39). Most of the markers (48 out of 50) showed He loci) and 5 for IDCAX. IDCAX displayed the highest values higher than 0.5. When analysing the organisation diversity (He = 0.69) related to different alleles in the among the three basic taxa, Fis values varied from -0.114 three ancestral taxa. IDAVP (He = 0.12) was the least for CAC23 to 0.594 for mCrCIR05A04. The overall Fis informative marker, as it differentiated only varieties from value was close to zero (0.030), conﬁrming that few the citron subpopulation. The best markers for genotype deviations from the Hardy–Weinberg equilibrium occurred differentiation within mandarins, pummelo and citron were within each basic taxon. In contrast, high Fit and Fst values IDCAX, IDPEPC1 and IDCHI, respectively. Fstats param- for almost all markers (averages of 0.454 and 0.434, eters (Wright 1969; Weir and Cockerham 1984) were respectively) are evidence of high differentiation between estimated to analyse the differentiation between the three the three basic taxa. ancestral taxa (C. maxima, C. medica and C. reticulata). Fis Average data over all InDel loci are given in Table 3. values varied from -0.474 for IDAVP to 0.125 for IDCHI. The population displayed a deﬁcit of average observed

For four loci, it was not possible to calculate the Fis heterozygosity (Ho = 0.59) compared with the expected parameter because the loci were monomorphic in each of value under Hardy–Weinberg equilibrium (He = 0.71). the ancestral taxa. With the exception of IDAVP, the Fis This finding is confirmed by the average FW value (0.175). value confirms a situation close to the Hardy–Weinberg Each of the three basic taxa had an observed heterozygosity equilibrium within each species. In contrast, Fit values with close to the expected value. C. reticulata was the most a high average (0.730) showed that, in the whole popula- diverse (He = 0.56) and heterozygous (Ho = 0.56) ances- tion (of the subset of the 3 ancestral taxa), the inbreeding tral taxa, but citron was the lowest (He = 0.28 and coefficient is higher than within taxa for almost all of the Ho = 0.17). markers, indicating an important organisation between taxa. Only IDTRPA had a low value (-0.149) with two Comparative diversity structure displayed alleles shared by C. maxima and C. reticulata. The high Fst by InDels and SSRs average value (0.766) and the Fst value of each locus (excluding IDTRPA) confirms that the inter-taxa differen- The genetic parameters for InDel and SSR markers, tiation contributes much more to the global inbreeding than respectively, were as follows: allele number per locus does the intra-taxa component. Thus, a large portion of the ranged from 2 to 5 and from 3 to 14, observed heterozy- total variation is explained by the differentiation between gosity average was 18 and 59% and the percentage of populations. varieties differentiated among the whole population was Average data over all InDel loci are given in Table 3. The 57.78% (52 out of 90) and 91.11% (82 out of 90). The average FW value (0.433) shows a high deficit of observed distribution of He and Fst between the three basic taxa heterozygous individuals in the population. Indeed, the (Fig. 1) confirmed that InDel markers are less polymorphic whole population had an observed heterozygosity of 0.18, than are SSR markers (lower He values) but allow a better 123 84 Mol Genet Genomics (2012) 287:77–94

Table 3 Statistical summary of the diversity of InDel and SSR markers Marker type All citrus accessions C. reticulata C. maxima C. medica 3 basic taxa

NHo He FW NHo He NHo He NHo He Fis Fit Fst

InDel 2.67 0.18 0.29 0.433 1.58 0.14 0.13 1.25 0.07 0.07 1.25 0.09 0.09 -0.148 0.730 0.766 SSR 8.10 0.59 0.71 0.175 5.02 0.56 0.56 3.36 0.50 0.52 1.94 0.17 0.28 0.030 0.454 0.434 Mean values are represented in the table

N allele number, Ho heterozygosity observed, He heterozygosity expected, Fw Wright ﬁxation index over the whole population, Fis,Fit and Fst Weir and Cockerham Index over the subset of C. maxima, C. medica and C. reticulata accessions

differentiation between ancestral species (higher Fst val- (a) InDel SSR ues). Statistics for the three ancestral groups were calculated for both types of primers (Table 3). Expected and observed heterozygosity were similar for both types of markers but were lower for InDels than SSRs within each taxon. With SSR markers, all accessions of C. medica and C. maxima were fully differentiated, whereas 96.7% of % of markers intervarietal differentiation was obtained within C. reticulata. The InDel intervarietal differentiations were 100, 40 and 53.3% within C. medica, C. maxima and C. reticulata, respectively. Twelve out of 50 SSR and 7 out of 12 InDel markers displayed signiﬁcant deﬁcits of heterozygous Range genotypes in the whole sample set (Online resources 4 (b) and 5). InDel SSR

The Fst value was estimated for each pair of basic taxa, and it was systematically higher with InDel than SSR markers. The least differentiated species were C. reticulata and C. maxima (Fst of 0.373 and 0.422 for SSR and InDel, respectively), followed by C. reticulata/C. medica (0.427 % of markers and 0.758) and C. maxima/C. medica (0.484 and 0.844). All of these data support the conclusion that InDel markers yield higher inter-taxa discrimination compared with SSR markers. Both NJ, Fig. 2 and principal coordinates analysis Range PCoA, Fig. 3 analyses revealed a clear differentiation Fig. 1 Comparison between InDel and SSR markers of the expected between the three ancestral citrus taxa for both kinds of heterozygosity (He) and the genetic differentiation index (Fst) markers. between ancestral taxa. a Expected heterozygosity, b genetic differentiation index NJ trees (Fig. 2) clearly separated C. medica and C. maxima from C. reticulata. For InDel markers (Fig. 2a), C. medica was the best defined group and showed good bootstrap support in all branches of its cluster, and all of NJ analysis confirmed higher intraspecific diversity with the samples were differentiated. The C. maxima group SSRs than with InDel markers. The lower differentiation formed a well-defined clade, but only four profiles were obtained with InDels may be partly due to the lower differentiated among ten accessions. The intraspecific number of these markers. However, it is also clearly diversity of C. reticulata was not well resolved (low explained by their lower allelic diversity, which is observed bootstrap support), perhaps due to the high number of mostly at the interspecific level. Clustering was stronger hybrids (within mandarin) in the sample set. Fourteen with InDel than with SSR markers, but SSRs allowed a genotypes were differentiated among the 29 mandarins. better intra-cluster differentiation between accessions. SSRs allowed a complete intercultivar differentiation for PCoA (Fig. 3) is more adapted than tree representation C. maxima and C. medica, whereas only two C. reticulata in describing the organisation of genetic diversity when cultivars (East India SG and Vohangisany Ambodiampoly) hybrids between differentiated groups are frequent in the were not differentiated (Fig. 2b). sample. In our study, PCoA allowed us to have a better idea

