DOCSLIB.ORG

Glutathione Peroxidase 4 and Vitamin E Cooperatively Prevent Hepatocellular Degeneration

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Glutathione Peroxidase 4 and Vitamin E Cooperatively Prevent Hepatocellular Degeneration Glutathione peroxidase 4 and vitamin E cooperatively prevent hepatocellular degeneration The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Carlson, Bradley A., Ryuta Tobe, Elena Yefremova, Petra A. Tsuji, Victoria J. Hoffmann, Ulrich Schweizer, Vadim N. Gladyshev, Dolph L. Hatfield, and Marcus Conrad. 2016. “Glutathione peroxidase 4 and vitamin E cooperatively prevent hepatocellular degeneration.” Redox Biology 9 (1): 22-31. doi:10.1016/j.redox.2016.05.003. http:// dx.doi.org/10.1016/j.redox.2016.05.003. Published Version doi:10.1016/j.redox.2016.05.003 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:27662198 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Redox Biology 9 (2016) 22–31 Contents lists available at ScienceDirect Redox Biology journal homepage: www.elsevier.com/locate/redox Research paper Glutathione peroxidase 4 and vitamin E cooperatively prevent hepatocellular degeneration Bradley A. Carlson a, Ryuta Tobe a, Elena Yefremova b, Petra A. Tsuji c, Victoria J. Hoffmann d, Ulrich Schweizer e, Vadim N. Gladyshev f, Dolph L. Hatfield a,n, Marcus Conrad b,nn a Molecular Biology of Selenium Section, Mouse Cancer Genetics Program, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA b Helmholtz Zentrum München, Institute for Developmental Genetics, Neuherberg, Germany c Department of Biological Sciences, Towson University, Towson, MD, USA d Office of the Director Diagnostic and Research Services Branch, National Institutes of Health, Bethesda, MD, USA e Institut für Biochemie und Molekularbiologie, Rheinische Friedrich-Wilhelms-Universität Bonn, Bonn, Germany f Division of Genetics, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA article info abstract Article history: The selenoenzyme glutathione peroxidase 4 (Gpx4) is an essential mammalian glutathione peroxidase, Received 17 May 2016 which protects cells against detrimental lipid peroxidation and governs a novel form of regulated ne- Accepted 18 May 2016 crotic cell death, called ferroptosis. To study the relevance of Gpx4 and of another vitally important Available online 26 May 2016 selenoprotein, cytosolic thioredoxin reductase (Txnrd1), for liver function, mice with conditional deletion Keywords: of Gpx4 in hepatocytes were studied, along with those lacking Txnrd1 and selenocysteine (Sec) tRNA À/À Selenoprotein (Trsp) in hepatocytes. Unlike Txnrd1- and Trsp-deficient mice, Gpx4 mice died shortly after birth and À À Ferroptosis presented extensive hepatocyte degeneration. Similar to Txnrd1-deficient livers, Gpx4 / livers mani- Lipid peroxidation fested upregulation of nuclear factor (erythroid-derived)-like 2 (Nrf2) response genes. Remarkably, Gpx4À/À pups born from mothers fed a vitamin E-enriched diet survived, yet this protection was re- versible as subsequent vitamin E deprivation caused death of Gpx4-deficient mice 4 weeks thereafter. Abrogation of selenoprotein expression in Gpx4À/À mice did not result in viable mice, indicating that the combined deficiency aggravated the loss of Gpx4 in liver. By contrast, combined Trsp/Txnrd1-deficient mice were born, but had significantly shorter lifespans than either single knockout, suggesting that Txnrd1 plays an important role in supporting liver function of mice lacking Trsp. In sum our study de- monstrates that the ferroptosis regulator Gpx4 is critical for hepatocyte survival and proper liver func- tion, and that vitamin E can compensate for its loss by protecting cells against deleterious lipid perox- idation. Published by Elsevier B.V. 1. Introduction eight glutathione peroxidases due to its broad substrate specificity, the fact that it functions as a phospholipid hydroperoxidase pro- Glutathione peroxidase 4 (Gpx4) is unique among a family of tecting cells from lipid peroxidation and serves a structural func- tion in mature sperm cells [1]. Moreover, Gpx4 was recently de- scribed to control a novel, iron-dependent form of regulated non- apoptotic cell death, ferroptosis [2], which is characterized by Keywords: Gpx4, glutathione peroxidase 4; Txnrd1, cytosolic thioredoxin re- ductase; Sec, selenocysteine; Trsp, Sec tRNA gene; Nrf2, nuclear factor (erythroid- generation of high levels of lipid hydroperoxides [3,4]. Ferroptotic derived)-like 2; Alb-Cre, Albumin-Cre; H&E, hematoxylin and eosin; qPCR, Quan- cell death was found not only to be relevant for cell death of titative PCR; GSH, glutathione; SEM, standard error of the mean; Gpx1, glutathione malignant cells, but emerged to play an