Structural Insights of Human Mitofusin-2 Into Mitochondrial Fusion and CMT2A Onset

Supplementary Information for

Structural insights of human mitofusin-2 into mitochondrial fusion and CMT2A onset

Yu-Jie Li1, Yu-Lu Cao1, Jian-Xiong Feng1, Yuanbo Qi2, Shuxia Meng3, Jie-Feng Yang1, Ya-Ting Zhong1, Sisi Kang4, Xiaoxue Chen4, Lan Lan5,6, Li Luo1, Bing Yu1, Shoudeng Chen4, David C. Chan3, Junjie Hu2,5,6, Song Gao1,7,*

Corresponding author: Song Gao ([email protected]). Yu-Jie Li, Yu-Lu Cao and Jian-Xiong Feng contributed equally to this work.

1, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou 510060, China.

2, Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin 300071, China.

3, Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA, USA.

4, Department of Experimental Medicine, Guangdong Provincial Key Laboratory of Biomedical Imaging, The Fifth affiliated Hospital, Sun Yat-sen University, Zhuhai 519000, China.

5, National Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China

6, University of Chinese Academy of Sciences, Beijing 100101, China

7, Guangzhou Regenerative Medicine and Health Guangdong Laboratory, Guangzhou 510530, China.

Supplementary Fig. 1 Nucleotide-loading states of MFN2IM after purification a, HPLC chromatograph shows that freshly purified MFN2IM is loaded with GTP. b, MFN2IM purified with optimized protocol is free of guanine nucleotides.

Supplementary Fig. 2 Biochemical and structural features of MFN2IM a, The structure and topology diagram of the G domains of MFN2IM, MFN1IM (Protein Data Bank code 5GOM), and dynamin-1 (2X2E). Secondary structural elements are not drawn to scale. The G G G MFN2-specific 310 helices (η1 and η2 ) and β2’ are colored cyan. Note that because of extra 1 secondary elements, element labeling of MFN2IM is slightly different from that of MFN1IM . b, Hydrophobic network within HD1. Side chains of the residues involved in the network are shown in the same color as the helices they belong to. c, The conventional HR2 is part of the HD1. ɑ4H comprising a large portion of HR2 is colored blue. and the rest part of MFN2IM is shown as hydrophobic surface representation. Note the extensive green patch underneath ɑ4H, which entails a tight hydrophobic association.

H H H H d, Extended ɑ3 and ɑ4 of MFN2IM as compared to MFN1IM. MFN1IM is colored grey. ɑ3 and ɑ4 of

MFN2IM are colored green and blue, respectively. e, Distribution of residues in HD1. No intramolecular interaction exists between Met376 and Leu727, or between His380 and Asp725. f, Binding of GMPPNP with MFN2IM and MFN1IM measured by ITC. N/D, not determined.

Supplementary Fig. 3 Structure of truncated MFN2IM(T111D) a, Structural comparison between MFN2IM(T111D) (violet) and GDP-bound MFN2IM (pink). b, Details of the T111D mutation. The GDP molecule is shown as ball-and-stick model. Note that the side chain of negatively-charged Asp111 causes a space- and charge-hindrance to the accommodation of the phosphate groups of GDP. c, Binding of GTPγS and GDP with MFN2IM(T111D) measured by ITC. N/D, not determined.

2+ d, The coordination of Ca of apo MFN2IM (upper-left) and MFN2IM(T111D) (right). Involved residues and acetate ion and are shown as ball-and-stick models. Electron density map is shown as blue mesh at a contour level of 1.0σ. e, GTP turnover rates of wild-type MFN2IM in the absence and presence of 10 mM CaCl2. Error bars indicate s.d. (n = 3). Source data are provided as a Source Data file. f, Dimerization property of nucleotide-free wild-type MFN2IM (left) and MFN2IM(T111D) (right) after incubated with 10 mM CaCl2 for 2 h. 5 mM CaCl2 were supplied to the running buffer of the RALS assay.

