DOCSLIB.ORG

Glutathione Peroxidase-2 Protects from Allergen-Induced Airway Inflammation in Mice

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Glutathione Peroxidase-2 Protects from Allergen-Induced Airway Inflammation in Mice Eur Respir J 2010; 35: 1148–1154 DOI: 10.1183/09031936.00026108 CopyrightßERS Journals Ltd 2010 Glutathione peroxidase-2 protects from allergen-induced airway inflammation in mice A.M. Dittrich*,#,e, H-A. Meyer*,e, M. Krokowski*, D. Quarcoo*, B. Ahrens*, S.M. Kube", M. Witzenrath", R.S. Esworthy+, F-F. Chu+ and E. Hamelmann*,1 ABSTRACT: The aim of the present study was to identify and validate the biological significance AFFILIATIONS of new genes/proteins involved in the development of allergic airway disease in a murine asthma *Dept of Paediatric Pneumology and Immunology, Charite´ Humboldt model. University, Gene microarrays were used to identify genes with at least a two-fold increase in gene "Dept of Internal Medicine/Infectious expression in lungs of two separate mouse strains with high and low allergic susceptibility. Diseases and Respiratory Medicine, Validation of mRNA data was obtained by western blotting and immunohistochemistry, followed Charite´-Universita¨tsmedizin Berlin, Berlin, by functional analysis of one of the identified genes in mice with targeted disruption of specific #Junior Research Group SFB 587, gene expression. Hannover Medical School, Hannover, Expression of two antioxidant enzymes, glutathione peroxidase-2 (GPX2) and glutathione S- 1University Children’s Hospital, Ruhr transferase omega (GSTO) 1-1 was increased in both mouse strains after induction of allergic University, Bochum, Germany. +Dept of Radiation Biology, Beckman airway disease and localised in lung epithelial cells. Mice with targeted disruption of the Gpx-2 Research Institute of City of Hope, gene showed significantly enhanced airway inflammation compared to sensitised and challenged Duarte, CA, USA. wild-type mice. eBoth authors contributed equally to Our data indicate that genes encoding the antioxidants GPX2 and GSTO 1-1 are common this work. inflammatory genes expressed upon induction of allergic airway inflammation, and independently CORRESPONDENCE of allergic susceptibility. Furthermore, we provide evidence to illustrate the importance of a single E. Hamelmann antioxidant enzyme, GPX2, in protection from allergen-induced disease. University Children’s Hospital Bochum Alexandrinenstraße 5 KEYWORDS: Airway hyperreactivity, asthma, glutathione peroxidase, glutathione S-transferase 44791 Bochum Germany E-mail: eckard.hamelmann@ llergic asthma is a polygenetic disease Different technologies may be applied in search klinikum-bochum.de that unfolds through the interplay of of new factors. Several recent studies benefitted A various genes with environmental factors. from microarray analysis of gene expression Received: Despite the identification of several proteins and profiles in order to identify genes involved in Feb 20 2008 pathways involved in this inflammatory process, the development of allergic airway inflammation, Accepted after revision: clinical trials in which key mediators were as reviewed previously [3]. This approach has Oct 08 2009 inhibited revealed that other, and as yet significant advantages over conventional experi- First published online: unknown, factors might be causally involved in mental approaches. Conventional approaches Nov 06 2009 the allergic cascade [1]. In search for these only permit the study of known mediators of putative candidates, it is intriguing to speculate inflammation, where previous studies usually that antioxidant defence systems might be already suggested a possible association with involved in the regulation of airway inflamma- allergic airway disease. Deductive gene expres- tion, since airways are naturally exposed to sion profiling via microarrays, however, might higher oxygen concentrations than most other identify mediators without any known