123 Mol Genet Genomics (2012) 287:77–94 85

Fig. 2 NJ bootstrap consensus (a) trees of 45 accessions of citrus (3 ancestor groups) including one outgroup, Severinia buxifolia. Numbers are bootstrap values over 50 based on 10,000 resampling. a InDel markers data, b SSR markers data C. reticulata

C. medica

C. maxima

(b)

C. reticulata

C. maxima

C. medica

of the relative contribution of the three basic taxa to the represented in the first two axes for InDels (Fig. 3a), but genome constitutions of secondary species and modern only 75.89% variability is represented for SSRs (Fig. 3b). hybrids. Almost all of the existing variability (92.10%) is This result confirms that higher interspecific organisation is

123 86 Mol Genet Genomics (2012) 287:77–94

Fig. 3 Organization of Principal Coordinates cultivated Citrus genetic C. reticulata diversity; principal coordinates (a) analysis. a InDel markers data, b SSR markers data. Mandarin (samples 1–29), pummelo (samples 30–39), citron C. medica (samples 40–45), interspeciﬁc C. limon C. sinensis hybrids (samples 46–50), sour orange (samples 51–52), C. aurantium clementine (samples 53–54),

lemon (samples 56–58), (23.16 %) grapefruit (samples 59–60), C. paradisi sweet orange (samples 61–64), hybrid mandarins (samples 67–76), tangelo (samples C. maxima 77–80) and tangor (samples 81–90). (Sample number assignment can be found in Online Resource 1)

(68.94 %)

Principal Coordinates (b) C. medica

C. reticulata C. limon

C. aurantium (27 %)

C. sinensis

C. maxima C. paradisi

(48.89 %) MANDARIN LEMON PUMMELO GRAPEFRUIT CITRON SWEET ORANGE INTERSPECIFIC HYBRID HYBRID MAND SOUR ORANGE TANGELO CLEMENTINE TAN GOR

123 Mol Genet Genomics (2012) 287:77–94 87 determined using InDel markers. For these markers, the C. intra-taxa diversity. C. paradisi is the secondary species medica group (and its hybrids with citron as one parent) with the highest contribution from C. maxima (60%), fol- was strongly differentiated from C. reticulata (and its lowed by C. aurantium (30%), C. sinensis (25%), tangelo hybrids) and C. maxima by axis 1, whereas the C. maxima group (20%), tangor group (10%) and clementines (7%). group was differentiated from the other species by axis 2. C. aurantium varieties displayed seven rare alleles, five of C. paradisi varieties and Bali hybrid, mandarin Suntara and which were shared with Suntara mandarin (two of them C. aurantium (the last two had exactly the same position), were also shared with C. limon), one was shared with in this order, were closer to C. maxima with InDel markers C. limon and another one was only present in C. aurantium. than with SSR markers. Tangors (mandarin 9 sweet The contributions of the ancestral groups to the sec- orange) were closer to the C. reticulata cluster and Tan- ondary species obtained with the Structure software was gelos (mandarin 9 grapefruit) were closer to C. maxima, compared with direct estimations performed with the spe- as expected from their origin. Clementines were close to cific allele from the SSR and InDel markers derived from C. reticulata accessions and some hybrids that have the mandarin, pummelo and citron groups (Table 4). No clementines as a parent. significant difference was found between the two methods For SSRs, C. medica was differentiated from C. maxima of evaluation. It is interesting to note that no specific allele by axis 1, and the C. reticulata group was differentiated from C. medica was observed in C. sinensis, C. paradisi, from C. medica by axis 2. C. reticulata accessions were Bali pummelo, Clementine and Temple, which confirms more dispersed around the axis based on SSR markers than that the low values estimated for the same genotypes with with InDel markers. As C. sinensis, C. aurantium appeared Structure were not significant. much more related to C. reticulata than to C. maxima, C. limon was clearly positioned between the C. medica Linkage disequilibrium gene pool and C. aurantium. Some hybrids derived from C. medica (Poncil, Rhobs el Arsa, Kadu Mul and Damas) Based on the data obtained with the 50 SSR markers dis- were positioned in a similar place, suggesting that these tributed along the genome, the extent of genome-wide LD hybrids share similar origins as C. limon. Tangor was was estimated by D0 for the whole population. InDel the most dispersed group, Murcott and Umatilla were the markers were not selected for this analysis because they closest varieties to C. reticulata and Ortanique was the were not mapped. D0 values ranged from 0.11 to 0.9 for closest to C. maxima. Tangelos were similarly distanced interchromosome pairs of loci and from 0.21 to 0.94 for between them. Clementines were close to the C. reticulata intrachromosome pairs (Fig. 5). The average D0 estimates gene pool, whereas C. paradisi was the secondary species for marker pairs within and between chromosomes were closest to C. maxima. 0.56 and 0.51, respectively. For interchromosome and intrachromosome marker pairs, 65.69 and 53.68% of the D0 Contribution of the ancestral taxa to secondary species values were over 0.5, respectively. The percentage of sig- and modern hybrids; analysis with structure software nificant p values was very high for marker pairs within and between chromosomes: 99.27/99.26% (\5%) and 97.08/ PCoA analysis provided some information on the relative 97.89% (\1%), respectively. When analysing the relation contribution of the three basic taxa to the genome consti- between LD and genetic distances between markers tution of the secondary ones, confirming the status of (Fig. 6), it appears that there is a high LD even between C. medica, C. reticulata and C. maxima as parental gene distant markers with a limited LD decay with increasing pools of the other species and modern hybrids in this study. distances. The distribution of the interchromosome D0 is Assuming an admixture model between the three ancestral highly similar. The mean value of D0 was 0.5161 for the species, the relative proportion of ancestral taxa genomes whole population and all marker pairs. in the secondary species and recent hybrids was inferred using the Structure version 2.3.3 software (Fig. 4) with the Selection of a subset of markers for quick genotyping complete set of data (SSRs ? InDels). C. limon and hybrids with C. medica as parents (Poncil, Identifying a subset of markers that can differentiate new Rhobs el Arsa, Kadu Mul and Damas) have the greatest accessions and study their origin could be useful for quick average contribution from C. medica (46%). Contributions and inexpensive genotyping. In this study, the parameters of C. medica lower than 2.5%, which was observed for used to select the subset of markers were high locus con- C. sinensis, C. aurantium, C. paradisi, Bali pummelo, tribution to F1 and F2 coordinates of the PCoA analysis Clementine and Temple, can probably be considered arte- (interspecific organisation), high expected heterozygosity facts and related to the relatively low number of repre- (global diversity displayed by the marker) and limited LD sentative genotypes of the basic taxa and probable lack of between the selected markers to avoid excessive redundant 123 88 Mol Genet Genomics (2012) 287:77–94