Supplementary Fig. 4 The difference in the switch I of human mitofusins a, GTP turnover rates of wild-type MFN1IM/MFN2IM and corresponding mutants. Error bars indicate s.d. (n = 3). Source data are provided as a Source Data file. b, Sequence alignment of primate and non-primate mitofusins in switch I. The equivalent positions for Thr129 of human MFN2 are highlighted by red frames. Primates: hs, Homo sapiens; cs, Chlorocebus sabaeus; an, Aotus nancymaae; sb, Saimiri boliviensis; rb, Rhinopithecus bieti; po, Pongo abelii; nl, Nomascus leucogenys; pa, Papio anubis; pt, Piliocolobus tephrosceles; tg, Theropithecus gelada; ma, Macaca mulatta. Non-primates: ss, Sus scrofa; bt, Bos taurus; oa, Ovis aries; ec, Equus caballus; cl, Canis lupus familiaris; fc, Felis catus; oc, Oryctolagus cuniculus; gg, Gallus gallus; xt, Xenopus tropicalis; dr, Danio rerio; dm, Drosophila melanogaster. c, Comparison of the configuration of switch I between MFN2IM and MFN1IM (PDB code 5GO4) in the nucleotide-free state. Switch I regions are highlighted in yellow. Thr129 of MFN2IM, Ile108 and other residues involved in the hydrophobic network of MFN1IM are shown as stick-and-ball models. d, Binding of GTPγS and GDP with MFN2IM(T129I) and MFN1IM(I108T).

Supplementary Fig. 5 Dimerization test of MFN2IM a, Dimerization property of MFN2IM in different nucleotide-loading states. b, GTP-induced MFN2IM dimers slowly hydrolyze GTP while keeping associated. Left: RALS analysis of MFN2IM-GTP mixture after incubation for 2 h. Right: HPLC analysis of the nucleotides in different fractions of the dimer peak in gel-filtration. c, Dimerization property of freshly purified GTP-loaded MFN2IM. d, Location of the citrate ions (shown as spheres) at the G interface. e, Interactions of citrate with MFN2IM. The citrate ion and corresponding residues are shown as ball-and-stick models. Electron density map for citrate is shown as blue mesh at a contour level of 1.2σ. f, GTP turnover rates of MFN2IM in the absence and presence of 10 mM sodium citrate. Error bars indicate s.d. (n = 3). Source data are provided as a Source Data file. g, Dimerization property of MFN2IM in the presence of GDP after incubated with 10 mM sodium citrate for 2 h. 5 mM sodium citrate were supplied to the running buffer of the RALS assay.

Supplementary Fig. 6 The differences of the MFN2IM and MFN1IM dimers a, Structural superposition of the G domains of the MFN1IM in the post-transition state, PDB code

5GOM), MFN1IM in the transition state (PDB code 5YEW) and MFN2IM in the GDP-bound state. Note that the relative position of HD1 of MFN2IM is in between those of the two MFN1IM. b, Different residue contacts of the MFN2IM-GDP dimer, MFN1IM-GDP•BeF3¯ dimer (PDB code

5YEW) and MFN1IM-GDP dimer (PDB code 5GOM). Corresponding residues are shown as ball-and-stick models. c, Dimerization property of MFN2IM G interface mutants in the presence of GDP•BeF3¯. d, Experimental process of spectroscopic liposome tethering assay. e, Purified and reconstituted TM-containing MFN1IM and MFN2IM were floated in a sucrose gradient. Top (T) and bottom (B) fractions were analyzed by SDS/PAGE and Coomassie blue staining. “A” denotes total proliposomes. Source data are provided as a Source Data file. f, GTP turnover rates of wild-type MFN2IM and the G interface mutants. Error bars indicate s.d. (n = 3). Source data are provided as a Source Data file. 7

Supplementary Fig. 7 The design and quality control of the FRET assay a, The selected MFN1IM/MFN2IM sites of fluorescent labeling for the FRET assay, as indicated by red (Cy3) or green (Cy5) spheres. The distances between the fluorescence labels were estimated based on the crystal structures of MFN2IM-GDP and MFN1IM-GDP•BeF3¯ (PDB code 5YEW). The FRET signals can be detected only when associated MFN2IM and MFN1IM both change to the closed conformation. b, Site-specific dye-labeling of engineered MFN1IM and MFN2IM. The SDS-PAGE results show that altering exposed cysteines to serines (C156S for MFN1IM and C390S for MFN2IM) has successfully prevented non-specific fluorescent labeling. The introduction of designated mutations, namely A696C for MFN1IM(C156S) and A706C for MFN2IM(C390S), allows efficient labeling by fluorescent dyes. Source data are provided as a Source Data file. c, GTP turnover rates of MFN2IM and MFN1IM constructs used for FRET assays. Error bars indicate s.d. (n = 3). GTPase activity is not affected by introduced mutations. Source data are provided as a Source Data file. d, Dimerization property of MFN2IM and MFN1IM constructs used for FRET assays in the absence and presence of GDP•BeF3¯. G interface-dependent dimerization is not affected by introduced mutations.

