J Am Soc Nephrol 10: 472–480, 1999 cGMP-Dependent and -Independent Inhibition of a Kϩ Conductance by Natriuretic Peptides: Molecular and Functional Studies in Human Proximal Tubule Cells

JOCHEN R. HIRSCH,* MARKUS MEYER,† HANS-JURGEN MAGERT,¨ † WOLF-GEORG FORSSMANN,† STEEN MOLLERUP,‡ PETER HERTER,§ GERHARD WEBER,* RAINER CERMAK,*† IEVA ANKORINA-STARK,* EBERHARD SCHLATTER,* and MOGENS KRUHØFFER†ʈ *Westfa¨lische Wilhelms-Universita¨t Mu¨nster, Medizinische Poliklinik, Experimentelle Nephrologie, Mu¨nster, Germany; †Niedersa¨chsisches Institut fu¨r Peptid-Forschung, Hannover, Germany; ‡Department of Toxicology, National Institute of Occupational Health, Oslo, Norway; §Max-Planck-Institut fu¨r Molekulare Physiologie, Dortmund, Germany; and ʈAarhus University, Department of Molecular and Structural Biology, Aarhus, Denmark.

Abstract. In immortalized human kidney epithelial (IHKE-1) 15). The effects of ANP and 8-Br-cGMP were not additive cells derived from proximal tubules, two natriuretic peptide (n ϭ 4). CNP (10 nM) also depolarized these cells, by 3 Ϯ 1 receptors (NPR) were identified. In addition to NPR-A, which mV (n ϭ 28), despite the absence of an increase in cellular is bound by atrial natriuretic peptide (ANP), brain natriuretic cGMP levels, indicating a cGMP-independent mechanism. In peptide (BNP), and urodilatin (URO), a novel form of NPR-B the presence of CNP, 8-Br-cGMP further depolarized Vm sig- that might be bound by C-type natriuretic peptide (CNP) was nificantly, by 1.6 Ϯ 0.3 mV (n ϭ 5). The depolarizations by identified using PCR. This novel splice variant of NPR-B ANP were completely abolished in the presence of Ba2ϩ (1 (NPR-Bi) was also found in human kidney. Whereas ANP, mM, n ϭ 4) and thus can be related to inhibition of a Kϩ BNP, and URO increased intracellular cGMP levels in IHKE-1 conductance in the luminal membrane of IHKE-1 cells. The cells in a concentration-dependent manner, CNP had no effect depolarizations attributable to CNP were completely blocked on cGMP levels. To determine the physiologic responses to when genistein (10 ␮M, n ϭ 6), an inhibitor of tyrosine these agonists in IHKE-1 cells, the membrane voltage (Vm) was kinases, was present. These findings indicate that natriuretic monitored using the slow whole-cell patch-clamp technique. peptides regulate electrogenic transport processes via cGMP-

ANP (10 nM), BNP (10 nM), and URO (16 nM) depolarized dependent and -independent pathways that influence the Vm of these cells by 3 to 4 mV (n ϭ 47, 7, and 16, respectively), an IHKE-1 cells. effect that could be mimicked by 0.1 mM 8-Br-cGMP (n ϭ

Natriuretic peptides are a family of structurally related proteins for NPR-B, whereas NPR-A is activated mainly by ANP, that have a wide spectrum of biologic activities (1). To date, URO, and BNP. A third receptor, NPR-C or clearance receptor, four major natriuretic peptide subgroups have been identified: serves to remove natriuretic peptides from the plasma. It only atrial natriuretic peptide (ANP), urodilatin (URO), brain natri- has a short cytoplasmic domain and is not coupled to a guan- uretic peptide (BNP), and C-type natriuretic peptide (CNP). ylate cyclase. All known natriuretic peptides bind to this re- Three types of receptors for these peptides have been described ceptor (4). (2,3). Two of these receptors, i.e., natriuretic peptide receptor It is widely accepted that ANP and URO are responsible for A (NPR-A) and NPR-B, contain an intracellular guanylyl the reduction of NaCl reabsorption in the nephron, leading to cyclase domain that is activated upon binding of these peptides natriuresis and concomitant diuresis (5,6). The receptor to the extracellular receptor domain. CNP has a high affinity (NPR-A) has been localized in various sections of the kidney, especially in the glomeruli, thin limbs of Henle’s loop, cortical and inner medullary collecting ducts, and renal vasculature, Received June 4, 1998. Accepted September 15, 1998. using either immunohistochemical or reverse transcription The nucleotide sequence reported in this article has been submitted to the (RT)-PCR techniques (7,8). The major target sites for ANP in EMBL nucleotide sequence database (accession no. A3005282). the kidney are considered to be the glomeruli and the inner Correspondence to Dr. Mogens Kruhøffer, Aarhus University, Department of medullary collecting duct (9). However, in the proximal tubule Molecular and Structural Biology, C.F. Møllers Alle´, Building 130, DK-8000 it has been reported that ANP inhibits Naϩ and water reab- Aarhus C, Denmark. Phone: 45-8942-2600; Fax: 45-8942-2612; E-mail: sorption by an interaction with protein kinases (10,11) and [email protected] ϩ ϩ ϩ 1046-6673/1003-0472$03.00/0 Na -coupled phosphate cotransport as well as Na /H anti- Journal of the American Society of Nephrology port (12). To date, no such actions have been shown for CNP. Copyright © 1999 by the American Society of Nephrology Interestingly, specific mRNA for CNP could be demonstrated J Am Soc Nephrol 10: 472–480, 1999 Natriuretic Peptides Inhibit a Kϩ Conductance 473

in proximal convoluted and straight tubules using PCR analy- sis, indicating a possible autocrine or paracrine action (13). We demonstrate that in immortalized human kidney epithe- lial (IHKE-1) cells derived from the proximal tubule, NPR-A is expressed and the natriuretic peptides ANP, URO, and BNP ϩ depolarize the membrane voltage (Vm) by inhibition of a K conductance via a cGMP-dependent mechanism. Furthermore, we show that a splice variant of NPR-B (NPR-Bi) is present in these cells, as well as in the human kidney, and that CNP

