PHYLOGENETIC RELATIONSHIPS AMONG THE SCOLOPACI (AVES: CHARADRIIFORMES): IMPLICATIONS FOR THE STUDY OF BEHAVIOURAL EVOLUTION

by

Rosemary Gibson

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Department of Ecology and Evolutionary Biology

University of Toronto

© Copyright by Rosemary Gibson 2010

PHYLOGENETIC RELATIONSHIPS AMONG THE SCOLOPACI (AVES: CHARADRIIFORMES): IMPLICATIONS FOR THE STUDY OF BEHAVIOURAL EVOLUTION

Rosemary Gibson

Master of Science

Department of Ecology & Evolutionary Biology University of Toronto

2010

ABSTRACT

Unraveling the relationships between organisms and patterns of diversity is a central goal of evolutionary biology, pursuant to the aim of reconstructing the history of life. I constructed a hypothesis for species relationships in the shorebird suborder Scolopaci, and mapped onto this framework behavioural and life-history traits to infer their evolutionary history. Relationships were well-resolved and well-supported, although reliable resolution of certain nodes will require additional, independent sources of information. We estimated the

Scolopaci ancestor to be monogamous, and care-giving through fledging, but ancestral breeding location and migration distance reconstructions were equivocal. Tests for correlations between parental care and other traits to explain extant species’ trait diversity show that, contrary to previous reports, evolution of Scolopaci diversity was a complex process that cannot be explained by individual character correlations. This study provides important insights into Scolopaci and shorebird evolutionary history, and the general practice of inferring past processes from phylogenetic hypotheses.

ii

ACKNOWLEDGEMENTS

Many thanks to my supervisor Allan Baker, and lab members Oliver Haddrath, Pasan

Samarasin, Alison Cloutier, Erika Tavares, Sergio Pereira, Rebecca Elbourne, Debbie

Buehler, Ida Conflitti, Mark Peck, Cathy Dutton and Sue Chopra. I am grateful for the opportunity and freedom you have afforded me, Allan, to explore my interests and challenge myself with the help of your expertise and insight. You have helped me become a stronger student and researcher. Oliver, thank you for your countless and invaluable pieces of advice, and for your unstinting help and encouragement for those around you. I have benefited greatly from your kindness and expertise. Erika, you were a fantastic help with lab work and analysis, and a delightful conference buddy. Alison, Sergio, Rebecca, Debbie,

Pasan and Ida were consistently helpful and conscientious lab partners, and always available for a cheerful discussion, scientific or otherwise. Cathy and Sue decoded many a form and made my life easier in countless other ways. Mark Peck helped me escape from the lab to get a glimpse of some of my research subjects in the field.

Thanks also go to Helen Rodd, Hernán López-Fernández, and Maydianne Andrade for agreeing to sit on my committee and offering their time and thoughts. Many thanks to

Brandon Campitelli, Emma Horrigan, Brechann McGoey and Rafal, Rosalind Murray, Anna

Simonsen, and Alethea Wang for coffee dates and many happy times. Tea Mutabdzic,

Steffi LaZerte, and Yvonne Verkuil, you are treasured and much appreciated for keeping me sane, decently fit, and laughing. Alastair Crombie, thank you for jam, tandem biking, nature sojourns, and many other happy adventures too numerous to name. To my mother and sister, many thanks for loving encouragement and unwavering support, and to my father for being perpetually available to me for scientific discussion and the occasional pep talk, and for taking me up on an ill-considered (but fantastic!) musical adventure.

iii

Table of contents

Abstract ii

Acknowledgements iii

Table of contents iv

List of tables vi

List of figures vi

List of appendices vii

Chapter One – Introduction 1 Goals of phylogenetics and behaviour studies 1

Shorebird relationships and the Scolopaci 4

Shorebird breeding systems 6

Phylogenetic comparative studies 8

Objectives of thesis 9

Chapter Two – Molecular phylogeny of the Scolopaci 12 Abstract 12

Introduction 13

Methods 15

Taxon sampling 15

DNA isolation, amplification, and sequencing 15

Phylogenetic analysis 20

Results 21

Sequence analysis and data features 21

Phylogenetic relationships 22

Discussion 27

Acknowledgements 30

iv

Chapter Three – Evolution of Scolopaci behavioural and life-history traits 31 Abstract 31

Introduction 32

Methods 35

Character Scoring 35

Parental care and social mating systems 35

Migration distance 36

Geographic region 37

Phylogenetic comparative analyses 37

Phylogeny 37

Ancestral state reconstructions and tests of correlated evolution 38

Correction for multiple tests 43

Results 43

Ancestral states and evolutionary transitions 43

Tests of correlated evolution 53

Discussion 59

Ancestral characteristics 59

Correlation of traits 61

Conclusions 64

Acknowledgements 65

Chapter Four – Conclusions and future directions 66

References 72

Appendix 82

v

List of Tables Page

Table 2.1 Scolopaci taxa sampled for phylogenetic inference 16

Table 2.2 Primer sequences used for sequencing members of Scolopaci 19

Table 2.3 Features of genes sequenced for this study 23

Table 2.4 Model parameters used in the partitioned Bayesian analysis 24

Table 3.1 Binary character coding for traits 40

Table 3.2 Ancestral state reconstructions & alternative topology support 45

Table 3.3 Summary of hypotheses of correlated evolution 54

Table 3.4 Results of tests of correlated evolution and order of transitions 55

List of figures Page

Figure 2.1 Scolopaci phylogeny from partitioned Bayesian analysis 25

Figure 3.1 Evolutionary transitions in independent (I) and dependent (D) models of character evolution 41

Figure 3.2 Ancestral state reconstruction of female parental care 46

Figure 3.3 Ancestral state reconstruction of male parental care 47

vi

Figure 3.4 Ancestral state reconstruction of male social mating system 48

Figure 3.5 Ancestral state reconstruction of female social mating system 49

Figure 3.6 Ancestral state reconstruction of migration distance (mean) 50

Figure 3.7 Ancestral state reconstruction of migration distance (1st quartile) 51

Figure 3.8 Ancestral state reconstruction of geographic region 52

Figure 3.9 Transitions between correlated character states 56

Figure 3.10 Male and female parental care 57

Figure 3.11 Male care and male social mating system 58

List of appendices

Appendix 1 Sampled taxa information accession numbers 82

Appendix 2 Character coding for the sampled taxa and associated references 86

vii

CHAPTER ONE

Introduction

“As buds give rise by growth to fresh buds, and these, if vigorous, branch out and overtop on all sides many a feebler branch, so by generation I believe it has been with the great Tree of Life, which fills with its dead and broken branches the crust of the earth, and covers the surface with its ever branching and beautiful ramifications.” Charles Darwin, 1859

A central goal of evolutionary biology is to reconstruct the history of life on earth

(Futuyma & Meagher 2002). Fundamental to this history is the Tree of Life, as first described by Charles Darwin in The Origin of Species (1859) to explain the relatedness of living things by descent from a common ancestor. Evolutionary biology seeks to describe the branches of this Tree of Life, formed by the relationships among all organisms, and to determine the origin, rate, and direction of change of each lineage and its characteristics

(Lewontin 2002). In addition to describing and quantifying the proximate components of

evolutionary biology, this field aims to elucidate the causal mechanisms of evolution

(Futuyma & Meagher 2002). Achievement of these goals requires an understanding of the

nature and magnitude of the selective forces acting on each organism and how these forces

result in evolution, adaptation, speciation, and extinction (Lewontin 2002). Central issues in

evolutionary biology include: (1) the processes by which some groups become species-rich

and others depauperate; (2) the circumstances under which complex adaptations develop; and

(3) evolutionary trends across lineages through time.

Another goal of evolutionary biology is to describe the diversity of life, including the

diversity of behavioural traits of organisms to determine why animals act in the ways they do

1 Chapter One - Introduction 2

and the relationship between their ecology and their behaviours. Important issues in

describing the diversity of these traits include: (1) elucidating the history and ancestral state

of the behaviour; (2) determining the forces that have shaped the evolution of the traits in

extant organism; (3) determining the adaptive value of these traits, if any; and (4)

determining the ecological consequences of behavioural options.

Progress towards answers to these objectives bring us closer to an understanding of

why organisms are as we see them today, and allows us to predict both the forces currently

acting on them and how they might react to future pressures. Examples of this progress come in the form of improved methods for inferring phylogeny that have become more sophisticated and able to estimate support for the various hypotheses of the pattern of evolution more confidently, and in the form of technological improvements that are providing fast and relatively inexpensive DNA sequencing (Lewontin, 2002). These advances have allowed greater insight into variation in mitochondrial, nuclear protein- coding, intron, and non-coding sequences, as well as genome-wide variation in insertions, deletions, and repeated DNA. In addition, researchers on organismal and behavioural diversity have established and tested many general hypotheses on behaviour, life history, morphological, and physiological traits, such as phenotypic plasticity, senescence, life- history trade-offs, coevolution, and mate choice (Futuyma & Meagher 2002). The diversity of trade-offs in life-history and between behaviours including foraging, habitat selection and predator and parasites avoidance also have been well documented and shown to be adaptive in many cases (Owens 2006). Finally, comparative studies between species with a phylogenetic perspective have become more refined in recent years, allowing the testing of

Chapter One - Introduction 3 hypotheses on the role of behaviour in speciation as well as on the evolution of specific and often complex behaviours (Owens 2006).

All of these advances are extremely timely as the rate of species extinctions increases rapidly, caused in large part by the pressure that our own species is exerting on the environment. Knowledge and quantification of species biodiversity, systematics and taxonomy, as well as the genetic diversity within species populations, can assist in making critical conservation decisions. In addition, an understanding of the past biotic and abiotic pressures that shaped the evolution of various behaviours can inform conservation efforts on the potential selective impact of such actions (Caro 2007) and predict response to environmental disturbance (Buchholz 2007).

My thesis will contribute to the body of knowledge for a group of shorebirds well known for their phenotypic diversity, many of whom are threatened or endangered (Morrison et al. 1994; International Wader Study Group 2003). I investigated the suborder Scolopaci, of the shorebird order Charadriiformes, to explore the historical patterns of speciation and trait diversification and to infer the factors that might have acted to influence those processes.

To achieve these aims, I conducted two main analyses: first, I constructed a multigene molecular phylogeny for this group, and second, I traced the history of, and correlation between, parental care patterns, social mating system and migration. Here I introduce my study group, discuss what is known of their systematics and their variation in breeding systems, and review phylogenetic comparative methods. Lastly I briefly outline the goals of each chapter.

Chapter One - Introduction 4

Shorebird relationships and the Scolopaci

Shorebirds (Aves: Charadriiformes) are a diverse assemblage of more than 360 species that generally are considered to comprise three suborders, nineteen families, and ninety-six

genera (Christian et al. 1992; Baker et al. 2007). Estimated to have originated more than 90 million years ago (Baker et al. 2007), this group exhibits a remarkable range of behaviour, morphology, and life history traits. Many studies have investigated the relationships among these species with the goal of understanding the evolutionary processes that resulted in the

diversity that is observed today. Historically, workers took advantage of the only variation

available to them to infer relationships: that which lies in morphological characteristics, such

as bill shape, foot type, skeletal features, and even colour patterns of the down-covered

precocial young (Sibley & Ahlquist 1990). Subsequently, morphological efforts have been

refined and updated as new information and methods of coding data were developed,

culminating in Livezey & Zusi’s (2007) analysis of 2,954 morphological characters for

Neornithine birds that included several shorebird genera. However morphological studies are

hampered by several critical limitations: they are unable to resolve many family-level

relationships, there is a great deal of incongruence between trees presented in various studies,

and the results are sensitive to the choice of which characters were included, and in what

manner (Fain & Houde, 2007; Paton et al. 2003).

Biochemical analysis also has been applied to the study of avian relationships,

including studies based on mass spectrometry (Jacob 1978), DNA-DNA hybridization

(Sibley et al. 1988) and electrophoretic patterns (Christian et al. 1992). These studies in

some cases provide greater resolution than do the morphological studies, and suggest new

relationships among the shorebird families and genera, yet they still suffer from issues of

Chapter One - Introduction 5

taxon sampling, resolution, and measures of support for the groupings they recover (Paton et

al. 2003). With the advent of DNA sequencing, which has potential for strong phylogenetic

signal, and the subsequent development of fast and relatively inexpensive methods to

generate large character-rich datasets, shorebird phylogenetics has been reinvigorated and seen rapid advancement in the quest to elucidate the relationships among birds.

Numerous subsequent studies using mitochondrial and nuclear markers have confirmed the organization of shorebirds into three main clades, the Charadrii, Lari, and

Scolopaci (Paton et al. 2002; Paton et al. 2003; Baker et al. 2007; Fain & Houde 2007), and have begun to provide well-supported and well-resolved hypotheses of relationships at the family and genus level. Several studies have gone further to resolve species-level phylogenies for shorebird taxa, thus paving the way for powerful inference of trait evolution and ancestral state reconstruction (Whittingham et al. 2000; Pereira & Baker 2005; Heath et al. 2008a). Nevertheless, species-level phylogenies still are lacking for many shorebirds groups, limiting the scope of inference that may be made with studies of character evolution.

Thomas et al. (2004) recently addressed this gap by constructing a species-level tree for all shorebirds using the matrix representation with parsimony (or ‘supertree’) method, using source trees based on morphology, biochemistry, and molecular data. Unfortunately, the supertree phylogeny was largely unresolved, and subject to the caveats that are inherent to the supertree method: branch lengths cannot be estimated, the topology is highly sensitive to the source trees included, with equal weighting of well-supported and poorly-supported phylogenies, and there is no way to estimate measures of node support (Baker et al. 2007).

Therefore the impetus remains to resolve fully the shorebird species relationships with

Chapter One - Introduction 6

molecular data and robust methods of analysis. Here, I describe my work towards that challenge.

The Scolopaci are a sub-order of Charadriiformes estimated to have arisen more than

70 million years ago (Baker et al. 2007). This geographically widespread group is comprised

of more than one hundred species of shorebirds, which are commonly grouped into five

families. Four of these are small clades, in total comprising fewer than twenty taxa: the

Jacanidae (jacanas) the Rostratulidae (painted snipes), the Thinocoridae (seedsnipes), and the

monotypic Pedionomidae (the Plains-wanderer). The fifth family, the Scolopacidae, has

more than 100 species that include the sandpipers, curlews, snipes, and their allies. Many

Scolopaci species have very broad distributions and/or make long-distance migrations. As a

result, their diversity in behaviour and habitat use provides potential insight into evolutionary

forces acting on behavioural and life-history traits (Thomas et al. 2007).

Shorebird breeding systems

Shorebirds are considered by many to display particularly compelling variation in their

breeding systems. In his book The Descent of Man (1871), Charles Darwin exclaimed over

the sex-role reversal of painted snipes (family Rostratulidae) and the impressively aggressive

lekking males of the Ruff (family Scolopacidae) (Hogan-Warburg 1966; Thomas et al. 2007).