Supplementary Fig. 8 Structural features of CMT2A-related mutants a-d, CMT2A-related mutation sites on the surface of MFN2. e, CD spectra of wild-type MFN2IM and CMT2A-related mutants. M.R.E. denotes mean residue epllipticity. f, Dimerization property of CMT2A-mutants at the G interface in the presence of GDP•BeF3¯.

Supplementary Table 1 Summary of CMT2A-related mutations

Interaction Interaction Mutations Zone* Con.** E/B*** G/A**** Mutations Zone* Con.** E/B*** G/A**** MFN1/2***** MFN1/2*****

V69F2 V S B — — R259L3 I/II I E — — L76P2 V S E H — S263P4, 5 II I E — — L92R6 IV I B — — V273G7 II I E C +++/++ L92P5, 8, 9 IV I B — — Q276R10 II I E — — 12, 13, R94G11 III I E — — Q276H II I E C +++/+ 14 2, 11, 13, R94Q III I E H +++/+++ H277R9 II I E — — 14, 15, 16, 17, 18 4, 8, 10, R94W III I E H +++/+++ H277Y20 II I E — — 11, 13, 17, 19 21 , 22, R104W I/II I E L -/+ R280H2, 8, 26 II I E H +++/++ 23, 24, 25 T105M7, 11 I/II I E H -/- F284Y18 V I E — — P123L9 I I E — — E288D27 V I E — — G127V28 II I E L -/++ G298R13 V U E — — G127D5 II I E — — E347V28 V I E — — H128R20 I I E — — S350P4, 8 V I E — — N131S29 I I E H +++/+++ T356A30 IV I E — — C132T15 V I E L +++/+++ K357N18 III I E — — L146F31 V I B — — H361Y10, 11 IV I E — — 5, 32, S156I20 V I E — — T362M IV I E — — 33 8, 10, A164V33 V I E — — R364W IV I E H +++/+ 11, 19, 34 13, 14, H165L35 II I E — — R364Q IV I E — — 20 11, 20, H165R4, 5, 8, 9 II I E H +++/++ R364P IV I E H +++/+ 36 H165Y9 II I E — — M376L6 V I B C +++/+++ I203M13 V N B — — M376I9, 28 V I B — — T206I10 V I E — — M376V13 V I B — — D210V37 V I E — — M376T5 V I B — — I213T7 V I B — — S378P25 V I E — — D214N33 V I E — — Q386P9 V U E — — F216S32 V I E — — C390F11 V U E — — L218P38 V I E H +++/++ C390R33 V U E — — F223Y39 V I B — — R400P23 V I E — — F223L18 V I B — — R707W17, 33 V U E — — L233V34 V I E — — L710P9 V I E — — T236M18 II I E — — A716T11, 17 V U E — — V244M18 V I B — — L724P40 V I B — — L248V11 IV I E H +++/+++ A738V40 V I E — — S249F24 IV I E ― — W740S2, 11 V U E C +++/+++ R250W9 IV S E — — W740R19 V U E — — R250Q6, 9 IV S E — — W740C20 V U E — — P251A2 IV I E — — E744M34 V I E — — P251R6, 11 IV I E L ++/++ L745P20 V I B — — P251L41 IV I E H +++/++ M747T20 V U E — — N252K13 IV I E — — H750P11 V U E — —

*Zone: I, nucleotide-binding site; II, G interface; III, hinge 2; IV, G domain-HD1 interface; V, other area. **Conservation between human MFN1 and MFN2: I, identical; S, similar; U, unconserved. ***Exposed (E) or buried (B). ****GTPase activity (G/A) compared to wild-type: H, (statistically) higher; C, comparable; L, lower. Significance was calculated with Student’s t-test (n = 3). Cut-off value: p < 0.05. *****Interaction with MFN1/MFN2: -, no interaction; +/++/+++, moderate/medium/strong interaction.