depolarizes the Vm through a cGMP-independent mechanism. Materials and Methods Cell Culture IHKE-1 cells (derived from embryonic kidneys) were cultured as described previously (14). In short, IHKE-1 cells were maintained in Dulbecco’s modified Eagle medium/F-12 medium (1:1), with 15 mM Hepes, pH 7.3, 1.6 nM epidermal growth factor, 100 nM hydrocorti- ␮ sone, 83 M transferrin/insulin, 29 nM Na2SeO3, 10 mM NaHCO3, 20 mM L-glutamine, 1000 U/L penicillin/streptomycin, and 1% fetal

calf serum, in an atmosphere of 5% CO2/95% air at 37°C. Subcul- turing was performed using 0.05% trypsin/0.02% ethylenediamine- tetra-acetic acid in Mg2ϩ- and Ca2ϩ-free phosphate buffer. Culture medium was exchanged twice each week. Cells were used from passages 162 to 188. Cells grew polarized on glass coverslips, with the apical surface facing upward, and developed apical microvilli (Figure 1). After the glass coverslips with the cells were transferred from the culture dishes to the perfusion chamber, they were rinsed for at least 20 min before electrophysiologic measurements were started with a standard solution (see below), at 37°C in a constantly running bath. All media, buffers, and growth factors were purchased, at the Figure 1. Apical cell surface of immortalized human kidney epithelial highest available purity, from Life Technologies (Eggenstein, Germa- (IHKE-1) cells derived from human proximal tubules, imaged by ny), Biochrom/Seromed (Berlin, Germany), Calbiochem (Bad Soden, scanning electron microscopy. Cells form microvilli, which is similar Germany), Sigma (Deisenhofen, Germany), or Merck (Darmstadt, to the cellular morphologic features of proximal tubule cells in mam- Germany). malian kidneys. Magnification, ϫ6000. Scanning Electron Microscopy Cultured cells were fixed with 4% paraformaldehyde in phosphate- GTC; NPRB-3A, TTCAGCGCTTGACCATTAGACTCC; NPRBi-1S, buffered saline for 1 h and were stored in 8% paraformaldehyde in GACTCTCACTCCAGCCCTAGTCTC; NPRB-1f, ATGGCGCTGC- Hepes buffer until dehydration in ethanol solutions with increasing CATCACTTCTGCTGTTGG; NPRB-2850r, GGGTCGGTGGCGGAT- ethanol content. After the critical point, dried cells were coated with GCGAAAGGAAG; NPRB-2760f, CCGAAATGGTCAACGCCATG- a 10-nm-thick layer of platinum and examined using a Hitachi S-800 CACC; NPRB-3337r, CAAGCCAGAGAGGGACAGGTATATGTA; scanning electron microscope (Nissan Sanyo, Ratingen, Germany). NPRC-428f, GTGGCCCGGCTTGCATCGCACTGG; NPRC-805r, TC- CGGATGGTGTCACTGCTCG; UNIP-5, oligo(dT). Primers were ob- cGMP and cAMP Assays tained from Perkin Elmer (Weiterstadt, Germany) or Biometra (Go¨ttin- Cells were grown to confluence in 24-multiwell plates (10 mm), gen, Germany). washed twice with 2 ml of serum-free phosphate-buffered saline, and then preincubated at 37°C for 5 min in 1 ml of medium containing 1 RT-PCR mM 3-isobutyl-1-methylxanthine. The natriuretic peptides were added Cells from cultures were lysed ina4Mguanidinium chloride for 10 min. The reaction was stopped by removal of the medium, buffer, and total RNA was isolated using the RNeasy-kit (Qiagen, Ϫ addition of ice-cold ethanol, and storage at 20°C. The ethanol was Hilden, Germany). RNA from human kidney tissue samples was ␮ evaporated, the sediment was resuspended in 150 lof50mM purified as described previously (16). cDNA first-strand synthesis was sodium acetate buffer (pH 6.0) and acetylated, and cGMP or cAMP performed in a total reaction volume of 30 ␮l, containing 5 ␮g of total content was measured with a specific RIA (15). RNA, 200 ␮M nucleotide triphosphate mixture, and 200 U of RNaseHϪ SuperScript Plus reverse transcriptase (Life Technologies). Primers Used One-three hundredth of each cDNA first-strand reaction mixture was The following PCR primers were used (listed in the 5Ј to 3Ј then subjected to a 50-␮l PCR in a Perkin Elmer model 9600 ther- direction): NPRA-541f, CAAGCGCTCATGCTCTACGCCTAC; mocycler (Perkin Elmer), using 20 pmol of each primer and1Uof NPRA-1140r, GATGTTCTCCCCATCAGTAACAGTTC; NPRB-97f, Taq DNA polymerase (Biomol, Hamburg, Germany). Reaction con- GAACACAACCTGAGCTATGCC; NPRB-549r, GGTGAAGTAGT- ditions were as follows: 4 min at 94°C, 1 cycle; 30 s at 98°C, 1 min GAGGCCGGTCA; NPRB-2S, CTGGCCTCCCAGGCCGAAATG- at 58°C, and 1 min 72°C, 35 cycles. PCR products were analyzed by 474 Journal of the American Society of Nephrology J Am Soc Nephrol 10: 472–480, 1999