Here, I use breeding system to refer to both the duration of parental care (hereafter referred to

as parental care) and the form and duration of the social pair-bond (hereafter referred to as

‘social mating system’) following Reynolds (1996). This diversity in breeding systems is

largely contained within two of the three sub-orders, comprising the sandpipers and allies

(Scolopaci) and the plovers and allies (Charadrii). The remaining suborder comprising the

Chapter One - Introduction 7

gulls and their allies (Lari), interestingly, is mostly invariant in breeding systems (Garcia-

Pena et al. 2009). The variation among the Scolopaci and Charadrii is impressive: males and females of each species range in parental care from giving no care to offspring after mating

or egg-laying to providing full care until the young are ready to fledge. In terms of social

mating system, species may range from social monogamy, in which each individual forms

only one pair bond per season; to polyandry, where the female has several male mates

simultaneously; or to polygyny, when the male has several female mates. Additionally, there

are numerous variations on these categories, such as species in which males or females are

sequentially polygamous, as well as species in which the male displays on a lek and mates

with numerous females but no pair bonds are formed.

This variation has attracted a great deal of attention, and there have been several

hypotheses on what drives the various combinations between the different modes of parental

care and social mating systems. Sexual conflict often has been put forth as one driver of

these evolutionary patterns, as the interests of the sexes almost never completely align,

especially in cases where reproduction is costly in terms of production of young that

subsequently require care of some kind (Thomas & Szekely 2005). This sets up what Trivers

(1972) famously called the ‘cruel bind’, in which one parent abandons the offspring to the

care of the other parent. The remaining parent thus is placed in the bind of being forced to

complete parental care duties alone, or else forfeit survival of the clutch. Long-distance

migration, another outstanding feature of many shorebirds, is another and perhaps related

potential candidate for association with breeding system evolution (Garcia-Pena et al. 2009;

Myers 1981; Reynolds & Szekely 1997). Long migrations are energetically expensive for

Chapter One - Introduction 8 shorebirds and therefore it has been suggested that some shorebirds may avoid incurring the additional costs of caring for offspring by reducing the duration of their care.

Phylogenetic comparative studies

Comparative studies of traits are one of the oldest veins of scientific investigation into the variation in living things (Pagel & Meade 2006). In circumstances where experimentation is not possible for hypothesis testing because the topic of interest operates on a time scale beyond that of one or even a group of researchers, comparative studies frequently and productively have been undertaken to investigate patterns of trait co- occurrences (Freckleton 2009). At such scales, these analyses have great potential for adding to our broader understanding of the nature and outcome of evolutionary processes. Because species are related by their history of common descent, the traits that they share may reflect that shared history rather than the independent effect of ecology or evolution (Pagel 1994).

The power of comparative tests, therefore, depends upon robust understanding of the phylogenetic relationships between the taxa in question, to ensure that the co-occurrence of character states reflects an evolutionary trend beyond that of shared ancestry. As DNA sequencing and the ability to construct well-resolved and robust phylogenies has increased over the last decade and a half, providing a framework for the comparison of innumerable biological traits, comparative studies accordingly have appeared in ever-increasing numbers

(Pagel 1999). Concurrent with improvements in our ability to produce phylogenetically- informative data have been improvements and refinements made to the statistical methods of analyzing traits of interest across phylogenies. It is now possible to describe the direction, order, and nature of the evolutionary changes observed across a phylogeny (Pagel 1997).

Chapter One - Introduction 9

Thus it now is achievable, in theory, to determine factors such as the most likely

characteristics of the ancestor of a group, to test whether the changes from that ancestor have

evolved in concert with another trait and if so, to determine the sequence of transitions away

from an inferred ancestral state and the nature of the influence of one trait on another

(Thomas et al. 2007).

Objectives of Thesis

The main objective of this thesis is to analyze the evolutionary path of several

behavioural and life-history traits, to hypothesize the group’s ancestral state, the pattern of change from that ancestral state, and finally to consider the ecological and evolutionary forces that may have determined at least one of those patterns. The results of these efforts are presented in Chapter Three. However, species-level relationships of the Scolopaci have not previously been examined in a molecular framework, which is important for studies of evolution at the molecular, as well as ecological, level. Therefore in Chapter Two I describe the results of my efforts to construct a hypothesis of these relationships. I have four specific goals: (1) to determine the relationships among these species; (2) to describe the trends across branches in terms of transitions and conservation of behavioural mode; (3) to determine whether there are obvious ecological or evolutionary constraints or correlates of potential transitions; and (4) to determine whether my results support previous findings and hypotheses. In so doing, this thesis addresses main objectives in the field of evolutionary biology, while contributing new insights to a point in conflict within shorebird evolutionary history regarding variation in breeding systems. Below, I present the main goals of each subsequent chapter.

Chapter One - Introduction 10

Chapter Two, ‘Molecular phylogeny of the Scolopaci’ details the construction of the phylogeny for the Scolopaci (for which a robust species-level phylogeny is lacking) to infer the branching pattern from their common ancestor to the species groups we observe today. I use nucleotide sequence data from nuclear and mitochondrial genes to reduce the risk of representing the evolution of a single gene, and to resolve both recent divergences

(mitochondrial DNA) and deeper nodes (nuclear DNA) (Paton & Baker 2006). I both confirm familial and generic relationships previously described and reveal several generic and species relationships for the first time, such as relationships within curlews, phalaropes,

godwits, and snipes (genus Gallinago) within which is nested the semisnipe genus

Coenocorypha.

Chapter Three, ‘Evolution of parental care duration, breeding systems, and migration

in the Scolopaci (Aves: Charadriiformes)’ details my investigation into the evolution of

parental care in the Scolopaci. This group of shorebirds is very diverse in this behavioural

trait. However, all previous attempts to map parental care modes onto a phylogeny of

shorebirds and then infer evolutionary patterns have rested on phylogenies lacking robust support for one or more reasons. The goals of this chapter are to evaluate the historical

patterns of the evolution of breeding systems, migration, and biogeography, and to test

support for two current hypotheses on the factors influencing variation in shorebird parental

care.

Chapter Four summarizes the main findings of this thesis. I discuss how it

contributes to our understanding of the evolutionary history of the Scolopaci and their

behaviour, and suggest possible future avenues of research.

Chapter One - Introduction 11

Chapters 2 and 3 were written as research papers intended for separate publication in the primary literature in collaboration with Dr. Allan Baker. As such there is some repetition of information describing components and themes that are shared among them.

CHAPTER TWO

Molecular phylogeny of the Scolopaci

ABSTRACT

Shorebirds are a diverse assemblage of species which has received considerable attention for its variation in behaviour, morphology, and life-history traits. Comparative studies of this impressive variation have been limited to date by the lack of a well-resolved and well-supported phylogeny based on DNA sequences. In this study I build upon the framework provided by several previous sequence-based shorebird phylogenies

(Whittingham et al. 2000; Paton e al. 2003; Pereira & Baker 2005; Baker et al. 2007) to construct the first sequence-based species-level phylogeny for the Scolopaci, one of three shorebird sub-orders. I sampled 84 Scolopaci species, and collected data for five genes (one nuclear and four mitochondrial) via PCR and sequencing or from GenBank. The phylogeny was estimated using Bayesian inference on a partitioned dataset of 6,365 aligned base pairs.

The constrained phylogeny is well-resolved and well-supported, except for the radiations within Tringa and Calidris. Resolutions of these problematic clades are unlikely to occur without multiple independent nuclear loci to estimate their species trees. Nevertheless, I argue that the Bayesian tree provided here represents a good framework for studies of trait evolution in the broad scope of the Scolopaci.

12 Chapter Two – Scolopaci phylogeny 13

INTRODUCTION

The systematics of shorebirds (order Charadriiformes) have been a popular subject for some time (Jacob 1978; Bjorklund 1994; Paton et al. 2003; Thomas et al. 2004; Fain &

Houde 2007). The great interest they have created in large part is due to their variation in a variety of life-history, behavioural, and morphological traits as well as their enigmatic

relationships and various ‘odd-ball’ taxa that are difficult to place phylogenetically (Van

Tuinen et al. 2004). They are composed of more than 350 species and 19 families that range

from species-rich radiations to small, morphologically and behaviourally distinct clades and individual taxa (Van Tuinen et al. 2004). Early efforts to elucidate the relationships among these species based on morphological and biochemical data produced incompletely resolved and discordant results (Strauch, 1978; Sibley et al., 1988; Bjorklund, 1994; Chu, 1995). The emergence of relatively inexpensive and rapidly-obtained DNA sequence data has resulted in several recent studies of these relationships that have begun to provide much-needed consensus and resolution of the Chardriiformes relationships. Among the insights provided by molecular studies has been the following: (1) progress in the placement of

Charadriiformes among other avian orders (Hackett et al. 2008); (2) multiple confirmations for the organization of Charadriiformes into three suborders: Lari, Charadrii and Scolopaci

(Ericson et al. 2003; Paton et al. 2003; Paton & Baker 2006; Baker et al. 2007; Fain &

Houde 2007), and (3) increased resolution of relationships to the family and genus level for

some groups. Interestingly, these results also indicate a common phylogenetic pattern among

the suborder in which the first split among taxa within the suborder is between a small

Gondwanan-distributed clade and a much larger, mostly cosmopolitan-distributed clade (Van

Tuinen et al. 2004). A recent matrix representation with parsimony ‘supertree’ approach

Chapter Two – Scolopaci phylogeny 14 from Thomas et al. (2004) focused on species-level relationships among all Charadriiformes species, but the supertree was largely unresolved and lacks measures of node support or estimates of branch length, shortcomings which limit its utility for studies of the impressive trait variation in shorebirds (Pagel 1994; Freckleton et al. 2002). Therefore, species-level relationships remain largely undetermined by multilocus molecular methods within shorebirds, with the exception of species-level phylogenies of the shanks (Pereira & Baker

2005) and the jacanas (Whittingham et al. 2000). These studies from Pereira & Baker (2005) and Whittingham et al. (2000) demonstrate the value of understanding species relationships, as they have offered insights of evolutionary and ecological processes at broad geographic and historical scales. The framework formed by these studies of shorebird relationships is an excellent one to build upon to more broadly apply phylogenetic information to questions of trait evolution at the species level.

I have begun that process by constructing a species-level phylogeny for the Scolopaci, one of three suborders of shorebirds. The five families that together form the suborder

Scolopaci exhibit the trait diversity for which Charadriiformes is well-known, and in some traits this group is considered especially diverse even among shorebirds (Thomas et al.

2007). In addition, there are species phylogenies for two groups (shanks and jacanas) as well as a well-supported genus-level phylogeny of the Charadriiformes available to form the backbone of a species phylogeny. The Scolopaci thus represent an ideal group with which to exploit the opportunities for studies of trait evolution that are afforded by the construction of a robust and well-resolved phylogeny. My goals for this study are three-fold: first, to describe the relationships among these shorebirds using multilocus molecular methods; second, to describe how the tree representing these relationships compares with previous

Chapter Two – Scolopaci phylogeny 15

hypotheses and how future studies might build upon it; and third, to assess the utility of the

tree in understanding other aspects of the evolutionary history of shorebirds.

METHODS

Taxon sampling

I obtained blood or tissue samples for 84 out of approximately 106 Scolopaci taxa, including species that recent molecular work has indicated include more than one distinct group that might possibly represent cryptic species (these were Limosa limosa islandica and

Limosa limosa melanuroides, Numenius phaeopus hudsonicus and Numenius phaeopus

variegatus, and Tringa solitaria solitaria and Tringa solitaria cinnamomea) and two

outgroup taxa (Sterna hirundo and Rynchops niger) from the two remaining shorebird sub-

orders, the Lari and the Charadrii. I was not able to obtain samples for 24 Scolopaci taxa,

most of which are rare or extinct. The samples are deposited in the Royal Ontario Museum.

Specific taxon sampling is given in Table 2.1. Other specimen information is given in the

Appendix 1.

DNA isolation, amplification, and sequencing

DNA was extracted from frozen tissues or ethanol-preserved samples using a rapid

alkaline method following Rudbeck & Dissing (1998). Fragments of the nuclear gene

recombination-activating gene 1 (RAG1; primers R1, R2b, R13, R14, R11, R17, R18, R19,

R20, R21, R22, R24 from Groth & Barrowclough (1999)) and the mitochondrial genes

cytochrome b (CYT B, primers b1, b6, and b3), 12S (primers L1537 and 12Send), and

Table 2.1 Scolopaci taxa sampled for phylogenetic inference

Scolopaci species Common Name Family Actitis hypoleucos Common Sandpiper Scolopacidae Actitis macularius Spotted Sandpiper Scolopacidae Chapter Two – Scolopaci phylogeny 16 Actophilornis africanus African Jacana Jacanidae Aphriza virgata Surfbird Scolopacidae Arenaria interpres Ruddy Turnstone Scolopacidae Arenaria melanocephala Black Turnstone Scolopacidae Attagis gayi Rufous-bellied Seedsnipe Thinocoridae Attagis malouinus White-bellied Seedsnipe Thinocoridae Bartramia longicauda Upland Sandpiper Scolopacidae Calidris acuminata Sharp-tailed Sandpiper Scolopacidae Calidris alba Sanderling Scolopacidae Calidris alpina Dunlin Scolopacidae Calidris bairdii Baird's Sandpiper Scolopacidae Calidris canutus Red Knot Scolopacidae Calidris ferruginea Curlew Sandpiper Scolopacidae Calidris fuscicollis White-rumped Sandpiper Scolopacidae Calidris himantopus Stilt Sandpiper Scolopacidae Calidris maritima Purple Sandpiper Scolopacidae Calidris mauri Western Sandpiper Scolopacidae Calidris melanotos Pectoral Sandpiper Scolopacidae Calidris minuta Little Stint Scolopacidae Calidris minutilla Least Sandpiper Scolopacidae Calidris ptilocnemis Rock Sandpiper Scolopacidae Calidris pusilla Semipalmated Sandpiper Scolopacidae Calidris ruficollis Rufous-necked Stint Scolopacidae Calidris subminuta Long-toed Stint Scolopacidae Calidris temminckii Temminck's Stint Scolopacidae Calidris tenuirostris Great Knot Scolopacidae Catoptrophorus semipalmatus Willet Scolopacidae Coenocorypha aucklandica Subantarctic Snipe Scolopacidae Coenocorypha pusilla Chatham Islands Snipe Scolopacidae Eurynorhynchus pygmeus Spoon-billed Sandpiper Scolopacidae Gallinago delicata Wilson's snipe Scolopacidae Gallinago gallinago Common Snipe Scolopacidae Gallinago imperialis Imperial Snipe Scolopacidae Gallinago media Great Snipe Scolopacidae Gallinago nigripennis African Snipe Scolopacidae Gallinago paraguaiae South American Snipe Scolopacidae Gallinago stenura Pintail Snipe Scolopacidae Heteroscelus brevipes Grey-tailed Tattler Scolopacidae Heteroscelus incanus Wandering Tattler Scolopacidae Hydrophasianus chirurgus Pheasant-tailed Jacana Jacanidae Irediparra gallinacea Comb-crested Jacana Jacanidae Jacana jacana Wattled Jacana Jacanidae Limicola falcinellus Broad-billed Sandpiper Scolopacidae Limnodromus griseus Short-billed Dowitcher Scolopacidae Limnodromus scolopaceus Long-billed Dowitcher Scolopacidae Limnodromus semipalmatus Asian Dowitcher Scolopacidae Limosa fedoa Marbled Godwit Scolopacidae Limosa haemastica Hudsonian Godwit Scolopacidae Limosa lapponica Bar-tailed Godwit Scolopacidae NADHLimosa dehydrogenase limosa islandica subunit 2 (ND2;Black-tailed primers MetL, Godwit Asn, and ND2sb) Scolopacidae were used in this Limosa limosa melanuroides Black-tailed Godwit Scolopacidae Microparra capensis Lesser Jacana Jacanidae Numenius americanus Long-billed Curlew Scolopacidae Numenius arquata Eurasian Curlew Scolopacidae Ni d ii FEt Cl Sl id Chapter Two – Scolopaci phylogeny 17

study. Cytochrome c oxidase subunit 1 (COI) sequences were obtained from a concurrent