Supplementary Table 2 List of primers

Primers Sequence 5’-3’

1 pET-28_MFN2IM-FW GGCGGATCCGCTGAGGTGAATGCATCCCCAC

2 pET-28_MFN2IM-RE GGCCTCGAGCTATCTGCTGGGCTGCAGGTAC

3 MFN2IM-overlap-FW GAGCGGCAAGACCGAACCCGGGAGAACCTGGAGCAGG

4 MFN2IM-overlap-RE CAGGTTCTCCCGGGTTCGGTCTTGCCGCTCTTCACGC

5 MBP-tagged MFN1IM-FW ATTTGCGGCCGCAGCTGAGGTGAATGCATCCCC

6 MBP-tagged MFN1IM-RE CCGCTCGAGCTATCTGCTGGGCTGCAGGTAC

7 MBP-tagged MFN2IM-FW GGTTCTGTCGACTCTGCGGCCGCAGCTGAGGTGAATGCATCCCCAC

8 MBP-tagged MFN2IM-RE GTGGTGGTGGTGGTGCTCGAGCTATCTGCTGGGCTGCAGGTAC

9 PGEX-6P-3_MFN2IM-FW CGCGGATCCATGGCTGAGGTGAATGCATCCCCACTTAA

10 MFN2IM-TM-RE1 ACCAGAATACCCATGCTAGCGCTCGCAGCCGATCGGTCTTGCCG

11 MFN2IM-TM-FW1 CGGCAAGACCGATCGGCTGCGAGCGCTAGCATGGGTATTCTGGT

12 MFN2IM-TM-RE2 GGTTCTCCCGGGTGGCTGCGGATGCGTAAACATACAGCAGG

13 MFN2IM-TM-FW2 CCTGCTGTATGTTTACGCATCCGCAGCCACCCGGGAGAACC

14 PGEX-6P-3_MFN2IM-RE CCGCTCGAGTTATCTGCTGGGCTGCAG

15 PGEX-6P-3_MFN1IM-FW CGCGGATCCATGGATTACAAGGATGACGACGATAAGGCCGAA

16 MFN1IM-TM-RE1 ACGATGATGATGCCCATGCTACTGCCGCCACTGCCACTGCCACTGCC

17 MFN1IM-TM-FW1 GGCAGTGGCAGTGGCAGTGGCGGCAGTAGCATGGGCATCATCATCGT

18 MFN1IM-TM-RE2 TGCGATACTTCCGGAACCGTACAGGTACAGTGCACCAT

19 MFN1IM-TM-FW2 GGTGCACTGTACCTGTACGGTTCCGGAAGTATCGCA

20 PGEX-6P-3_MFN1IM-RE CCGCTCGAGTTAAGCGTAATCTGGAACATCGTATGGGTAGCTTTCTTCGTT

21 PGEX-6P-1_MFN2IM-FW GGCGGATCCGCTGAGGTGAATGCATCCCCAC

Sac1 22 MFN2IM-TM -FW1 GCCTTGACCGTTTTAGGTGCTACGATATTTTTTCCTAAAGATAGATTTACCAGCAGTAAGACCCGGGAGAACCTGGAGCAG

Sac1 23 MFN2IM-TM -RE1 CGTAGCACCTAAAACGGTCAAGGCTGCGCAAATGATCATTGGGATCAGCTGAATATATCGGTCTTGCCGCTCTTCACGC

Sac1 24 MFN2IM-TM -FW2 CGATTGTCTTGGCGCTTTCAACCAAATTCATGTTTAAGAACGGTATTCAGTTTGTCACCCGGGAGAACCTGGAGCAG

Sac1 25 MFN2IM-TM -RE2 GGTTGAAAGCGCCAAGACAATCGACGCACCTGCAAAATACAGCAAATTCTTACTGCTGGTAAATCTATCTTTAGG

26 PGEX-6P-1_MFN2IM-RE GGCCTCGAGCTATCTGCTGGGCTGCAGGTAC

27 PGEX-6P-1_MFN1IM-FW GGCGGATCCATGGCAGAACCTGTTTCTCCACTG

Sac1 28 MFN1IM-TM -FW1 GCCTTGACCGTTTTAGGTGCTACGATATTTTTTCCTAAAGATAGATTTACCAGCAGTAAGGCTAGATTACCCAAAGAAATAGATCAG

Sac1 29 MFN1IM-TM -RE1 CGTAGCACCTAAAACGGTCAAGGCTGCGCAAATGATCATTGGGATCAGCTGAATATATGAATAATGCCTTTTATCTTCAGCTG

Sac1 30 MFN1IM-TM -FW2 CGATTGTCTTGGCGCTTTCAACCAAATTCATGTTTAAGAACGGTATTCAGTTTGTCGCTAGATTACCCAAAGAAATAGATCAG

Sac1 31 MFN1IM-TM -RE2 GGTTGAAAGCGCCAAGACAATCGACGCACCTGCAAAATACAGCAAATTCTTACTGCTGGTAAATCTATCTTTAGG