important role in cells and peroxidase 1; SelR, Selenoprotein R; SepW, Selenoprotein W; Gsta1, glutathione tissue demise in kidney tubule cells [5], viral immunity [6], and S-transferase alpha 1; Srxn1, sulfiredoxin 1; Cbr3, carbonyl reductase 3; Gclc, glutamate-cysteine ligase; Gsr, glutathione reductase; TBARS, thiobarbituric acid motor neuron degeneration [7]. Among the proteins encoded by reactive substances 25 selenoprotein genes in mammals, Gpx4 enzyme appears to be nn Corresponding author. particularly critical for murine survival in that its knockout in mice n Correspondence to: Molecular Biology of Selenium Section, Mouse Cancer Ge- is early embryonic lethal [8], and it can only be partially knocked netics Program, National Cancer Institute, National Institutes of Health, 37 Convent down in cultured cells [9,10]. Furthermore, its targeted removal in Dr, Building 37, Room 5016, Bethesda, MD 20892, USA. E-mail addresses: hatfi[email protected] (D.L. Hatfield), neural and skin tissues virtually mimics the knockout of the gene [email protected] (M. Conrad). encoding the selenocysteine (Sec)-specific tRNA, Trsp (see [11,12], http://dx.doi.org/10.1016/j.redox.2016.05.003 2213-2317/Published by Elsevier B.V. B.A. Carlson et al. / Redox Biology 9 (2016) 22–31 23 respectively). manner for further analysis. Tissues used for pathological analysis A remarkable interrelationship exists between Gpx4 and vita- were immediately placed in 10% neutral-buffered formalin and min E, which is a lipid soluble antioxidant responsible for pro- paraffin embedded. Tissue sections were routinely stained with tecting membranes from oxidative damage [5,13]. Inducible in- hematoxylin and eosin (H&E) and examined by light microscopy activation of Gpx4 in cells has been shown to result in lipid per- by a board certified veterinary pathologist. oxidation-mediated cell death, which could be prevented by vi- tamin E supplementation [10]. In addition, this relationship was 2.4. RNA isolation and qPCR analysis also demonstrated by disrupting Gpx4 in mouse endothelium, which had no apparent effect on normal vascular homeostasis, Total RNA was isolated from tissues or cells using TriPure iso- unless the mice were restricted from dietary vitamin E [13]. Vi- lation reagent following the manufacturer's instructions and re- tamin E removal from the diets of these animals resulted in en- verse transcribed using an iScript cDNA synthesis kit. Quantitative dothelial cell death and subsequent thrombus formation in mul- PCR (qPCR) was performed in triplicate using iTaq Universal SYBR tiple organs and consequently early death of mice. Green Supermix according to the manufacturer's instructions. Knockout of either Trsp (TrspÀ/À) [14,15] or Txnrd1 (Txnrd1À/À) Results were normalized to mouse Gapdh. Primers sequences used [16] was found to be embryonic lethal; however, the targeted for analyses are shown in Supplementary Table 3. knockout of either gene in liver was not embryonic lethal [17–19]. The incidence of hepatocarcinogenesis in hepatocyte-specific 2.5. Protein isolation and western blotting conditional knockout mice carrying the Albumin-Cre (Alb-Cre) transgene (genotype Alb-Cre; Txnrd1fl/fl) was dramatically in- Tissues were washed twice with DPBS and then harvested in creased compared to control mice expressing normal levels of ice cold lysis buffer (50 mM Tris; pH 7.5, 150 mM NaCl, 1 mM Txnrd1 (genotype Alb-Cre; Txnrd1þ/ þ), suggesting that this major EDTA, 0.1% Igepal and protease inhibitors). Western blot analysis redox regulator selenoprotein has a role in protecting hepatocytes was carried out as described in Supplementary Information. from cancer [18]. Since mice carrying hepatocyte-specific knockout of Trsp sur- 2.6. Thioredoxin reductase activity and lipid peroxidation assays and vived for several months and their death appeared to be due to quantification of GSH and GSSG severe hepatocellular degeneration and necrosis [17], while mice carrying hepatocyte-specific knockout of Txnrd1 exhibited no ap- Txnrd1 activity was determined spectrophotometrically based parent phenotype [18], we interrogated whether the ferroptosis on the method of Holmgren [21] and lipid peroxidation assessed regulator Gpx4 could be the critical selenoprotein responsible for as described in Supplementary Information. Total glutathione the effect observed in the Trsp knockout mice. To this end, we (GSH) levels in liver were quantified using a glutathione assay kit generated a series of mice with hepatocyte-specific deletion of according to the manufacturer's instructions (Sigma-Aldrich). Gpx4 alone or in combination with Trsp, and as controls hepato- cyte-specific knockout of Txnrd1 in combination with Trsp. Find- 2.7.
