This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright Author's personal copy
Molecular Phylogenetics and Evolution 56 (2010) 622–630
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution
journal homepage: www.elsevier.com/locate/ympev
Genetic structure, phylogeny, and biogeography of Brazilian eyelid-less lizards of genera Calyptommatus and Nothobachia (Squamata, Gymnophthalmidae) as inferred from mitochondrial DNA sequences
Ana Carolina Siedchlag a, Maria Lúcia Benozzati a, José Carlos Passoni a, Miguel Trefaut Rodrigues b,* a Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, Brazil b Departamento de Zoologia, Instituto de Biociências, Universidade de São Paulo, Brazil article info abstract
Article history: Calyptommatus and Nothobachia genera of gymnophthalmid lizards are restricted to sandy open habitats Received 23 October 2009 on São Francisco River margins, northeastern Brazil. Phylogenetic relationships and geographic distribu- Revised 24 March 2010 tion of the four recognized species of Calyptommatus were analyzed from partial mitochondrial cyt b, 12S, Accepted 23 April 2010 and 16S rRNA genes sequencing, taking allopatric populations of the monotypic Nothobachia ablephara as Available online 29 April 2010 the outgroup. In Calyptommatus a basal split separated C. sinebrachiatus, a species restricted to the eastern bank of the river, from the three other species. In this clade, C. confusionibus, found on western margin, Keywords: was recovered as the sister group of the two other species, C. leiolepis and C. nicterus, from opposite mar- Cyt b gins. According to approximate date estimations, C. sinebrachiatus would have separated from the other 12S 16S congeneric species by 4.4–6.5 my, and C. nicterus, also from eastern bank, would be diverging by mtDNA phylogeny 1.8–2.6 my from C. leiolepis, the sister species on the opposite margin. C. confusionibus and C. leiolepis, both Biogeography from western sandy areas, would be differentiating by 2.8–5.0 my. Divergence times of about 3.0–4.0 my Divergence times were estimated for allopatric populations of Nothobachia restricted to western margin. Significant differ- Calyptommatus ences in 16S rRNA secondary structure relatively to other vertebrates are reported. Distinct evolutionary Nothobachia patterns are proposed for different taxa in those sandy areas, probably related to historical changes in the Gymnophthalmidae lizards course of São Francisco River. São Francisco River sand dunes Ó 2010 Elsevier Inc. All rights reserved. Brazil
1. Introduction Caatinga (Rodrigues, 1991a,b,c, 1996; Rodrigues and Juncá, 2002). Among several other squamates endemic for this area, new genera The neotropical lizard family Gymnophthalmidae comprises were described for this group: Calyptommatus (4 species), Nothoba- small animals which live in leaf litter or ground vegetation of for- chia (1), Procellosaurinus (2), Psilophthalmus (1), and Vanzosaura (1). ests and open areas; some are semiaquatic or fossorial. According The other genera of Gymnophthalmini are restricted to the Ama- to phylogenies (Presch, 1980; Pellegrino et al., 2001; Brandley zon (Tretioscincus and Gymnophthalmus), or broadly distributed in et al., 2008) limb reduction seems to have originated indepen- Cerrados and Caatingas (Micrablepharus), but not on dunes. More dently multiple times in this family. One of the limb-reduced lin- recently another new, monotypic, elongate, eyelid-less and limb- eages is characterized by the presence of scincoid scales on body, reduced genus (Scriptosaura catimbau) was described for this radi- eyelid loss in most genera, a reduced series of femoral pores, and ation from a sandy area in the state of Pernambuco (Rodrigues and a more pronounced reduction of forelimbs in regard to hindlimbs, Santos, 2008). among other remarkable fossorial adaptations (Rodrigues, 1991a). In this radiation, the sister relationships between the elongate This radiation, the Gymnophthalmini, according to Pellegrino et al. and limb-reduced genera Calyptommatus and Nothobachia and (2001) is much more rich than previously reported (MacLean, their position as the most derived clade within Gymnophthalmini 1974; Presch, 1980) due to the discovery of an undisclosed diver- has been highly supported in all studies (Rodrigues, 1991c; Pelleg- sity associated with the continental dunes of the middle São Fran- rino et al., 2001; Benozzati and Rodrigues, 2003; Castoe et al., cisco River, in the morphoclimatic domain of the semiarid Brazilian 2004). They are psammophilous fossorial lizards restricted to dunes or sandy habitats adjacent or close to the middle course of São Francisco River, in the state of Bahia (Rodrigues et al., 2001). * Corresponding author. Address: Departamento de Zoologia, Instituto de Four species of Calyptommatus are presently admitted, all noctur- Biociências, Universidade de São Paulo, CP-11.461, CEP, 05422-970 São Paulo, SP, Brazil. Fax: +55 11 3091 7513. nal. C. sinebrachiatus occurs on the sandy habitats at the right bank E-mail address: [email protected] (M.T. Rodrigues). of the river in a set of geographically close localities, whereas
1055-7903/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2010.04.027 Author's personal copy
A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) 622–630 623
C. nicterus is known only from a place situated about 30 km apart, could be compared to that of sympatric populations of C. leiolepis, in the same bank. The two other species, C. leiolepis and C. confusio- on western margin of São Francisco River. Approximate dates for nibus, occur on the opposite margin of São Francisco River. C. leiol- vicariance events were proposed for both genera, allowing com- epis is found in several areas in two distinct dune fields separated parison to previous estimates for other lizards endemic in the area. by a region of rocky soils approximately 150 km long: Alagoado, on northern dune field, also referred as Casanova dune field, and at 2. Materials and methods Queimadas, Ibiraba, Mocambo do Vento, Ilha do Gado Bravo, and Barra, all on the southern dune field also referred as Xique-Xique 2.1. Taxonomic sampling dune field. C. confusionibus, from Toca da Cabocla in Serra das Con- fusões National Park, Piauí, is the only species occurring out of São A sample of 26 individuals representing the four described spe- Francisco drainage and its complex of continental dunes. Neverthe- cies of Calyptommatus and eight individuals of N. ablephara were less, as the sandy areas where this species occurs are not distant collected at 10 different localities in middle São Francisco sand from São Francisco dunes and are in the same direction of the dunes (Bahia), and from Serra das Confusões (Piauí). They were northwestern winds responsible for building those dunes, it was all assayed for a mitochondrial