DNA barcoding study in our lab. Sequences already available from this group from previous

studies were obtained from GenBank (see Appendix 1 for a complete list of accession

numbers and other information for all sampled taxa). Nuclear and mitochondrial primers

used in this study are described in Table 2.2. The genes were chosen because they are

common to previous datasets that formed the backbone of this study and therefore many

sequences already were available for Scolopaci species and also because they are commonly

used and have been shown to contain phylogenetic signal in the Scolopaci (Paton et al., 2003;

Pereira & Baker, 2005; Baker et al., 2007). Amplification of RAG1, CYTB, 12S, ND2, and

COI was performed using a buffer solution of 10mM TrisHCl pH 8.3, 2.5 mM MgCl2, 50mM

KCl and 0.01% gelatin in a PCR cocktail of 1.25 µL water, 0.28 µL buffer, 0.5 µL primers

(each), 1µL DNA, and 0.05 µL Taq DNA polymerase. Nuclear genes were amplified using a touchdown procedure as described by Groth and Barrowclough (1999). Mitochondrial genes were amplified following Pereira & Baker (2005) with an initial denaturation step at 94° C, followed by 36 cycles of 94° C for 40 seconds, 50° C for 40 seconds, and 72° C for one minute, and a final extension step at 74° C for 5 minutes. Amplification products were run out on a 1.5% agarose gel. Amplified product was extracted from the gel by excising the band and centrifuging it through a filter tip to separate agarose from DNA. These recovered amplified products then were sequenced and run out on an ABI 3100 automated DNA sequencer, following suggested protocols by the manufacturer. Sequences were deposited in

GenBank (for accession numbers, see Appendix 1).

Table 2.2 Primer sequences used for sequencing species in the Scolopaci.

Chapter Two – Scolopaci phylogeny 18

Gene Primer Sequence ( 5’ Æ 3’ ) Reference RAG1 R1 GACAAGCACCTGAGGAAGAAGAT Groth & Barrowclough 1999 R2b GAGGTATATAGCCAGTGATGCTT Groth & Barrowclough 1999 R11 GGACCAGTAGATGATGAAACTCT Groth & Barrowclough 1999 R13 TCTGAATGGAAATTCAAGCTGTT Groth & Barrowclough 1999 R14 TTCCTGTGGATAATACTCCAGCA Groth & Barrowclough 1999 R17 CCCTCCTGCTGGTATCCTTGCTT Groth & Barrowclough 1999 R18 GATGCTGCCTCGGTCGGCCACCTTT Groth & Barrowclough 1999 R19 GTCACTGGGAGGCAGATCTTCCA Groth & Barrowclough 1999 R20 CCATCTATAATTCCCACTTCTGT Groth & Barrowclough 1999 R21 GGATCTTTGAGGAAGTAAAGCCCAA Groth & Barrowclough 1999 R22 GAATGTTCTCAGGATGCCTCCCAT Groth & Barrowclough 1999 R24 GCCTCTACTGTCTCTTTGGACAT Groth & Barrowclough 1999 CytB B1 CCATCCAACATCTCAGCATGATGAAA Kocher et al. 1989 B3 GGACGAGGCTTTTACTACGGCTC T. Birt B6 GTCTTCAGTTTTTGGTTTACAAGAC T. Birt 12S L1537 AATCTTGTGCCAGCCACCGCG G Oliver Haddrath, pers. comm. 12Send GTGCACCTTCCGGTACACTTACC Oliver Haddrath, pers. comm. ND2 MetL AAGCTATCGGGCCCATACCCG Oliver Haddrath, pers. comm. ASN GATCRAGGCCCATCTGTCTAG Oliver Haddrath, pers. comm. ND2sb CCTTGAAGCACTTCTGGGAATCAGA Oliver Haddrath, pers. comm.

Phylogenetic analysis

Chapter Two – Scolopaci phylogeny 19

DNA chromatograms were edited in ChromasPro 1.42

(http://www.technelysium.com.au/ChromasPro.html) to identify ambiguous bases and

correctly label bases that the program was unable to ascertain. Ambiguous bases were coded

according to the standardized IUPAC ambiguity code. Sequences then were translated into

amino acid sequences, aligned by eye using MEGA 4 (Tamura et al. 2007), and translated

back into nucleotide sequences. Indels and regions of ambiguous alignment were excluded

from all analyses. Aligned sequences for each of the five genes then were concatenated

using MacClade version 4.08 (Maddison & Maddison 2000) into a combined dataset of 6,365

base pairs. Each gene alignment was tested for stationarity in base composition at variable

sites using TREE_PUZZLE-5.2 (Schmidt et al. 2002), and saturation of substitutions was

evaluated by comparing transitions and transversions versus total sequence divergence using

DAMBE (Xia & Xie 2001). RAG1 showed little evidence of saturation, while the

mitochondrial genes ND2, CYT B and COI show moderate saturation at third positions, but not a complete plateau, indicating they retain phylogenetic signal (Salemi & Vandamme

2003). As a result, each protein-coding gene was partitioned into two partitions: one partition for 1st & 2nd positions, and one for 3rd positions. A model of evolution was chosen

for each partition using MrModeltest 2.3 (Nylander et al. 2004) as implemented in PAUP

4.0b10 (Swofford, 2003).

Bayesian analysis with Markov-chain Monte Carlo sampling was performed using

MrBayes 3.1.2 (Huelsenbeck & Ronquist, 2001) run for 5 million generations. I made two

simultaneous runs, sampling trees every 1,000 generations, with one hot and five cold chains

to encourage swapping among the MCMC chains and to avoid the analysis remaining in local

rather than global optima. I allowed model parameters to be unlinked across the partitions,

Chapter Two – Scolopaci phylogeny 20

with each partition corresponding to a different gene. All trees were considered equally

likely (the default setting in MrBayes). I assumed variation among partitions in five

parameters: substitution rates (ratepr), the shape parameter of the gamma distribution of substitution rates (Shape), the stationary base frequencies (statefreq), the proportion of invariable sites (pinvar), and the nucleotide substitution ratio (revmat). A burn-in period of

750 was chosen by plotting the likelihood scores against time to determine when convergence was reached and how many trees ought to be discarded. Posterior probabilities of the nodes of the 50% majority-rule consensus tree were calculated from the remaining

trees. (The posterior probability of a node refers to the proportion of trees in the posterior

distribution that contained that node.)

RESULTS

Sequence analysis and data features

Of the 6,365 sites in the aligned dataset (with indels removed) 2,085 were

phylogenetically informative under parsimony (Table 2.3). Examination of the nucleotide

composition for each gene revealed several significant departures from stationarity in the

mitochondrial genes ND2: five Gallinago species were significantly non-stationary (P <

0.05). Because non-stationarity was present in only one gene and then only within members

of a single genus I consider it unlikely to be causing the analysis to recover spurious species

relationships. Models and parameters estimated for each of the nine partitions are presented

in Table 2.4.

Phylogenetic relationships

Chapter Two – Scolopaci phylogeny 21

Bayesian analysis of the concatenated dataset revealed the 50% majority-rule

consensus tree in Fig 2.1. This phylogeny was in agreement with previous family- and

genus-level hypotheses for shorebirds (Paton et al. 2003; Baker et al. 2007) with the

exceptions of relationships within Tringa and the Calidridine sandpipers that are detailed

below. The consensus tree was derived from several thousand trees, which had posterior

probabilities of 0.013 to 0.001. Most relationships in the consensus topology are well-

resolved and strongly supported. The sampled taxa form two main clades: a smaller clade

containing the seedsnipe + Plains-wanderer group, which is sister to the jacana + painted

snipe group, and these together as sister to the much larger clade containing the remainder of the Scolopaci taxa. Within the seedsnipes, the two Attagis species are sister to the

Thinocorus species, and this group is sister to the Plains-wanderer. This group in turn is sister to the clade formed by Rostratula and the Jacanas. Within the Jacanidae, the relationships are congruent with those of Whittingham (2000) and Baker et al. (2007).

Relationships among genera of the Scolopacidae follow Baker et al. (2007), with the shanks and allies sister to the phalaropes (as constrained), and with this group sister to the clade formed by the snipes and woodcocks, which together are sister to the dowitchers: ((Gallinago

+ Scolopax), Limnodromus). The New Zealand snipes, Coenocorypha, are nested within

Gallinago and this group is sister to the clade containing sandpipers and their allies. Godwits

(Limosa), and the curlews and the Upland sandpiper (Numenius + Bartramia) constitute successive sister groups at the base of the Scolopaci.

One difference from Baker et al. (2007) and Pereira and Baker (2005) is the placement

(with low node support) of the phalaropes as sister to the Terek sandpiper, and with those

Table 2.3 Features of genes sequenced for this study.

Chapter Two – Scolopaci phylogeny 22

Gene Constant sites Parsimony - Variable Total sites Informative Uninformative

RAG1 1923 609 382 2914

ND2 378 524 82 984

CYT B 481 437 87 1005

12S 324 205 50 579

COI 547 310 26 883

Total 3653 2085 627 6365

Table 2.4 Model parameters used in the analysis.

Chapter Two – Scolopaci phylogeny 23

Partition Model Model parameters

I G

RAG1 1st & 2nd GTR + I + G 0.673 0.898

RAG1 3rd GTR + G - 0.793

COI 1st & 2nd GTR + I + G 0.876 0.738

COI 3rd GTR + I + G 0.023 2.229

CYT B 1st & 2nd HKY + I + G 0.550 0.434

CYT B 3rd GTR + G - 2.091

ND2 1st & 2nd HKY + I + G 0.444 0.473

ND2 3rd GTR + G - 3.495

12S GTR + I + G 0.460 0.638

Chapter Two – Scolopaci phylogeny 24

Figure 2.1 Phylogeny based on sequences of five genes (RAG1, CYT B, 12S, ND2, and

COI) estimated with partitioned Bayesian analysis for 84 species of the Scolopaci. All nodes received a posterior probability of 1.00 unless otherwise labeled.

Chapter Two – Scolopaci phylogeny 25

two taxa as sister to the rest of the shanks – i.e. ((Phalaropus, Xenus), Tringa + allies), rather

than placing the phalaropes as the basal sister group to the clade containing the shanks and

their allies – i.e. (Phalaropus, (Xenus, Tringa + allies). Within Tringa, the relationships

differ slightly from those found by Pereira and Baker (2005). First, the species T. glareola,

T. stagnatilis, and T. totanus were arranged as (T. glareola, T. stagnatilis), T.totanus)

whereas Pereira and Baker (2005) found the relationship to be (T. glareola, T.totanus), T.

stagnatilis). Second, the relationship of the aforementioned clade with that of the clade formed by T. melanoleuca, T. nebularia, and T. erythropus and the clade containing C. semipalmatus and T. flavipes is not resolved, whereas in Pereira and Baker (2005) T. glareola, T. totanus, and T. stagnatilis are sister to C. semipalmatus and T. flavipes, and T. melanoleuca, T. nebularia, and T. erythropus are the basal sister group.

Although the monophyly of the Scolopacidae is strongly supported, the genus-level backbone differs from (Baker et al. 2007). Calidris is not monophyletic, with

Eurynorynchus, Tryngites, Limicola, Philomachus, and Aphriza nested within Calidris, whereas the genus relationships recovered in Baker et al. (2007) were a polytomy between

(Aphriza, Calidris), Eurynorhynchus); (Limicola, Philomachus); and (Calidris, Tryngites).

While in the consensus topology most species relationships are well-supported, several

within the clade of Calidridae sandpipers are weakly supported. However, strongly-

supported nodes were recovered for several clades, such as (C. maritima, C. ptilocnemis), C.

alpina), C. alba); (C. fuscicollis, C.minutilla); (C. mauri, C. pusilla); (C. ruficollis, E. pygmeus); (C. acuminata, L. falcinellus), P. pugnax); and ((A. virgata, C. tenuirostris), C. canutus).

Chapter Two – Scolopaci phylogeny 26

DISCUSSION

The great diversity shown by shorebirds in behaviour, life-history, and morphology makes them ideal subjects for investigating the evolutionary mechanisms that have resulted in such impressive variation. Knowledge of the phylogenetic relationships among species is

an important prerequisite, so that the evolutionary history of the trait may be traced back

through time, and the shared history among taxa is taken into account when attempting to

understand the pattern and association of different traits among the taxa. A robust and

inclusive phylogeny permits more powerful inferences about evolutionary forces acting on a

large clade of species.

This study represents the first DNA sequence based species-level phylogeny

constructed for a shorebird suborder, and thus takes the first step in reconstructing the

detailed evolutionary history of this group. The phylogenetic analysis supports and extends

the hypotheses of relationships proposed in previous molecular phylogenies of shorebirds

(Whittingham et al. 2000; Paton et al. 2003; Pereira & Baker 2005) and greatly improves on

the resolution of the species relationships found using the supertree method (Thomas et al.

2004). The relationships within phalaropes, snipes, woodcocks, dowitchers, sandpipers,

godwits, and curlews have not been elucidated previously using sequence information.

There are several interesting implications of the phylogeny presented in this study.

First, several genera were found to be paraphyletic. The paraphyly of Tringa was presented

previously (Pereira & Baker 2005) but here I show that the genera Gallinago and Calidris are

also paraphyletic. The genus Coenocorypha, which represents the New Zealand semi-snipes, is embedded within Gallinago, members of which are distributed nearly worldwide. Many of the sandpipers of monotypic genera nested within Calidris are unusual in behaviour and/or

Chapter Two – Scolopaci phylogeny 27

morphology, which likely influenced their historical classification into separate genera. For

example, the Buff-breasted Sandpiper (Tryngites subruficollis) is placed in the paraphyletic

Calidris assemblage, and has an unusual ‘exploded lek’ breeding system that likely

contributed to its classification in a monotypic genus. Another example is found in the

Spoon-billed Sandpiper (Eurynorhynchus pygmeus), which is nested within the Calidridine

sandpipers in this study, and which has a striking and very unusual spatulate bill morphology

that is likely the basis of its historical classification into the monotypic genus

Eurynorhynchus. The molecular phylogeny shows that historical classifications based on

these unusual features are likely in error, and that there is need for taxonomic revision of

genera within the Scolopaci.