agarose gel electrophoresis using Sau3A-cleaved pUC18 as a size standard solution, at 37°C in the dark. Cells were excited at 340, 360, marker. and 380 nm using a filter wheel (Physiologisches Institut, Universita¨t For receptor-specific PCR, the following primer pairs were used: Freiburg) rotating at 10 Hz, with a Xenon quartz lamp (XBO 75 W; NPR-A, NPRA-541f/NPRA-1140r; NPR-B, NPRB-97f/NPRB-549r, Zeiss) as the light source. Fura-2 emission was recorded at 500 to 530 NPRBi-1S/NPRB-3A, and NPRB-2S/NPRB-3A; NPR-C, NPRC- nm from approximately five cells of each monolayer, using an ad- 428f/NPRC-805r. Negative controls included amplification reactions justable aperture. The ratio of the emissions after excitation at 340 and with non-reverse-transcribed RNA, amplifications without template, 380 nm at 10 Hz was calculated, and 10 consecutive values were and amplifications with a single primer. Amplification of the entire averaged, yielding a time resolution of 1 Hz. Signal noise and coding region of the IHKE-1 NPR-B was accomplished using the autofluorescence were measured before the cells were loaded with primer pairs NPRB-1f/NPRB-2850r and NPRB-2760f/NPRB-3337r, Fura-2/acetoxymethyl ester and amounted to Ͻ5% of the signal after which generated overlapping fragments of 2850 and 578 bp, respec- the cells were loaded. These background values were subtracted from tively. the measured signals for each experiment. Fluorescence at 360 nm was used to detect volume changes, leakage or bleaching of Fura-2, Genomic PCR loss of cells, or air bubbles in the area of measurement during the 2ϩ High-molecular weight genomic DNA from blood samples from experiment (19). Calibration of [Ca ]i was attempted at the end of 2ϩ three different male individuals was isolated as described (17). each experiment by incubation of the cells with the Ca ionophore ␮ Twenty-five nanograms of each DNA was subjected to PCR using the ionomycin (1 M; Sigma) in the presence (1.3 mM) and nominal 2ϩ primer pair NPRB-2S/NPRB-3A. Reaction conditions were as de- absence of Ca (with 5 mM EGTA), according to standard methods 2ϩ scribed above, with the exception of elongation steps of 2 min at (21), assuming a dissociation constant of Fura-2 for Ca of 224 nM. 72°C. Biochemical Reagents DNA Sequencing All standard chemicals and nucleotides were obtained, at the high- PCR products were separated by standard agarose gel electrophore- est available purity, from Merck, Calbiochem, or Sigma. The natri- sis. Gel pieces containing the desired DNA fragments were cut out uretic peptides ANP, URO, BNP, and CNP were synthesized in the with a clean scalpel, and the DNA was isolated using the QIAquick™ Niedersa¨chsisches Institut fu¨r Peptid-Forschung (Hannover, Ger- gel extraction kit (Qiagen, Hilden, Germany). Twenty to 40 ng of the many). purified fragments or 500 to 800 ng of the plasmid-cloned fragments were sequenced with each of the amplification primers (separately) or Statistical Analyses vector-derived standard sequencing primers and the DyeDeoxy Ter- Data are presented as original recordings from individual experi- minator cycle sequencing kit (Perkin Elmer). The reaction mixtures ments or as mean values Ϯ SEM, with n referring to the number of were subsequently analyzed using an ABI PRISM 310 DNA fluores- observations. Slow whole-cell experiments were performed in a cence sequencer (Perkin Elmer). paired manner, with control periods before and after each experimen- tal maneuver. Pre- and postexperiment control values were averaged Patch-Clamp Studies and compared with the corresponding experimental value. Therefore, Coverslips with cultured cells were fixed at the bottom of a per- a two-sided paired t test was used to test for statistical significance. fusion chamber mounted on an inverted microscope (IM 35; Zeiss, P Ͻ 0.05 was set as the significance level. Oberkochen, Germany). The perfusion chamber was continuously perfused at a rate of 10 to 30 ml/min with a standard solution Results containing 145 mM NaCl, 0.4 mM KH2PO4, 1.6 mM K2HPO4,5mM Stimulation of cGMP Production D-glucose, 1 mM MgCl , and 1.3 mM calcium gluconate; the pH was 2 As a functional index of NPR-A and NPR-B presence, we adjusted to 7.4. All agonists were dissolved in this standard solution compared the ability of four natriuretic peptides (ANP, URO, immediately before use. All experiments were performed at 37°C. and BNP for NPR-A and CNP for NPR-B) to stimulate cGMP Recordings of Vm were made in the cell-attached configuration, using the slow whole-cell method (18). For this method, pipettes were filled generation in IHKE-1 cells. Figure 2 shows the relationship with a solution containing 95 mM potassium gluconate, 30 mM KCl, between the concentration of each peptide and the cellular

1.2 mM NaH2PO4, 4.8 mM Na2HPO4,5mMD-glucose, 0.73 mM cGMP response. ANP and URO were equally potent and 1000 calcium gluconate, 1 mM ethylene glycol bis(␤-aminoethyl ether)- times more potent than BNP in stimulating cGMP generation. Ј Ј N,N,N ,N -tetra-acetic acid (EGTA), 1.03 mM MgCl2,and1mM ANP and URO both showed maximal stimulatory effects at a ATP; the pH was adjusted to 7.2 before 21 ␮M nystatin (Sigma) was concentration of 1 nM, with significant effects at 0.1 pM. CNP ⍀ added. The input resistance of these pipettes was 8 to 15 M . Vm and failed to stimulate cGMP production at concentrations up to currents across the membrane were recorded continuously with a 100 nM (Figure 2). All natriuretic peptides failed to increase patch-clamp amplifier (U. Fro¨be, Physiologisches Institut, Universita¨t intracellular cAMP levels (data not shown). Freiburg, Freiburg, Germany) and plotted with a pen recorder (WeKa- Graph WK-250R; WKK, Kaltbrunn, Switzerland). Voltages always refer to the cytosolic face of the membrane. Detection of NPR-A and NPR-B by RT-PCR Total RNA from IHKE-1 cells was transcribed into cDNA Measurements of Intracellular Ca2ϩ Concentrations by RT. A subsequent PCR with cDNA from IHKE-1 cells and 2ϩ 2ϩ NPR-A- or NPR-B-specific primers gave rise to DNA products The intracellular Ca concentration ([Ca ]i) of IHKE-1 cells was measured with the Ca2ϩ-sensitive dye Fura-2, as described previously of the expected sizes (600 and 453 bp, respectively). Compa- (19,20). IHKE-1 cells were incubated for 60 min with Fura-2/acet- rable levels of ␤-tubulin-specific PCR products were used, to oxymethyl ester (5 ␮M) dissolved with 0.1 g/L pluronic F-127 in enable semiquantitative interpretation of receptor gene expres- J Am Soc Nephrol 10: 472–480, 1999 Natriuretic Peptides Inhibit a Kϩ Conductance 475