gene sequence encoding for part suggested they have been in contact in the past as a result of more of cytochrome b (cyt b) protein. In this analysis, two individuals intense wind activities during cooler phases in the Pleistocene of Procellosaurinus erythrocercus were used as the outgroup (Rodri- (Rodrigues et al., 2001). Nothobachia is a monotypic genus, diurnal, gues, 1991c). From those 34 ingroup specimens, 23–24 DNA sam- and similar in habitat and ecological requirements to Calyptomma- ples showing different cyt b haplotypes were also sequenced for tus. N. ablephara is sympatric and syntopic with C. leiolepis at most 12S and 16S ribosomal RNAs (rRNA) gene segments. Fig. 1 and Ta- localities, being restricted to sandy habitats on left bank of the riv- ble 1 show, respectively, geographic distribution and size of ana- er, on Casanova and Xique-Xique dune fields. lyzed samples. Based on geomorphological and paleoclimatic data on the São Francisco sand dunes (Ab’Saber, 1969; Tricart, 1974), Rodrigues proposed a vicariant model to explain the speciation of endemic 2.2. DNA extraction pairs of closely related psammophilous species of tropidurids, gymnophthalmids, snakes, and amphisbaenians living in opposite DNA enriched in mitochondrial fraction was obtained according banks of the river and showing the same geographic distribution to Hillis and Davis (1986) and Dowling et al. (1990), as modified by (Rodrigues, 1986, 1991a,b,c,d). He hypothesized that the ancestral Passoni et al. (2000). Field collected samples were stored at populations were bisected by São Francisco River after the last gla- 196 °C. Entire lizards weighting from 0.4 to 0.5 g approximately cial period, about 12,000 years ago. According to this model, until were pulverized to fine powder in liquid nitrogen, yielding approx- the Pleistocene the river flowed into a paleolake and, at the end imately 3–4 lg of DNA enriched in mitochondrial fraction. Each of the Würm–Wisconsin glaciation, it found the way out to the individual was homogenized in 800 ll STES (0.01 M NaCl, 0.01 M Atlantic Ocean. More recently it was also argued that, although this Tris, 0.1 M EDTA, 0.25 M sucrose, pH 7.5) and then centrifuged paleolacustrine hypothesis could account for the speciation in the for 5 min at 1200g at 4 °C to pellet the nuclei. The supernatant area, forsaken meanders of the river might be in the origin of those was centrifuged at 23,000g for 20 min at 4 °C for mitochondrial vicariant patterns (Rodrigues, 1996). Paleoclimatic and geomor- precipitation. The pellet was suspended in 250 ll STE (0.1 M NaCl, phological data on this region support the model (Souza-Lima 0.01 M Tris, 0.1 M EDTA, pH 7.5), with 1% sodium dodecyl sulfate et al., 2005). (SDS) and 10 U/ml proteinase K. After incubation for 2 h at 55 °C, Speciation timing in the neotropical region has been widely de- the preparation was extracted with one volume of phenol, and bated. The original idea considering tropical species richness as a then with one volume of 24:1 chloroform: isoamyl alcohol solu- result of a long-term process in stable environments was tion. DNA was precipitated from the supernatant by the addition abandoned with the advent of the refuge hypothesis, and most of of 1/10 volume buffer (3 M NaCl, 0.25 M Tris, 0.1 M EDTA) and speciation was attributed to Quaternary events (Haffer, 1969, 2.5 volumes 100% ethanol at 20 °C overnight. The DNA pelleted 2001). More recently, a growing evidence of pre-Quaternary differ- after 15 min centrifugation at 23,000 g at 4 °C was washed in entiation has been accumulated, attributing to tectonic, eustatic, 70% ethanol, air dried and dissolved in 20–80 ll TE (0.01 M Tris, orogenic events (Rull, 2006; Geurgas et al., 2008; Ribas et al., 0.001 M EDTA, pH 8.0), and stored at 20 °C. 2009) or to rivers (Pellegrino et al., 2005; Passoni et al., 2008) the barriers to gene flow. The advance of molecular phylogenetic and 2.3. DNA amplification and sequencing phylogeographic studies allowing inferences on divergence time of lineages have stimulated the controversy (Galewski et al., Partial mitochondrial sequences of cyt b protein and of 12S 2005; Carnaval et al., 2009). The rich squamate fauna of the Quater- and 16S rRNA coding genes were amplified via polymerase chain nary sand dunes of São Francisco River characterized by high degree reaction (PCR) in 25 or 50 ll reaction volumes containing 12– of endemism in a relatively small area provides a great opportunity 20 ng DNA, 1 PCR buffer, 4 mM MgCl2, 0.2 mM each dNTP, to contribute to this debate comparing evolutionary patterns 1 lM each primer, and 2.5 U AmpliTaq DNA Polymerase (Per- among different taxa (Rodrigues, 1996; Rodrigues and Juncá, 2002). kin-Elmer, Roche). Amplification primers and thermocycler condi- Previous morphological (Rodrigues, 1991a), allozymical (Mar- tions are specified in Table 2. Negative controls were made to tins, 1997), and karyotypical (Yonenaga-Yassuda et al., 1998) anal- avoid contamination. Amplification products were checked by yses could not resolve unequivocally phylogenetic relationships electrophoresis on 0.8% agarose gel with 0.3 lg/ml ethidium bro- among the three Calyptommatus species known at the time, mide (the target fragment size was estimated from molecular- although the monophyly of the group was demonstrated in all weight markers). Products were cleaned with the Concert Rapid them. Therefore, in the present study mitochondrial DNA sequenc- PCR Purification System or the Concert Rapid Gel Extraction Sys- ing data were used to obtain more precise estimations of phyloge- tem (Gibco-BRL Life Technologies) in cases of non-specific ampli- netic relationships in Calyptommatus genus, taking N. ablephara as fications. Purified PCR products containing about 100 ng (cyt b)to outgroup. Secondary structure of ribosomal RNAs was also used in 200 ng (ribosomal RNAs) of DNA in a final volume of 6 ll were molecular analyses. Nothobachia samples from different localities utilized for sequencing using the Big Dye Terminator Ready-Reac- were available, so that phylogeographical pattern in this genus tion Kit (Perkin-Elmer Applied Biosystems). A Perkin-Elmer-2400 Author's personal copy
624 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) 622–630
Fig. 1. Sand dune region of middle São Francisco River, Brazil. Localities: (1) Alagoado; (2) Queimadas; (3) Vacaria; (4) Ibiraba; (5) Mocambo do Vento; (6) Ilha do Gado Bravo; (7) Lagoa de Itaparica; (8) Gameleira do Assuruá; (9) Santo Inácio; (10) Barra; (11) Toca da Cabocla (Serra das Confusões).
Table 1 Samples of Calyptommatus and Nothobachia from different localities of São Francisco River sand dunes in Bahia, and in Piauí ( ), analyzed for cyt b, 12S, and 16S mitochondrial gene segments. Procellosaurinus erythrocercus was used as outgroup in cyt b analyses.