Another interesting feature of the Scolopaci phylogeny is the considerable variation in

branch lengths across the phylogeny. The four smaller families (Jacanidae, Rostratulidae,

Thinocoridae, and Pedionomidae), historically ‘odd-ball’ taxa that were difficult to place, are

now confirmed in a basal clade within the Scolopaci, with long branches separating them

from each other and the remaining family, the Scolopacidae. Several other clades within the

Scolopacidae also have long internal branches and well-resolved relationships, such as the

snipes, woodcocks, and dowitchers, as well as the godwits and curlews. Notable exceptions

to this trend are the short internodes within the two most species-rich, and difficult to resolve, clades in the phylogeny: Tringa and especially Calidris. The presence of these extremely short branches within the Scolopaci suggests relatively rapid diversification within the shanks and the sandpipers, and as a result few accumulated nucleotide differences among the lineages. Therefore the difficulty in resolving these relationships may stem from incomplete sorting of those few differences among the lineages into reciprocally monophyletic groups.

Chapter Two – Scolopaci phylogeny 28

Despite the advances made in my study, the analysis was not able to resolve all relationships within the Scolopaci to a high degree of certainty. While the backbone of the phylogeny, and most within-family relationships are very well supported, with posterior probabilities of 0.95 or greater, several nodes in the shanks (Tringa), and several in the

Calidridine sandpipers have weak support. An examination of the individual gene trees and the distribution of topologies in the posterior distribution suggests that there may be an appreciable level of uncertainty in the dataset that centres on the species relationships in

Tringa and Calidris. This type of uncertainty likely arises where the phylogenetic signal is ambiguous or where gene trees are incongruent due to incomplete lineage sorting across short branches in the tree. In such cases, concatenation of genes into a single dataset and single-individual representation of species can lead to an inaccurate inference of the species tree (Edwards et al. 2005; Liu & Pearl 2007; Degnan & Rosenberg 2009). Therefore it seems likely that resolution of these difficult clades will require both the acquisition of additional sequence data from independent loci, as well as the application of methods of analysis that allow for gene trees to be estimated independently and the species tree to be inferred based on the frequency of nodes in those gene trees (Degnan & Rosenberg 2009). Additional independent sources of phylogenetic information, such as retroposon insertions (Watanabe et al. 2006), also should be an invaluable source for confirmation of species trees. Retroposon insertions, such as those of chicken repeat 1 (CR1) are useful clade markers because they are irreversible: once a copy of a retroposon is inserted into the genome, it is nonfunctional and will not remove itself. Therefore homoplasy of an insertion is effectively impossible, in contrast to nucleotide insertions in which homoplasy becomes an increasing issue as time goes on and mutation may hit upon sites repeatedly. However, like other rare genomic

Chapter Two – Scolopaci phylogeny 29

events, retroposons might also fail to recover the species tree if they sort randomly across

short internodes deep in the tree (Degnan & Rosenberg 2006). Analysis of multiple nuclear

loci will help to firmly ascertain species relationships as well as make possible the

application of phylogenetic knowledge to the study of phenotypic diversity.

Despite the above-mentioned drawbacks, the tree from this analysis is mostly well-

resolved with very strong support at the majority of nodes, and is congruent with previous

molecular hypotheses. As a result, it represents a strong, well-sampled hypothesis of

Scolopaci relationships and a powerful basis on which to begin efforts to unravel the

evolution of the myriad traits that make shorebirds such popular subjects of study by

evolutionary biologists.

ACKNOWLEDGEMENTS

Thanks go to Rebecca Elbourne and Erika Tavares for generously allowing the use of their COI sequences, Ida Conflitti for help with sequence analyses, Pasan Samarasin

Dissanayake for helpful discussions on tree inference, and Oliver Haddrath for advice on data partitioning. This work was supported by NSERC and the Frank M Chapman Grant from the

American Museum of Natural History to RG and ROM Governors grants to AJB.

CHAPTER THREE

Evolution of parental care duration, breeding systems, and migration

distance in the Scolopaci (Aves:Charadriiformes)

ABSTRACT

Shorebirds are well known for their variation in a range of behavioural, life-history, and

morphological traits. In particular, they have attracted a great deal of attention for their range

of breeding systems. Several hypotheses have been proposed to explain evolution in these

traits, including the roles of long-distance migration and sexual conflict. However, most

previous studies are weakened by one or more problems, such as the use of a poorly resolved

phylogeny, limited and paraphyletic taxon sampling, and failure to account for phylogenetic

uncertainty. Here I detail analyses to infer the history of several traits relating to breeding systems, including duration of parental care, social mating system, migration distance, and

zoogeographic region, for a group of shorebird species in the suborder Scolopaci for which I

have constructed a species-level phylogeny. In addition I describe tests of correlated

evolution for duration of parental care with social mating system and migration distance. My

results corroborate previous findings that male and female care are correlated and may

represent evidence of sexual conflict, and that male parental care and social mating system

are correlated. Tests of individual parameters and precedence of changes away from the

ancestral state indicate that reduction of care by males may have preceded that by females,

and that male transition to polygamy might have preceded their reductions in care. I discuss

the implications of these findings for our understanding of the variation observed in

Scolopaci breeding systems and suggest potential avenues of future research.

30 Chapter Three – Scolopaci and the evolution of parental care 31

INTRODUCTION

Shorebirds are famous for their behavioural, morphological, and life-history variation.

For instance, the Scolopaci count members that are respectively long-distance migrants,

short-distance migrants or residents; in addition they may be monogamous, polyandrous,

polygynous, or lekking; they may be parents who desert after mating or egg-laying, or are

incubators-only, or devoted care givers until the young are fully fledged, and they take on

multiple body shapes and sizes, including wide variation in bill and foot shapes and skeletal characteristics. As such, they have been the subject of much scientific attention to try to explain the evolution of this large scale variation. One focus of attention and a topic of much

debate has centred on their phylogenetic relationships, as various types of data

(morphological, biochemical, and molecular) have indicated different relationships. A robust

species tree would be of great utility to unravel the sequence of evolutionary events that have

resulted in the diversity of extant species that we observe today. DNA sequence-based

methods of analysis largely have reinvigorated this effort and helped it move forward, and as

a result a consensus is emerging on the relationship among avian groups at many levels.

Higher-order relationships are beginning to be resolved, and the resolution is slowly crystallizing at the finer levels of families, genera, and species relationships. This progress in turn makes possible the study of character evolution across shorebirds, one of the oft-stated purposes of pursuing the characterization of phylogenetic relationships. Comparative studies aim to use phylogenetic relationships to help elucidate the evolutionary processes and forces that have contributed to the observed diversity of organisms such as that observed in shorebirds.

Chapter Three – Scolopaci and the evolution of parental care 32

Shorebird ‘breeding systems’, a term used to encompass both parental care duration

(hereafter referred to as parental care) and social mating systems following Reynolds (1996), are an example of a set of traits that vary greatly amongst shorebirds. The pattern of variation has accordingly been a popular topic for many years by researchers interested in reconstructing the ancestral state of traits associated with breeding systems as well as those interested in determining the ‘ultimate’ why? and by what process? questions regarding breeding system evolution. Researchers have previously examined the interrelationships of male and female care with offspring developmental mode, mating opportunities, and two proxies of sexual selection or mating opportunities: sexual size dimorphism, and tendency towards polygamy, using a variety of statistical techniques. Results of these studies have suggested (1) that the ancestral state in shorebirds is full care by both parents (Szekely &

Reynolds 1995; Reynolds et al. 2002; Cockburn 2006; Garcia-Pena et al. 2009), (2) the evolution of precocial young allowed the diversification of parental care duration and mating behaviours (Thomas & Szekely 2005; Thomas et al. 2006) and (3) there is evidence of sexual conflict (a ‘tug-of-war’) where males and females are at odds over which gender will reduce their length of care (Reynolds & Szekely 1997; Olson et al. 2008).

The evolution of long-distance migration also has been proposed as an explanation for the variation in shorebird breeding systems, with the suggestion that long-distance migration is associated with reduced parental care and deviations from monogamy first having been hypothesized by Myers (1981). However, there has not been agreement on the scope or direction of this relationship. Results alternatively have indicated that the evolution of reduced parental care drives increases in migration distance (Reynolds & Szekely 1997), and the opposite: increases in migration distance lead to reduction in parental care (Garcia-

Chapter Three – Scolopaci and the evolution of parental care 33

Pena et al. 2009). In both studies the relationships were only significant for males, leaving

unexplained the variation that is also observed in female breeding behaviour.

Much of the research into these issues to date has provided important insights into the

practice of inferring trait evolutionary history using phylogenetic relationships, but have also

been hampered by the available phylogenetic information and the scope of their datasets.

First, despite the importance of correct phylogenetic information for robust inference of ancestral states, none of the previous studies on this topic is based on a well-resolved species- level phylogeny with branch lengths and well-supported nodes. Second, many of these studies are based on a paraphyletic assemblage of shorebird species, low taxon representation, or both, which seriously limits the scope of the conclusions that may be reasonably made by the investigators (Heath et al. 2008b). Third, most studies have not taken into account phylogenetic uncertainty, which is inherent to the practice of inferring evolutionary processes from a hypothesis of the course of historical events that cannot be re- run.

Here I describe my investigation into the evolution of a group of shorebirds with especially diverse breeding systems (Thomas et al. 2007) using a multigene phylogeny I constructed for this group, and maximum-likelihood reconstruction and comparative methods of studying trait evolution (Pagel 1994). The Scolopaci include more than 100 species which exhibit a range of migration behaviours and occupy a range of habitats and geographic regions in addition to their variation in breeding behaviour (del Hoyo et al. 1996; Thomas &

Szekely 2005). All Scolopaci have precocial offspring, thus potentially releasing them from a constraint on parental care and setting the stage for a diversification of parental care behaviours (Thomas et al. 2006) in response to various factors that I will explore. I aim to

Chapter Three – Scolopaci and the evolution of parental care 34 answer these questions: What are the ancestral states? What are the patterns of change? Is there any evidence of sexual conflict? Does migration distance, or mating system, appear to be related to parental care? What might explain the variation in parental care between species and between males and females? I plan to answer these questions by pursuing three goals:

(1) describing the characteristics inferred for the Scolopaci ancestor and the patterns of evolution among descendents in parental care, social mating system, migration, and geographic region in the Scolopaci; (2) testing for correlated evolution of parental care with mating system and migration distance; and in cases of significant correlation, (3) examining transition rates to infer factors that have influenced the evolution of parental care.

METHODS

Character scoring

Full representation of the sampled taxa and the character coding assigned to each species are presented in Appendix 2.

Parental care & breeding system

Parental care and breeding system was scored using information gathered from the literature on the evolution of shorebird parental care (Reynolds & Szekely 1997; Thomas et al. 2007; Garcia-Pena et al. 2009) and other literature (del Hoyo et al. 1996) for Scolopaci species not examined in the previous studies. I scored the duration of parental care and social mating system for each sex independently. I follow the aforementioned authors’ coding protocol for parental care by assigning species to one of eight scoring categories where 0 represents no care after laying of eggs, 1 represents parental care in the first third of

Chapter Three – Scolopaci and the evolution of parental care 35 egg incubation, 2 represents parental care in the second third, 3 represents parental care in the last third of incubation, 4 represents parental care in the first third of fledging, 5 represents parental care in the second third of incubation, 6 represents parental care in the last third of fledging, and 7 represents full care through the end of the fledging period. In females of

Scolopaci species, all but one of these states are represented, while males occupy four of these states. Following Thomas et al. (2006) and Garcia-Pena et al. (2009), I coded social mating system, or tendency towards polygamy or monogamy, on a five-category scale where

0 represents monogamy, 1 represents rare instances of polygamy (<1% of cases), 2 represents occasional instances of polygamy (1-5%), 3 represents common instances of polygamy (6-

20%), and 4 represents many instances of polygamy (>20% of cases).

Migration distance

Migration distance was scored using information from the literature and following

Garcia-Pena et al. (2009) for species for which migration distance had not been previously estimated. I estimated migration distance by plotting the distance between the estimated centroid of breeding and wintering latitudes using Google Earth (version 5, http://earth.google.com) and information from del Hoyo et al. (1996). I confirmed the accuracy of my estimates against those for which Garcia-Pena et al. (2009) estimated migration distance to ensure congruence in estimations of distance between the two datasets.

I then coded migration in a binary fashion as long- or short-distance migrants for use in tests of correlated evolution (described below). Because my main focus was on parental care duration patterns, and the evolution of migration within and among species is itself a complex matter worthy of study, I coded this trait in a binary fashion only, to get a broad

Chapter Three – Scolopaci and the evolution of parental care 36

sense of the evolutionary patterns of migration. Short-distance migrants were coded as 0,

whereas long-distance migrants were coded as 1. I tested the threshold for assigning the

‘long-distant migrant’ state using two values: the first quartile of the migration distances

(2509 km), and the mean migration distance (5519 km) to determine whether the coding

system was strongly biasing the results.

Geographic region

Zoogeographic region was assigned according to information from del Hoyo et al.

(1996) and Cockburn (2006). Breeding ranges were used for migratory species. The regions

were coded as 1=Palearctic, 2=Neotropical, 3=Nearctic, 4=Holarctic, 5=Widespread,

6=Africa, 7=Australia, and 8=Indomalayan.

Phylogenetic comparative analyses

Phylogeny

I used the multigene molecular phylogeny constructed in Chapter 2 for all reconstructions and comparisons of Scolopaci taxa. This tree is based on DNA sequence

data from five genes: one nuclear (RAG1) and four mitochondrial (CYTB, 12S, ND2, and

COI) for 84 of approximately 106 Scolopaci taxa. The phylogeny is well-resolved and

strongly-supported at the majority of nodes, but the individual gene trees and examination of

the distribution of trees in the posterior distribution indicate there is uncertainty in the data

regarding some relationships within the shanks (Tringa) and the sandpipers (Calidris). For

this reason, and because of the importance of investigating the inherent uncertainty in a

phylogenetic hypothesis, I also selected 100 trees (sampled every 20,000 generations) from

Chapter Three – Scolopaci and the evolution of parental care 37

the posterior distribution of the Bayesian analysis after it had reached convergence to examine the effect of changes in topology on the estimations of ancestral states and comparisons among traits. The results of the correlation tests were very similar for all

topologies, so for tests of individual parameters and precedence hypotheses, I only

considered the consensus topology.

Ancestral state reconstructions and tests of correlated evolution

Ancestral states were reconstructed for each character using the maximum-likelihood

analysis in Mesquite version 2.7 (D. Maddison & W. Maddison 2009) for all trees, using the

Markov k-state 1-parameter (Mk1) model, which assumes equal rates of change between

states (Lewis 2001).