link to tissues. Recent studies have identified increased inflammation or airway disease, thereby introdu- levels of oxidative stress and alterations of cing truly ‘‘novel’’ targets into the field of allergic antioxidant enzymes in the lungs of allergic airway research. To identify novel factors com- individuals and in allergic animal models, result- monly involved in pulmonary inflammation, we ing in the hypothesis that an increase in oxidative therefore employed RNA microarray technology. stress may contribute to the characteristic fea- Comparisons of naı¨ve and treated mice on the tures of asthma [2]. one hand, and of two mouse strains with known European Respiratory Journal Print ISSN 0903-1936 This article has online supplementary material available from www.erj.ersjournals.com Online ISSN 1399-3003 1148 VOLUME 35 NUMBER 5 EUROPEAN RESPIRATORY JOURNAL A.M. DITTRICH ET AL. CELL AND ANIMAL STUDIES different genetic susceptibilities to the induction of allergic Airway reactivity airway disease [4] on the other hand, allowed us to identify Airway reactivity was measured by whole body barometric common genes involved in pulmonary inflammation, inde- plethysmography (WBP; corresponding to the Buxco-system pendently from genetic susceptibility to disease development. provided by EMKA Technologies, Paris, France), as previously Among the identified genes were several genes involved in the described [6]. regulation of oxidative stress, among these the antioxidative Invasive lung function measurement in isolated perfused enzymes, glutathione peroxidase-2 (GPX2) and glutathione S- mouse lungs after three challenges (days 28, 29 and 30) of transferase omega 1-1 (GSTO 1-1). These two enzymes had not wild-type and knockout mice: mouse lungs were prepared, previously been recognised to be part of the allergen-mediated ventilated and analysed as described [7]. After a steady state inflammation cascade. Our data indicate that GSTO 1-1 and period of 30 min, methacholine was administered to the GPX2 are upregulated in allergic airway inflammation. perfusate for 30 s at 12-min intervals. Airway resistance values Furthermore, the absence of GPX2 leads to an increase in the were determined at the end of the steady state period, as well allergic airway inflammation. Manipulating this pathway in as at the maximum level of resistance increase. The change in future studies will test the hypotheses that oxidative stress is airway resistance was expressed as ‘‘relative fold airway involved in the pathogenesis of asthma. resistance’’, representing the increase in responsiveness due to OVA sensitisation by normalising fold airway resistance METHODS values of OVA lungs to corresponding mean values of control Animals groups. Specific-pathogen-free female BALB/c and C57BL/6 mice (Harlan-Winkelmann, Borchen, Germany), and C57BL/6 mice Preparation of RNA with a targeted disruption of Gpx-2 [5], 6–8 weeks old at the Total RNA was extracted from mouse lungs using Qiagen starting point of experiments, were used. Five animals per RNeasy Total RNA isolation kit (Qiagen, Hilden, Germany) group were analysed and three independent experiments were according to the manufacturer’s instructions. conducted. All experimental procedures were approved by the animal care facility (Berlin Office for Occupational Safety, Microarray analysis Protection of Health and Technical Safety-LAGeSo, Berlin, cRNAs were hybridised individually to mouse genome MG- Germany). U74Av2 chips (Affymetrix, High Wycombe, UK). In total, eight lungs were analysed, two treated mice versus two controls in Sensitisation and challenge protocol two different mouse strains (BALB/c and C57BL/6), respec- Mice were sensitised by intraperitoneal injection of 20 mg tively. The gene chips were scanned with an Affymetrix Gene ovalbumin (OVA) grade VI (Sigma-Aldrich, Munich, Chip Instrument and scaled using Affymetrix’s Microarray Germany) in 2 mg of aluminium hydroxide on days 1 and Suite software 