Figure 3. Ethidium bromide-stained agarose gel showing the products of reverse transcription-PCR analysis of IHKE-1 cells. PCR was performed using 25, 30, 35, or 40 cycles (from left to right). Fifteen microliters of each reaction mixture was applied to the lanes. Homo- geneous natriuretic peptide receptor A (NPR-A)- and NPR-B-specific PCR products were obtained with the expected sizes of 600 and 453 bp, respectively. The comparable levels of ␤-tubulin-specific PCR products enabled reliable semiquantitative interpretation of receptor gene expression. No PCR products were obtained from negative controls (C).

Figure 2. Concentration-dependent increases in cellular cGMP levels via stimulation of particulate guanylate cyclase activity by the natri- contains the guanylyl cyclase catalytic domain, it is most uretic peptides atrial natriuretic peptide (ANP), urodilatin (URO), likely that NPR-Bi does not exhibit guanylyl cyclase activ- brain natriuretic peptide (BNP), and C-type natriuretic peptide (CNP), ity. in the presence of 3-isobutyl-1-methylxanthine (1 mM). Confluent To verify the existence of the detected NPR-Bi form, we cultures of IHKE-1 cells were processed as described in Materials and analyzed different cDNA and genomic DNA using NPR-B- Methods and were incubated with increasing concentrations of each and NPR-Bi-specific primers (Figure 5). First, we performed peptide. The amount of cGMP was measured by RIA. Each point represents the mean of triplicate measurements from three separate PCR with human kidney cDNA and cDNA from IHKE-1 cells, samples. The fits were performed freehand or were fitted linearly. using the primer pair NPRBi-1S/NPRB-3A (see above). NPRBi-1S is a sense primer derived from the insertion of the NPR-Bi variant, whereas NPRB-3A is an antisense primer sion (Figure 3). No product was obtained using the NPR-C- corresponding to the region flanking the downstream terminus specific primers (data not shown). Sequencing of the PCR of the insertion. In both cases, we obtained homogeneous PCR products verified the amplification of the authentic receptor fragments of the expected size of 169 bp, clearly verifying the DNA sequences of NPR-A and NPR-B. existence of the NPR-Bi splice variant. Furthermore, we per- formed PCR analysis with cDNA from human kidney, cDNA Cloning and Detection of an NPR-B Subtype from two independent IHKE-1 samples, and genomic DNA Because CNP failed to stimulate cGMP generation, we from three different male individuals, using the primer pair decided to investigate the NPR-B primary transcript in a NPRB-2S/NPRB-3A (see above). Primer NPRB-2S is a sense more precise way. For this purpose, we first amplified two primer hybridizing with the cDNA region flanking the NPR-Bi IHKE-1 cell-derived fragments representing the entire cod- insertion in the upstream direction. In the case of the human ing region of the NPR-B cDNA, as described above. Clon- kidney sample, as well as the two IHKE-1 cDNA samples, we ing and sequence analysis of the fragments revealed the obtained two different PCR fragments (248 and 319 bp). The existence of a variant of the NPR-B primary transcript, size of the smaller fragment corresponds to that expected for which was probably generated by alternative splicing. This NPR-B lacking the 71-bp insertion, whereas the larger frag- variant contains an additional 71-bp insertion, between the nucleotides in positions 3537 and 3538 of the NPR-B ment corresponds to the NPR-Bi form. Therefore, both forms cDNA, and was designated NPR-Bi (Figure 4). The 5Ј- and do exist in kidney and IHKE-1 cells. The same primer pair was 3Ј-terminal nucleotides of the insertion perfectly match the used to analyze the genomic DNA samples. In this case we consensus sequence for intron boundaries (exon ¦ exclusively obtained the larger fragment of 319 bp, indicating GTRAGOintronOAG ¦ exon) (22). The deduced amino that the 71-bp insertion represents an intron normally occurring acid sequence of the NPR-Bi variant corresponds to the within the human NPR-B gene. Next, a PCR was performed initial 941 amino acid residues of the wild-type receptor. using NPRBi-1S as the forward primer and UNIP-5, an oli- However, because of the additional insertion and a frame go(dT) primer, as the reverse primer, confirming that mRNA shift that results in premature termination of translation, the was amplified. In addition, all fragments obtained were se- carboxy-terminal 84 amino acids are replaced by 31 devi- quenced, directly confirming the correctness of the interpreta- ating amino acids. Because the carboxy terminus of NPR-B tions of the data given above. 476 Journal of the American Society of Nephrology J Am Soc Nephrol 10: 472–480, 1999

Figure 4. Comparison of the nucleotide and amino acid sequences of the published NPR-B and its splice variant (NPR-Bi) with an insertion from IHKE-1 cells. Nucleotides at the beginning and end of the insertion are splice consensus sequences (GT/AG); TGA describes a stop codon (TER), which arises from the frameshift resulting from the insert in the splice variant. The nucleotides between the splice consensus sequences are part of NPR-Bi. The numbers below the sequence indicate the amino acid positions in NPR-B, showing that the insert in the splice variant interrupts Gly963, which happens to be regenerated by the inserted sequence. Black bars, nontranslated regions; light gray bars, extracellular domain; dark gray bars, kinase-like domain; white bars, guanylyl cyclase domain; striped bar, insertion of NPR-Bi.