C. reticulata C. maxima C. medica

Interspecific hybrids Hybrid mandarins Tangelos Tangors

Fig. 4 Relative contribution of basic taxa to secondary species and C. reticulata population, 2 C. maxima population, 3 C. medica modern cultivars; structure analysis with K = 3 as initial hypothesis, population, -9 population with unknown contribution from ancestors considering SSR and InDel data. In parenthesis are indicated (sample number assignment can be found in Online Resource 1) the reference population assignment for the admixture model 1

Table 4 Contribution of the ancestral taxa to secondary species: comparison between direct estimation from interspeciﬁc discriminant allele and the estimation from Structure software (admixture model) Latin name Common name SSR ? InDel Total informative Direct estimation from Structure data allele speciﬁc from alleles discriminant alleles

Re Ma Me SSR ? InDel Re (%) Ma (%) Me (%) Re (%) Ma (%) Me (%) v2

C. aurantium Sevillano 32 16 1 49 65.31 32.65 2.04 67.2 30.6 2.2 0.10 C. clementina Clemenules 49 1 0 50 98 2 0 92 7.1 0.9 2.48 C. limon Eureka Frost 21 4 22 47 44.68 8.51 46.8 41.6 12.1 46.3 0.61 C. limon Lisbon Limoneira 20 6 22 48 41.67 12.50 45.8 40.3 14.7 45 0.19 C. paradisi Marsh 21 22 0 43 48.84 51.16 0 38.6 60.9 0.5 2.05 C. sinensis Valencia late delta 37 5 0 42 88.10 11.90 0 73.3 25.6 1.1 4.79 9 C. maxima Bali 28 18 0 46 60.87 39.13 0 58.4 41.1 0.6 0.37 9 C. medica Poncil 14 5 26 45 31.11 11.11 57.8 26.3 10.8 62.9 0.59 9 C. medica Rhobs el Arsa 15 9 20 44 34.09 20.45 45.5 33.6 18.7 47.7 0.12 9 C. medica Kadu Mul 31 0 23 54 57.41 0 42.6 54.9 2.7 42.3 1.52 9 C. medica Damas 11 8 24 43 25.58 18.60 55.8 33.6 18.7 47.7 1.42 9 C. reticulata Citrus daoxianensis 50 1 0 51 98.04 1.96 0 94.1 4.1 1.8 1.57

Re C. reticulata, Ma C. maxima, Me C. medica, v2 homogeneity test on distribution with the two methods (a = 0.05; v2 \ 5.99)

information between markers (Online Resource 6). A total TAA41 and mCrCI02G12 were selected for their high of nine markers were selected: mCrCI02D04b and expected heterozygosity. Six out of the nine linkage groups MEST431 were selected for their high contribution to the were represented by the selected marker subset. With these F1 component (which distinguished C. reticulata from the nine markers, the three ancestors groups were clearly dif- other two ancestors), IDCHI and IDCAX have a high ferentiated (Online Resource 7). Samples in the C. medica contribution to F2 (axis which differentiates between group were fully separated, whereas in C. maxima, only C. medica and the other ancestors), mCrCI07F11 and ‘Gil’ and ‘Sans Pepins’ cultivars could not be differenti- mCrCI07D06 contributed in both axes (it is helpful to dis- ated. C. reticulata within diversity was slightly less tinguish individuals that are intermediate) and MEST488, resolved than with the whole marker set (6 mandarins were

123 Mol Genet Genomics (2012) 287:77–94 89

Fig. 5 Linkage disequilibrium D' interchromosomes D' intrachromosomes for marker pairs within a same linkage group (grey) and between markers located in different chromosomes (black) chromosomes between Nb of markers pairs within chromosomes Nb of markers pairs

Range of LD (D')

InDels as genetic markers in Citrus. We searched for InDel polymorphisms in the three basic taxa (C. reticulata, C. maxima and C. medica) by sequencing PCR products obtained from 13 genes. Primers were designed to amplify 150–350 bp fragments flanking the 12 identified InDels, and amplicon size variation was studied by capillary electrophoresis on a sample of 90 genotypes of the Citrus genus. The frequency of InDels per kb in citrus was 0.71 and 5.22 in exon and intron sequences, respectively. More sequence polymorphisms were found in non-coding regions than in coding regions. Similar results have been observed Fig. 6 Relation between LD in the population for all markers pairs in other species. In Brassica, 0.45 and 7.42 InDel/kb were within chromosomes and genetic distances (Clementine genetic map; found in exons and introns, respectively (Park et al. 2010). Ollitrault et al. 2011) In melon, InDels occurred less frequently in introns (approximately 0.60/kb) and no InDel was found inside coding regions (Morales et al. 2004). In maize, 0.43 and not distinguished). The average observed and expected 11.76 InDels/kb were found in coding and non-coding heterozygosity values were 56 and 64%, respectively, and regions, respectively (Ching et al. 2002). the FW was 0.163. The mean number of alleles per locus was 2.83 with a maximum of five alleles at the IDCAX locus. Seven of the 12 markers were diallelic. Retroposon movements, such as Discussion Alu or the L1 element, are known to generate such diallelic InDels (Watkins et al. 2001). In our study, pluri-allelism Citrus InDel markers are less polymorphic but display was caused by differences in InDel size or the presence of higher interspecies differentiation than do SSR markers several InDels in the amplified fragments. InDels with a size that is not a multiple of 3 are uncommon in exons InDels are generally considered to be interesting poly- but relatively common in introns (Mills et al. 2006; The morphisms for genetic studies. However, despite increasing Arabidopsis Genome Initiative 2000). molecular resources in citrus, such as EST sequence Almost 60% of the whole set of samples were differ- information (Forment et al. 2005; Terol et al. 2007), Har- entiated with the 12 InDel markers. A better differentiation vEST software Version 1.32 of ‘‘HarvEST:Citrus’’ (http:// may be obtained with more InDels; however, the low mean www.harvest-web.org) and genomic sequence information number of alleles per locus may be a limitation compared (Terol et al. 2008), no specific study has been conducted with techniques using multi-allelic markers, such as SSRs. prior to the present work to analyse the value of nuclear Indeed, we found a mean value of 8.1 alleles per locus for