5.0 (MAS5). We made four-way comparison of 14. Airway inflammation was induced by intranasal instillation the arrays; between two different mouse strains and between of OVA grade V (Sigma-Aldrich) (50 mgin50mL PBS) on day treated and controls (262 matrix). Only those genes which 28 (for microarray analyses) and 29 (for quantitative real-time were found to be similarly regulated in all four comparisons RT-PCR). For studies with GPX2-null animals, mice were were classified as differentially expressed genes. The signal log systemically sensitised by i.p. injection of OVA and aluminium ratio was converted to a standard on a logarithmic scale and hydroxide. Nonsensitised mice received aluminium hydroxide the mean fold change of all four comparisons was calculated. without OVA. On days 28, 29 and 30, all mice were challenged We consecutively focused on those genes, which were with OVA, and killed at day 32. For microarray analyses, similarly regulated in both strains of mice and with more than animals were sacrificed 16 h after the single intranasal two-fold changes between treated and untreated mice. A more challenge on day 28. For RT-PCR, western blotting and for detailed description of the microarray analysis is attached as studies with GPX2-null animals, animals were sacrificed 48 h supplementary material. after last challenge, i.e. either 48 h after two challenges on day Real-time PCR 28 and 29 or 48 h after challenges on day 28, 29 and 30. PCR amplification and analysis were performed using an ABI PRISM 7700 (Perkin Elmer, Rodgau, Germany) and SDS Detection of the allergic phenotype software version 1.7 (a more detailed description of the real Immunoglobulins time PCR can be found in the online supplementary material). 48 h after the last challenge, blood was drawn from the tail vein, and serum levels of total immunoglobulin (Ig)E
Load more

Recommended publications
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • MK+10-025-Mouse-Model-For-Inflammatory-Bowel-Diseases
    Intellectual Property (Non-confidential) NATIONAL MEDICAL CENTER AND BECKMAN RESEARCH INSTITUTE Mouse Model for Inflammatory Bowel Diseases DESCRIPTION This is a transgenic double-knockout (DKO) mouse (Gpx1 and Gpx2). Both GPX1 and GPX2 belong to a selenium-dependent glutathione peroxidase (GPXs) family, which are enzymes that are efficient in the reduction of hydroperoxides. Gpx1 is expressed ubiquitously, and Gpx2 is highly expressed in the epithelium of the gastrointestinal (GI) tract. Gpx1/2-DKO mice have early-onset spontaneous ileocolitis beginning around weaning. These mice are an excellent model for human inflammatory bowel diseases (IBD) because they share similar disease etiology, which includes that the disease severity is highly influenced by genetic background, gut microflora, diet, and higher cancer risk in the distal GI tract. Unlike most mouse IBD models which have disrupted genes playing an important role in regulation of adaptive immunity, these Gpx1/2-DKO mice have intact immunity- which resembles human IBD. KEY ASPECTS • Homozygous disruption of both the endogenous Gpx1 and Gpx2 genes. • Disease characteristics include ileitis, colitis, hypothermia, growth retardation, runting, perianal ulceration, diarrhea, wasting syndrome,, IBD histopathology, tumors/cancer in the ileum or colon PUBLISHED DATA • Esworthy RS, Binder SW, Doroshow JH, and Chu FF, Microflora trigger colitis in mice deficient in selenium-dependent glutathione peroxidase and induce Gpx2 gene expression. Biol. Chem. 384: 597- 607, 2003 • Lee D-H, Esworthy RS, Chu, C, Pfeifer GP, and Chu, F-F. Mutation accumulation in the intestine and colon of mice deficient in two intracellular glutathione peroxidases. Cancer Res. 66: 9845-9851, 2006 • Hahn MA, Hahn T, Lee DH, Esworthy RS, Kim B, Riggs AD, Chu F-F, and Pfeifer GP.
    [Show full text]
  • Characterization of Cytosolic Glutathione Peroxidase And
    Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism.