Species Locality Mitochondrial gene marker Left margin Right margin Cyt b 12S 16S C. leiolepis Alagoado — 5 2 1 Mocambo do Vento — 2 1 2 Ilha do Gado Bravo 1 1 1 Queimadas — 2 2 2 Barra — 2 2 2 Ibiraba — 2 1 1 C. nicterus — Vacaria 2 2 2 C. sinebrachiatus — Santo Inácio 5 1 4 — Gameleira do Assuruá 1 1 1 — Lagoa de Itaparica 2 2 1 C. confusionibus Toca da Cabocla* —222 N. ablephara Alagoado — 3 2 1 Queimadas — 3 2 2 Mocambo do Vento — 1 1 1 Ibiraba — 1 1 1 P. erythrocercus Queimadas — 1 — — Toca da Cabocla* —1——
thermocycler was used with the following parameters (time in 2.4. Phylogenetic analyses minutes:seconds): 96 °C (0:10), 50 °C (0:05), 60 °C (4:00) 25 (0:05 at 96 °C before first cycle). Both strands of each segment Multiple alignments were accomplished using Clustal X 1.64b were sequenced for each specimen. An ABI PRISM 310 Genetic (Thompson et al., 1997). For 12S and 16S segments, gap-opening Analyzer (Perkin-Elmer Applied Biosystems) was used and the se- values of 6, 8, 10, and 12, and a gap-extension value of 0.05 were quences were edited using Sequence Navigator 1.0.1 (Perkin-El- used to assess the effects on sequence alignment according to mer Applied Biosystems). The obtained cyt b and ribosomal Gatesy et al. (1993), Wiens and Reeder (1997), and Reeder and RNA gene sequences were deposited in GenBank. For distance Montanucci (2001). Regions of ambiguous alignments were ex- analyses, the substitutional model that best fit each data set cluded. 12S rRNA secondary structure models for a scincoid lizard was found employing PAUP* 4.0b10 (Swofford, 2002) and MOD- (Hickson et al., 1996), for the lizard family Opluridae (Titus and ELTEST 3.06 (Posada and Crandall, 1998) programs. Frost, 1996) and for hyperoliid treefrogs (Richards and Moore, Author's personal copy
A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) 622–630 625
Table 2 List of PCR and sequencing primers, and a summary of the PCR conditions for all three gene segments.
Primer label Sequence (50–30) PCR conditions: denaturation/annealing/extension 35* B1a CCATCCAACATCTCAGCATGATGAAA 95 °C (1:00), 52 °C (1:00), 72 °C (2:00) B2a (cyt b) GCCCCTCAGAATGATATTTGTCCTCA L1091b AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT 95 °C (1:00), 48–52 °C (1:00), 72 °C (2:00) H1478b (12S) TGACTGCAGAGGGTGACGGGCGGTGTGT Ar-50c CAAACCCCGCCTGTTTACCAAAAACAT 95 °C (1:00), 52–54 °C (1:00), 72 °C (2:00) Br-30c (16S) CCGGTCTGAACTCAGATCACGT
Incubation times are given in parentheses, in minutes:seconds. References for primers are aFu et al. (1997), bKocher et al. (1989), and cPalumbi (1996). * At 95 °C for 5:00 before first cycle and for 10:00 at 72 °C after the last cycle.
1996), and the 16S rRNA secondary structure models for humans sequences, and for the three possible couples of sequences (cyt b/ (Gutell and Fox, 1988) and for mammals (Burk et al., 2002) were 12S, cyt b/16S and 12S/16S) using PAUP* to calculate log likelihood considered, along with 12S and 16S models for Eurolophosaurus liz- values of trees obtained enforcing the molecular clock and trees ards (Passoni et al., 2008). Cyt b sequences were translated into calculated without this assumption. PAUP* and MODELTEST were amino acid sequences to check for unexpected occurrences of stop used to select the most appropriate model of evolution for each codons, which might indicate that pseudogenes had been ampli- data set. Evolutionary rate constancy was detected for the three fied (Sorenson and Fleischer, 1996; Zhang and Hewitt, 1996). pairs of sequences, but only when the less frequent haplotype of The degree of saturation in each gene segment was investigated C. sinebrachiatus from Santo Inácio (SI2) was included in the anal- by plotting proportions of transitions and transversions against the yses. A distance matrix was constructed from corrected genetic pairwise Lake 94 corrected distances employing DAMBE program distances and divergence times estimated for combined cyt b/16S (Xia, 2000; Xia and Xie, 2001). For protein-coding segments these data set (616 bp; P = 0.001). ML distance matrixes were con- analyses were accomplished considering all codon positions, the structed from this data set, and also for cyt b haplotypes taking first and second codon positions together, and the third position sep- P. erythrocercus as the outgroup (P = 0.01). arately. Analyses of transition and transversion substitutions at third codon positions showed some saturation in both cases. At 12S and 16S ribosomal gene sequences no saturation was detected. 3. Results The partition homogeneity test (Farris et al., 1994) using PAUP* (1000 replicates) indicated that the three gene regions could be ana- 3.1. Population structure lyzed together. Phylogenetic signal was detected for the combined Calyptommatus and Nothobachia DNA samples were firstly as- data set using the g1 statistic (Sokal and Rohlf, 1981; Hillis, 1991; Huelsenbeck, 1991; Hillis and Huelsenbeck, 1992), which measured sayed for mitochondrial cyt b sequences in order to evaluate pop- the skewness of the distribution of 10,000 random cladograms. ulation structure in both genera. Twenty-three different Phylogenetic analyses were conducted on combined cyt b and haplotypes were identified from two or more specimens of main ribosomal sequences, taking only one specimen from each of the sampled localities. Analyses were based on nucleotide divergence 15 sampled populations. PAUP* 4.0b10 (Swofford, 2002) was used estimations and MP phylogenetic analysis (not shown) of those in maximum parsimony (MP), maximum-likelihood (ML), and 23 different cyt b haplotypes consisting of 242 cyt b precisely neighbor joining (NJ) analyses. Cyt b sequences of two or more indi- aligned characters, taking two different haplotypes of P. erythrocer- viduals from different sampled regions (see Table 1) were also ana- cus as the outgroup. These sequences were deposited in GenBank lyzed separately to evaluate genetic structure of main populations of under Accession Nos.: GU952800, HM015530–HM015553. Calyptommatus and Nothobachia, taking P. erythrocercus as outgroup. A consensus MP cladogram (63 of the 73 variable sites were Parsimony trees were constructed from combined data set informative under parsimony) was estimated from seven most par- using a branch-and-bound search, and the confidence tested by simonious trees, considering 0.5 weighting for third cyt b codon 1000 bootstrap replicates (Felsenstein, 1985). Due to saturation positions (L = 82; CI = 0.58; RI = 0.83). Calyptommatus and Nothoba- on third codon positions, MP