32 PGEX-6P-1_MFN1IM-RE GGCCTCGAGTTAGGATTCTTCATTGCTTGAAGGTAG 33 pQCXIP_MFN2(I126D)-FW ATCCACGCTGTTTTGACCTC 34 pQCXIP_MFN2I126D_FW (I126D)-RE CTGTGCCCCCAACCCGCAGGAAGCAATTGGTGGTATGACCATCC CCAGATGGCAG 35 pQCXIP_MFN2-FW GGGAAGAGCACCGTGATCAA 36 MFN2(N161A)-FW TGGGCCAGTTGGGCCACAGTCTTGAC 37 MFN2(N161A)-RE GTCAAGACTGTGGCCCAACTGGCCCA 38 pQCXIP_MFN2-RE AGCAGCGGTCAGACAGGTT 39 MFN2(K307A)-FW CTGAGAACCTCCGCGGCAGACACGAA 40 MFN2(K307A)-RE TTCGTGTCTGCCGCGGAGGTTCTCAG

Supplementary References

1. Cao YL, Meng S, Chen Y, Feng JX, Gu DD, Yu B, et al. MFN1 structures reveal nucleotide-triggered dimerization critical for mitochondrial fusion. Nature 2017, 542(7641): 372-376.

2. Züchner S, Mersiyanova IV, Muglia M, Bissar-Tadmouri N, Rochelle J, Dadali EL, et al. Mutations in the mitochondrial GTPase mitofusin 2 cause Charcot-Marie-Tooth neuropathy type 2A. Nature genetics 2004, 36(5): 449-451.

3. Ajroud-Driss S, Fecto F, Ajroud K, Yang Y, Donkervoort S, Siddique N, et al. A novel de novo MFN2 mutation causing CMT2A with upper motor neuron signs. Neurogenetics 2009, 10(4): 359-361.

4. Cho HJ, Sung DH, Kim BJ, Ki CS. Mitochondrial GTPase mitofusin 2 mutations in Korean patients with Charcot-Marie-Tooth neuropathy type 2. Clinical genetics 2007, 71(3): 267-272.

5. Chung KW, Kim SB, Park KD, Choi KG, Lee JH, Eun HW, et al. Early onset severe and late-onset mild Charcot-Marie-Tooth disease with mitofusin 2 (MFN2) mutations. Brain : a journal of neurology 2006, 129(Pt 8): 2103-2118.

6. McCorquodale DS, 3rd, Montenegro G, Peguero A, Carlson N, Speziani F, Price J, et al. Mutation screening of mitofusin 2 in Charcot-Marie-Tooth disease type 2. Journal of neurology 2011, 258(7): 1234-1239.

7. Lawson VH, Graham BV, Flanigan KM. Clinical and electrophysiologic features of CMT2A with mutations in the mitofusin 2 gene. Neurology 2005, 65(2): 197-204.

8. Chung KW, Suh BC, Cho SY, Choi SK, Kang SH, Yoo JH, et al. Early-onset Charcot-Marie-Tooth patients with mitofusin 2 mutations and brain involvement. Journal of neurology, neurosurgery, and psychiatry 2010, 81(11): 1203-1206.

9. Verhoeven K, Claeys KG, Zuchner S, Schroder JM, Weis J, Ceuterick C, et al. MFN2 mutation distribution and genotype/phenotype correlation in Charcot-Marie-Tooth type 2. Brain : a journal of neurology 2006, 129(Pt 8): 2093-2102.

10. Zuchner S, De Jonghe P, Jordanova A, Claeys KG, Guergueltcheva V, Cherninkova S, et al. Axonal neuropathy with optic atrophy is caused by mutations in mitofusin 2. Annals of neurology 2006, 59(2): 276-281.