    [Show full text]
  • Glutathione Peroxidase 4 and Vitamin E Cooperatively Prevent Hepatocellular Degeneration
    Glutathione peroxidase 4 and vitamin E cooperatively prevent hepatocellular degeneration The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Carlson, Bradley A., Ryuta Tobe, Elena Yefremova, Petra A. Tsuji, Victoria J. Hoffmann, Ulrich Schweizer, Vadim N. Gladyshev, Dolph L. Hatfield, and Marcus Conrad. 2016. “Glutathione peroxidase 4 and vitamin E cooperatively prevent hepatocellular degeneration.” Redox Biology 9 (1): 22-31. doi:10.1016/j.redox.2016.05.003. http:// dx.doi.org/10.1016/j.redox.2016.05.003. Published Version doi:10.1016/j.redox.2016.05.003 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:27662198 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Redox Biology 9 (2016) 22–31 Contents lists available at ScienceDirect Redox Biology journal homepage: www.elsevier.com/locate/redox Research paper Glutathione peroxidase 4 and vitamin E cooperatively prevent hepatocellular degeneration Bradley A. Carlson a, Ryuta Tobe a, Elena Yefremova b, Petra A. Tsuji c, Victoria J. Hoffmann d, Ulrich Schweizer e, Vadim N. Gladyshev f, Dolph L. Hatfield a,n, Marcus Conrad b,nn a Molecular Biology of Selenium Section, Mouse Cancer Genetics Program, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA b Helmholtz Zentrum München,
    [Show full text]
  • Inactivation of Glutathione Peroxidase Activity Contributes to UV-Induced Squamous Cell Carcinoma Formation
    Research Article Inactivation of Glutathione Peroxidase Activity Contributes to UV-Induced Squamous Cell Carcinoma Formation Jennifer Walshe,1 Magdalena M. Serewko-Auret,1 Ngari Teakle,1 Sarina Cameron,1 Kelly Minto,1 Louise Smith,1 Philip C. Burcham,5 Terry Russell,1 Geoffrey Strutton,2 Anthony Griffin,3 Fong-Fong Chu,6 Stephen Esworthy,6 Vivienne Reeve,7 and Nicholas A. Saunders1,4 1Epithelial Pathobiology Group, Cancer Biology Programme, Diamantina Institute for Cancer, Immunology and Metabolic Medicine, University of Queensland, 2Department of Pathology, and 3Transplant Surgery Unit, Princess Alexandra Hospital; 4School of Biomedical Sciences, University of Queensland, Brisbane, Queensland, Australia; 5Pharmacology and Anaesthesiology Unit, School of Medicine and Pharmacology, University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; 6City of Hope, Duarte, California; and 7Faculty of Veterinary Sciences, Sydney University, Sydney, New South Wales, Australia Abstract SCC (intraepidermal carcinoma; ref. 3) and a late-stage SCC (3). Cutaneous squamous cell carcinomas (CSCC) are a common In that study, we reported that the most significant and early malignancy of keratinocytes that arise in sites of the skin observable alteration in gene expression was a 10- to 40-fold exposed to excessive UV radiation. In the present study, we induction in the mRNA for glutathione peroxidase 2 (GPX2; ref. 3). showthat human SCC cell lines, preneoplastic solar keratoses This profound and early induction of GPX2 mRNA in SCCs (SK), and CSCC are associated with perturbations in glutathi- suggested that GPX, and by extrapolation aberrant peroxide one peroxidase (GPX) activity and peroxide levels. Specifically, metabolism, may be involved in the early events that contribute to the development of SCC in vivo.
    [Show full text]
  • Effects of Se-Depletion on Glutathione Peroxidase and Selenoprotein W
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector FEBS Letters 579 (2005) 792–796 FEBS 29196 Effects of Se-depletion on glutathione peroxidase and selenoprotein W gene expression in the colon Vasileios Pagmantidisa, Giovanna Bermanob, Stephane Villettea, Iain Broomb, John Arthurc, John Hesketha,* a School of Cell and Molecular Biosciences, University of Newcastle upon Tyne, NE1 7RU, UK b School of Life Sciences, The Robert Gordon University, Aberdeen AB25 1HG, UK c Rowett Research Institute, Bucksburn, Aberdeen AB21 9SB, UK Received 3 September 2004; revised 22 November 2004; accepted 9 December 2004 Available online 27 December 2004 Edited by Lukas Huber tant in determining the level of anti-oxidant protection and Abstract Selenium (Se)-containing proteins have important roles in protecting cells from oxidative damage. This work inves- inflammatory responses in the colon [8]. In addition, supple- tigated the effects of Se-depletion on the expression of the genes mentation with Se above normal intake reduces mortality from encoding selenoproteins in colonic mucosa from rats fed diets of cancer of the colon [2,3], as well as that of lung and prostate. different Se content and in human intestinal Caco-2 cells grown These observations indicate that selenoproteins such as the in Se-adequate or Se-depleted culture medium. Se-depletion pro- GPXs are critical for colon function. However, little is known duced statistically significant (P < 0.05) falls in glutathione per- of how selenoprotein gene expression in colonic cells, particu- oxidase (GPX) 1 mRNA (60–83%) and selenoprotein W mRNA larly in vivo, is regulated by Se availability.