Load more

Recommended publications
  • Glutathione Reductase (Ec 1.6.4.2)
    Enzymatic Assay of GLUTATHIONE REDUCTASE (EC 1.6.4.2) PRINCIPLE: ß-NADPH + GSSG Glutathione Reductase> ß-NADP + 2 GSH Abbreviations used: ß-NADPH = ß-Nicotinamide Adenine Dinucleotide Phosphate, Reduced Form ß-NADP = ß-Nicotinamide Adenine Dinucleotide Phosphate, Oxidized Form GSSG = Glutathione, Oxidized Form GSH = Glutathione, Reduced Form CONDITIONS: T = 25°C, pH = 7.6, A340nm, Light Path = 1 cm METHOD: Continuous Spectrophotometric Rate Determination REAGENTS: A. 100 mM Potassium Phosphate Buffer with 3.4 mM Ethylenediaminetetraacetic Acid (EDTA), pH 7.6 at 25°C (Prepare 200 ml in deionized water using Potassium Phosphate, Monobasic, Anhydrous, Sigma Prod. No. P-5379 and Ethylenediaminetetraacetic Acid, Dipotassium Salt, Sigma Stock No. ED2P. Adjust to pH 7.6 at 25°C with 1 M KOH.) B. 30 mM Glutathione Substrate Solution (GSSG) (Prepare 5 ml in deionized water using Glutathione, Oxidized Form, Disodium Salt, Sigma Prod. No. G-4626.) C. 0.8 mM ß-Nicotinamide Adenine Dinucleotide Phosphate, Reduced Form Solution (ß-NADPH) (Prepare 5 ml in cold Reagent A using ß-Nicotinamide Adenine Dinucleotide Phosphate, Tetrasodium Salt, Sigma Prod. No. N-1630.) D. 1.0% (w/v) Bovine Serum Albumin (BSA) (Prepare 100 ml in Reagent A using Albumin, Bovine, Sigma Prod. No. A-4503. This solution should be kept cold.) SPGLUT01 Page 1 of 3 Revised: 08/03/95 Enzymatic Assay of GLUTATHIONE REDUCTASE (EC 1.6.4.2) REAGENTS: (continued) E. Glutathione Reductase Enzyme Solution (Immediately before use, prepare a solution containing 0.30 - 0.60 unit/ml of Glutathione Reductase in cold Reagent D.) PROCEDURE: Pipette (in milliliters) the following reagents into suitable cuvettes: Test Blank Deionized Water 0.65 0.65 Reagent A (Buffer) 1.50 1.50 Reagent B (GSSG) 0.10 0.10 Reagent C (ß-NADPH) 0.35 0.35 Reagent D (BSA) 0.30 0.40 Mix by inversion and equilibrate to 25°C.
