Glutathione Peroxidase 4 and Vitamin E Cooperatively Prevent Hepatocellular Degeneration
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Glutathione Reductase (Ec 1.6.4.2)
Enzymatic Assay of GLUTATHIONE REDUCTASE (EC 1.6.4.2) PRINCIPLE: ß-NADPH + GSSG Glutathione Reductase> ß-NADP + 2 GSH Abbreviations used: ß-NADPH = ß-Nicotinamide Adenine Dinucleotide Phosphate, Reduced Form ß-NADP = ß-Nicotinamide Adenine Dinucleotide Phosphate, Oxidized Form GSSG = Glutathione, Oxidized Form GSH = Glutathione, Reduced Form CONDITIONS: T = 25°C, pH = 7.6, A340nm, Light Path = 1 cm METHOD: Continuous Spectrophotometric Rate Determination REAGENTS: A. 100 mM Potassium Phosphate Buffer with 3.4 mM Ethylenediaminetetraacetic Acid (EDTA), pH 7.6 at 25°C (Prepare 200 ml in deionized water using Potassium Phosphate, Monobasic, Anhydrous, Sigma Prod. No. P-5379 and Ethylenediaminetetraacetic Acid, Dipotassium Salt, Sigma Stock No. ED2P. Adjust to pH 7.6 at 25°C with 1 M KOH.) B. 30 mM Glutathione Substrate Solution (GSSG) (Prepare 5 ml in deionized water using Glutathione, Oxidized Form, Disodium Salt, Sigma Prod. No. G-4626.) C. 0.8 mM ß-Nicotinamide Adenine Dinucleotide Phosphate, Reduced Form Solution (ß-NADPH) (Prepare 5 ml in cold Reagent A using ß-Nicotinamide Adenine Dinucleotide Phosphate, Tetrasodium Salt, Sigma Prod. No. N-1630.) D. 1.0% (w/v) Bovine Serum Albumin (BSA) (Prepare 100 ml in Reagent A using Albumin, Bovine, Sigma Prod. No. A-4503. This solution should be kept cold.) SPGLUT01 Page 1 of 3 Revised: 08/03/95 Enzymatic Assay of GLUTATHIONE REDUCTASE (EC 1.6.4.2) REAGENTS: (continued) E. Glutathione Reductase Enzyme Solution (Immediately before use, prepare a solution containing 0.30 - 0.60 unit/ml of Glutathione Reductase in cold Reagent D.) PROCEDURE: Pipette (in milliliters) the following reagents into suitable cuvettes: Test Blank Deionized Water 0.65 0.65 Reagent A (Buffer) 1.50 1.50 Reagent B (GSSG) 0.10 0.10 Reagent C (ß-NADPH) 0.35 0.35 Reagent D (BSA) 0.30 0.40 Mix by inversion and equilibrate to 25°C. -
Glutathione Reductase Human, Recombinant Expressed in Escherichia Coli
Glutathione Reductase human, recombinant expressed in Escherichia coli Catalog Number G9297 Storage Temperature –20 °C CAS RN 9001-48-3 Precautions and Disclaimer EC 1.8.1.7 (formerly 1.6.4.2) This product is for R&D use only, not for drug, Synonyms: GR, NADPH:oxidized glutathione household, or other uses. Please consult the Material oxidoreductase, glutathione-disulfide reductase Safety Data Sheet for information regarding hazards and safe handling practices. Product Description Glutathione reductase (GR) is an ubiquitous Storage/Stability flavoenzyme involved in protecting cells from stress. The product ships on wet ice and storage at –20 °C is GR catalyzes the reduction of oxidized glutathione recommended. The product is stable at –20 °C for at (GSSG) to glutathione (GSH). It is an essential least 2 years. component of the glutathione redox cycle, which maintains adequate levels of reduced cellular GSH. References GSH serves as an antioxidant, reacting with free 1. Lopez-Mirabal, H.R., and Winther, J.R., Redox radicals and organic peroxides. Glutathione is also an characteristics of the eukaryotic cytosol. Biochim. electron donor for glutathione peroxidases and a Biophys. Acta, 1783, 629-640 (2008). substrate for glutathione S-transferases contributing to 2. Qiao, M., et al., Increased expression of glutathione the detoxification and elimination of toxic electrophilic reductase in macrophages decreases 1,2 metabolites and xenobiotics. artherosclerotic lesion formation on low-density lipoproetin receptor-deficient mice. Arterioscler. Glutathione reductase is a homodimeric enzyme Thromb. Vasc. Biol., 27, 1375-1382 (2007). containing 1 FAD molecule and 1 NADPH binding 3. Worthington, D.J., and Rosemeyer, M.A., 3 domain per subunit. -
In Thyroid Cancer
Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue. -
SUPPLEMENTARY DATA Supplementary Figure 1. The
SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary -
Glutathione Reductase Assay Kit