123 90 Mol Genet Genomics (2012) 287:77–94

SSRs. With higher allelic diversity and intra-taxon diver- inexpensive to use in phylogenetic and genetic association sity, SSRs are more informative than InDels at the intra- studies in Citrus. speciﬁc level. The number of repeats in microsatellites evolves at a high rate (Weber and Wrong 1993; Jarne and The genetic constitution of secondary species Lagoda 1996), which can vary depending on the number of and modern hybrids repeats or base composition (Bachtrog et al. 2000). Thus, there are generally good markers for intra-population In agreement with previous molecular studies (Barkley diversity analysis, as we observed at the intra-taxon level. et al. 2006; Luro et al. 2008), no intercultivar polymor- However, due to this important rate of variation, homo- phism was found at intraspeciﬁc level for C. sinensis, plasy should be relatively frequent, as demonstrated in C. aurantium and C. paradisi, whereas these species are

Citrus (Barkley et al. 2009), and should limit the value of highly heterozygous (Ho values of 0.47, 0.50 and 0.44, SSRs as phylogenetic markers. Our results confirmed this respectively). This finding confirms that most of the int- hypothesis, as we observed that InDel markers displayed a ervarietal polymorphisms within these secondary species much higher differentiation between the three basic taxa arise from punctual mutation or movement of transposable than SSRs, with Fst value averages of 0.77 and 0.43, elements (Breto´ et al. 2001). These types of mutations are respectively. The structure of the whole sample diversity unlikely to be detected with SSR or InDel markers. The was higher for InDels with a fixation index value (Fw; three lemon cultivars were differentiated. However, lemons Wright 1978) of 0.433 and 0.175 for SSRs. Interestingly, cv. ‘Lisbon’ and cv. ‘Eureka’ only differed for five the three InDel markers (IDTRPA, IDLCY2 and IDHYB1) markers. that may result from variation in copy number of SSRs PCA using SSR or InDel markers confirmed that the showed lower Fst value than the average. Therefore, these differentiation between C. reticulata, C. maxima and three markers provide less inter-taxa differentiation than C. medica gene pools was the structuring factor of the the other InDels. The PCA also confirmed a higher level of analysed edible citrus germplasm. Secondary species and structure of the diversity displayed by InDels markers than modern tangor and tangelo cultivars (which display higher by SSRs with 92.2 and 75% of the whole diversity, heterozygosity than C. reticulata, C. maxima and C. med- respectively, represented by the first two axes. ica) take intermediary positions between the three basic Thus, we can conclude that, in the Citrus genus, InDel taxa, confirming their hybrid status. Structure analysis with markers are less polymorphic than SSRs but display a an admixture model considering C. reticulata, C. maxima higher organisation of genetic diversity at the interspecific and C. medica at the origin of all analysed germplasm level. From the 50 SSRs and 12 InDels we have selected a allowed us to estimate the contribution of these taxa to the core set of 9 markers (2 InDels and 7 SSRs) that keep the genomes of secondary species, modern cultivars and some interspecific structure, as well as a significant part of the genotypes of unclear origin. intraspecific polymorphism information. These markers Two accessions initially considered as representative of should be useful for the rapid and inexpensive assignment C. maxima and C. medica (Bali pummelo and Poncil citron, of a new germplasm variety to its genetic group or iden- respectively) were discarded by structure analysis from the tification of its potential hybrid origin. ancestor species and positioned as hybrids. Bali seemed to InDels play a major role in sequence divergence be a hybrid between C. reticulata and C. maxima (genome between closely related DNA sequences in animals, plants, contributions of 57 and 43%, respectively) and Poncil insects and bacteria. InDels are responsible for many more seemed to be a tri-hybrid from C. medica (63%), C. retic- unmatched nucleotides than are base substitutions, and ulata (26%) and C. maxima (11%). human genetic data suggests that InDels are a major source As proposed by Roose et al. (2009), we found that sweet of gene defects (Britten et al. 2003). InDels in coding orange (C. sinensis) exhibits close to 75% C. reticulata and regions probably have functional roles and are considered 25% C. maxima contribution and thus should be the result to be a significant source of evolutionary change in of a backcross 1 (BC1) [(C. maxima 9 C. reticulata) 9 eucaryotic and bacterial evolution (Britten et al. 2003). C. reticulata]. These contributions differ from the ones InDels in genes with functional diversity between alleles estimated by Nicolosi et al. (2000) where C. sinensis should be highly useful for marker-assisted selection shared half of its markers with C. reticulata and the other (Raman et al. 2006) or QTL mapping (Vasema¨gi et al. half with C. maxima and in Barkley et al. (2006) where 2010). Using the increasing amounts of sequence infor- only 6–8% of its genome arose from C. maxima. mation acquired by new technologies (454-Roche, SOLiD It is believed that grapefruit (C. paradisi) arose from a system-Applied biosystems or Solexa-Illumina), the cross between pummelo and sweet orange in the West development of PCR-based InDel markers will become an Indies where they were introduced after Christopher important source of genetic markers that are easy and Columbus discovered the new world (Barrett and Rhodes 123 Mol Genet Genomics (2012) 287:77–94 91