    [Show full text]
  • Glutathione Reductase Human, Recombinant Expressed in Escherichia Coli
    Glutathione Reductase human, recombinant expressed in Escherichia coli Catalog Number G9297 Storage Temperature –20 °C CAS RN 9001-48-3 Precautions and Disclaimer EC 1.8.1.7 (formerly 1.6.4.2) This product is for R&D use only, not for drug, Synonyms: GR, NADPH:oxidized glutathione household, or other uses. Please consult the Material oxidoreductase, glutathione-disulfide reductase Safety Data Sheet for information regarding hazards and safe handling practices. Product Description Glutathione reductase (GR) is an ubiquitous Storage/Stability flavoenzyme involved in protecting cells from stress. The product ships on wet ice and storage at –20 °C is GR catalyzes the reduction of oxidized glutathione recommended. The product is stable at –20 °C for at (GSSG) to glutathione (GSH). It is an essential least 2 years. component of the glutathione redox cycle, which maintains adequate levels of reduced cellular GSH. References GSH serves as an antioxidant, reacting with free 1. Lopez-Mirabal, H.R., and Winther, J.R., Redox radicals and organic peroxides. Glutathione is also an characteristics of the eukaryotic cytosol. Biochim. electron donor for glutathione peroxidases and a Biophys. Acta, 1783, 629-640 (2008). substrate for glutathione S-transferases contributing to 2. Qiao, M., et al., Increased expression of glutathione the detoxification and elimination of toxic electrophilic reductase in macrophages decreases 1,2 metabolites and xenobiotics. artherosclerotic lesion formation on low-density lipoproetin receptor-deficient mice. Arterioscler. Glutathione reductase is a homodimeric enzyme Thromb. Vasc. Biol., 27, 1375-1382 (2007). containing 1 FAD molecule and 1 NADPH binding 3. Worthington, D.J., and Rosemeyer, M.A., 3 domain per subunit.
    [Show full text]
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Glutathione Reductase Assay Kit
    Glutathione Reductase Assay Kit Item No. 703202 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd · Ann Arbor, MI · USA TABLE OF CONTENTS GENERAL INFORMATION GENERAL INFORMATION 3 Materials Supplied Materials Supplied 4 Safety Data 4 Precautions 5 If You Have Problems Item Number Item Quantity 4 Storage and Stability 703210 GR Assay Buffer (10X) 1 vial 4 Materials Needed but Not Supplied INTRODUCTION 5 Background 703212 GR Sample Buffer (10X) 1 vial 5 About This Assay 703214 GR Glutathione Reductase (control) 1 vial PRE-ASSAY PREPARATION 6 Reagent Preparation 7 Sample Preparation 703216 GR GSSG 1 vial ASSAY PROTOCOL 9 Plate Set Up 703218 GR NADPH 3 vials 11 Performing the Assay 400014 96-Well Solid Plate (Colorimetric Assay) 1 plate ANALYSIS 12 Calculations 13 Performance Characteristics 400012 96-Well Cover Sheet 1 cover RESOURCES 14 Interferences If any of the items listed above are damaged or missing, please contact our 16 Troubleshooting Customer Service department at (800) 364-9897 or (734) 971-3335. We cannot 17 References accept any returns without prior authorization. 18 Plate Template 19 Notes WARNING: THIS PRODUCT IS FOR RESEARCH ONLY - NOT FOR HUMAN OR VETERINARY DIAGNOSTIC OR THERAPEUTIC USE. 19 Warranty and Limitation of Remedy ! GENERAL INFORMATION 3 Safety Data INTRODUCTION This material should be considered hazardous until further information becomes available. Do not ingest, inhale, get in eyes, on skin, or on clothing. Wash Background thoroughly after handling. Before use, the user must review the complete Safety Glutathione (GSH) is a tripeptide widely distributed in both plants and Data Sheet, which has been sent via email to your institution.
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • Ferroptosis-Related Flavoproteins: Their Function and Stability
    International Journal of Molecular Sciences Review Ferroptosis-Related Flavoproteins: Their Function and Stability R. Martin Vabulas Charité-Universitätsmedizin, Institute of Biochemistry, Charitéplatz 1, 10117 Berlin, Germany; [email protected]; Tel.: +49-30-4505-28176 Abstract: Ferroptosis has been described recently as an iron-dependent cell death driven by peroxida- tion of membrane lipids. It is involved in the pathogenesis of a number of diverse diseases. From the other side, the induction of ferroptosis can be used to kill tumor cells as a novel therapeutic approach. Because of the broad clinical relevance, a comprehensive understanding of the ferroptosis-controlling protein network is necessary. Noteworthy, several proteins from this network are flavoenzymes. This review is an attempt to present the ferroptosis-related flavoproteins in light of their involvement in anti-ferroptotic and pro-ferroptotic roles. When available, the data on the structural stability of mutants and cofactor-free apoenzymes are discussed. The stability of the flavoproteins could be an important component of the cellular death processes. Keywords: flavoproteins; riboflavin; ferroptosis; lipid peroxidation; protein quality control 1. Introduction Human flavoproteome encompasses slightly more than one hundred enzymes that par- ticipate in a number of key metabolic pathways. The chemical versatility of flavoproteins relies on the associated cofactors, flavin mononucleotide (FMN) and flavin adenine dinu- cleotide (FAD). In humans, flavin cofactors are biosynthesized from a precursor riboflavin that has to be supplied with food. To underline its nutritional essentiality, riboflavin is called vitamin B2. In compliance with manifold cellular demands, flavoproteins have been accommo- Citation: Vabulas, R.M. dated to operate at different subcellular locations [1].