Electrophysiologic Characteristics and permeable analog of cGMP (3.8 Ϯ 0.6 mV, n ϭ 15). Figure 6 2ϩ [Ca ]i Measurements shows an original recording of Vm, demonstrating the depolar- IHKE-1 cells were investigated 5 to 15 d (10 Ϯ 1d,n ϭ ization induced by ANP (10 nM) and the lack of effect in the Ϫ Ϯ ϭ 2ϩ 297) after passaging and had a mean Vm of 54 1mV(n presence of Ba (1 mM). In four paired experiments in which 221). There was no detectable specific Naϩ conductance, be- the effect of ANP was tested in the absence and presence of ␮ ⌬ ϭ 2ϩ Ϯ 2ϩ cause amiloride (10 M) failed to hyperpolarize Vm ( Vm Ba , ANP depolarized Vm by 4 1 mV without Ba and Ϯ ϭ Ϫ Ϯ 1 1 mV, n 6). After complete removal of extracellular failed to depolarize Vm ( 0.4 0.5 mV) in the presence of ϩ 2ϩ Ϯ ϭ Na (replaced by N-methyl-D-glucosamine), cells were ini- Ba . BNP (10 nM) also depolarized Vm by 4.6 0.7 mV (n tially hyperpolarized by 21 Ϯ 2mV(n ϭ 36), indicating that 16), whereas CNP (10 nM, n ϭ 28) and URO (16 nM, n ϭ 7) ϩ Ϯ Ϯ these cells do posses Na -dependent electrogenic transport significantly depolarized Vm,by3.0 0.3 and 2.9 0.7 mV, systems, such as the Naϩ/glucose and Naϩ/phosphate trans- respectively. Figure 7 presents a summary of the effects of porters or nonselective cation channels. natriuretic peptides (ANP, URO, BNP, and CNP) and 8-Br- Ϫ Reduction of the extracellular Cl concentration from 145 to cGMP on Vm. There was no additivity between ANP and Ϫ ⌬ ϭ Ϯ ϭ 32 mM (replaced by gluconate) revealed a small Cl conduc- 8-Br-cGMP ( Vm 0.3 0.1 mV, n 4). However, in the Ϯ tance, because cells were initially depolarized by 5 1mV presence of CNP, 8-Br-cGMP further depolarized Vm signifi- ϭ Ϫ Ϯ ϭ (n 23). Neither the Cl channel blocker 5-nitro-2-(3-phe- cantly, by 1.6 0.3 mV (n 5). Because CNP depolarized Vm nylpropylamino)benzoate (10 ␮M) nor 4,4Ј-diisothiocyanatos- significantly but did not increase intracellular cGMP levels, we tilben-2,2Ј-disulfonic acid (0.5 mM) had significant effects on investigated the effects of two different activators of the pro- ϭ ␮ Vm (n 4 each). tein kinase A pathway on Vm. Forskolin (1 M) and 8-Cl- ϩ ⌬ Increasing the extracellular K concentration by 15 mM cAMP (0.1 mM) had no effect on the Vm of IHKE-1 cells ( Vm (with a corresponding decrease in the Naϩ concentration) ϭ 1 Ϯ 1 mV, n ϭ 16 and 6, respectively). sn-1,2-Dioctanoyl- resulted in a depolarization of 12 Ϯ 1mV(n ϭ 66). A glycerol (1 ␮M), a membrane-permeable activator of protein ϩ ⌬ ϭ Ϯ ϭ comparable response was seen with the K channel blocker kinase C, also had no effect on Vm ( Vm 1 1 mV, n 8). 2ϩ ⌬ ϭ Ϯ ϭ Ba at a concentration of 1 mM ( Vm 14 2 mV, n 20). In seven experiments, CNP (10 nM) also failed to change 2ϩ After demonstration of the receptors for natriuretic peptides [Ca ]i. As a positive control for the reactivity of these cells, and observation of increases in intracellular cGMP levels pro- we used ATP (10 ␮M), which reversibly and significantly 2ϩ duced by these peptides, we were interested in the physiologic increased [Ca ]i in these cells, by approximately 300 nM responses to these agonists in IHKE-1 cells. Therefore, we (n ϭ 13). Removal of extracellular Ca2ϩ significantly reduced 2ϩ Ϯ ϭ measured the Vm of IHKE-1 cells with the patch-clamp tech- [Ca ]i by 31 14 nM (n 16). nique. In 47 recordings, ANP (1 nM) depolarized IHKE-1 cells Because of the one-transmembrane domain structure of the by 4.0 Ϯ 0.4 mV. At a concentration of 0.1 nM, ANP still CNP receptor, we also tested genistein (10 ␮M), an inhibitor of Ϯ ϭ significantly depolarized Vm,by3.0 0.6 mV (n 6). This the tyrosine kinases epidermal growth factor receptor and effect was mimicked by 8-Br-cGMP (0.1 mM), a membrane- p60v-src (23). In six paired experiments, CNP (10 nM) depo- J Am Soc Nephrol 10: 472–480, 1999 Natriuretic Peptides Inhibit a Kϩ Conductance 477

Figure 5. Agarose gel electrophoresis of the different PCR fragments obtained using NPR-B- and NPR-Bi-specific primers and different samples of cDNA and genomic DNA (inverse presentation). Amplification of homogeneous cDNA fragments of the expected size of 169 bp from human kidney and IHKE-1 (IHKE A) cDNA using the NPR-Bi-specific primer pair NPRBi-1S/NPRB-3A indicates the occurrence of this receptor form in both samples. The use of the primer pair NPRB-2S/NPRB-3A, flanking the 71-bp insertion of the NPR-Bi-specific cDNA, led to the amplification of small (248 bp) and large (319 bp) fragments from cDNA from human kidney and two independent IHKE-1 samples (IHKE A and IHKE B). These sizes correspond to those expected for the NPR-B and NPR-Bi forms, respectively, indicating the existence of both mRNA variants in the samples analyzed. Using the same primer pair, only the larger fragment was obtained from three different samples of human genomic DNA (Gen. A, Gen. B, and Gen. C; see text), indicating that the 71-bp NPR-Bi insertion represents a normally occurring intron within the human NPR-B gene.