    [Show full text]
  • Is Intestinal Oxidative Stress Involved in Patients with Compensated Liver Cirrhosis?
    402 Pijls KE, et al. , 2016; 15 (3): 402-409 ORIGINAL ARTICLE May-June, Vol. 15 No. 3, 2016: 402-409 The Official Journal of the Mexican Association of Hepatology, the Latin-American Association for Study of the Liver and the Canadian Association for the Study of the Liver Is intestinal oxidative stress involved in patients with compensated liver cirrhosis? Kirsten E. Pijls,*,*** Daisy M.A.E. Jonkers,*,*** Montserrat Elizalde,*,*** Marie-Jose Drittij-Reijnders,**,*** Guido R. Haenen,**,*** Aalt Bast**,*** Ad A.M. Masclee,*,*** Ger H. Koek*,*** * Division Gastroenterology-Hepatology, Department of Internal Medicine, Maastricht University Medical Center, the Netherlands. ** Department of Toxicology, Maastricht University Medical Center, the Netherlands. *** School for Nutrition, Toxicology and Metabolism (NUTRIM), Maastricht University Medical Center, the Netherlands. ABSTRACT Background. Liver cirrhosis is associated with intestinal epithelial barrier dysfunction, which may be affected by oxidative stress. Studies in cirrhotic rats provided evidence for intestinal oxidative stress, but studies in cirrhotic patients are scarce. We have shown intestinal barrier dysfunction in patients with compensated cirrhosis. Aim. The present study aimed to investigate whether oxidative stress occurs in the intestinal mucosa of compensated cirrhotic patients and may contribute to barrier dysfunction. Material and methods. Oxidative stress was studied in duodenal and sigmoid biopsies from 15 cirrhotic patients and 22 controls by analyzing transcription of genes involved in glutathione and uric acid metabolism using quantitative real-time polymerase chain reaction. Protein levels of glutathione and glutathione disulphide were measured and the glutathione/glutathione disulphide ratio was calculated as mar- ker of oxidative stress. In addition, intestinal myeloperoxidase and fecal calprotectin were determined.
    [Show full text]
  • Selenoprotein Expression Is Regulated at Multiple Levels in Prostate Cells
    npg Selenoproteins in prostate cells 940 Cell Research (2006) 16:940-948 npg © 2006 IBCB, SIBS, CAS All rights reserved 1001-0602/06 $ 30.00 ORIGINAL ARTICLE www.nature.com/cr Selenoprotein expression is regulated at multiple levels in prostate cells Cheryl M Rebsch1, Frank J Penna III1, Paul R Copeland1,2 1Department of Molecular Genetics, Microbiology and Immunology; 2The Cancer Institute of New Jersey, UMDNJ - Robert Wood Johnson Medical School, 675 Hoes Lane, Piscataway, NJ 08854, USA Selenium supplementation in a population with low basal blood selenium levels has been reported to decrease the incidence of several cancers including prostate cancer. Based on the clinical findings, it is likely that the antioxidant function of one or more selenoproteins is responsible for the chemopreventive effect, although low molecular weight seleno-compounds have also been posited to selectively induce apoptosis in transformed cells. To address the effects of selenium supplementation on selenoprotein expression in prostate cells, we have undertaken an analysis of antioxidant selenoprotein expression as well as selenium toxicity in non-tumorigenic prostate epithelial cells (RWPE-1) and prostate cancer cells (LNCaP and PC-3). Our results show that two of the glutathione peroxidase family members (GPX1 and GPX4) are highly induced by supplemental selenium in prostate cancer cells but only slightly induced in RWPE-1 cells. In addition, GPX1 levels are dramatically lower in PC-3 cells as compared to RWPE-1 or LNCaP cells. GPX2 protein and mRNA, however, are only detectable in RWPE-1 cells. Of the three selenium compounds tested (sodium selenite, sodium selenate and selenomethionine), only sodium selenite shows toxicity in a physiological range of selenium concentrations.