analyses were done considering three chia were recovered as monophyletic genera, with 92% and 90% different weightings for those characters, 0, 0.5, and 1. In ribosomal BVs, respectively. In N. ablephara, the haplotype identified in three segments, gap was treated as a fifth character state. Maximum- specimens from Alagoado (see Fig. 1) was shown as a sister taxon likelihood (ML) heuristic searches and NJ tree estimates were (58% BV) to those from Queimadas, Mocambo do Vento, and Ibir- based on the best evolutionary model for each data set found by aba localities, with nucleotide differentiation of 0.09–0.11 between PAUP* 4.0b10 (Swofford, 2002) and MODELTEST 3.7 (Posada and them. In each of these three localities on southern dune field, dif- Crandall, 1998) programs. The substitution model for all three con- ferent haplotypes diverged from 0.0 to 0.013. In Calyptommatus, catenated segments was found to be the TrN+G (Tamura and Nei, cyt b MP analysis recovered two major clades, one of them com- 1993), with gamma shape parameter and no invariable sites. In posed of five haplotypes identified in eight specimens of C. sine- ML analyses, tree bisection–reconnection (TBR) branch swapping, brachiatus (97% BV), and the other one of the 14 haplotypes MULTREES, and random addition of sequences (100 replicates) identified in the remaining three species, C. nicterus, C. leiolepis, were employed. Bootstrap values (BVs) were estimated by 100 rep- and C. confusionibus, grouped in a polyphyly (63% BV). In C. sine- licates with 10 replicates of random addition of sequences. In NJ brachiatus clade, the five specimens collected in Santo Inácio analyses, BVs were calculated by 1000 replicates. showed two haplotypes with 0.02 of nucleotide divergences be- tween them, the most frequent one diverging by 0.01 from the haplotypes of Lagoa de Itaparica and Gameleira do Assuruá. The 2.5. Divergence time estimations second clade was composed by the haplotypes identified in the three other Calyptommatus species. In C. leiolepis, 10 haplotypes The hypothesis of rate constancy was tested by the likelihood- were identified in 15 specimens: Alagoado (3); Queimadas (2); ratio test (Muse and Weir, 1992) for the three concatenated gene Barra (1); Ibiraba (2); Mocambo do Vento (1); and Ilha do Gado Author's personal copy
626 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) 622–630
Bravo (1). In this species, estimated intrapopulation divergences et al., 1994) using PAUP* (1000 replicates) detected no significant were 0.004 (Ibiraba), 0.009 (Queimadas) and 0.035 (Alagoado). heterogeneity among those gene segments. The g1 statistic (Hillis Interpopulation nucleotide divergences ranged from 0.0 between and Huelsenbeck, 1992) estimated for the total data matrix was Ibiraba and Ilha do Gado Bravo, to about 0.07 between Queimadas 1.119, indicating the presence of phylogenetic signal. Therefore, haplotypes and those of the other four localities on southern dune main phylogenetic analyses were carried on this combined data fields. In the two remaining species, C. nicterus (Vacaria) and C. con- consisting of 910 precisely aligned sites, with 110 of the 154 vari- fusionibus (Serra das Confusões), two different haplotypes were able sites being informative under parsimony. grouped in each clade, respectively, with 96% and 99% BVs (nucle- Two most parsimonious trees were obtained from MP analyses otide divergences of 0.004 in C. nicterus and 0.013 in C. of 15 combined haplotypes identified in Calyptommatus and Not- confusionibus). hobachia samples, considering a 0.5 weighting for third codon posi- tions in cyt b sequences (L = 178; CI = 0.80; RI = 0.88). Fig. 2 shows 3.2. Molecular characterization the strict consensus MP cladogram, with bootstrap supports P50% (1000 replicates) indicated on the branches. Phylogeny of Calyp- Molecular and phylogenetical analyses were based on cyt b re- tommatus could be resolved in MP analysis, although with low sults: only the individuals of Calyptommatus and Nothobachia BVs in some branches. Monophyly of both genera was corrobo- showing the most frequent cyt b haplotypes were considered in rated with 100% bootstrap. NJ and ML analyses using the TrN+G ribosomal analyses. Ribosomal gene sequences have been depos- model with an estimated gamma distribution shape parameter of ited in GenBank under Accession Nos.: HM015554–HM015568 0.099 and no invariable sites (Tamura and Nei, 1993) also con- for 12S; HM015569–HM015584 for 16S (accession numbers of firmed their monophyly with 100% BV, as indicated below the cyt b sequences are given in Section 3.1). Protein-coding sequences branches in Fig. 2. Nevertheless, both methods grouped Calyp- had no indels or premature stop codons, and ribosomal sequences tommatus species in polytomies (not shown). MP analysis recov- apparently code for rRNAs with stable secondary structures, sug- ered two major clades in Calyptommatus. One of them with 100% gesting that the three sequenced DNA segments correspond to BV is composed of C. sinebrachiatus haplotypes from three different functional mitochondrial genes (see Zhang and Hewitt, 1996). locations in a southern dune field on right margin of São Francisco Nucleotide frequencies (Table 3) show the bias against guanine on light strands of protein-coding sequences, and the bias against guanine and thymine on light strands of the ribosomal sequences. Those analyses corroborate the assumption that the analyzed se- quences do not represent nuclear-integrated copies of mitochon- drial genes (e.g. Zhang and Hewitt, 1996; Macey et al., 1997; Ast, 2001). Ribosomal sequences were precisely aligned, and stem and loop regions could be identified. No ambiguously aligned characters were identified in the analyzed 294 bp of 12S rRNA gene sequences (Appendix I). Four insertion/deletion events (indels) corresponding to characters 107, 171, 172, and 176 were identified, which did not disrupt the RNA secondary structure. Only one of them is located in a paired region of the RNA molecule (character 176 in 420 region) but it did not compromise the 42/420 stem structure (see Hickson et al., 1996; Titus and Frost, 1996; Passoni et al., 2008). In 388 bp of 16S ribosomal gene sequences (Appendix II), 14 characters were ambiguously aligned and, therefore, unconsidered in phylogenetic analyses. Twelve indels (characters 15, 196, 250, 271, 272, 273, 274, 287, 288, 289, 290, 353) were identified. Five of them were lo- cated in paired regions (271–274 and 353) but did not disrupt 16S secondary structure.