Ϯ larized Vm by 3.1 0.3 mV, whereas in the presence of as their most important sites of action (5,6,9). In proximal genistein these depolarizations were completely abolished tubules, it was shown that ANP inhibits Naϩ and water reab- ⌬ ϭ Ϯ ( Vm 0.3 0.5 mV). In five of five excised membrane sorption (10,27,28). ϩ patch experiments, genistein had no direct effect on the K In this study, we show an inhibitory effect of natriuretic channel itself. peptides on a Kϩ conductance in the apical membrane of

IHKE-1 cells. Natriuretic peptides depolarized the Vm of Discussion IHKE-1 cells, indicating either activation of a nonselective To elucidate the physiologic functions and possible clinical cation conductance or a ClϪ conductance or inhibition of a Kϩ implications of the actions of members of the natriuretic pep- conductance. Because the depolarizing effects of ANP on the tide family in the renal proximal tubule, the NPR system was 2ϩ Vm of these cells were completely abolished by Ba , a well investigated. We monitored possible changes in cellular cGMP known Kϩ channel blocker, it is clear that natriuretic peptides and cAMP concentrations, electrophysiologic parameters, and ϩ 2ϩ inhibited a K conductance in our study. Direct effects of [Ca ] after addition of cGMP-stimulating agonists to immor- ϩ ϩ i natriuretic peptides on K conductances and K channels were talized human kidney epithelial (IHKE-1) cells, as a model for reported for mesangial cells, where a Kϩ conductance was the proximal tubule. These cells provide several indications stimulated by ANP, BNP, and URO (29) and where a large that they are derived from proximal tubules, e.g., they possess Ca2ϩ-dependent Kϩ channel was activated by ANP (30), and brush border membranes with microvilli, they express proxi- ϩ mal tubule-specific enzyme markers (maltase, alkaline phos- for adrenal glomerulosa cells, where ANP also activated a K conductance (31). Furthermore, in rat pituitary tumor (GH4C1) phatase, and leucine aminopeptidase) in the luminal mem- ϩ brane, and they exhibit several Naϩ-dependent and cells, a K channel was activated by natriuretic peptides, via -independent amino acid and organic cation transport systems cGMP-dependent dephosphorylation (32), and a new endoge- ϩ (24–26). nous natriuretic factor (LLU-␣) was shown to inhibit a K In the kidney, natriuretic peptides led to natriuresis and channel in the luminal membrane of the thick ascending limb diuresis, with glomeruli and inner medullary collecting ducts of rat kidney (33). In rat cortical collecting ducts, we recently 478 Journal of the American Society of Nephrology J Am Soc Nephrol 10: 472–480, 1999

Figure 6. Original recording of the membrane voltage (Vm) of IHKE-1 cells with the slow whole-cell method. ANP (10 nM) depolarized Vm by 4 mV, but in the presence of 1 mM Ba2ϩ it was without effect. The induced depolarization by ANP could be repeated after Ba2ϩ was washed out. C, control solution.

described in this study, led to a depolarization of 4 mV. This moderate effect decreases the driving force for Naϩ-coupled transport systems and thus might explain the reduced Naϩ transport seen with ANP in the proximal tubule (10,12). This effect might be more pronounced in proximal tubules in vivo; in the cultured cells used in this study, the Kϩ conductance

contributes less to Vm, leading to more depolarized baseline Vm values, compared with in vivo studies (36). The effects of

natriuretic peptides on Vm and intracellular cGMP levels are already maximal at a concentration of 100 pM, which is within the physiologic range of ANP concentrations in plasma. A more detailed characterization of this Kϩ conductance, espe- cially a resolution at the single-channel level, determination of its involvement in Naϩ-coupled transport processes, and its