1976; Nicolosi et al. 2000). Grapefruit displays a contri- with these two species. Our results confirm the hypothesis bution of 61% from C. maxima and 39% from C. reticu- of Swingle (1943) Coletta Filho et al. (1998) and Nicolosi lata, which are values that are close to the theoretical et al. (2000) regarding the origin of King. As expected, average values (62.5 and 37.5%, respectively) expected for tangelos had a greater contribution of C. maxima than a C. maxima 9 [(C. maxima 9 C. reticulata) 9 C. retic- tangors (approximately 20%). ulata] hybrid. Of the genotypes of uncertain origin, we found that Sour orange (C. aurantium) is thought to be derived C. daoxianensis is mostly of C. reticulata origin (94%). from hybridisation between C. maxima and C. reticulata This result is in agreement with Li et al. (1992), who gene pools (Nicolosi et al. 2000; Barkley et al. 2006; Uzun considered C. daoxianensis to be a wild mandarin. Rhobs et al. 2009). Our analysis with Structure suggests that it el Arsa was considered by Federici et al. (1998)tobea showed a greater contribution from C. reticulata (68%) cross between C. aurantium and C. medica, as are lemons. than did C. maxima (30%) and a bit of C. medica (2%). Our results are in agreement with this hypothesis. The Seven rare alleles were found in C. aurantium that were not origin of Kadu Mul has not been reported previously. Our present in the analysed germplasm of the three main results prompt the hypothesis that Kadu Mul arose from a ancestors. However, five of them were found in the cross C. medica 9 C. reticulata, as we found that Kadu accession Suntara mandarin. Furthermore, Suntara and Mul exhibits 42.3 and 54.9% contribution from C. medica C. aurantium share the same alleles at most loci. Thus, and C. reticulata, respectively. there is a high probability that C. aurantium and Suntara This study showed that the ancestral C. reticulata group mandarin share parentage, but we do not have sufficient contributes to a great proportion of the genomes of evidences to conclude whether Suntara is a parent or a secondary species and recent hybrids. The facultative hybrid from C. aurantium. The small contribution of apomixis exhibited by all secondary species probably arose C. medica (2%) can probably be considered an artefact by from the C. reticulata germplasm. estimation with Structure software, due to an underrepre- sentation of C. maxima and C. reticulata diversity. It is Cultivated citrus: a highly structured gene pool likely that C. aurantium is a BC1 (C. maxima 9 (C. max- with generalised linkage disequilibrium that is ima 9 C. reticulata)). not favourable for global association genetic studies In agreement with its putative C. aurantium 9 C. medica origin (Nicolosi et al. 2000; Gulsen and Roose 2001), Previous molecular studies (Herrero et al. 1996; Federici we found that lemons (C. limon) cv. ‘Eureka’ and ‘Lisbon’ et al. 1998; Nicolosi et al. 2000; Luro et al. 2001; Ollitrault had a complex tri-hybrid structure from C. reticulata et al. 2003; Barkley et al. 2006; Liang et al. 2007) have (41%), C. medica (45%) and C. maxima (13%). The provided evidence of a strong diversification between the argument that C. aurantium is one parent is reinforced by ancestral taxa of all cultivated forms. Therefore, the anal- the fact that these two lemons shares three rare alleles with ysis of the organisation of cultivated citrus and the study of C. aurantium. the LD organisation of the genome were necessary to Mandarin-like varieties are an increasing component of estimate how association studies should be conducted in the citrus fresh fruit market and include C. reticulata Citrus. hybrids, known or supposed tangors (hybrids between Our analysis of Fstat parameters in the subset of the three C. reticulata and C. sinensis) and tangelos (hybrids basic taxa genotypes (C. reticulata, C. medica and between C. reticulata and C. paradisi). The clementine, a C. maxima) with non-significant Fis value but high Fit and variety selected from a seedling of ‘‘Common mandarin’’ Fst values confirms the important structure of the allelic one century ago in Algeria, is the most popular variety of diversity between these taxa. The interspecific differentia- mandarin in the Mediterranean Basin. Most of its genome tion was particularly high using InDel markers. Eleven of is inherited from C. reticulata, but it seems to have been 50 SSR markers and 7 of 12 InDel markers displayed introgressed in small part from C. maxima (6%). The allelic significant deficits of heterozygous genotypes in the whole constitution of clementine is in agreement with the sample. This indicates a strong population subdivision hypothesis of a ‘‘Common mandarin’’ 9 C. sinensis (Hartl and Clark 1997) and, therefore, a low gene flow hybridisation (Deng et al. 1996; Nicolosi et al. 2000). In between C. medica, C. reticulata and C. maxima. The addition, the ‘‘Temple’’, ‘‘Ellendale’’, ‘‘Murcott’’ and differentiation between these sexually compatible taxa can ‘‘King’’ varieties have been considered as tangor. These be explained by the foundation effect in three geographic varieties showed close to 90% contribution of the C. re- zones and by an initial allopatric evolution. C. maxima ticulata genome and 10% contribution of the C. maxima originated in the Malay Archipelago and Indonesia, genome, as expected for hybrids between C. reticulata and C. medica evolved in Northeastern India and the nearby C. sinensis. Moreover, they shared most of their alleles region of Burma and China and C. reticulata diversification 123 92 Mol Genet Genomics (2012) 287:77–94 occurred over a region including Vietnam, Southern China Conclusions and