3.3. Phylogeny
Phylogenetic analyses were based on mitochondrial gene se- quences composed of 242 bp from cyt b, 294 bp from 12S rRNA, and 374 bp from 16S rRNA. The partition homogeneity test (Farris
Table 3 Mean base frequencies, v2 and P values in homogeneity test among taxa for each DNA segment.
Gene Cyt b 12S 16S Bpa 242 294 388 %A 29.8 36.5 35.4 %C 24.4 23.3 24.5 %G 15.1 18.8 18.6 %T 30.6 21.4 21.5 v2 7.0650 2.7547 4.3771 P 1.00 1.00 1.00 Fig. 2. Tree estimated for combined mitochondrial gene sequences (cyt b, 12S, and 16S) in Calyptommatus and Nothobachia gymnophthalmids. Bootstrap values a Number of characters. correspond to MP (bold), ML (italics), and NJ (regular) analyses. Author's personal copy
A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) 622–630 627
River (see Fig. 1). This group was also recovered with 100% BV in NJ would have diverged by approximately 1.2–2.0 my. Genetic differ- analysis. The other MP clade is composed of C. nicterus, and the two entiation between N. ablephara specimens from those two fields species on the opposite margin, C. leiolepis and C. confusionibus, suggests they have diverged by 3.0–4.0 my. According to present with 83% bootstrap. In this group, C. confusionibus was recovered estimates, the ancestor of Nothobachia and Calyptommatus would as the sister taxon to a clade composed of C. nicterus and the six date from approximately 9 to 15 my. C. leiolepis haplotypes from six different localities, although with lower bootstrap support (62%). Populations of N. ablephara also 4. Discussion showed two differentiated clades in MP analyses. The haplotype of Alagoado, on northern dune field, was recovered sister to a clade Information about population structure in both genera was ob- consisting of haplotypes from Queimadas, Mocambo do Vento, and tained from cyt b analyses, taking two specimens of P. erythrocercus Ibiraba, all localities on southern dunes, with high bootstrap sup- as outgroup. These sequencing data evidenced genetically diver- port (93%). NJ analyses also evidenced those two groups with a gent populations in different localities on São Francisco dune fields. 71% BV (see Fig. 2). They corroborated previous data based on 41 mitochondrial restriction sites (Arruda Campos, 1999) in which monophyletic 3.4. Divergence times units were shown in samples of Calyptommatus and Nothobachia from some of those localities. In N. ablephara nucleotide diver- Approximate divergence times were estimated based on cor- gences estimated between haplotypes from Alagoado and those rected genetic distances for 16 concatenated cyt b/16S gene se- from southern dune fields were of about 0.09–0.11, 10 times high- quences (see Section 2.3), considering an evolutionary rate of 2% er than divergences estimated for haplotypes from different south- sequence divergence per million of years. Table 4 shows pairwise ern locations (0.0–0.013). Otherwise, in C. leiolepis divergences distances for Calyptommatus and Nothobachia haplotypes estimated between haplotypes of Alagoado and those from south- (616 bp), corrected by the GTR+G substitutional model (Rodríguez ern dunes were of 0.032–0.064, of the same order than divergences et al., 1990), as selected by MODELTEST, and rough divergence estimated between Queimadas and the other four southern haplo- times estimated for main taxa. In Calyptommatus, nucleotide diver- types (0.052–0.071). gences estimated for conspecific haplotypes from different locali- Genetic distances based on combined cyt b and 16S sequences ties varied from 0.001 to 0.017 in C. sinebrachiatus, and from corroborated this pattern of differentiation (see Table 4). Diver- 0.007 to 0.046 in C. leiolepis, the highest values being detected be- gences between haplotype of C. leiolepis from Alagoado and those tween C. leiolepis of Queimadas and those of Mocambo do Vento from southern dune fields were lower than the estimated for sym- and Ilha do Gado Bravo. Interspecific divergences were estimated patric N. ablephara populations. A similar pattern had also been in about 0.09–0.13, between C. sinebrachiatus and the three other suggested by previous mitochondrial RFLP data (Arruda Campos, species, in 0.04–0.05 between C. leiolepis and C. nicterus, and in 1999). 0.06–0.10 between C. confusionibus haplotype and those of C. leiol- Regarding rRNA second structure, in both Calyptommatus and epis and C. nicterus. In the monospecific Nothobachia, on left margin Nothobachia the analyzed 16S rRNA sequence showed three un- of São Francisco River, the highest divergences have been detected paired regions different in length regarding literature data. The between population from Alagoado, on northern dunes, and those 40/400 loop and the helix between 420 and 44 stem regions (see from Queimadas (0.061), Mocambo do Vento (0.065), and Ibiraba Appendix II) are smaller than corresponding helixes in mammals (0.080), all on southern dune fields. (Gutell and Fox, 1988; Burk et al., 2002) and in Eurolophosaurus liz- According to present estimates, C. sinebrachiatus would have di- ards (Passoni et al., 2008). On the other hand, the helix between 440 verged from the three other congeners by 4.4–6.6 my. C. confusio- and 45 stem regions was longer than in mammals and Eurolopho- nibus (Piauí) would have diverged by 2.8–5.0 my from C. leiolepis, saurus. A more comprehensive analysis of these characters, includ- the geographically closer species in southern dunes, on left margin ing other representatives of eyelid-less gymnophthalmids, would of São Francisco River (Bahia). C. nicterus, from eastern margin of be valuable to a better characterization of the group. the river, would be diverging by 1.8–2.6 my from C. leiolepis, the Phylogenetic analyses based on combined cyt b, 12S and 16S sister species on the opposite margin. Populations of C. leiolepis mitochondrial sequences (see Fig. 2) corroborated the monophyly from northern and those from southern dune fields on west margin of Calyptommatus genus with 100% of BV, taking Nothobachia as
Table 4 Maximum-likelihood percent distance matrix (GTR+G model) for cyt b/16S combined data (below diagonal) and divergence time estimates for main taxa (in bold, above diagonal). No, Nothobachia ablephara; Csi, Calyptommatus sinebrachiatus; Cle, C. leiolepis; Cni, C. nicterus; Cco, C. confusionibus.