responsibility for repolarizing Vm, will be the subject of a future study. Three different receptors for natriuretic peptides have been characterized: NPR-A, NPR-B, and NPR-C (2,3). In proximal tubules, NPR-A and NPR-B were detected in rat kidneys by RT-PCR microlocalization (7,13). The existence of NPR-A was also demonstrated in microdissected proximal tubules of Figure 7. Summary of the effects of ANP (10 nM), BNP (10 nM), rat and rabbit kidneys by peptide binding studies (37). In this CNP (10 nM), URO (16 nM), and 8-Br-cGMP (10 mM) on Vm of IHKE-1 cells. The numbers in parentheses refer to the number of study, we detected the messages for NPR-A and NPR-B in experiments. *P Ͻ 0.05, statistical significance of the effects. IHKE-1 cells using the RT-PCR technique. As expected, all natriuretic peptides increased intracellular cGMP levels; only CNP had no effect on the intracellular cGMP concentration, demonstrated activation of a Kϩ channel via a cGMP-depen- even at the high concentration of 10Ϫ7 M. Therefore, the dent protein kinase (34,35). observed effect of CNP on Vm is apparently not mediated via Inhibition of the Kϩ conductance by natriuretic peptides, as cGMP. This conclusion is supported by the additivity of effects J Am Soc Nephrol 10: 472–480, 1999 Natriuretic Peptides Inhibit a Kϩ Conductance 479 attributable to CNP and 8-Br-cGMP. Such additivity was not of Naϩ-dependent transport processes in these proximal tubule seen with ANP and 8-Br-cGMP. A lack of increase in cGMP cells. levels with CNP was previously described in proximal convo- luted tubules (13), despite the demonstrated presence of Acknowledgments NPR-B (2,3). By cloning the complete NPR-B expressed in This study was supported by the Deutsche Forschungsgemeinschaft IHKE-1 cells, we found that these cells predominantly express (Schl 277/5-1 to 5-4), the Alexander von Humboldt Foundation, the a splice variant of NPR-B (NPR-Bi). This receptor exhibits a Zentrum fu¨r Innovative Medizinische Forschung Mu¨nster (Hi-1-1-II/ modified guanylyl cyclase domain in which the last 84 amino 96-7), the Danish Center for Respiratory Physiological Adaptation, acids at the carboxy terminus have been replaced by 31 unre- and the Danish Cancer Society (Grants 95-100-40 and 78-5000). We lated amino acids. The NPR-Bi insertion contains the con- gratefully acknowledge Dr. K. Adermann for help with the synthesis served intron/exon splicing sites and a lariat sequence of natriuretic peptides. The authors thank Sabine Haxelmans, Ingrid Kleta, Melanie Klingenberg, Ulrike Opel, Daniela Rehder, and Heike (CTGAC), which is necessary for correct splicing (38). A Stegemann for excellent technical assistance. phosphodiester bond is formed between the 5Ј terminus of the intron at the RNA level and the 2Ј-hydroxy group of the adenosine nucleotide of the lariat sequence. Nevertheless, the References 1. Rosenzweig A, Seidman CE: Atrial natriuretic factor and related position of the lariat sequence directly behind the splice donor hormones. Annu Rev Biochem 60: 229–255, 1991 site is somewhat unusual, if not sterically hindering (for the 2. Maack T: Receptors of atrial natriuretic factor. Annu Rev Physiol sequence, see Figure 4). Therefore, splicing may not be as 54: 11–27, 1992 accurate, and both receptor variants are possible. Such a tran- 3. Garbers DL, Lowe DG: Guanylyl cyclase receptors. J Biol Chem script would give rise to a receptor that might still be able to 269: 30741–30744, 1994 bind CNP because of the unmodified extracellular domain but 4. Zhao J, Ardaillou N, Lu C-Y, Placier S, Pham P, Badre L, would not elicit a cGMP response. We also detected a signal Cambar J, Ardaillou R: Characterization of C-type natriuretic for NPR-Bi in whole human kidney, which clearly indicates peptide receptors in human mesangial cells. Kidney Int 46: 717– that this splice variant is not restricted to this cultured cell line. 725, 1994 5. Brenner BM, Ballermann BJ, Gunning ME, Zeidel ML: Diverse Because we also found a weaker signal for wild-type NPR-B in biological actions of atrial natriuretic peptide. Physiol Rev 70: IHKE-1 cells, there are at least two possible reasons why we 665–699, 1990 did not detect any increase in intracellular cGMP levels: (1) 6. Kishimoto I, Dubois SK, Garbers DL: The heart communicates The mRNA is not translated into a functional NPR-B. (2) The with the kidney exclusively through the guanylyl cyclase-A wild-type NPR-B is located on the basolateral side of these receptor: Acute handling of sodium and water in response to cells and, because this membrane is barely accessible in our volume expansion. Proc Natl Acad Sci USA 93: 6215–6219, preparation, CNP could not bind this receptor. The aforemen- 1996 tioned lack of an effect of CNP on cellular cGMP levels in rat 7. Terada Y, Moriyama T, Martin BM, Knepper MA, Garcia-Perez proximal tubules, despite the presence of NPR-B, indicates that A: RT-PCR microlocalization of mRNA for guanylyl cyclase- coupled ANF receptor in rat kidney. Am J Physiol 261: F1080– NPR-Bi is possibly present in these rat cells as well. ANP, F1087, 1991 URO, and BNP induced strong intracellular cGMP responses 8. Ritter D, Dean AD, Gluck SL, Greenwald JE: Natriuretic peptide and depolarized Vm; therefore, we must assume that at least receptors A and B have different cellular distributions in rat NPR-A is located in the apical membrane. The effect of CNP kidney. Kidney Int 48: 1758–1766, 1995 on Vm in these cells was blocked in the presence of genistein, 9. Zeidel ML: Hormonal regulation of inner medullary collecting an inhibitor of tyrosine kinases (23). If CNP binds to this duct sodium transport. Am J Physiol 265: F159–F173, 1993 receptor, it could be that this receptor splice variant has the 10. Harris PJ, Thomas D, Morgan TO: Atrial natriuretic peptide capability of autophosphorylation and may act as a tyrosine inhibits angiotensin-stimulated proximal tubular sodium and wa- kinase when regulating the Kϩ channel in these cells. Inhibi- ter reabsorption. Nature (Lond) 326: 697–698, 1987 ϩ 11. Garcia NH, Garvin JL: ANF and angiotensin II interact via tion of a K channel in T lymphocytes via tyrosine kinase kinases in the proximal straight tubule. Am J Physiol 268: F730– activation was recently shown (39). Because there was no F735, 1995 2ϩ significant change in [Ca ]i attributable to CNP or any change 12. Hammond TG, Yusufi ANK, Knox FG, Dousa TP: Administra- in Vm attributable to activators of the cAMP pathway (forskolin tion of atrial natriuretic factor inhibits sodium-coupled transport or 8-Cl-cAMP) or protein kinase C (sn-1,2-dioctanoylglyc- in proximal tubules. J Clin Invest 75: 1983–1989, 1985 erol), we can exclude participation of these candidates. 13. Terada Y, Tomita K, Nonoguchi H, Yang T, Marumo F: PCR In conclusion, natriuretic peptides that bind to NPR-A reg- localization of C-type natriuretic peptide and B-type receptor ulate a Kϩ conductance in the apical membrane of human mRNAs in rat nephron segments. Am J Physiol 267: F215–F222, proximal tubule cells via a cGMP-dependent pathway. CNP 1994 14. Tveito G, Hansteen I-L, Dalen H, Haugen A: Immortalization of uses a different, cGMP-independent pathway, which might normal human kidney epithelial cells by nickel(II). Cancer Res involve tyrosine kinase activity. Its receptor (NPR-B) is coex- 49: 1829–1835, 1989 pressed with a splice variant (NPR-Bi) that lacks a functional 15. Kaever V, Resch K: Are cyclic nucleotides involved in the guanylyl cyclase catalytic domain but may act as a tyrosine initiation of mitogenic activation of human lymphocytes? Bio- ϩ kinase. The K conductance might be an important regulator chim Biophys Acta 846: 216–225, 1985 480 Journal of the American Society of Nephrology J Am Soc Nephrol 10: 472–480, 1999