Japan (Webber et al. 1967; Scora 1975). Later on, human activity facilitated migration and hybridization This work achieves for the first time in citrus, the devel- among the differentiated gene pools of the basic taxa. opment of InDel markers as an important tool for diversity However, the partial apomixis observed in most of the and phylogenetic studies in citrus. InDel markers appear to secondary species has strongly limited the interspecific be better phylogenetic markers for tracing the contributions gene flow. of the three ancestral species to the secondary species and Using 50 mapped SSR markers, we found that the LD modern cultivars, whereas SSR markers are more useful for decay was very slow as the distance increased in a same intraspecific diversity analysis. Most of the genetic orga- linkage group. Moreover, a similar distribution of LD was nisation of the Citrus gene pool is related to the differen- found when considering LD within or between linkage tiation between C. reticulata, C. maxima and C. medica. groups (65.69 and 53.68% of the D0 values [0.5, respec- High and generalised LD was observed, probably due to tively). 99.3% of significant p values (\0.05) were the initial differentiation between the basic species and a observed both within and between linkage groups. This LD limited number of interspecific meiosis. This structure structure confirms that the history of cultivated Citrus precludes association genetic studies at the genus level (initial allopatric differentiation of basic taxa followed by a without developing additional recombinant populations limited number of interspecific meiosis) is not a favourable from interspecific hybrids. Association genetic studies situation for association genetic studies. Indeed, significant should also be affordable at intraspecific level in a less LD between polymorphisms on different chromosomes structured pool such as C. reticulata. may produce associations between a marker and a pheno- type, even though the marker is not physically linked to the Acknowledgments This research was jointly financed by the grant locus responsible for the phenotypic variation. Similar AGL2008-00596-Ministry of Science and Innovation of Spain-Fondo Europeo de Desarrollo Regional (FEDER) and the grant Prometeo/ population structures exist in many crops where the com- 2008/121 from the Generalitat Valenciana, Spain. plex breeding history and limited gene flow found in most wild plants have created complex stratification (Flint-Gar- cia et al. 2003; Abdurakhmonov and Abdukarimov 2008). LD between unlinked loci primarily happens due to the References occurrence of distinct allele frequencies with different ancestry in an admixed or structured population when Abdurakhmonov IY, Abdukarimov A (2008) Application of Associ- ation Mapping to Understanding the Genetic Diversity of Plant predominant parents exist in germplasm groups. This was Germplasm Resources. Int J Plant Genomics 2008:574927. doi: the case in our sample representative of the cultivated 10.1155/2008/574927 Citrus genus. Statistical methodologies have been devel- Aleza P, Froelicher Y, Schwarz S, Agusti M, Hernandez M, Juarez J, oped to properly interpret the results of association tests Luro F, Morillon R, Navarro L, Ollitrault P (2011) Tetraploid- ization events by chromosome doubling of nucellar cells are when using such structured populations (Pritchard et al. frequent in apomictic citrus and are dependent on genotype and 2000; Reich and Goldstein 2001; Price et al. 2006; Yu et al. environment. Ann Bot. doi:10.1093/aob/mcr099 2006). However, to be applied properly, these methods Bachtrog D, Agis M, Imhof M, Schlotterer C (2000) Microsatellite require that a significant part of the structured population variability differs between dinucleotide repeat motifs-evidence from Drosophila melanogaster. Mol Biol Evol 17:1277–1285 results from recombination between the ancestral genomes Barkley NA, Roose ML, Krueger RR, Federici CT (2006) Assessing with sufficient meiosis events to reduce the initial extent of genetic diversity and population structure in a citrus germplasm LD, whereas the actual cultivated citrus germplasm arises collection utilizing simple sequence repeat markers (SSRs). from a limited number of such inter-ancestry meiosis. This Theor App Genet 112:1519–1531 Barkley NA, Krueger RR, Federici CT, Roose ML (2009) What result precludes LD-based association study at the genus phylogeny and gene genealogy analyses reveal about homoplasy level without developing additional interspecific hybrids, in citrus microsatellite alleles. Plant Syst Evol 282:71–86 such as BC1 or F2, between ancestral taxa or hybrids of the Barrett HC, Rhodes AM (1976) A numerical taxonomic study of secondary species. In addition, the potential use of genetic affinity relationships in cultivated Citrus and its close relatives. Syst Bot 1:105–136 association studies within basic species should be explored, Breto´ MP, Ruiz C, Pina JA, Asins MJ (2001) The diversification of particularly in C. reticulata where useful polymorphisms Citrus clementina Hort. ex Tan., a vegetatively propagated crop (resistance to biotic and abiotic constraints and some species. Mol Phylogenet Evol 21:285–293 quality factors) have been identified. Moreover, markers Britten RJ, Rowen L, Williams J, Cameron RA (2003) Majority of divergence between closely related DNA samples is due to with a higher rate of identity-by-descent, such as InDels indels. PNAS 100:661–4665 or SNPs, should be more useful than SSRs for genetic Calabrese F (1992) The history of citrus in the Mediterranean association studies. countries and Europe. Proc Int Soc Citricult 1:35–38