    [Show full text]
  • The Keap1/Nrf2 Signaling Pathway in the Thyroid—2020 Update
    antioxidants Review The Keap1/Nrf2 Signaling Pathway in the Thyroid—2020 Update Christina Thanas 1, Panos G. Ziros 1, Dionysios V. Chartoumpekis 1,2 ,Cédric O. Renaud 1 and Gerasimos P. Sykiotis 1,* 1 Service of Endocrinology, Diabetology and Metabolism, Lausanne University Hospital and University of Lausanne, CH-1011 Lausanne, Switzerland; [email protected] (C.T.); [email protected] (P.G.Z.); [email protected] (D.V.C.); [email protected] (C.O.R.) 2 Division of Endocrinology, Department of Internal Medicine, School of Medicine, University of Patras, GR-26500 Patras, Greece * Correspondence: [email protected]; Tel.: +41-21-314-0606; Fax: +41-21-314-9451 Received: 31 August 2020; Accepted: 2 November 2020; Published: 4 November 2020 Abstract: The thyroid gland has a special relationship with oxidative stress. On the one hand, like all other tissues, it must defend itself against reactive oxygen species (ROS). On the other hand, unlike most other tissues, it must also produce reactive oxygen species in order to synthesize its hormones that contribute to the homeostasis of other tissues. The thyroid must therefore also rely on antioxidant defense systems to maintain its own homeostasis in the face of continuous self-exposure to ROS. One of the main endogenous antioxidant systems is the pathway centered on the transcription factor Nuclear factor erythroid 2-related factor 2 (Nrf2) and its cytoplasmic inhibitor Kelch-like ECH-associated protein 1 (Keap1). Over the last few years, multiple links have emerged between the Keap1/Nrf2 pathway and thyroid physiology, as well as various thyroid pathologies, including autoimmunity, goiter, hypothyroidism, hyperthyroidism, and cancer.
    [Show full text]
  • Aron Berhanie Abera
    The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgementTown of the source. The thesis is to be used for private study or non- commercial research purposes only. Cape Published by the University ofof Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author. University CHARACTERIZATION OF SIGNALLING CROSS-TALK BETWEEN THE EP2 AND FP RECEPTORS IN ENDOMETRIAL EPITHELIAL CELLS ARON BERHANIE ABERA B.tech (Medial Biotechnology), Cape Peninsula University of Technology B.Sc (Hons) (Human Genetics), University of the Cape Town M.Sc (Medicine), University of the Cape Town Department of Medical Biochemistry University of Cape Town Medical School Anzio Road Observatory Town 7925 South Africa and Cape of Human Reproductive Sciences Unit Medical Research Council The Queen’s Medical Research Institute 47 Little France Crescent Edinburgh EH16 4TJ UK University Thesis presented for the Degree of DOCTOR OF PHILOSOPHY in the Division of Medical Biochemistry UNIVERSITY OF CAPE TOWN August, 2009 DECLARATION I herewith declare that I autonomously carried out this work, except where due acknowledgements is made by reference. No portion of this work has been previously accepted for, or is currently being submitted in candidature for another degree. Aron B Abera August, 2009 Town Cape of University VII ACKNOWLEDGEMENTS This thesis is the culmination of study conducted between the Receptor Biology group (RBG), South Africa and the Human Reproductive Science Unit (HRSU), UK. I am very grateful to Prof Bob Millar for establishing this collaboration between the two countries and I thoroughly enjoyed interacting and working with different people.
    [Show full text]