16. Ma¨gert H-J, Hadrys T, Cieslak A, Gro¨ger A, Feller S, Forssmann 27. Harris PJ, Skinner SL: Intra-renal interactions between angioten- W-G: cDNA sequence and expression pattern of the putative sin II and atrial natriuretic factor. Kidney Int 38: S87–S91, 1990 pheromone carrier aphrodisin. Proc Natl Acad Sci USA 92: 28. Maack T: Role of atrial natriuretic factor in volume control. 2091–2095, 1995 Kidney Int 49: 1732–1737, 1996 17. Wei␤ J, Ma¨gert H-J, Cieslak A, Forssmann W-G: Association 29. Cermak R, Kleta R, Forssmann W-G, Schlatter E: Natriuretic between different psychotic disorders and the DRD4 polymor- peptides increase a Kϩ conductance in rat mesangial cells. phism, but no difference in the main ligand binding region of the Pflu¨gers Arch 431: 571–577, 1996 DRD4 receptor protein compared to controls. Eur J Med Res 1: 30. Stockand JD, Sansom SC: Role of large Ca2ϩ-activated Kϩ 439–445, 1996 channels in regulation of mesangial contraction by nitroprusside 18. Greger R, Kunzelmann K: Simultaneous recording of the cell and ANP. Am J Physiol 270: C1773–C1779, 1996 membrane potential and properties of the cell attached membrane 31. Ganz MB, Nee JJ, Isales CM, Barrett PQ: Atrial natriuretic of HT29 colon carcinoma and CF-PAC cells. Pflu¨gers Arch 419: peptide enhances activity of potassium conductance in adrenal 209–211, 1991 glomerulosa cells. Am J Physiol 266: C1357–C1365, 1994 19. Nitschke R, Fro¨be U, Greger R: Antidiuretic hormone acts via V1 32. White RE, Lee AB, Shcherbatko AD, Lincoln TM, Schonbrunn receptors on intracellular calcium in the isolated perfused cortical A, Armstrong DL: Potassium channel stimulation by natriuretic thick ascending limb. Pflu¨gers Arch 417: 622–632, 1991 peptides through cGMP-dependent dephosphorylation. Nature 20. Schlatter E, Ankorina I, Haxelmans S, Kleta R: Effects of dia- (Lond) 361: 263–266, 1993 denosine polyphosphates, ATP and angiotensin II on cytosolic 33. Wechter WJ, Kantoci D, Murray ED Jr, D’Amico DC, Jung ME, Ca2ϩ-activity and contraction of rat mesangial cell. Pflu¨gers Wang W-H: A new endogenous natriuretic factor: LLU-␣. Proc Arch 430: 721–728, 1995 2ϩ Natl Acad Sci USA 93: 6002–6007, 1996 21. Grynkiewicz G, Poenie M, Tsien RY: A new generation of Ca ϩ 34. Hirsch J, Schlatter E: K channels in the basolateral membrane indicators with greatly improved fluorescence properties. J Biol of rat cortical collecting duct are regulated by a cGMP-dependent Chem 260: 3440–3450, 1985 protein kinase. Pflu¨gers Arch 429: 338–344, 1995 22. Mount SM: A catalogue of splice junction sequences. Nucleic 35. Hirsch J, Schlatter E: Kϩ channels in the basolateral membrane Acids Res 10: 459–472, 1982 23. Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh of rat cortical collecting duct. Kidney Int 48: 1036–1046, N, Shibuya M, Fukami Y: Genistein, a specific inhibitor of 1995 tyrosine-specific protein kinases. J Biol Chem 262: 5592–5595, 36. Fro¨mter E: Electrophysiological analysis of rat renal sugar and 1987 amino acid transport. I. Basic phenomena. Pflu¨gers Arch 393: 24. Jessen H, Røigaard H, Riahi-Esfahani S, Jacobsen C: A compar- 179–189, 1982 ative study on the uptake of ␣-aminoisobutyric acid by normal 37. Butlen D, Mistaoui M, Morel F: Atrial natriuretic peptide recep- 125 ␣ and immortalized human embryonic kidney cells from proximal tors along the rat and rabbit nephrons: [ I] -rat atrial natri- tubule. Biochim Biophys Acta 1190: 279–288, 1994 uretic peptide binding in microdissected glomeruli and tubules. 25. Hirsch JR, Gonska T, Waldegger S, Lang F, Schlatter E: Naϩ- Pflu¨gers Arch 408: 356–365, 1987 dependent and -independent amino acid transport systems in 38. Keller W: The RNA lariat: A new ring to the splicing of mRNA immortalized human kidney epithelial cells derived from the precursors. Cell 39: 423–425, 1984 proximal tubule. Kidney Blood Press Res 21: 50–58, 1998 39. Szabo` I, Gulbins E, Apfel H, Zhang X, Barth P, Busch AE, 26. Hohage H, Stachon C, Feidt C, Hirsch JR, Schlatter E: Regula- Schlottmann K, Pongs O, Lang F: Tyrosine phosphorylation- ϩ tion of cation transport in IHKE-1 and LLC-PK1 cells: Fluoro- dependent suppression of a voltage-gated K channel in T lym- metric studies with 4-(4-dimethylaminostyryl)-N-methylpyri- phocytes upon Fas stimulation. J Biol Chem 271: 20465–20469, dinium. J Pharmacol Exp Ther 286: 305–310, 1998 1996