11. Feely SM, Laura M, Siskind CE, Sottile S, Davis M, Gibbons VS, et al. MFN2 mutations cause severe phenotypes in most patients with CMT2A. Neurology 2011, 76(20): 1690-1696.

12. Ching CK, Lau KK, Yu KW, Chan YW, Mak MC. A novel mitofusin 2 gene mutation causing 12

Charcot-Marie-Tooth type 2A disease in a Chinese family. Chinese medical journal 2010, 123(11): 1466-1469.

13. Casasnovas C, Banchs I, Cassereau J, Gueguen N, Chevrollier A, Martinez-Matos JA, et al. Phenotypic spectrum of MFN2 mutations in the Spanish population. Journal of medical genetics 2010, 47(4): 249-256.

14. Banchs I, Casasnovas C, Montero J, Martinez-Matos JA, Volpini V. Two Spanish families with Charcot-Marie-Tooth type 2A: clinical, electrophysiological and molecular findings. Neuromuscular disorders : NMD 2008, 18(12): 974-978.

15. Zhang RX, Fu M, Zi XH, Li XB, Zhang FF, Xia K, et al. [Mutation analysis of MFN2 gene in Chinese patients with Charcot-Marie-Tooth disease]. Zhonghua yi xue za zhi 2009, 89(47): 3324-3327.

16. Neusch C, Senderek J, Eggermann T, Elolff E, Bahr M, Schneider-Gold C. Mitofusin 2 gene mutation (R94Q) causing severe early-onset axonal polyneuropathy (CMT2A). European journal of neurology 2007, 14(5): 575-577.

17. Braathen GJ, Sand JC, Lobato A, Hoyer H, Russell MB. MFN2 point mutations occur in 3.4% of Charcot-Marie-Tooth families. An investigation of 232 Norwegian CMT families. BMC medical genetics 2010, 11: 48.

18. Kijima K, Numakura C, Izumino H, Umetsu K, Nezu A, Shiiki T, et al. Mitochondrial GTPase mitofusin 2 mutation in Charcot-Marie-Tooth neuropathy type 2A. Human genetics 2005, 116(1-2): 23-27.

19. Lv H, Wang L, Li W, Qiao X, Li Y, Wang Z, et al. Mitofusin 2 gene mutation causing early-onset CMT2A with different progressive courses. Clinical neuropathology 2013, 32(1): 16-23.

20. Calvo J, Funalot B, Ouvrier RA, Lazaro L, Toutain A, De Mas P, et al. Genotype-phenotype correlations in Charcot-Marie-Tooth disease type 2 caused by mitofusin 2 mutations. Archives of neurology 2009, 66(12): 1511-1516.

21. Del Bo R, Moggio M, Rango M, Bonato S, D'Angelo MG, Ghezzi S, et al. Mutated mitofusin 2 presents with intrafamilial variability and brain mitochondrial dysfunction. Neurology 2008, 71(24): 1959-1966.

22. Genari AB, Borghetti VH, Gouvea SP, Bueno KC, dos Santos PL, dos Santos AC, et al. Characterizing the phenotypic manifestations of MFN2 R104W mutation in Charcot-Marie-Tooth type 2. Neuromuscular disorders : NMD 2011, 21(6): 428-432.

23. Baets J, Deconinck T, De Vriendt E, Zimon M, Yperzeele L, Van Hoorenbeeck K, et al. Genetic spectrum of hereditary neuropathies with onset in the first year of life. Brain : a journal of

neurology 2011, 134(Pt 9): 2664-2676.

24. Abe A, Numakura C, Kijima K, Hayashi M, Hashimoto T, Hayasaka K. Molecular diagnosis and clinical onset of Charcot-Marie-Tooth disease in Japan. Journal of human genetics 2011, 56(5): 364-368.

25. Brockmann K, Dreha-Kulaczewski S, Dechent P, Bonnemann C, Helms G, Kyllerman M, et al. Cerebral involvement in axonal Charcot-Marie-Tooth neuropathy caused by mitofusin2 mutations. Journal of neurology 2008, 255(7): 1049-1058.

26. Vinci P, Lapi G. Anesthetic management in Charcot-Marie-Tooth disease type 2 due to a mutation in the mitofusin-2 gene. Journal of anaesthesiology, clinical pharmacology 2011, 27(2): 286-287.