    [Show full text]
  • MK+10-025-Mouse-Model-For-Inflammatory-Bowel-Diseases
    Intellectual Property (Non-confidential) NATIONAL MEDICAL CENTER AND BECKMAN RESEARCH INSTITUTE Mouse Model for Inflammatory Bowel Diseases DESCRIPTION This is a transgenic double-knockout (DKO) mouse (Gpx1 and Gpx2). Both GPX1 and GPX2 belong to a selenium-dependent glutathione peroxidase (GPXs) family, which are enzymes that are efficient in the reduction of hydroperoxides. Gpx1 is expressed ubiquitously, and Gpx2 is highly expressed in the epithelium of the gastrointestinal (GI) tract. Gpx1/2-DKO mice have early-onset spontaneous ileocolitis beginning around weaning. These mice are an excellent model for human inflammatory bowel diseases (IBD) because they share similar disease etiology, which includes that the disease severity is highly influenced by genetic background, gut microflora, diet, and higher cancer risk in the distal GI tract. Unlike most mouse IBD models which have disrupted genes playing an important role in regulation of adaptive immunity, these Gpx1/2-DKO mice have intact immunity- which resembles human IBD. KEY ASPECTS • Homozygous disruption of both the endogenous Gpx1 and Gpx2 genes. • Disease characteristics include ileitis, colitis, hypothermia, growth retardation, runting, perianal ulceration, diarrhea, wasting syndrome,, IBD histopathology, tumors/cancer in the ileum or colon PUBLISHED DATA • Esworthy RS, Binder SW, Doroshow JH, and Chu FF, Microflora trigger colitis in mice deficient in selenium-dependent glutathione peroxidase and induce Gpx2 gene expression. Biol. Chem. 384: 597- 607, 2003 • Lee D-H, Esworthy RS, Chu, C, Pfeifer GP, and Chu, F-F. Mutation accumulation in the intestine and colon of mice deficient in two intracellular glutathione peroxidases. Cancer Res. 66: 9845-9851, 2006 • Hahn MA, Hahn T, Lee DH, Esworthy RS, Kim B, Riggs AD, Chu F-F, and Pfeifer GP.
    [Show full text]
  • Characterization of Cytosolic Glutathione Peroxidase And
    Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism.
    [Show full text]
  • Higher Susceptibility of Cerebral Cortex and Striatum to Sulfite Neurotoxicity
    Biochimica et Biophysica Acta 1862 (2016) 2063–2074 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis Higher susceptibility of cerebral cortex and striatum to sulfite neurotoxicity in sulfite oxidase-deficient rats Mateus Grings a, Alana Pimentel Moura a, Belisa Parmeggiani a, Marcela Moreira Motta a, Rafael Mello Boldrini a, Pauline Maciel August a, Cristiane Matté a,b, Angela T.S. Wyse a,b, Moacir Wajner a,b,c, Guilhian Leipnitz a,b,⁎ a Programa de Pós-Graduação em Ciências Biológicas: Bioquímica, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil b Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos, 2600-Anexo, CEP 90035-003, Porto Alegre, RS, Brazil c Serviço de Genética Médica, Hospital de Clínicas de Porto Alegre, Rua Ramiro Barcelos, 2350, CEP 90035-903, Porto Alegre, RS, Brazil article info abstract Article history: Patients affected by sulfite oxidase (SO) deficiency present severe seizures early in infancy and progressive Received 14 May 2016 neurological damage, as well as tissue accumulation of sulfite, thiosulfate and S-sulfocysteine. Since the Received in revised form 27 July 2016 pathomechanisms involved in the neuropathology of SO deficiency are still poorly established, we evaluated Accepted 9 August 2016 the effects of sulfite on redox homeostasis and bioenergetics in cerebral cortex, striatum, cerebellum and Available online 12 August 2016 hippocampus of rats with chemically induced SO deficiency. The deficiency was induced in 21-day-old rats by adding 200 ppm of tungsten, a molybdenum competitor, in their drinking water for 9 weeks.