NoAla NoQue NoMVe NoIbi CsiSI1 CsiSI2 CsiGAs CsiLIt CleAla CleQue CleIbi CleMVe CleBar CleIGB CniVac CcoSCo NoAla — 3.0 4.0 13.0 13.8 13.0 14.0 15.4 13.3 14.2 NoQue 6.1 — 0.4 0.7 12.2 12.5 11.6 10.1 11.9 14.4 11.1 14.8 NoMVe 6.5 0.7 — 0.2 11.2 12.2 9.2 12.2 NoIbi 8.0 1.4 0.5 — 11.8 11.8 10.9 9.4 11.4 11.5 14.0 CsiSI1 26.1 25.0 23.0 23.5 — 0.6 0.4 5.2 4.5 4.4 5.5 5.2 4.5 CsiSI2 24.4 24.4 22.5 22.9 1.3 — 0.8 0.6 6.2 5.2 6.1 5.0 CsiGAs 27.7 26.5 24.4 24.9 0.7 1.7 — 0.4 6.6 4.8 5.4 CsiLIt 26.1 25.0 23.0 23.5 0.1 1.3 0.7 — 5.2 4.5 5.2 4.5 CleAla 25.9 23.2 21.4 21.8 10.5 12.4 11.4 10.5 — 1.8 1.2 2.0 2.6 5.0 CleQue 26.5 20.2 18.5 18.9 12.1 12.6 13.1 12.1 3.6 — 1.5 2.2 2.2 CleIbi 25.7 24.1 22.2 22.7 9.0 10.0 9.8 9.0 2.5 3.0 — 0.4 0.4 1.8 3.1 CleMVe 28.0 26.3 24.3 24.8 9.3 10.4 10.2 9.3 4.0 4.6 0.9 — 0.9 3.8 CleBar 24.3 23.8 22.0 22.4 8.8 9.9 9.7 8.8 2.9 3.4 0.7 1.8 — 0.8 2.0 2.8 CleIGB 30.7 28.9 26.7 27.3 11.0 12.2 12.0 11.0 3.8 4.4 0.8 1.6 1.6 — 2.6 4.1 CniVac 26.6 22.2 21.5 23.0 10.5 10.2 10.7 10.5 5.2 4.7 3.6 4.6 4.0 5.1 — 4.6 CcoSCo 28.4 29.6 27.5 28.0 9.0 10.0 10.5 9.0 9.9 8.0 6.2 7.7 5.5 8.2 9.1 —
Localities: Ala, Alagoado; Que, Queimadas; Ibi, Ibiraba; MVe, Mocambo do Vento; SI, Santo Inácio; LIt, Lagoa de Itaparica; GAs, Gameleira do Assuruá; IGB, Ilha do Gado Bravo; Bar, Barra; Vac, Vacaria; SCo, Serra das Confusões (Piauí). Author's personal copy
628 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) 622–630 outgroup. Consistent estimates were also obtained at species level. for different populations of E. divaricatus inhabiting northern and The species on right margin, C. sinebrachiatus, was shown as the ba- southern dune fields (Passoni et al., 2008). sal taxon to a clade comprising C. leiolepis, C. nicterus, and C. confu- Although several alternatives exist, we have no reliable hypoth- sionibus. In this clade, the first two are found in sandy habitats on esis to explain the contrasting different patterns of C. leiolepis and opposite margins of São Francisco River (Bahia) while C. confusioni- N. ablephara distributions in the area. Except for the greater abun- bus occurs in Piauí and is restricted to left bank (see Fig. 1). C. nicte- dance of Calyptommatus in Xique-Xique dune field, both species rus and the six different populations of C. leiolepis were grouped in live in the same areas, are ecologically similar and have apparently a monophyletic clade, although with lower bootstraps (60–70%). C. homogeneous distributions within sandy habitats of southern and confusionibus was recovered as the sister species to this group, with northern dune fields. Incomplete lineage assorting is a possibility about 80% BVs. Present sequencing data could, therefore, elucidate and, in this case, nuclear gene sequencing could resolve the issue. phylogenetic relationships between C. nicterus and the two other Upstream gene flow in Calyptommatus could be admitted if we known species, C. sinebrachiatus and C. leiolepis, which remained consider that most of the area was inundated in 1975 during the ambiguous in all previous studies on this genus (Rodrigues, filling of the Sobradinho reservoir. The hypothesis that Queimadas, 1991a; Martins, 1997; Yonenaga-Yassuda et al., 1998; Arruda Cam- located in the northern area of southern dune field, has been for- pos, 1999). merly isolated and only more recently incorporated to the Xique- In N. ablephara our results corroborate previous data showing a Xique dune field could not be ignored too. high genetic differentiation between populations of Alagoado and Rough date estimates were proposed for the whole radiation of those on southern dune fields. This pattern was also described Gymnophthalmini in São Francisco River dunes based on mito- for populations of the tropidurid Eurolophosaurus divaricatus, also chondrial DNA restriction-site data (Benozzati and Rodrigues, restricted to dunes on left bank of São Francisco River (Passoni 2003), in which Nothobachia and Calyptommatus were included et al., 2000, 2008). In this genus, mitochondrial cit b, COI, and as the most derived clade. According to their estimates considering 12S and 16S ribosomal gene sequencing showed two differentiated a 2% my evolutionary rate, those microteiids would have diverged clades corresponding to northern and southern dune populations, from a common ancestor some 7–8 my ago, and the sand dune and a taxonomic reevaluation of species limits of E. divaricatus radiation would date of about 2–3 my. Similar divergence times was suggested (Passoni et al., 2008). In Nothobachia similar consid- had also been previously estimated for different populations of erations might be done, as genetic divergences estimated between Calyptommatus and Nothobachia based on mitochondrial RFLP data Casanova and Xique-Xique dune fields were of the same order than (Arruda Campos, 1999). those estimated for different species in Calyptommatus (see Ta- Present sequencing data suggest the evolutionary history of ble 4). On this basis we strongly suggest a reexamination of spec- Calyptommatus was characterized by a complex and alternate pat- imens from those localities to check the possible existence of an tern of cladogenesis involving sandy habitats on opposite margins overlooked undescribed species. of São Francisco River. The observed pattern strongly suggests that Divergence time estimations are presently proposed for vicari- the river led to speciation, isolating in a basal event Santo Inácio ance events in Calyptommatus and Nothobachia, based on concate- area in the right margin from all other regions on left margin. In nated cyt b and 16S rRNA, the longer analyzed gene sequence the state of Piauí, sandy habitats of the Paraiba River drainage shown to be evolving according to the ‘‘molecular clock” hypothe- are also situated not far from the left bank of São Francisco River, sis. To the extent that an mtDNA ‘‘molecular clock” is reliable, and are closely related to sandy habitats of its left and right mar- branch points in molecular phylogenies could be dated (Brown gins. Present distribution of C. sinebrachiatus and C. leiolepis, as well et al., 1979; Shields and Wilson, 1987), yielding at least crude as that of C. nicterus and C. leiolepis, occurring in