Glutathione Reductase Assay Kit Item No. 703202 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd · Ann Arbor, MI · USA TABLE OF CONTENTS GENERAL INFORMATION GENERAL INFORMATION 3 Materials Supplied Materials Supplied 4 Safety Data 4 Precautions 5 If You Have Problems Item Number Item Quantity 4 Storage and Stability 703210 GR Assay Buffer (10X) 1 vial 4 Materials Needed but Not Supplied INTRODUCTION 5 Background 703212 GR Sample Buffer (10X) 1 vial 5 About This Assay 703214 GR Glutathione Reductase (control) 1 vial PRE-ASSAY PREPARATION 6 Reagent Preparation 7 Sample Preparation 703216 GR GSSG 1 vial ASSAY PROTOCOL 9 Plate Set Up 703218 GR NADPH 3 vials 11 Performing the Assay 400014 96-Well Solid Plate (Colorimetric Assay) 1 plate ANALYSIS 12 Calculations 13 Performance Characteristics 400012 96-Well Cover Sheet 1 cover RESOURCES 14 Interferences If any of the items listed above are damaged or missing, please contact our 16 Troubleshooting Customer Service department at (800) 364-9897 or (734) 971-3335. We cannot 17 References accept any returns without prior authorization. 18 Plate Template 19 Notes WARNING: THIS PRODUCT IS FOR RESEARCH ONLY - NOT FOR HUMAN OR VETERINARY DIAGNOSTIC OR THERAPEUTIC USE. 19 Warranty and Limitation of Remedy ! GENERAL INFORMATION 3 Safety Data INTRODUCTION This material should be considered hazardous until further information becomes available. Do not ingest, inhale, get in eyes, on skin, or on clothing. Wash Background thoroughly after handling. Before use, the user must review the complete Safety Glutathione (GSH) is a tripeptide widely distributed in both plants and Data Sheet, which has been sent via email to your institution. -
Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components. -
Ferroptosis-Related Flavoproteins: Their Function and Stability
International Journal of Molecular Sciences Review Ferroptosis-Related Flavoproteins: Their Function and Stability R. Martin Vabulas Charité-Universitätsmedizin, Institute of Biochemistry, Charitéplatz 1, 10117 Berlin, Germany; [email protected]; Tel.: +49-30-4505-28176 Abstract: Ferroptosis has been described recently as an iron-dependent cell death driven by peroxida- tion of membrane lipids. It is involved in the pathogenesis of a number of diverse diseases. From the other side, the induction of ferroptosis can be used to kill tumor cells as a novel therapeutic approach. Because of the broad clinical relevance, a comprehensive understanding of the ferroptosis-controlling protein network is necessary. Noteworthy, several proteins from this network are flavoenzymes. This review is an attempt to present the ferroptosis-related flavoproteins in light of their involvement in anti-ferroptotic and pro-ferroptotic roles. When available, the data on the structural stability of mutants and cofactor-free apoenzymes are discussed. The stability of the flavoproteins could be an important component of the cellular death processes. Keywords: flavoproteins; riboflavin; ferroptosis; lipid peroxidation; protein quality control 1. Introduction Human flavoproteome encompasses slightly more than one hundred enzymes that par- ticipate in a number of key metabolic pathways. The chemical versatility of flavoproteins relies on the associated cofactors, flavin mononucleotide (FMN) and flavin adenine dinu- cleotide (FAD). In humans, flavin cofactors are biosynthesized from a precursor riboflavin that has to be supplied with food. To underline its nutritional essentiality, riboflavin is called vitamin B2. In compliance with manifold cellular demands, flavoproteins have been accommo- Citation: Vabulas, R.M. dated to operate at different subcellular locations [1]. -
MK+10-025-Mouse-Model-For-Inflammatory-Bowel-Diseases
Intellectual Property (Non-confidential) NATIONAL MEDICAL CENTER AND BECKMAN RESEARCH INSTITUTE Mouse Model for Inflammatory Bowel Diseases DESCRIPTION This is a transgenic double-knockout (DKO) mouse (Gpx1 and Gpx2). Both GPX1 and GPX2 belong to a selenium-dependent glutathione peroxidase (GPXs) family, which are enzymes that are efficient in the reduction of hydroperoxides. Gpx1 is expressed ubiquitously, and Gpx2 is highly expressed in the epithelium of the gastrointestinal (GI) tract. Gpx1/2-DKO mice have early-onset spontaneous ileocolitis beginning around weaning. These mice are an excellent model for human inflammatory bowel diseases (IBD) because they share similar disease etiology, which includes that the disease severity is highly influenced by genetic background, gut microflora, diet, and higher cancer risk in the distal GI tract. Unlike most mouse IBD models which have disrupted genes playing an important role in regulation of adaptive immunity, these Gpx1/2-DKO mice have intact immunity- which resembles human IBD. KEY ASPECTS • Homozygous disruption of both the endogenous Gpx1 and Gpx2 genes. • Disease characteristics include ileitis, colitis, hypothermia, growth retardation, runting, perianal ulceration, diarrhea, wasting syndrome,, IBD histopathology, tumors/cancer in the ileum or colon PUBLISHED DATA • Esworthy RS, Binder SW, Doroshow JH, and Chu FF, Microflora trigger colitis in mice deficient in selenium-dependent glutathione peroxidase and induce Gpx2 gene expression. Biol. Chem. 384: 597- 607, 2003 • Lee D-H, Esworthy RS, Chu, C, Pfeifer GP, and Chu, F-F. Mutation accumulation in the intestine and colon of mice deficient in two intracellular glutathione peroxidases. Cancer Res. 66: 9845-9851, 2006 • Hahn MA, Hahn T, Lee DH, Esworthy RS, Kim B, Riggs AD, Chu F-F, and Pfeifer GP. -