I tested for correlation between several behavioural and life-history traits in the

Scolopaci using maximum-likelihood analyses in the Discrete module of BayesTraits (Pagel

1994). Discrete requires traits to be binary, so I recoded parental care and social mating

system characters to investigate their potential correlations with each other and with

migration distance (already coded in binary states) (Table 3.1). For parental care, following

Garcia-Pena et al. (2009) I coded as reduced care (0) those species (males and females) that

were scored as 0, 1, 2 , or 3 in the eight-level scoring system described above, and I coded as

full care (1) those species that gave care levels 4, 5, 6 or 7. Also following Garcia-Pena

(2009) for social mating system, I considered species as monogamous (0) if they were coded

as a 0, 1, 2, or 3, and polygamous (1) if they were coded as 4 on the five-level coding scheme

described above. Discrete also requires a fully resolved phylogeny, so I arbitrarily resolved

Chapter Three – Scolopaci and the evolution of parental care 38

the polytomy within Tringa in the consensus tree, while all trees from the posterior distribution were resolved.

For each test for correlated evolution, I fit two maximum likelihood models to the

data: one that assumes independent evolution of two binary traits (the independent model I),

and one that allows transitions of character states in one character to depend on the state of

the other character (the dependent model D) (Figure 3.1 top). There are four possible

combinations of these states (here: “1” = (R,0); “2” = (R,1); “3” = (F,0); and “4” = (F, 1)

where R = reduced parental care, F = full parental care, and 0 or 1 represent states of the

putatively correlated trait). The independent model estimates two transition rate parameters

per trait in a binary character coding, or four in total: a ‘forward’ transition parameter

representing a transition from state 0 to state 1 (symbolized by 1 or 2) and a ‘backward’ transition parameter representing transitions from state 1 to state 0 (symbolized by 1 or

2). The transition parameters for one state are independent of the other state. For

example, the value of 1 (e.g., transitions in trait Y, from monogamy to polygamy) is

independent of whether the state of trait X (parental care) is reduced care or full care, and so

1 represents the transition parameter for this type of transition in social mating system regardless of the state of parental care. Alternatively, the dependent model allows transition rates to be estimated for each character state transition against each background state of the other character, resulting in eight transition parameters (Figure 3.1 bottom). For example, the value of transition parameter q12 and q34 representing transitions from monogamy to polygamy (trait Y) are allowed to vary depending on whether parental care (trait X) is full or

reduced.

Chapter Three – Scolopaci and the evolution of parental care 39

Table 3.1 Character coding for traits evaluated in this study for correlated evolution.

Trait States Parental care R = reduced; F=full Social mating system 0 = monogamous, 1 = polygamous Migration distance 1st quartile 0 = short distance (<2509 km); 1 = long distance Mean 0 = short distance (<5518 km); 1 = long distance

Chapter Three – Scolopaci and the evolution of parental care 40

Figure 3.1 Evolutionary transitions between states of parental care (F, full care; R, reduced

care) under scenarios of independent evolution of the traits (independent model I, top) and dependent (correlated) evolution of traits (dependent models D , bottom).

Chapter Three – Scolopaci and the evolution of parental care 41

I calculated the likelihood ratio (LR) from the results of each dependent and independent model by calculating the value of 2*[L(D)-L(I)]. Because this statistic approaches a χ2 distribution, support for an improvement in likelihood by the dependent model (indicating correlation of traits) can be assessed by comparing the LR against a χ2

distribution with degrees of freedom equal to the difference in the number of parameters between the two models – here, that is four (Pagel 1994). A significant result indicates the

two traits are evolving in a correlated fashion.

In the case of a significant correlation, I then tested individual transition rates by

setting them equal to zero in the dependent model and comparing the resulting likelihood of

this seven-parameter dependent model against that of the full eight-parameter dependent

model, with one degree of freedom (Pagel 1994). A significant result from this test indicates

that the estimated transition rate is significantly different from zero. Lastly, I performed

several tests where I restricted certain transition rates to be equal to each other to test

hypotheses of the temporal pattern and the conditionality of changes in character states. The

significance of these tests was determined using a likelihood-ratio test with one degree of

freedom, as were the tests of individual transition rate parameters (Pagel 1994). Here, a significant result would indicate that the transition rate from one state to another in character one is not equal to the transition rate in character two (e.g. one may have been more likely to have preceded the other), for example, or that transitions from one state to another in character one are more likely in the background condition of one state of character two than in the background condition of the other state.

Chapter Three – Scolopaci and the evolution of parental care 42

Correction for multiple tests

Because multiple tests were performed on each of the traits that were examined, the α level was adjusted using sequential Bonferroni corrections to assess the significance of my results (Holm 1979; Rice 1989; Crawford et al. 2009). Following Quinn and Keough (2002) and Crawford et al. (2009), I consider tests of hypotheses unrelated to each other to be separate families of tests, although they may not be independent of each other. Therefore I analyzed tests for correlation between parental care duration and other traits separately, determining significance by examining the smallest P value at an α level of α/c where c was the number of tests. The next-smallest P-value was evaluated at α/(c-1), and so on until a nonsignificant value was reached. In total I considered five families of correlation tests: male care and female care, male care and polygamy, female care and polygamy, male care and migration, and lastly female care and migration. If a significant correlation was found, I tested whether each of eight individual parameters was different from zero, and one

‘precedence’ hypothesis (setting transition parameters away from the ancestral state equal to zero to determine which transition was more likely to have occurred first), for a total of 10 tests.

RESULTS

Ancestral state reconstructions

Maximum-likelihood analysis of the evolution of male and female parental care in the

Scolopaci suggests that both male and female ancestors of the group were full care-givers

through to the end of the fledging period, a finding supported by the consensus topology and

Chapter Three – Scolopaci and the evolution of parental care 43 all 101 alternative topologies (Table 3.2). The reconstruction indicates that there were repeated instances of reduction in parental care by both males and females (Figures 3.2-3.3).

Males appear to have reduced care ten times, and have no incidence of increases in care, while females appear to have reduced care 19 or more times and increased 6 times.

Males occupy fewer intermediate care levels between full care (98% of species exhibit either full or no care, 2 species occupy 2 of 5 intermediate states), and no care, than do females

(62% of species exhibit full or no care, 31 species occupy 5 of 5 intermediate states).

Analysis of the social mating system adopted by males and females suggests that both sexes were monogamous in the ancestor of the Scolopaci, a finding supported by the consensus trees and all alternative topologies (Table 3.2). Males and females have similar numbers of transitions from monogamy to a form of polygamy (13 in males, and 11 in females), and both sexes have representatives in all of the polygamy coding categories

(Figures 3.4-3.5).

Migration distance for the ancestor of the Scolopaci could not be conclusively ascertained by the maximum-likelihood analysis for either the consensus tree or any of the alternative topologies (Table 3.2). For both cut-off points, long-distance migration received higher (but not significantly so) likelihood values than did short-distance migration at the ancestral node for Scolopaci taxa. The ancestor of the Scolopacidae family is very likely to have been a long-distance migrant (0.91-0.98 likelihood), whereas the ancestor of the clade containing the remaining four families is likely to be a short-distance migrant (0.71-0.92 likelihood). There are several apparent reductions in migration distance (6 for the first quartile, and 16 for the mean as cut-off), and fewer instances of increases in migration distance (2 for the first quartile, 2 for the mean) (Figures 3.6 – 3.7). The reconstruction of an

Chapter Three – Scolopaci and the evolution of parental care 44

Table 3.2 Ancestral states of parental care duration, social mating system, migration, and geographic region for the ancestor of the Scolopaci. Maximum-likelihood support values from the consensus topology are shown in parentheses, and the number of alternative- topology trees that support that ancestral value. “n/a” denotes instances where the analysis could not optimize a single most-likely state.

Trait Ancestral state # of alternative Consensus ML support supporting topologies Parental care

Male Full care (0.99) 100

Female Full care (0.78) 100

Breeding system

Male Monogamous (0.99) 100

Female Monogamous (0.84) 100

Migration

1st quartile Equivocal n/a

Mean Equivocal n/a

Geographic region Palearctic (0.47*), n/a Neotropical (0.17*), n/a Nearctic (0.10*) n/a

Chapter Three – Scolopaci and the evolution of parental care 45

Figure 3.2 Maximum likelihood ancestral state reconstruction of female care in the

Scolopaci. Outgroups are not shown.

Chapter Three – Scolopaci and the evolution of parental care 46

Figure 3.3 Maximum likelihood ancestral state reconstruction of male care in the Scolopaci.

Outgroups are not shown.

Chapter Three – Scolopaci and the evolution of parental care 47

Figure 3.4 Maximum likelihood ancestral state reconstruction of male social mating system in the Scolopaci. Outgroups are not shown.

Chapter Three – Scolopaci and the evolution of parental care 48

Figure 3.5 Maximum likelihood ancestral state reconstruction of female social mating system in the Scolopaci. Outgroups are not shown.

Chapter Three – Scolopaci and the evolution of parental care 49

Figure 3.6 Maximum likelihood ancestral state reconstruction of migration distance (using the mean migration distance (5519 km) as the cut-off point for categorizing species) in the

Scolopaci. Outgroups are not shown.

Chapter Three – Scolopaci and the evolution of parental care 50

Figure 3.7 Maximum likelihood ancestral state reconstruction of migration distance (using the first quartile of migration distance (2509 km) as the cut-off point for categorizing species) in the Scolopaci. Outgroups are not shown.

Chapter Three – Scolopaci and the evolution of parental care 51

Figure 3.8 Maximum likelihood ancestral state reconstruction of geographic origin in the

Scolopaci. Outgroups not shown

Chapter Three – Scolopaci and the evolution of parental care 52

ancestral geographic region where the Scolopaci originated was also inconclusive, but the

analysis suggested three most likely states, of which the

Palearctic received the highest likelihood (44%, Table 3.2). There are more than 20

subsequent transitions away from the Palearctic, and one instance of a ‘re-gaining’ of a

Palearctic origin (Figure 3.8).

Tests of correlated evolution

The hypotheses tested in this study are summarized in Table 3.3. The tests of

correlated evolution between male and female care found strong evidence of an association

(Table 3.4). Tests of individual parameters found only four parameters to be significantly different from zero (Table 3.4), two of which were not significant after sequential Bonferroni correction. Precedence tests (here, q43 g q42) from the assumed ancestral state (Figure 3.4)

were unable to distinguish the order of character changes, but the significance of transition

parameter q43 away from state 4 (or male full care, female full care) suggests that reductions

in female parental care may have preceded reductions in male parental care (Figure 3.9,

3.10).

Next, the possible correlation between parental care and social mating system system

was tested. Male parental care was correlated with the extent of male polygamy but female

parental care did not correlate with female polygamy, although P-values approached

significance (Table 3.4). Tests of individual parameters in the significant correlation

between male care and male polygamy revealed two transition rate parameters that were

significantly different from zero, but neither remained significant after sequential Bonferroni

correction (Table 3.4). Precedence tests were not able to determine the sequence of character

Chapter Three – Scolopaci and the evolution of parental care 53

Table 3.3 Summary of hypotheses tested.

Trait pair Hypothesis d.f. Description

Male & female parental care L (I) < L(D) 4 Correlated evolution?

q43 g q42 1 Precedence away from ancestral state (Which sex reduced care first?)

qij - 0 1 qij transitions constrained to 0

Parental care & social mating system L (I) < L(D) 4 Correlated evolution?

q34 g q31 1 Precedence away from ancestral state? (Did reductions in care or increases in polygamy come first?)

qij - 0 1 qij transitions constrained to 0

Parental care & migration distance

1st quartile L (I) < L(D) 4 Correlated evolution?

Mean L (I) < L(D) 4 Correlated evolution?

Chapter Three – Scolopaci and the evolution of parental care 54

Table 3.4 Results of tests of correlated evolution between pairs of traits in the Scolopaci using the consensus topology and summarized likelihoods from analyses of 100 alternative trees. Bold values retained significance after sequential Bonferroni corrections for 10 tests (only consensus tree and parameter tests were corrected). Values are likelihood ratios (with associated P-values) from likelihood ratio tests.

Chapter Three – Scolopaci and the evolution of parental care 55

Trait pair Model comparisons Transition rates g Order of transitions? Correlated? 0? q - q L (I) < L(D) ij ij qij - 0

Male & female care q43 g q42 Consensus tree 24.48 (6.4E-05) q12,: 6.246 (0.0125) 2.237 (0.135) q31: 6.252 (0.012) q34, : 9.307 (0.0002) q43 : 8.678 (0.003) Lower quartile 24.03 (7.86E-05) Median 24.14 (7.49E-05) Upper quartile 23.50 (0.0001)

Male care & mating system q31 g q34 Consensus tree 22.11 (0.0002) q34 : 5.243 (0.022) 2.499 (0.114) q42 : 5.417 (0.020) Lower quartile 35.07 (4.5 E-07) Median 32.13 (1.8 E-06) Upper quartile 16.32 (0.0026)

Female care & mating system Consensus tree 9.139 (0.058) Lower quartile 9.059 (0.060) Median 9.067 (0.060) Upper quartile 9.089 (0.059)

Male care & migration 1st quartile mean Consensus tree 5.073 (0.280) 6.478 (0.166) Lower quartile 4.651 (0.325) 7.716 (0.103) Median 4.514 (0.341) 7.690 (0.104) Upper quartile 4.069 (0.397) 7.571 (0.109)

Female care & migration Consensus tree 9.766 (0.0446) 6.937 (0.139) Lower quartile 9.512 (0.0450) 6.821 (0.146) Median 9.685 (0.0460) 6.675 (0.154) Upper quartile 9.487 (0.0500) 6.431 (0.169)

Chapter Three – Scolopaci and the evolution of parental care 56

Figure 3.9 Evolutionary transitions in the dependent model of correlated evolution between male & female parental care, and male parental care & male social mating system. Ancestral state indicated by bold black box. Transition rates and arrows in bold had P values < 0.05, and those marked with an * retained significance after sequential Bonferroni correction.

Chapter Three – Scolopaci and the evolution of parental care 57

Figure 3.10 Maximum likelihood econstruction of male parental care (left) & female parental care (right) which have evolved in a correlated fashion in the shorebird suborder

Scolopaci. Outgroups are not shown.

Chapter Three – Scolopaci and the evolution of parental care 58

Figure 3.11 Maximum likelihood reconstruction of male parental care (left) & male social mating system (right) which have evolved in a correlated fashion in the shorebird suborder

Scolopaci. Outgroups are not shown.

Chapter Three – Scolopaci and the evolution of parental care 59

change away from the assumed ancestral state (1, 0) or (full male care, male monogamy) but

the conditional significance of q34 away from the ancestral state suggests that in males for

this group, transitions to polygamy may have preceded reductions in care (Figure 3.9, 3.11).