adjacent banks on assessment of whether branching times are consistent with geo- opposite margins, suggests this hypothesis. Likewise, an appar- logically dated vicariant events (Bermingham and Avise, 1986). ently isolated population of C. leiolepis occurring at Ilha do Gado Even though fossils are absent and geomorphological records are Bravo, a large river island between Santo Inácio and Ibiraba, sug- poorly known for middle São Francisco River sandy dunes, it is gests that similar islands could have been the scenario for differen- worthwhile to estimate preliminary dates for differentiation in tiation, or even areas to transfer species to opposite sides, driven those lizards, and compare it with recent estimations for endemic by changes in the course of the river. The presence of a new species fauna of those dune fields (Benozzati and Rodrigues, 2003; Pelleg- of lizard genus Ameiva at Ilha do Gado Bravo, related to the wide- rino et al., 2005; Passoni et al., 2008). Most of these estimates have spread Ameiva ameiva in both sides of the river, gives support to considered evolutionary rates of about 2% of sequence divergence this idea (Rodrigues et al., 2005). per million years, based on previous data on lizard mtDNA (Thorpe Pleistocene refugia are commonly evoked to explain the differ- et al., 1994; González et al., 1996; Carranza et al., 2000). Therefore, entiation and present day distribution of closed related, largely rough divergence times have been proposed for the studied genera allopatric species. For South America, the main model has been also considering a 2% evolutionary rate. The Calyptommatus/Not- of forest refugia established during Pleistocene drought cycles hobachia ancestor would date from Miocene, about 9–15 my. C. (Haffer, 1969; Vanzolini and Williams, 1981). Historical geomor- sinebrachiatus would have diverged from nicterus/leiolepis/confusio- phology of those sandy regions has been improved in the last years, nibus complex by approximately 4.4–6.6 my ago. C. nicterus, from but it still encompasses timescales of thousands and not millions of the right margin of Rio São Francisco, would be diverging from C. years ago (see Cartelle and Hartwig, 1996; Barreto et al., 1999). leiolepis, its sister species from the opposite margin, only by Divergence times estimated for radiations of the microteiid and approximately 1.8–2.6 my. Furthermore, as shown in Table 4, C. lei- tropidurid lizards living in this area are similar, of the order of a olepis population from Alagoado in northern dune fields would be few million years, although more recent events in Calyptommatus diverging from those on the southern dunes by 1.2–2.0 my. This is and Nothobachia could be attributed to the Pleistocene as previ- interesting because similar divergence times were found between ously suggested (Benozzati and Rodrigues, 2003; Passoni et al., Queimadas and the other four southern C. leiolepis populations, all 2008). on Xique-Xique dunes (1.5–2.2 my). This pattern differs from that As a final remark we would like to point out the puzzling ab- of N. ablephara populations of northern and southern dune fields, sence of Nothobachia on the right bank of São Francisco River. Con- which would have differentiated by 3.0–4.0 my ago, about 10 sidering the sister relationship, sympatry and shared ecological times earlier than its populations on southern dune fields. Diver- requirements of Nothobachia and Calyptommatus it would be rea- gence times of the same order (2.0–3.0 my) were also reported sonable to suppose they have been submitted to the same histori- Author's personal copy
A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) 622–630 629 cal vicissitudes in their occurrence areas. We hope that a more Gatesy, J., Desalle, R., Wheeler, W., 1993. Alignment-ambiguous nucleotide sites and comprehensive phylogeny including more extensive molecular the exclusion of systematic data. Mol. Phylogenet. Evol. 2, 152–157. Geurgas, S.R., Rodrigues, M.T., Moritz, C., 2008. The genus Coleodactylus data, and representatives of the whole Gymnophthalmini radiation (Sphaerodactylinae, Gekkota) revisited: a molecular phylogenetic perspective. in the region, might illuminate further this issue as well as reveal Mol. Phylogenet. Evol. 49, 92–101. new evolutionary patterns for its fauna. González, P., Pinto, F., Nogales, M., Jiménez-Asensio, J.J., Hernández, M., Cabrera, V.M., 1996. Phylogenetic relationships of the Canary Islands endemic lizard genus Gallotia (Sauria: Lacertidae), inferred from mitochondrial DNA sequences. Mol. Phylogenet. Evol. 6, 63–71. Acknowledgments Gutell, R.R., Fox, G.E., 1988. A compilation of large subunit RNA sequences presented in a structural format. Nucleic Acids Res. 16 (Suppl.), r175–r269. Authors thank the Brazilian agencies Fundação de Amparo à Haffer, J., 1969. Speciation in Amazonian forest birds. Science 165, 131–137. Haffer, J., 2001. Hypothesis to explain the origin of species in Amazonia. In: Vieira, Pesquisa do Estado de São Paulo (FAPESP), Conselho Nacional de I.G.C., Silva, J.M.C., Oren, D.C., d’Incao, M.A. (Eds.), Diversidade Biológica e Desenvolvimento Científico e Tecnológico (CNPq), and Coorde- Cultural da Amazônia. Museu Paraense Emílio Goeldi, Belém, Pará. nação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Hickson, R.E., Simon, C., Cooper, A., Spicer, G.S., Sullivan, J., Penny, D., 1996. for financial support. We also thank D. Pavan, F.F. Curcio, J.M. Mar- Conserved sequence motifs, alignment, and secondary structure for the third domain of animal 12S rRNA. Mol. Biol. Evol. 13 (1), 150–169. tins, P.L.B. Rocha, R. Moraes, G. Skuk, R.M.L. Santos, R. Villela, and J. Hillis, D.M., 1991. Discriminating between phylogenetic signal and random noise in Roscito for help in field, and J. Cassimiro and M. Teixeira Jr. for help DNA sequences. In: Miyamoto, M.M., Cracraft, J. (Eds.), Phylogenetic Analysis of with figures. DNA Sequences. Oxford University Press, New York, pp. 278–294. Hillis, D.M., Davis, S.K., 1986. Evolution of ribosomal DNA: fifty million years of recorded history in the frog genus Rana. Evolution 40, 1275–1288. Hillis, D.M., Huelsenbeck, J.P., 1992. Signal, noise, and reliability in molecular Appendix A. Supplementary data phylogenetic analyses. J. Hered. 