27. Bergamin G, Dalla Torre C, Cacciavillani M, Lucchetta M, Boaretto F, Campagnolo M, et al. Novel mutation of the mitofusin 2 gene in a family with Charcot-Marie-Tooth disease type 2. Muscle & nerve 2014, 49(1): 145-146.

28. Engelfried K, Vorgerd M, Hagedorn M, Haas G, Gilles J, Epplen JT, et al. Charcot-Marie-Tooth neuropathy type 2A: novel mutations in the mitofusin 2 gene (MFN2). BMC medical genetics 2006, 7: 53.

29. Fischer C, Trajanoski S, Papic L, Windpassinger C, Bernert G, Freilinger M, et al. SNP array-based whole genome homozygosity mapping as the first step to a molecular diagnosis in patients with Charcot-Marie-Tooth disease. Journal of neurology 2012, 259(3): 515-523.

30. Wang YW, Han WT, Jiang M, Lu CX, Li XF, Zhang X, et al. A novel mutation of the MFN2 gene in a Chinese family with Charcot-Marie-Tooth disease. Genetics and molecular research : GMR 2012, 11(2): 1454-1459.

31. Klein CJ, Kimmel GW, Pittock SJ, Engelstad JE, Cunningham JM, Wu Y, et al. Large kindred evaluation of mitofusin 2 novel mutation, extremes of neurologic presentations, and preserved nerve mitochondria. Archives of neurology 2011, 68(10): 1295-1302.

32. Polke JM, Laura M, Pareyson D, Taroni F, Milani M, Bergamin G, et al. Recessive axonal Charcot-Marie-Tooth disease due to compound heterozygous mitofusin 2 mutations. Neurology 2011, 77(2): 168-173.

33. Nicholson GA, Magdelaine C, Zhu D, Grew S, Ryan MM, Sturtz F, et al. Severe early-onset axonal neuropathy with homozygous and compound heterozygous MFN2 mutations. Neurology 2008, 70(19): 1678-1681.

34. Lin KP, Soong BW, Yang CC, Huang LW, Chang MH, Lee IH, et al. The mutational spectrum in a cohort of Charcot-Marie-Tooth disease type 2 among the Han Chinese in Taiwan. PloS one

2011, 6(12): e29393.

35. Marchesi C, Ciano C, Salsano E, Nanetti L, Milani M, Gellera C, et al. Co-occurrence of amyotrophic lateral sclerosis and Charcot-Marie-Tooth disease type 2A in a patient with a novel mutation in the mitofusin-2 gene. Neuromuscular disorders : NMD 2011, 21(2): 129-131.

36. Takahashi R, Ikeda T, Hamaguchi A, Iwasa K, Yamada M. Coenzyme Q10 therapy in hereditary motor sensory neuropathy type VI with novel mitofusin 2 mutation. Internal medicine 2012, 51(7): 791-793.

37. Rouzier C, Bannwarth S, Chaussenot A, Chevrollier A, Verschueren A, Bonello-Palot N, et al. The MFN2 gene is responsible for mitochondrial DNA instability and optic atrophy 'plus' phenotype. Brain : a journal of neurology 2012, 135(Pt 1): 23-34.

38. Ostern R, Fagerheim T, Hjellnes H, Nygard B, Mellgren SI, Nilssen O. Diagnostic laboratory testing for Charcot Marie Tooth disease (CMT): the spectrum of gene defects in Norwegian patients with CMT and its implications for future genetic test strategies. BMC medical genetics 2013, 14: 94.

39. Park SY, Kim SY, Hong YH, Cho SI, Seong MW, Park SS. A novel double mutation in cis in MFN2 causes Charcot-Marie-Tooth neuropathy type 2A. Neurogenetics 2012, 13(3): 275-280.

40. Luigetti M, Fabrizi GM, Taioli F, Conte A, Del Grande A, Sabatelli M. Clinical, electrophysiological and pathological findings of a patient with CMT2 due to the p.Ala738Val mitofusin 2 mutation. Journal of the neurological sciences 2011, 307(1-2): 168-170.

41. Sivera R, Sevilla T, Vilchez JJ, Martinez-Rubio D, Chumillas MJ, Vazquez JF, et al. Charcot-Marie-Tooth disease: genetic and clinical spectrum in a Spanish clinical series. Neurology 2013, 81(18): 1617-1625.