123 Mol Genet Genomics (2012) 287:77–94 93

Casa AM, Pressoir G, Brown PJ, Mitchell SE, Rooney WL, Tuinstra Hall TA (1999) BioEdit: a user-friendly biological sequence align- MR, Francks CD, Kresovich S (2008) Community resources and ment editor and analysis program for Windows 95/98/NT. Nucl strategies for association mapping in sorghum. Crop Sci 48:30–40 Acids Symp Ser 41:95–98 Ching A, Caldwell KS, Jung M, Dolan M, Smith OS, Tingey S, Hartl DL, Clark AG (1997) Principles of population genetics. Sinauer Morgante M, Rafalski AJ (2002) SNP frequency, haplotype Associates Incorporated, Sunderland structure and linkage disequilibrium in elite maize inbred lines. Hayashi K, Yoshida H, Ashikawa I (2006) Development of PCR- BMC Genet 3:19 based allele-specific and InDel marker sets for nine rice blast Coletta Filho HD, Machado MA, Targon MLPN, Moreira MCPQDG, resistance genes. Theor Appl Genet 113:251–260 Pompeu J Jr (1998) Analysis of the genetic diversity among Herrero R, Asins MJ, Carbonell AE, Navarro L (1996) Genetic mandarins (Citrus spp.) using RAPD markers. Euphytica 102: diversity in the orange subfamily Aurantioideae. I. Intraspecies 133–139 and intragenus genetic variability. Theor Appl Genet 92:599– Cuenca J, Froelicher Y, Aleza P, Jua´rez J, Navarro L, Ollitrault P 609 (2011) Multilocus half-tetrad analysis and centromere mapping Ingvarsson P (2005) Nucleotide polymorphism and linkage disequi- in Citrus: evidence of SDR mechanism for 2n megagametophyte librium within and among natural populations of European production and partial chromosome interference in mandarin cv. Aspen (Populus tremula L., Salicaceae). Genetics 169:945–953 ‘Fortune’. Heredity 107:462–470 Jarne P, Lagoda PJL (1996) Microsatellites, from molecules to De Moraes A, dos Santos Soares Filho W, Guerra M (2007) populations and back. Trends Ecol Evol 11:424–429 Karyotype diversity and the origin of grapefruit. Chromosome Jombart T, Devillard S, Balloux F (2010) Discriminant analysis of Res 1:115–121 principal components: a new method for the analysis of Deng ZN, Gentile A, Nicolosi E, Continella G, Tribulato E (1996) genetically structured populations. BMC Genet 11:94 Parentage determination of some citrus hybrids by molecular Kamiri M, Stift M, Srairi I, Costantino G, El Moussadik A, Hmyene markers. Proc Int Soc Citricul 2:849–854 A, Bakry F, Ollitrault P, Froelicher Y (2011) Evidence for non- Deu M, Glaszmann JC (2004) Linkage disequilibrium in sorghum. In: disomic inheritance in a Citrus interspecific tetraploid somatic Plant & animal genomes XII conference, 10–14 January, Town between C. reticulata and C. lemon hybrid using SSR markers & Country Convention Center, San Diego, CA, W10 and cytogenetic analysis. Plant Cell Rep 30:1415–1425 Falush D, Stephens M, Pritchard JK (2003) Inference of population Kijas JMH, Thomas MR, Fowler JCS, Roose ML (1997) Integration structure using multilocus genotype data: linked loci and of trinucleotide microsatellites into a linkage map of citrus. correlated allele frequencies. Genetics 164:1567–1587 Theor Appl Genet 94:701–706 Fanciullino AL, Dhuique-Mayer C, Luro F, Casanova J, Morillon R, Krueger RR, Navarro L (2007) Citrus germplasm resources. In: Khan Ollitrault P (2006) Carotenoid diversity in cultivated Citrus is I (ed) Citrus genetics, breeding and biotechnology. CABI highly influenced by genetic factors. J Agric Food Chem Publishing, CAB International, Wallington, pp 45–140 54:4397–4406 Li WB, Liu GF, He SW (1992) Leaf isozymes of mandarin. Proc Int Fanciullino AL, Dhuique-Mayer C, Luro F, Morillon R, Ollitrault P Soc Citricult 1:217–220 (2007) Carotenoid biosynthetic pathway in the Citrus genus: Liang G, Xiong G, Guo Q, He Q, Li X (2007) AFLP analysis and the number of copies and phylogenetic diversity of seven genes. taxonomy of Citrus. Acta Hortic 760:137–142 J Agric Food Chem 55:7405–7417 Liu K, Muse SV (2005) PowerMarker: an integrated analysis Federici CT, Fang DQ, Scora RW, Roose ML (1998) Phylogenetic environment for genetic marker analysis. Bioinformatics 21: relationships within the genus Citrus (Rutaceae) and related 2128–2129 genera as revealed by RFLP and RAPD analysis. Theor Appl Luro F, Rist D, Ollitrault P (2001) Evaluation of genetic relationships Genet 96:812–822 in Citrus genus by means of sequence tagged microsatellites. Flint-Garcia SA, Thornsberry JM, Buckler ES (2003) Structure Acta Hortic 546:237–242 of linkage disequilibrium in plants. Annu Rev Plant Biol Luro F, Costantino G, Terol J, Argout X, Allario T, Wincker P et al 54:357–374 (2008) Transferability of the EST-SSRs developed on Nules Forment J et al (2005) Development of a citrus genome-wide EST clementine (Citrus clementina Hort ex Tan) to other Citrus collection and cDNA microarray as resources for genomic species and their effectiveness for genetic mapping. BMC studies. Plant Mol Biol 57:375–391 Genomics 9:287 Froelicher Y, Dambier D, Costantino G, Lotfy S, Didout C, Beaumont Mabberley DJ (1997) A classification for edible Citrus (Rutaceae). V, Brottier P, Risterucci AM, Luro F, Ollitrault P (2008) Telopea 7:167–172 Characterization of microsatellite markers in Citrus reticulata Mills RE, Luttig CT, Larkins CE, Beauchamp A, Tsui C, Pittard WS, Blanco. Mol Ecol Resour 8:119–122 Devine SE (2006) An initial map of insertion and deletion Froelicher Y, Mouhaya W, Bassene JB, Costantino G, Kamiri M, (INDEL) variation in the human genome. Genome Res 16:1182– Luro F, Morillon R, Ollitrault P (2011) New universal 1190 mitochondrial PCR markers reveal new information on maternal Morales M, Roig E, Monforte AJ, Aru´s P, Garcia-Mas J (2004) citrus phylogeny. Tree Genet Genomes 7:49–61 Single-nucleotide polymorphisms detected in expressed Garris AJ, McCouch SR, Kresovich S (2003) Population structure and sequence tags of melon (Cucumis melo L.). Genome 47:352–360 its effects on haplotype diversity and linkage disequilibrium Nicolosi E (2007) Origin and taxonomy. In: Khan I (ed) Citrus surrounding the xa5 locus of rice Oryza sativa L. Genetics genetics, breeding and biotechnology. CABI Publishing, CAB 165:759–769 International, Wallington, pp 19–43 Green RM, Vardi A, Galun E (1986) The plastome of Citrus. Physical Nicolosi E, Deng ZN, Gentile A, La Malfa S, Continella G, Tribulato map, variation among Citrus cultivars and species and compar- E (2000) Citrus phylogeny and genetic origin of important ison with related genera. Theor Appl Genet 72:170–177 species as investigated by molecular markers. Theor Appl Genet Gulsen O, Roose ML (2001) Chloroplast and nuclear genome analysis 100:1155–1166 of the parental lemons. J Am Soc Hort Sci 126:210–215 Nordborg M, Borevitz JO, Bergelson J, Berry CC, Chory J, Gupta P, Rustgi S, Kulwal P (2005) Linkage disequilibrium and Hagenblad J, Kreitman M, Maloof JN, Noyes T, Oefner PJ, association studies in higher plants: present status and future Stahl EA, Weigel D (2002) The extent of linkage disequilibrium prospects. Plant Mol Biol 57:461–485 in Arabidopsis thaliana. Nat Genet 30:190–193