83, 189–195. Huelsenbeck, J.P., 1991. Tree-length distribution skewness: an indicator of phylogenetic information. Syst. Zool. 40, 257–270. Supplementary data associated with this article can be found, in Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S., Villablanca, F.X., the online version, at doi:10.1016/j.ympev.2010.04.027. Wilson, A.C., 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA 86, 6196–6200. References Macey, J.R., Larson, A., Ananjeva, N.B., Papenfuss, T.J., 1997. Evolutionary shifts in three major structural features of the mitochondrial genome among iguanian lizards. J. Mol. Evol. 44, 660–674. Ab’Saber, A.N., 1969. Participação das superfícies aplainadas nas paisagens do MacLean, W.P., 1974. Feeding and locomotor mechanisms of teiid lizards: nordeste brasileiro. Geomorfologia (São Paulo) 19, 1–39. functional morphology and evolution. Pap. Avulsos Zool. (São Paulo) 27 (15), Arruda Campos, C.V., 1999. Caracterização de lagartos microteídeos do gênero 173–213. Calyptommatus (Squamata, Gymnphthalmidae) através da análise de Martins, J.M., 1997. Estudo alozímico de um grupo de lagartos gimnoftalmídeos fragmentos de restrição do DNA mitocondrial. M.S. Thesis, Universidade de (Squamata: Gymnophthalmidae). Ph.D. Thesis, Universidade de São Paulo, São São Paulo, São Paulo. Paulo. Ast, J.C., 2001. Mitochondrial DNA evidence and evolution in Varanoidea Muse, S.V., Weir, B., 1992. Testing for equality of evolutionary rates. Genetics 132, (Squamata). Cladistics 17, 211–226. 269–276. Barreto, A.M.F., Suguio, K., Oliveira, P.E., Tatumi, S.H., 1999. O campo de dunas Palumbi, S.R., 1996. Nucleic acids: II. The polymerase chain reaction. In: Hillis, D.M., inativas do médio Rio São Francisco, Bahia. In: Schobbenhaus, C., Campos, D.A., Moritz, C., Mable, B.K. (Eds.), Molecular Systematics, second ed. Sinauer Queiroz, E.T., Winge, M., Berbert-Born, M.L.C. (Eds.), Sítios Geológicos e Associates, Sunderland, MA, pp. 205–247. Paleontológicos do Brasil. Available from:
630 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) 622–630
pálpebra, com a redefinição do gênero Gymnophthalmus (Sauria, Teiidae). Pap. Souza-Lima, W., Salgado de Carvalho, M.S., Lacerda Grillo, J., Milhomem, P.S., 2005. Avulsos Zool. (São Paulo) 37 (21), 329–342. Bacia do Almada. In: Paleo 2005, Reunião Anual Regional da Sociedade Rodrigues, M.T., 1991d. Herpetofauna das dunas interiores do Rio São Francisco: Brasileira de Paleontologia, resumos, pp. 20–27. Bahia: Brasil: IV. Uma nova espécie de Typhlops (Ophidia, Typhlopidae). Pap. Swofford, D.L., 2002. PAUP* 4.0b10: Phylogenetic Analysis Using Parsimony ( and Avulsos Zool. (São Paulo) 37 (21), 343–346. other methods). Sinauer Associates, Sunderland, MA. Rodrigues, M.T., 1996. Lizards, snakes and amphisbaenians from the Quaternary Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in sand dunes of the middle Rio São Francisco: Bahia: Brazil. J. Herpetol. 30, 513– the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. 523. Evol. 10, 512–526. Rodrigues, M.T., Juncá, F.A., 2002. Herpetofauna of the Quaternary sand dunes of the Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The middle Rio São Francisco: Bahia: Brazil: VII. Typhlops amoipira, sp. n., a possible CLUSTAL_X windows interface: flexible strategies for multiple sequence relative of Typhlops yonenagae (Serpentes, Typhlopidae). Pap. Avulsos Zool. (São alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Paulo) 42, 325–333. Thorpe, R.S., McGregor, D., Cumming, A.M., Jordan, W.C., 1994. DNA evolution and Rodrigues, M.T., Santos, E.M., 2008. A new genus and species of eyelid-less and limb colonization sequence of island lizards in relation to geological history: mtDNA reduced gymnophthalmid lizard from northeastern Brazil (Squamata, RFLP, cytochrome b, cytochrome oxidase, 12S rRNA sequence, and nuclear RAPD Gymnophthalmidae). Zootaxa 1873, 50–60. analyses. Evolution 48, 230–240. Rodrigues, M.T., Zaher, H., Curcio, F., 2001. A new species of lizard, genus Titus, T.A., Frost, D.A., 1996. Molecular homology assessment and phylogeny in the Calyptommatus, from the Caatingas of the state of Piauí, northeastern Brazil lizard family Opluridae (Squamata: Iguania). Mol. Phylogenet. Evol. 6 (1), 49–62. (Squamata, Gymnophthalmidae). Pap. Avulsos Zool. (São Paulo) 41 (28), 529– Tricart, J., 1974. Existance de périodes sèches en Amazonie et dans les régions 546. voisines. Rev. Geomorph. Dyn. 4, 148–158. Rodrigues, M.T., Freire, M.E.X., Pellegrino, K.C.M., Sites Jr., J.W., 2005. Phylogenetic Vanzolini, P.E., Williams, E.E., 1981. The vanishing refuge: a mechanism for relationships of a new genus and species of microteiid lizard from the Atlantic ecogeographical speciation. Pap. Avulsos Zool. (São Paulo) 34 (23), 251–255. forest of northeastern Brazil (Squamata, Gymnophthalmidae). Zool. J. Linn. Soc. Wiens, J.J., Reeder, T.W., 1997. Phylogeny of the spiny lizards (Sceloporus) based on 144, 543–557. molecular and morphological evidence. Herpetol. Monogr. 11, 1–101. Rodríguez, F., Oliver, J.L., Marín, A., Medina, J.R., 1990. The general stochastic model Xia, X., 2000. Data Analysis in Molecular Biology and Evolution. Kluwer Academic of nucleotide substitution. J. Theor. Biol. 142, 485–501. Publishers, Boston. Rull, V., 2006. Quaternary speciation in the neotropics. Mol. Ecol. 15, 4257–4259. Xia, X., Xie, Z., 2001. DAMBE: data analysis in molecular biology and evolution. J. Shields, G.F., Wilson, A.C., 1987. Calibration of mitochondrial DNA evolution in Hered. 92, 371–373. geese. J. Mol. Evol. 24, 121–217. Yonenaga-Yassuda, Y., Pellegrino, K.C.M., Rodrigues, M.T., 1998. Extensive chromosome Sokal, R.R., Rohlf, F.J., 1981. Biometry. W.H. Freeman, San Francisco. variability in a monophyletic group of eyelid-less microteiid lizards (Squamata, Sorenson, M.D., Fleischer, R.C., 1996. Multiple independent transpositions of Gymnophthalmidae) from Brazil. Cytogenet. Cell Genet. 81, 135. mitochondrial DNA control region sequences to the nucleus. Proc. Natl. Acad. Zhang, D.-X., Hewitt, G.M., 1996. Nuclear integrations: challenges for mitochondrial Sci. USA 93, 15239–15243. DNA markers. Trends Ecol. Evol. 11, 247–251.