Migration distance and male or female parental care was not associated when using the mean

migration distance or the first quartile of migration distances as the cut-off point for

designation as a ‘long-distance migrant’, although P-values for the correlation with female

care and migration (using the 1st quartile) approached significance.

DISCUSSION

Ancestral characteristics

The first goal of this study was to describe the pattern of change in parental care

duration, social mating system, migration, and biogeography in order to answer the questions

what are the ancestral states of these traits? and what are the patterns of change? With

regards to the former, my results suggest that in both males and females the ancestor of the

Scolopaci was a monogamous, full-care parent through the end of the fledging period, and may have been a long-distance migrant with a Palearctic origin. These results are consistent with previous findings which have suggested that full care through fledging and monogamy for both males and females is the ancestral state in shorebirds (Szekely & Reynolds 1995;

Reynolds et al. 2002; Garcia-Pena et al. 2009). When considering migration, the ancestral state for shorebirds previously has been estimated as short-distance (Garcia-Pena et al. 2009), so my results suggest that the transition to long-distance migration may have occurred prior to the Scolopaci ancestor, with the ancestor of painted snipes, seedsnipes, jacanas, and the plains-wanderer re-gaining the ancestral state. Alternatively it may be that the transition to

Chapter Three – Scolopaci and the evolution of parental care 60

long-distance migration occurred in the ancestor of the Scolopacidae and the clade containing

the painted snipes, seedsnipes, jacanas, and the plains-wanderer retained the ancestral state.

The reconstruction of geographic origin of the Scolopaci, while not conclusive,

suggests that the ancestor of the group may have been an arctic breeder, but the uncertainty

of the reconstruction at the ancestral node makes it difficult to reach any conclusions on this

point. Although this phylogenetic method has been previously used to reconstruct

biogeographic origins (e.g. Barker et al. 2002; Nepokroeff et al. 2003; McGuire et al. 2007) the results can be misleading because they do not take into account biogeographical processes that potentially affect species distributions (Cook & Crisp 2005). To my knowledge, there have not been other studies that have reconstructed geographic origins for shorebirds. A broader scale of reconstruction, that included the other two sub-orders as outgroups, and that took into account ecological factors in addition to phylogenetic relationships would be ideal, but is beyond the scope of this study. Therefore I consider this reconstruction to be an exploratory one, which may be useful for informing future hypotheses. The reconstruction of the geographic origin of shorebirds is an interesting avenue of future research that could help to infer ancestral states of ecological and behavioural characters.

The results of efforts to answer the second question regarding the patterns of change from the inferred ancestral state reveal both differences and similarities among trait histories.

The difference in pattern of change in parental care by males and females is an interesting one that has not been postulated previously for shorebirds, to my knowledge. The pattern suggests that the circumstances resulting in reductions in parental care may be different for males and females, a finding that is further supported by the tests of correlation that I discuss

Chapter Three – Scolopaci and the evolution of parental care 61

below. Patterns in the social mating system were less dimorphic between males and females,

suggesting that trends towards polygyny or polygamy may be less contingent on sex than is

parental care. All of the traits showed multiple, independent losses of the ancestral state, and

few gains. Thus patterns of change among states are not simply dictated by phylogeny, but

instead may be responding to ecological forces and conditions. Despite evidence of

differences in evolutionary lability, however, transitions appear to be directional: traits show

several transitions away from ancestral states but few instances of return to an ancestral state.

Correlation of Traits

Our second goal for this study was to test for correlated evolution of parental care with migration and social mating system in the Scolopaci to answer the questions Is there

evidence of sexual conflict in parental care patterns in the Scolopaci? and Do social mating

system or migration distance appear to be related to patterns of Scolopaci parental care?

First, the tests of correlation suggest that co-evolution has occurred between male and female

care which is consistent with sexual conflict. The traits are evolving in a correlated fashion,

and when looking at the transitions on the phylogeny it can be seen that when one parent

reduces care, the other maintains high levels of parental care (Figure . This is consistent with

Reynolds & Szekely (1997), and Olson et al. (2008) who found evidence of a negative

relationship between male and female parental care duration in shorebirds and across all

birds, respectively, using phylogenetically-controlled contrasts and modeling. My work

extends this analysis to another level of resolution, and adds insights into the phylogenetic

patterns at the species level.

Chapter Three – Scolopaci and the evolution of parental care 62

So if there is a tug-of-war operating in this group between parents over who will reduce care, what factors might be influencing this conflict? Might it be the demands of a long migration to be made after the breeding season, or the potential for other mating opportunities? My next research question thus asked whether parental care duration was correlated with the evolution of increased migration distance or polygamy across the

Scolopaci phylogeny. There are two main answers to this question. First, the evolution of parental care was not associated with migration distance for either cut-off point of migration distance in males or females. Second, the evolution of parental care is related to social mating system, but this pattern was only significant for males. Although the values approach significance, female social mating system and parental care duration are not significantly correlated. Therefore the correlates of parental care are different for males and females, but are not likely explained by migration for either. These findings are consistent with previous work that found correlations between social mating system and parental care across all shorebirds, but refutes previous work that suggested migration either influenced (Garcia-

Pena et al. 2009) or was influenced by (Reynolds & Szekely 1997) the evolution of reduced parental care.

The last research question asked what the correlation of traits and comparisons of transition parameters might indicate about the causes of parental care variation in the scolopacid shorebirds. Tests of individual parameters and precedence of changes failed to elucidate strong patterns or establish the sequence of change away from the ancestral state.

One reason for this might be due to the increased information given by the denser taxon sampling in this study than in previous studies, demonstrating the complexity of the trait variation that is obscured by sparser sampling. However there were suggestions in my

Chapter Three – Scolopaci and the evolution of parental care 63 analyses that transitions to polygamy in males may have preceded reductions in male care, and that reductions in female care may have preceded male reductions. If these hypotheses are correct they provide an interesting perspective on the variation in parental care observed in the Scolopaci. First, the suggestion of transitions to polygamy preceding transitions to reduced care by males, a relationship not found in females, indicates that perhaps the effects of social mating system and the opportunity to take multiple mates are different for males than in females. This is supported by the finding that female transitions to reduced care might have occurred before males reduced care. Females may be the sex experiencing the strongest selective pressure to avoid the costs of parental care by reducing its duration

(Clutton-Brock 1991), given their previous energy expenditure in producing eggs (Visser &

Lessells 2001) that might be exacerbated by the large energetic costs of migration (Wikelski et al. 2003). Therefore the pattern of their reductions in parental care might not follow social mating systems closely, if females reduce care for reasons including increased opportunity for multiple mates or long-distance migration. This is consistent with P-values that approached statistical significance in tests for correlation between female parental care duration and either migration or social mating system.

As Price (2009) found in comparative work on female song evolution in blackbirds, many life-history variables are not individually significant in tests of correlation with the evolution of female song. However, when the variables were combined into a single composite ‘lifestyle’ trait, a significant correlation with female song was obtained. This might be a useful technique for future inquiry into variation in the Scolopaci. In addition, multivariate techniques might be helpful to elucidate the suite of traits that together result in reduced care among males and females, if that indeed is the nature of how parental care

Chapter Three – Scolopaci and the evolution of parental care 64 reductions are determined over their evolutionary history. This concept is supported by previous work in shorebirds indicating that determinants of reductions in parental care by males and females are likely different (Reynolds & Szekely 1997); and that male patterns of reduction are usually related to polygyny whereas patterns of female care are less consistent with social mating system (Thomas & Szekely, 2005). These findings might help explain why efforts to relate these and other variables to parental care duration have not found consistent patterns. Future work ideally would explore these patterns by developing a strong phylogenetic hypothesis for all shorebirds, and using both comparative and multivariate tests of traits to determine which of a host of life-history traits explain these trends in parental care among Scolopaci species and between the sexes.

Conclusions

This study estimates several life-history and behavioural characteristics of the ancestor of a biologically interesting group of shorebirds. In addition, it extends the work of previous studies on relationships between parental care, mating system, and migration in shorebirds to one shorebird suborder using a robust species-level molecular phylogeny. I tested for correlations between the patterns of parental care, social mating system and migration distance. At the scale of the Scolopaci there does appear to be conflict between the sexes, and contrary to common supposition, migration distance is not associated with changes in parental care. Additionally, I saw that males and females may respond differently to evolutionary forces acting on parental care. Thus analyses that can take into account the variation in a suite of life-history traits in a composite variable may be the best option for future efforts to dissect the causes of parental care reductions in the Scolopaci, and in

Chapter Three – Scolopaci and the evolution of parental care 65

shorebirds generally. Lastly, this study demonstrates that conclusions on the correlates and

explanations of parental care variation differ with the underlying phylogenetic hypotheses

and taxon sampling, indicating the need for careful consideration of these factors in

comparative studies as well as the scope of conclusions that may be drawn from such

analyses.

ACKNOWLEDGEMENTS

Thanks go to Hernán López-Fernández, Yvonne Verkuil and Deborah Buehler for helpful

discussions, Erika Tavares for help with mapping programs, and the many researchers whose

careful work collecting information on the ecology of shorebirds made this study possible.

This work was supported by grants from OGS, NSERC, and the Frank M Chapman Fund

from AMNH to RG, and the ROM Governors Grant to AJB.

Chapter Four

Conclusions and future directions

This thesis investigates the evolutionary history of the Scolopaci, a group of shorebirds

within the order Charadriiformes, and examines the evolution of parental care, a highly

variable and controversial trait for this group. In Chapter Two, I used DNA sequence data

from nuclear and mitochondrial loci to estimate the phylogenetic relationships among species in the suborder. In Chapter Three, I used this phylogeny to reconstruct the likely attributes of the common ancestor of the Scolopaci, and to test for association in the patterns of evolution of those traits across the phylogeny to infer the evolutionary and ecological processes that influenced current-day diversity. In particular I explore the hypothesis that long-distance

migration and reduced parental care have evolved in a correlated fashion. Below I

summarize the results from each chapter and discuss potential directions for future work in

these areas.

A molecular phylogeny for the Scolopaci

In Chapter Two I constructed a multigene species-level phylogeny for the Scolopaci,

one of three shorebird suborders. Most relationships among the species of this group were

undetermined prior to my study, representing a limiting step in the goal of applying

phylogenetic knowledge towards developing an understanding of the evolutionary patterns

and processes resulting in their diversity. Phylogenetic analyses using dense taxon sampling

increased the resolution for this group to that of species relationships, the majority of which

are very strongly supported. Most of the relationships within genera were unexplored before

66 Chapter Four – Conclusion 67

the present study, such as those of Numenius, Limosa, Limnodromus, and Gallinago. The species tree was congruent with a phylogenetic framework based on a previous genus-level phylogeny and species phylogenies for two clades within the group, with the exception of the placement of Tringa (the phalaropes and allies). Relationships within two clades (Tringa and

Calidris) were less well-supported and in one case unresolved.

Future directions

The supertree approach has been taken previously for all groups within

Charadriiformes, but the results were poorly resolved and lacked branch lengths and

measures of nodal support. However it is clear that in the quest to complete the description

of the history and diversity of organisms, particularly before much of it is lost to extinction,

the supertree method will be necessary as no single analysis will be able to encompass even a

reasonable fraction of living organisms (Gittleman et al. 2004) Instead, we must approach

the effort from the tips of the tree, working our way in manageable subtrees that will

ultimately be grafted onto the overarching tree.

However, the necessity and utility of these supertrees at present do not diminish their

problems when considering their use in applications, such as in the study of trait evolution,

and their source material must be robust in its own right. In the case of the Scolopaci, many

of the relationships have no previous examination and therefore a supertree can shed little

light on their evolution. Therefore it remains important to attempt to determine species trees

using data that contain strong phylogenetic signal and methods that account for the properties

of the data as well as the processes of evolution that can produce discordant gene trees. For

now, this means sequence data from multiple, truly independent loci and analysis that allows

Chapter Four – Conclusion 68

these loci to have independent evolutionary histories (Edwards 2009). Future work on these

relationships, therefore, likely will require additional DNA sequence data and perhaps

additional types of confirmation, such as retroposon insertion mapping. For Tringa and

Calidris, this might require a large amount of data to resolve relationships complicated by

rapid radiations that are hard to resolve. Moreover future work may involve determining

how best to put together robust source trees into a supertree framework to continue to expand

and improve upon the Tree of Life.

Evolution of parental care duration, breeding systems, and migration in the Scolopaci

(Aves:Charadriiformes)

In Chapter Three I used maximum likelihood analyses to reconstruct ancestral

character states for parental care, social mating system, migration distance, and geographic

region for the most recent common ancestor of the Scolopaci, using the phylogeny developed

in Chapter Two as well as 100 alternative topologies drawn from the posterior distribution of

the Bayesian analysis. I found that regardless of variation in tree topology, the ancestor of

the Scolopaci in either sex likely was monogamous and provided full offspring care through

to the end of the fledging period. In addition, members of the Scolopaci ancestral population

may have been long-distance migrants whose geographic breeding range was in the

Palearctic, but these results are not as strongly supported. The descendents of this ancestor

display multiple subsequent transitions to different breeding regions, reduced parental care

and increased polygamy by males, females, or both. I then tested the hypothesis that

migration distance and reduced parental care have evolved in a related fashion in shorebirds.

In addition, I tested for a correlation between male and female care, and between parental

Chapter Four – Conclusion 69 care duration and social mating system for each sex. Again regardless of variation in tree topology, in neither males nor females was parental care duration correlated with migration distance, for either distance cut-off point. The duration of parental care provided by males and females is correlated, and male parental care is associated with male social mating system, but the same is not true for females. I further tested the hypothesis that the transition rates away from the reconstructed ancestral state were equal (e.g. the ‘precedence hypothesis’). Most parameters could not be distinguished from zero, and the precedence tests could not determine the sequence of change away from the ancestral state. However, the transition parameters that differed from zero show trends indicating that reductions in female care may have preceded reductions in male care, and that transitions to polygamy in males may have preceded reductions in care by males. Thus the results of this study are consistent with the hypotheses that males and females are in conflict over parental care; determinants of parental care are different for males and females; and thus a single variable may not be sufficient to explain the variation of parental care in the Scolopaci, and perhaps all shorebirds. However, these results are not consistent with previous findings that parental care is associated with migration distance. Instead, these tests of correlation between traits in the Scolopaci show that trait evolution likely is a complicated process that cannot be unraveled through comparative analyses alone but instead will require continued exploration of shorebird phylogeny, additional knowledge of species’ ecology, and advanced statistical exploration of a suite of biological traits.

Chapter Four – Conclusion 70

Future directions

Future work on the variation in parental care and other traits among the Scolopaci

might involve widening the scope of the analyses conducted here to that of all shorebirds.