123 94 Mol Genet Genomics (2012) 287:77–94

Ollitrault P, Jacquemond C, Dubois C, Luro F (2003) Genetic citrus industry, 2nd edn. University of California, Berkeley vol 1, diversity of cultivated tropical plants. In: Hamon P, Seguin M, pp 190–430 Perrier X, Glaszmann J-C (eds) Montpellier. CIRAD, Tanaka T (1961) Citologia: semi-centennial commemoration papers pp 193–217 on citrus studies. Citologia Supporting Foundation, Osaka, p 114 Ollitrault F, Terol J, Pina JA, Navarro L, Talon M, Ollitrault P (2010) Terol J, Conesa A, Colmenero JM, Cercos M, Tadeo FR, Agustı´ J, Development of SSR markers from Citrus clementina (Rutaceae) Alo´s E, Andres F, Soler G, Brumos J, Iglesias DJ, Go¨tz S, Legaz BAC end sequences and interspecific transferability in Citrus. F, Argout X, Courtois B, Ollitrault P, Dossat C, Wincker P, Am J Bot 97:124–129 Morillon R, Talon M (2007) Analyses of 13000 unique Citrus Ollitrault P, Terol J, Chen C, Federici CT, Lofty S, Hippolyte I, clusters associated with fruit quality, production and salinity Ollitrault F, Berard A, Chauveau A, Constantino G, Kacar Y, Mu tolerance. BMC Genomics 8:31 L, Cuenca J, Garcia-Lor A, Froelicher Y, Aleza P, Boland A, Terol J, Naranjo A, Ollitrault P, Talon M (2008) Development of Billot C, Navarro L, Luro F, Roose ML, Gmitter FG, Talon M, genomic resources for Citrus clementina: characterization of Brunel D (2011) A reference linkage map of C. clementina based three deep-coverage BAC libraries and analysis of 46,000 BAC on SNPs, SSRs and Indels. In: Plant & Animal genomes XIX end sequences. BMC Genomics 9:423 conference, San Diego, CA, USA, p 477 The Arabidopsis Genome Initiative (2000) Analysis of the genome Park S, Yu HJ, Mun JH, Lee SC (2010) Genome-wide discovery of sequence of the flowering plant Arabidopsis thaliana. Nature DNA polymorphism in Brassica rapa. Mol Genet Genomics 408:796–815 283:135–145 Thornsberry JM, Goodman MM, Doebley J, Kresovich S, Nielsen D Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in (2001) Dwarf8 polymorphisms associate with variation in Excel. Population genetic software for teaching and research. flowering time. Nat Genet 28:286–289 Mol Ecol Notes 6:288–295 Torres AM, Soost RK, Diedenhofen U (1978) Leaf isozymes as Perrier X, Jacquemoud-Collet JP (2006) DARwin software. genetic markers in citrus. Am J Bot 65:869–881 http://darwin.cirad.fr/darwin Uzun A, Yesilogu T, Aka-kacar Y, Tuzcu O, Gulsen O (2009) Price AL, Patterson NJ, Plenge RM, Weinblatt ME, Shadick NA, Genetic diversity and relationships within Citrus and related Reich D (2006) Principal components analysis corrects for genera based on sequence related amplified polymorphism stratification in genome-wide association studies. Nat Genet markers. Sci Hortic 121:306–312 38:904–909 Va¨li U¨ , Brandstro¨m M, Johansson M, Ellegren H (2008) Insertion- Pritchard JK, Stephens M, Donnelly P (2000) Inference of population deletion polymorphisms (indels) as genetic markers in natural structure using multilocus genotype data. Genetics 155:945–959 populations. BMC Genet 9:8 Rafalski A, Morgante M (2004) Corn and humans: recombination and Vasema¨gi A, Gross R, Palm D, Paaver T, Primmer CR (2010) linkage disequilibrium in two genomes of similar size. Trends Discovery and application of insertion-deletion (INDEL) poly- Genet 20:103–111 morphisms for QTL mapping of early life-history traits in Raman H, Raman R, Wood R, Martin P (2006) Repetitive indel Atlantic salmon. BMC Genomics 11:156 markers within the ALMT1 gene conditioning aluminium Watkins WS, Ricker CE, Bamshad MJ, Carroll ML, Nguyen SV, tolerance in wheat (Triticum aestivum L.). Mol Breed 18:171– Batzer MA, Harpending HC, Rogers AR, Jorde LB (2001) 183 Patterns of ancestral human diversity: an analysis of Alu-inser- Reich DE, Goldstein DB (2001) Detecting association in a case– tion and restriction-site polymorphisms. Am J Hum Genet control study while correcting for population stratification. Genet 68:738–752 Epidemiol 20:4–16 Webber HJ, Reuther W, Lawton HW (1967) History and development Remington DL, Thornsberry JM, Matsouka Y, Wilson LM, Whitt SR of the citrus industry. In: Reuther W, Webber HJ, Batchelor LD (2001) Structure of linkage disequilibrium and phenotypic (eds) The citrus industry, vol 1. University of California Press, associations in the maize genome. Proc Natl Acad Sci USA Berkeley, pp 1–39 98:11479–11484 Weber JL, Wrong C (1993) Mutation of human short tandem repeats. Roose ML, Federici CT, Mu L, Kwok K, Vu C (2009) Map-based Hum Mol Genet 2:1123–1128 ancestry of sweet orange and other Citrus variety groups. In: Weir BS, Cockerham CC (1984) Estimating F-Statistics for the Second international citrus biotechnology symposium, Catania, analysis of population structure. Evolution 38:1358–1370 Italy, p 28 Wright S (1969) Evolution and the genetics of populations. The Saitou N, Nei M (1987) The neighbor-joining method: a new method theory of gene frequencies, vol 2. The University of Chicago for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 Press, Chicago Scora RW (1975) On the history and origin of Citrus. Bull Torr Bot Wright S (1978) Evolution and the genetics of population, variability Club 102:369–375 within and among natural populations. The University of Scora RW, Kumamoto J, Soost RK, Nauer EM (1982) Contribution to Chicago Press, Chicago the origin of the grapefruit Citrus paradisi (Rutaceae). Syst Bot Yu J, Pressoir G, Briggs WH, Vroh Bi I, Yamasaki M, Doebley JF, 7:170–177 McMullen MD, Gaut BS, Nielsen DM, Holland JB, Kresovich S, Swingle WT (1943) The botany of Citrus and its wild relatives in the Buckler ES (2006) A unified mixed-model method for associ- orange subfamily. In: Webber HJ, Batchelor DL (eds) The citrus ation mapping that accounts for multiple levels of relatedness. industry, vol 1, pp 128–474 Nat Genet 38:203–208 Swingle WT, Reece PC (1967) The botany of Citrus and its wild Zhu C, Gore M, Buckler ES, Yu J (2008) Status and prospects of relatives. In: Reuther W, Webber HJ, Batchelor LD (eds) The association mapping in plants. Plant Genome 1:5–20

123