    [Show full text]
  • Properties of Lipoamide Dehydrogenase and Thioredoxin Reductase from Escherichia Coti Altered by Site-Directed Mutagenesis“
    Properties of Lipoamide Dehydrogenase and Thioredoxin Reductase from Escherichia coti Altered by Site-Directed Mutagenesis“ CHARLES H. WILLIAMS, JR.,~JNIGEL ALL IS ON,^,^ GEORGE c. RUSSELL! ANDREW J. PRONGAY,~ L. DAVID ARSCOTT,~SHOMPA DATTA,~ LENA SAHLMAN,~~AND JOHN R. GUEST^ Veterans Administration Medical Center and Department of Biological Chemistry University of Michigan Ann Arbor, Michigan 481 05 and dDepartment of Microbiology Shefield University Shefield SIO 2TN United Kingdom Lipoamide dehydrogenase and thioredoxin reductase are members of the pyridine nucleotidedisulfide oxidoreductase family of flavoenzymes, which is distinguished by an oxidation-reduction-active disulfide.’ Other members of the family, glutathione reductase and mercuric reductase, are homologous with lipoamide dehydrogenase in all domains.”5 Thioredoxin reductase is homologous with the others only in its two adenosine binding regions; the remainder of the protein, including its active-site disulfide region, appears to have evolved convergently.6 Catalysis takes place in two half-reactions, as shown in FIGUREI for lipoamide dehydrogenase.’” In the first, dithiol-disulfide interchange effects reduction of the oxidized enzyme (E) to the 2-electron reduced form of the enzyme (EH,); and in the second, the reoxidation of EH, to E, electrons pass very rapidly via the FAD to NAD’. The distinct roles of the two nascent thiols of EH, have been demonstrated.’”” The thiol nearer the amino terminus reacts almost exclusively with iodoacetamide, and it is this thiol that interchanges with the dithiol substrate; the sulfur nearer the carboxyl terminus interacts with the FAD. Similar results are seen with glutathione reductase” and mercuric reductase.” The assignment of roles to the two nascent thiols in ‘This work was supported by the Medical Research Service of the Veterans Administration, by Grant GM21444 from the National Institute of General Medical Sciences (to C.
    [Show full text]
  • Glutathione Peroxidase-2 Protects from Allergen-Induced Airway Inflammation in Mice
    Eur Respir J 2010; 35: 1148–1154 DOI: 10.1183/09031936.00026108 CopyrightßERS Journals Ltd 2010 Glutathione peroxidase-2 protects from allergen-induced airway inflammation in mice A.M. Dittrich*,#,e, H-A. Meyer*,e, M. Krokowski*, D. Quarcoo*, B. Ahrens*, S.M. Kube", M. Witzenrath", R.S. Esworthy+, F-F. Chu+ and E. Hamelmann*,1 ABSTRACT: The aim of the present study was to identify and validate the biological significance AFFILIATIONS of new genes/proteins involved in the development of allergic airway disease in a murine asthma *Dept of Paediatric Pneumology and Immunology, Charite´ Humboldt model. University, Gene microarrays were used to identify genes with at least a two-fold increase in gene "Dept of Internal Medicine/Infectious expression in lungs of two separate mouse strains with high and low allergic susceptibility. Diseases and Respiratory Medicine, Validation of mRNA data was obtained by western blotting and immunohistochemistry, followed Charite´-Universita¨tsmedizin Berlin, Berlin, by functional analysis of one of the identified genes in mice with targeted disruption of specific #Junior Research Group SFB 587, gene expression. Hannover Medical School, Hannover, Expression of two antioxidant enzymes, glutathione peroxidase-2 (GPX2) and glutathione S- 1University Children’s Hospital, Ruhr transferase omega (GSTO) 1-1 was increased in both mouse strains after induction of allergic University, Bochum, Germany. +Dept of Radiation Biology, Beckman airway disease and localised in lung epithelial cells. Mice with targeted disruption of the Gpx-2 Research Institute of City of Hope, gene showed significantly enhanced airway inflammation compared to sensitised and challenged Duarte, CA, USA. wild-type mice.
    [Show full text]