Previous studies have used the supertree with limited taxon sampling and left out one of the

three suborders, the Lari, because the species within that group lack variation in parental care

duration and social mating systems. However, the lack of variation in the Lari nested within

Charadriiformes potentially is just as interesting biologically as is the wide variation present

within its sister group Scolopaci, and within their basal sister clade Charadrii. In addition,

more information on the Charadriiform outgroups of the Scolopaci would help to resolve

some of the uncertainties in the ancestral node reconstruction of character states. However,

this will require more systematics work for the remaining suborders of Charadriiformes as

well as more data on the character states for the traits in question. Unfortunately the ecology

of many species is still largely unstudied, even within such popular research groups as

Charadriiformes (del Hoyo et al. 1996; Szekely et al. 2007).

Additionally, future research into this area might focus on alternative statistical

methods that can take into account multiple variables, as it appears likely that the

determination of parental care is based on several, rather than just a single factor or variable.

This has been done with blackbirds by combining multiple variables into a single ‘lifestyle’

type trait using comparative methods (Price 2009). Additionally, Garcia-Pena et al. (2009)

explored the use of phylogenetic general linear models, but based their phylogenetic corrections on a poor quality supertree.

Finally, it is an oft-repeated but easily forgotten truth that correlation is not synonymous with causation. Therefore studies such as this one that attempt to identify

Chapter Four – Conclusion 71

correlates of a trait of interest will always benefit from corroboration, if possible, from experimental work. This is a difficult task when considering processes at such deep evolutionary timescales but might include long-term observational studies of shorebird parental care across a varying seasonal landscape of mating opportunities, habitat qualities, and climate variation (Thomas et al., 2007).

Evolutionary lability and character reconstruction

Lastly, it is important to consider the validity of applying studies of trait evolution to a phylogenetic framework. Traits vary in their phylogenetic signal (Blomberg et al. 2003;

Garland et al. 2005; Losos 2008) and may not always evolve in the hierarchical manner of most species. Traits such as behaviour and ecological variables are considered more labile than morphological or life-history traits, for example, but still display significant phylogenetic signal (Blomberg et al. 2003). Behaviour especially can be complex and highly variable even among closely related species, and lacks the potential for discovery of fossils to help infer ancestral states, yet it remains a relatively good marker of evolutionary history (de

Queiroz & Wimberger 1993). The study of these traits provide the potential to reconstruct

the actions of ancient organisms that we will never observe in our lifetimes, and to allow us to trace those actions through millions of years as they changed and diversified into the behaviours now being acted out every day. As such they present a powerful complement to the contribution of other streams of evolutionary research and provide a dynamic and

captivating story of the history of life and its ‘ever-branching and beautiful ramifications’.

REFERENCES

Baker, A., Pereira, S., & Paton, T. (2007). Phylogenetic relationships and divergence times of

Charadriiformes genera: multigene evidence for the Cretaceous origin of at least 14

clades of shorebirds. Biology Letters, 3(2), 205-210. doi: 10.1098/rsbl.2006.0606

Barker, F. K., Barrowclough, G. F., & Groth, J. G. (2002). A phylogenetic hypothesis for

passerine birds: taxonomic and biogeographic implications of an analysis of nuclear

DNA sequence data. Proceedings of the Royal Society B - Biological Sciences,

269(1488), 295-308. doi: 10.1098/rspb.2001.1883

Bjorklund, M. (1994). Phylogenetic relationships among Charadriiformes: reanalysis of

previous data. Auk, 111(4), 825-832.

Blomberg, S., Garland, T., & Ives, A. (2003). Testing for phylogenetic signal in comparative

data: Behavioral traits are more labile. Evolution, 57(4), 717-745.

Buchholz, R. (2007). Behavioural biology: an effective and relevant conservation tool.

Trends in Ecology & Evolution, 22(8), 401-407. doi: 10.1016/j.tree.2007.06.002

Caro, T. (2007). Behavior and conservation: a bridge too far? Trends in Ecology &

Evolution, 22(8), 394-400. doi: 10.1016/j.tree.2007.06.003

Christian, P., Christidis, L., & Schodde, R. (1992). Biochemical systematics of the

Charadriiformes (Shorebirds) - relationships between the Charadrii, Scolopaci and

Lari. Australian Journal of Zoology, 40(3), 291-302.

Chu, P. C. (1995). Phylogenetic Reanalysis of Strauch's Osteological Data Set for the

Charadriiformes. The Condor, 97(1), 174-196.

Clutton-Brock, T. H. (1991). The evolution of parental care. Princeton, New Jersey:

Princeton University Press.

72 References 73

Cockburn, A. (2006). Prevalence of different modes of parental care in birds. Proceedings of

the Royal Society B - Biological Sciences, 273(1592), 1375-1383. doi:

10.1098/rspb.2005.3458

Cook, L., & Crisp, M. (2005). Directional asymmetry of long-distance dispersal and

colonization could mislead reconstructions of biogeography. Journal of

Biogeography, 32(5), 741-754. doi: 10.1111/j.1365-2699.2005.01261.x

Crawford, M., Jesson, L., & Garnock-Jones, P. (2009). Correlated evolution of sexual system

and life-history traits in mosses. Evolution, 63(5), 1129-1142. doi: 10.1111/j.1558-

5646.2009.00615.x

Darwin, C. (1859). On the origin of species by means of natural selection, or, the

preservation of favoured races in the struggle for life. London: John Murray.

Darwin, C. (1871). The descent of man and selection in relation to sex. New York: D.

Appleton and Co.

Degnan, J. H., & Rosenberg, N. A. (2009). Gene tree discordance, phylogenetic inference

and the multispecies coalescent. Trends in Ecology & Evolution, 24(6), 332-340. doi:

10.1016/j.tree.2009.01.009

Degnan, J., & Rosenberg, N. (2006). Discordance of species trees with their most likely gene

trees. PLOS Genetics, 2(5), 762-768. doi: 10.1371/journal.pgen.0020068

Edwards, S. V. (2009). Is a new and general theory of molecular systematics emerging?

Evolution; International Journal of Organic Evolution, 63(1), 1-19. doi:

10.1111/j.1558-5646.2008.00549.x

Edwards, S., Jennings, W., & Shedlock, A. (2005). Phylogenetics of modern birds in the era

of genomics. Proceedings of the Royal Society B - Biological Sciences, 272(1567),

References 74

979-992. doi: 10.1098/rspb.2004.3035

Ericson, P., Envall, I., Irestedt, M., & Norman, J. (2003). Inter-familial relationships of the

shorebirds (Aves : Charadriiformes) based on nuclear DNA sequence data. BMC

Evolutionary Biology, 3, 1471-2148.

Fain, M. G., & Houde, P. (2007). Multilocus perspectives on the monophyly and phylogeny

of the order Charadriiformes (Aves). BMC Evolutionary Biology, 7, 35. doi:

10.1186/1471-2148-7-35

Freckleton, R. (2009). The seven deadly sins of comparative analysis. Journal of

Evolutionary Biology, 22(7), 1367-1375. doi: 10.1111/j.1420-9101.2009.01757.x

Freckleton, R., Harvey, P., & Pagel, M. (2002). Phylogenetic analysis and comparative data:

A test and review of evidence. American Naturalist, 160(6), 712-726.

Futuyma, D., & Meagher, T. (Eds.). (2002). Executive Document: Evolution, Science, and

Society. The American Naturalist, 159(2), 219-220.

Garcia-Pena, G. E., Thomas, G. H., Reynolds, J. D., & Szekely, T. (2009). Breeding systems,

climate, and the evolution of migration in shorebirds. Behavioral Ecology, arp093.

doi: 10.1093/beheco/arp093

Garland, T., Bennett, A. F., & Rezende, E. L. (2005). Phylogenetic approaches in

comparative physiology. J Exp Biol, 208(16), 3015-3035. doi: 10.1242/jeb.01745

Gittleman, J., Jones, K., & Price, S. (2004). Supertrees: usings complete phylogenies in

comparative biology. In O. R. P. Bininda-Emonds (Ed.), Phylogenetic Supertrees:

Combining Information to Reveal the Tree of Life, Computational Biology Series

(Vol. 4). Norwell, Massachusetts: Kluwer Academic Publishers.

Groth, J. G., & Barrowclough, G. F. (1999). Basal divergences in birds and the phylogenetic

References 75

utility of the nuclear RAG-1 gene. Molecular Phylogenetics and Evolution, 12(2),

115-123. doi: 10.1006/mpev.1998.0603

Hackett, S. J., Kimball, R. T., Reddy, S., Bowie, R. C. K., Braun, E. L., Braun, M. J., et al.

(2008). A Phylogenomic Study of Birds Reveals Their Evolutionary History. Science,

320(5884), 1763-1768. doi: 10.1126/science.1157704

Heath, T., Hedtke, S., & Hillis, D. (2008a). Taxon sampling and the accuracy of phylogenetic

analyses. Journal of Systematics and Evolution, 46(3), 239-257. doi:

10.3724/SP.J.1002.2008.08016.

Heath, T., Zwickl, D., Kim, J., & Hillis, D. (2008b). Taxon sampling affects inferences of

macroevolutionary processes from phylogenetic trees. Systematic Biology, 57(1),

160-166. doi: 10.1080/10635150701884640.

Hogan-Warburg, A. (1966). Social behavior of the ruff, Philomachus pugnax (L.). Leiden:

Brill Archive.

Holm, S. (1979). A simple sequentially rejective multiple test procedure. Scandinavian

journal of statistics, theory, and applications, 6(2), 65-70. del Hoyo, J., Elliot, A., & Sargatal, J. (Eds.). (1996). Handbook of the birds of the world

(Volume 3): Hoatzin to Auks. Barcelona: Lynx Edicions.

Huelsenbeck, J., & Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogenetic

trees. Bioinformatics, 17(8), 754-755. doi: 10.1093/bioinformatics/17.8.754

International Wader Study Group. (2003). Waders are declining worldwide. Conclusions

from the 2003 International Wader Study Group Conference, Cadiz, Spain. Wader

Study Group Bulletin, 101/102, 8-12.

Jacob, J. (1978). Chemotaxic relationships within order Charadriiformes. Biochemical

References 76

Systematics and Ecology, 6(4), 347-350.

Lewis, P. (2001). A likelihood approach to estimating phylogeny from discrete

morphological character data. Systematic Biology, 50(6), 913-925. doi:

10.1080/106351501753462876

Lewontin, R. C. (2002). Directions in evolutionary biology. Annual Review of Genetics, 36,

1-18.

Liu, L., & Pearl, D. (2007). Species trees from gene trees: Reconstructing Bayesian posterior

distributions of a species phylogeny using estimated gene tree distributions.

Systematic Biology, 56(3), 504-514. doi: 10.1088/10635150701429982

Livezey, B. C., & Zusi, R. L. (2007). Higher-order phylogeny of modern birds (Theropoda,

Aves: Neornithes) based on comparative anatomy. II. Analysis and discussion.

Zoological Journal of the Linnean Society, 149(1), 1-95. doi: 10.1111/j.1096-

3642.2006.00293.x

Losos, J. (2008). Phylogenetic niche conservatism, phylogenetic signal and the relationship

between phylogenetic relatedness and ecological similarity among species. Ecology

Letters, 11(10), 995-1003. doi: 10.1111/j.1461-0248.2008.01229.x

Maddison, D., & Maddison, W. (2000). MacClade version 4: Analysis of phylogeny and

character evolution. Sinauer Associates, Sunderland Massachusetts.

Maddison, D., & Maddison, W. (2009). Mesquite: a modular system for evolutionary

analysis [Internet]. Version 2.71 build 514. Available from http://mesquiteproject.org.

McGuire, J. A., Witt, C. C., Altshuler, D. L., & Remsen, J. V. (2007). Phylogenetic

Systematics and Biogeography of Hummingbirds: Bayesian and Maximum

Likelihood Analyses of Partitioned Data and Selection of an Appropriate Partitioning

References 77

Strategy. Syst Biol, 56(5), 837-856. doi: 10.1080/10635150701656360

Morrison, R., Downes, C., & Collins, B. (1994). Population trends of shorebirds on fall

migration in eastern Canada 1974-1991. Wilson Bulletin, 106, 431-447.

Myers, J. P. (1981). Cross-seasonal interactions in the evolution of sandpiper social systems.

Behavioral Ecology and Sociobiology, 8(3), 195-202. doi: 10.1007/BF00299830

Nepokroeff, M., Sytsma, K. J., Wagner, W. L., & Zimmer, E. A. (2003). Reconstructing

ancestral patterns of colonization and dispersal in the Hawaiian understory tree genus

Psychotria (Rubiaceae): a comparison of parsimony and likelihood approaches.

Systematic biology, 52(6), 820–838.

Nylander, J. A. A., Ronquist, F., Huelsenbeck, J. P., & Nieves-Aldrey, J. L. (2004). Bayesian

phylogenetic analysis of combined data. Systematic Biology, 53(1), 47-67.

Olson, V., Liker, A., Freckleton, R., & Szekely, T. (2008). Parental conflict in birds:

comparative analyses of offspring development, ecology and mating opportunities.

Proceedings of the Royal Society B - Biological Sciences, 275(1632), 301-307. doi:

10.1098/rspb.2007.1395

Owens, I. P. (2006). Where is behavioural ecology going? Trends in Ecology & Evolution,

21(7), 356-361. doi: 10.1016/j.tree.2006.03.014

Pagel, M. (1994). Detecting correlated evolution on phylogenies: a general method for the

comparative analysis of discrete characters. Proceedings of the Royal Society of

London: Series B-Biological Sciences, 255(1342), 37-45.

Pagel, M. (1999). Inferring the historical patterns of biological evolution. Nature, 401(6756),

877-884.

Pagel, M. (1997). Inferring evolutionary processes from phylogenies. Zoologica Scripta,

References 78

26(4), 331-348.

Pagel, M., & Meade, A. (2006). Bayesian analysis of correlated evolution of discrete

characters by reversible-jump Markov chain Monte Carlo. American Naturalist,

167(6), 808-825. doi: 10.1086/503444

Paton, T. A., Baker, A., Groth, J., & Barrowclough, G. (2003). RAG-1 sequences resolve

phylogenetic relationships within Charadriiform birds. Molecular Phylogenetics and

Evolution, 29(2), 268-278. doi: 10.1016/S1055-7903(03)00098-8

Paton, T., Haddrath, O., & Baker, A. J. (2002). Complete mitochondrial DNA genome

sequences show that modern birds are not descended from transitional shorebirds.

Proceedings of the Royal Society B - Biological Sciences, 269(1493), 839–846. doi:

10.1098/rspb.2002.1961

Paton, T. A., & Baker, A. J. (2006). Sequences from 14 mitochondrial genes provide a well-

supported phylogeny of the Charadriiform birds congruent with the nuclear RAG-1

tree. Molecular Phylogenetics and Evolution, 39(3), 657-667. doi:

10.1016/j.ympev.2006.01.011

Pereira, S., & Baker, A. (2005). Multiple gene evidence for parallel evolution and retention

of ancestral states in the shanks (Charadriiformes: Scolopacidae). The Condor,

107(3), 514. doi: 10.1650/0010-5422(2005)107[0514:MGEFPE]2.0.CO;2

Price, J. J. (2009). Evolution and life-history correlates of female song in the New World

blackbirds. Behavioral Ecology, 20(5), 967-977. doi: 10.1093/beheco/arp085 de Queiroz, A., & Wimberger, P. H. (1993). The Usefulness of Behavior for Phylogeny

Estimation: Levels of Homoplasy in Behavioral and Morphological Characters.

Evolution, 47(1), 46-60.

References 79

Reynolds, J., Goodwin, N., & Freckleton, R. (2002). Evolutionary transitions in parental care

and live bearing in vertebrates. Philosophical transactions of the Royal Society B -

Biological Sciences, 357(1419), 269-281. doi: 10.1098/rstb.2001.0930

Reynolds, J., & Szekely, T. (1997). The evolution of parental care in shorebirds: Life

histories, ecology, and sexual selection. Behavioral Ecology, 8(2), 126-134.

Reynolds, J. D. (1996). Animal breeding systems. Trends in Ecology & Evolution, 11(2), 68-

72. doi: 10.1016/0169-5347(96)81045-7

Rice, W. R. (1989). Analyzing Tables of Statistical Tests. Evolution, 43(1), 223-225.

Rudbeck, L., & Dissing, J. (1998). Rapid, simple alkaline extraction of human genomic DNA

from whole blood, buccal epithelial cells, semen and forensic stains for PCR.

BioTechniques, 25(4), 588-590, 592.

Salemi, M., & Vandamme, A. (2003). The phylogenetic handbook. Cambridge University

Press.

Schmidt, H. A., Strimmer, K., Vingron, M., & von Haeseler, A. (2002). TREE-PUZZLE:

maximum likelihood phylogenetic analysis using quartets and parallel computing.

Bioinformatics, 18(3), 502-504. doi: 10.1093/bioinformatics/18.3.502

Sibley, C. G., Jon E. Ahlquist, & Monroe, B. L. (1988). A Classification of the Living Birds

of the World Based on Dna-Dna Hybridization Studies. The Auk, 105(3), 409-423.

Sibley, C. G., & Ahlquist, J. E. (1990). Phylogeny and classification of birds. Yale

University Press.

Strauch, J. (1978). The phylogeny of the Charadriiformes (Aves): a new estimate using the

method of character compatibility analysis. Transactions of the Zoological Society of

London, 34, 263-345.

References 80

Swofford, D. (2003). PAUP*: Phylogenetic analysis using parsimony (* and other methods),

version 4.0b10. Sinauer Associates, Sunderland, Massachusetts.

Szekely, T., Kosztolanyi, A., Kupper, C., & Thomas, G. (2007). Sexual conflict over parental

care: a case study of shorebirds. Journal of Ornithology, 148, S211-S217. doi:

10.1007/s10336-007-0218-1

Szekely, T., & Reynolds, J. D. (1995). Evolutionary Transitions in Parental Care in

Shorebirds. Proceedings: Biological Sciences, 262(1363), 57-64.

Tamura, K., Dudley, J., Nei, M., & Kumar, S. (2007). MEGA4: Molecular Evolutionary

Genetics Analysis (MEGA) software version 4.0. Molecular biology and evolution,

24(8), 1596-9.

Thomas, G., & Szekely, T. (2005). Evolutionary pathways in shorebird breeding systems:

Sexual conflict, parental care, and chick development. Evolution, 59(10), 2222-2230.

Thomas, G., Szekely, T., & Reynolds, J. (2007). Sexual conflict and the evolution of

breeding systems in shorebirds. In Advances in the Study of Behavior Volume 37

(Vol. 37, pp. 279-342). Elsevier.

Thomas, G., Wills, M., & Szekely, T. (2004). A supertree approach to shorebird phylogeny.

BMC Evolutionary Biology, 4. doi: 10.1186/1471-2148-4-28

Thomas, G., Freckleton, R., & Szekely, T. (2006). Comparative analyses of the influence of

developmental mode on phenotypic diversification rates in shorebirds. Proceedings of

the Royal Society B - Biological Sciences, 273(1594), 1619-1624. doi:

10.1098/rspb.2006.3488

Trivers, R. L. (1972). Sexual selection and the descent of man 1871-1971. In B. Campbell

(Ed.), (Vol. 12). Chicago: Aldine.

References 81

Van Tuinen, M., Waterhouse, D., & Dyke, G. (2004). Avian molecular systematics on the

rebound: a fresh look at modern shorebird phylogenetic relationships. Journal of

Avian Biology, 35(3), 191-194.

Visser, M. E., & Lessells, C. M. (2001). The costs of egg production and incubation in Great

Tits (Parus major). Proceedings of the Royal Society B - Biological Sciences,

268(1473), 1271-1277.

Watanabe, M., Nikaido, M., Tsuda, T. T., Inoko, H., Mindell, D. P., Murata, K., et al. (2006).

The rise and fall of the CR1 subfamily in the lineage leading to penguins. Gene, 365,

57-66.

Whittingham, L. A., Sheldon, F. H., & Emlen, S. T. (2000). Molecular phylogeny of jacanas

and its implications for morphologic and biogeographic evolution. The Auk, 117(1),

22-32.

Wikelski, M., Tarlow, E. M., Raim, A., Diehl, R. H., Larkin, R. P., & Visser, G. H. (2003).

Avian metabolism: Costs of migration in free-flying songbirds. Nature, 423(6941),

704. doi: 10.1038/423704a

Xia, X., & Xie, Z. (2001). DAMBE: software package for data analysis in molecular biology

and evolution. Journal of Heredity, 92(4), 371.

APPENDIX

Appendix 1. Sampled taxa and accession numbers for the construction of a multi-gene phylogeny of the Scolopaci. Scolopaci species Family RAG1 Cyt B ND2 12S COI Actitis hypoleucos Scolopacidae Actitis macularius Scolopacidae Actophilornis africanus Jacanidae Aphriza virgata Scolopacidae Arenaria interpres Scolopacidae Arenaria melanocephala Scolopacidae Attagis gayi Thinocoridae Attagis malouinus Thinocoridae Bartramia longicauda Scolopacidae Calidris acuminata Scolopacidae Calidris alba Scolopacidae Calidris alpina Scolopacidae Calidris bairdii Scolopacidae Calidris canutus Scolopacidae Calidris ferruginea Scolopacidae Calidris fuscicollis Scolopacidae Calidris himantopus Scolopacidae Calidris maritima Scolopacidae Calidris mauri Scolopacidae Calidris melanotos Scolopacidae Calidris minuta Scolopacidae Calidris minutilla Scolopacidae Calidris ptilocnemis Scolopacidae Calidris pusilla Scolopacidae Calidris ruficollis Scolopacidae Calidris subminuta Scolopacidae

82

Appendix 1 83

Scolopaci species Family RAG1 Cyt B ND2 12S COI Calidris temminckii Scolopacidae Calidris tenuirostris Scolopacidae Catoptrophorus semipalmatus Scolopacidae Coenocorypha aucklandica Scolopacidae Coenocorypha pusilla Scolopacidae Eurynorhynchus pygmeus Scolopacidae Gallinago delicata Scolopacidae Gallinago gallinago Scolopacidae Gallinago imperialis Scolopacidae Gallinago media Scolopacidae Gallinago nigripennis Scolopacidae Gallinago paraguaiae Scolopacidae Gallinago stenura Scolopacidae Heteroscelus brevipes Scolopacidae Heteroscelus incanus Scolopacidae Hydrophasianus chirurgus Jacanidae Irediparra gallinacea Jacanidae Jacana jacana Jacanidae Limicola falcinellus Scolopacidae Limnodromus griseus Scolopacidae Limnodromus scolopaceus Scolopacidae Limnodromus semipalmatus Scolopacidae Limosa fedoa Scolopacidae Limosa haemastica Scolopacidae Limosa lapponica Scolopacidae Limosa limosa islandica Scolopacidae Limosa limosa melanuroides Scolopacidae Microparra capensis Jacanidae Numenius americanus Scolopacidae Numenius arquata Scolopacidae Numenius madagascariensis Scolopacidae

Appendix 1 84

Scolopaci species Family RAG1 Cyt B ND2 12S COI Numenius minutus Scolopacidae Numenius phaeopus Scolopacidae hudsonicus Numenius phaeopus Scolopacidae variegatus Numenius tahitiensis Scolopacidae Pedionomus torquatus Pedionomidae Phalaropus fulicaria Scolopacidae Phalaropus lobatus Scolopacidae Phalaropus tricolor Scolopacidae Philomachus pugnax Scolopacidae Rostratula benghalensis Rostratulidae Rostratula semicollaris Rostratulidae Scolopax minor Scolopacidae Scolopax rusticola Scolopacidae Thinocorus orbignyianus Thinocoridae Thinocorus rumicivorus Thinocoridae Tringa erythropus Scolopacidae Tringa flavipes Scolopacidae Tringa glareola Scolopacidae Tringa melanoleuca Scolopacidae Tringa nebularia Scolopacidae Tringa ochropus Scolopacidae Tringa solitaria cinnamomea Scolopacidae Tringa solitaria solitaria Scolopacidae Tringa stagnatilis Scolopacidae Tringa totanus Scolopacidae Tryngites subruficollis Scolopacidae Xenus cinereus Scolopacidae

Appendix 1 85

Scolopaci species Family RAG1 Cyt B ND2 12S COI Outgroup

Sterna hirundo Sternidae Rynchops niger Rynchopidae

Appendix 2 86

Appendix 2. Character coding values for the sampled taxa for migration distance, male parental care (MC), female parental care (PC), male social mating systerm (MP), female social mating system (FP), and geographic region or distribution (D).

Migration Migration Scolopaci species distance MC FC MP FP D distance (mean) (1st quartile) Actitis hypoleucos 1 1 7 5 0 0 1 Actitis macularius 1 1 7 0 0 4 3 Actophilornis africanus 0 0 7 0 0 4 6 Aphriza virgata 1 1 7 7 0 0 3 Arenaria interpres 1 1 7 4 0 0 4 Arenaria melanocephala 0 0 7 7 0 0 3 Attagis gayi 0 0 0 7 0 0 2 Attagis malouinus 0 0 0 7 0 0 2 Bartramia longicauda 1 1 7 7 0 0 3 Calidris acuminata 1 1 0 7 4 4 1 Calidris alba 1 1 7 0 0 1 4 Calidris alpina 0 1 6 4 1 1 4 Calidris bairdii 1 1 7 4 0 0 4 Calidris canutus 1 1 7 6 0 0 4 Calidris ferruginea 1 1 0 7 - - 1 Calidris fuscicollis 1 1 0 7 3 0 3 Calidris himantopus 1 1 7 4 0 0 3 Calidris maritima 0 0 7 3 0 0 4 Calidris mauri 0 1 7 4 0 0 4 Calidris melanotos 1 1 0 7 4 - 4 Calidris minuta 1 1 7 0 1 2 1 Calidris minutilla 1 1 7 5 0 0 3 Calidris ptilocnemis 0 0 7 4 0 0 4 Calidris pusilla 1 1 7 5 0 0 3 Calidris ruficollis 1 1 7 4 0 0 1

Appendix 2 87

Migration Migration Scolopaci species distance MC FC MP FP D distance (mean) (1st quartile) lidris subminuta 0 1 7 4 - - 1 Calidris temminckii 1 1 7 0 3 3 1 Calidris tenuirostris 1 1 7 3 0 0 1 Catoptrophorus semipalmatus 0 1 7 5 0 0 3 Coenocorypha aucklandica 0 0 7 7 2 1 7 Coenocorypha pusilla 0 0 7 7 0 0 7 Eurynorhynchus pygmeus 1 1 7 4 0 0 1 Gallinago delicata 0 1 7 7 0 0 5 Gallinago gallinago 0 1 7 7 0 0 5 Gallinago imperialis 0 0 7 7 - - 2 Gallinago media 1 1 0 7 4 0 1 Gallinago nigripennis 0 0 7 7 0 0 6 Gallinago paraguaiae 0 0 7 7 - - 2 Gallinago stenura 1 1 7 7 0 0 1 Heteroscelus brevipes 1 1 7 7 - - 1 Heteroscelus incanus 1 1 7 7 0 0 4 Hydrophasianus chirurgus 0 0 7 0 0 4 8 Irediparra gallinacea 0 0 7 0 0 4 6 Jacana jacana 0 0 7 0 0 4 2 Limicola falcinellus 1 1 7 4 0 0 1 Limnodromus griseus 1 1 7 3 0 0 3 Limnodromus scolopaceus 0 1 7 2 0 0 4 Limnodromus semipalmatus 1 1 7 4 - - 1 Limosa fedoa 0 1 7 6 0 0 3 Limosa haemastica 1 1 7 7 0 0 3 Limosa lapponica 1 1 7 7 0 0 1 Limosa limosa islandica 0 1 7 7 0 0 1 Limosa limosa melanuroides 0 1 7 7 0 0 1 Microparra capensis 0 0 7 7 - - 6

Appendix 2 88

Migration Migration Scolopaci species distance MC FC MP FP D distance (mean) (1st quartile) Numenius americanus 0 0 7 4 0 0 3 Numenius arquata 1 1 7 6 0 0 1 Numenius madagascariensis 1 1 7 7 0 0 1 Numenius minutus 1 1 7 7 - - 1 Numenius phaeopus hudsonicus 1 1 7 6 - - 5 Numenius phaeopus variegatus 1 1 7 6 0 0 5 Numenius tahitiensis 1 1 7 5 0 0 3 Pedionomus torquatus 0 0 7 0 0 0 7 Phalaropus fulicaria 1 1 7 0 0 3 4 Phalaropus lobatus 1 1 7 0 0 2 4 Phalaropus tricolor 1 1 7 0 0 3 3 Philomachus pugnax 0 1 0 7 0 3 1 Rostratula benghalensis 0 0 7 0 4 0 5 Rostratula semicollaris 0 0 7 7 0 4 2 Scolopax minor 0 0 2 7 - - 3 Scolopax rusticola 0 1 0 7 4 0 1 Thinocorus orbignyianus 0 0 0 7 4 0 2 Thinocorus rumicivorus 0 1 0 7 0 0 2 Tringa erythropus 1 1 7 3 0 0 1 Tringa flavipes 1 1 7 7 0 1 3 Tringa glareola 1 1 7 4 0 0 1 Tringa melanoleuca 1 1 7 7 0 0 3 Tringa nebularia 0 1 7 6 0 0 1 Tringa ochropus 0 1 7 4 1 0 1 Tringa solitaria cinnamomea 1 1 7 7 0 0 3 Tringa solitaria solitaria 1 1 7 7 0 0 3 Tringa stagnatilis 1 1 7 7 0 0 1 Tringa totanus 0 1 7 6 0 0 1 Tryngites subruficollis 1 1 0 7 0 0 3

Appendix 2 89

Migration Migration Scolopaci species distance MC FC MP FP D distance (mean) (1st quartile) Xenus cinereus 1 1 - - 0 0 1

Outgroup Sterna hirundo 1 1 3 6 0 0 2 Rynchops niger 1 1 3 6 0 0 4