Characterization of Cytosolic Glutathione Peroxidase And
Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism. -
Higher Susceptibility of Cerebral Cortex and Striatum to Sulfite Neurotoxicity
Biochimica et Biophysica Acta 1862 (2016) 2063–2074 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis Higher susceptibility of cerebral cortex and striatum to sulfite neurotoxicity in sulfite oxidase-deficient rats Mateus Grings a, Alana Pimentel Moura a, Belisa Parmeggiani a, Marcela Moreira Motta a, Rafael Mello Boldrini a, Pauline Maciel August a, Cristiane Matté a,b, Angela T.S. Wyse a,b, Moacir Wajner a,b,c, Guilhian Leipnitz a,b,⁎ a Programa de Pós-Graduação em Ciências Biológicas: Bioquímica, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil b Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos, 2600-Anexo, CEP 90035-003, Porto Alegre, RS, Brazil c Serviço de Genética Médica, Hospital de Clínicas de Porto Alegre, Rua Ramiro Barcelos, 2350, CEP 90035-903, Porto Alegre, RS, Brazil article info abstract Article history: Patients affected by sulfite oxidase (SO) deficiency present severe seizures early in infancy and progressive Received 14 May 2016 neurological damage, as well as tissue accumulation of sulfite, thiosulfate and S-sulfocysteine. Since the Received in revised form 27 July 2016 pathomechanisms involved in the neuropathology of SO deficiency are still poorly established, we evaluated Accepted 9 August 2016 the effects of sulfite on redox homeostasis and bioenergetics in cerebral cortex, striatum, cerebellum and Available online 12 August 2016 hippocampus of rats with chemically induced SO deficiency. The deficiency was induced in 21-day-old rats by adding 200 ppm of tungsten, a molybdenum competitor, in their drinking water for 9 weeks. -
Properties of Lipoamide Dehydrogenase and Thioredoxin Reductase from Escherichia Coti Altered by Site-Directed Mutagenesis“
Properties of Lipoamide Dehydrogenase and Thioredoxin Reductase from Escherichia coti Altered by Site-Directed Mutagenesis“ CHARLES H. WILLIAMS, JR.,~JNIGEL ALL IS ON,^,^ GEORGE c. RUSSELL! ANDREW J. PRONGAY,~ L. DAVID ARSCOTT,~SHOMPA DATTA,~ LENA SAHLMAN,~~AND JOHN R. GUEST^ Veterans Administration Medical Center and Department of Biological Chemistry University of Michigan Ann Arbor, Michigan 481 05 and dDepartment of Microbiology Shefield University Shefield SIO 2TN United Kingdom Lipoamide dehydrogenase and thioredoxin reductase are members of the pyridine nucleotidedisulfide oxidoreductase family of flavoenzymes, which is distinguished by an oxidation-reduction-active disulfide.’ Other members of the family, glutathione reductase and mercuric reductase, are homologous with lipoamide dehydrogenase in all domains.”5 Thioredoxin reductase is homologous with the others only in its two adenosine binding regions; the remainder of the protein, including its active-site disulfide region, appears to have evolved convergently.6 Catalysis takes place in two half-reactions, as shown in FIGUREI for lipoamide dehydrogenase.’” In the first, dithiol-disulfide interchange effects reduction of the oxidized enzyme (E) to the 2-electron reduced form of the enzyme (EH,); and in the second, the reoxidation of EH, to E, electrons pass very rapidly via the FAD to NAD’. The distinct roles of the two nascent thiols of EH, have been demonstrated.’”” The thiol nearer the amino terminus reacts almost exclusively with iodoacetamide, and it is this thiol that interchanges with the dithiol substrate; the sulfur nearer the carboxyl terminus interacts with the FAD. Similar results are seen with glutathione reductase” and mercuric reductase.” The assignment of roles to the two nascent thiols in ‘This work was supported by the Medical Research Service of the Veterans Administration, by Grant GM21444 from the National Institute of General Medical Sciences (to C. -
Glutathione Peroxidase-2 Protects from Allergen-Induced Airway Inflammation in Mice
Eur Respir J 2010; 35: 1148–1154 DOI: 10.1183/09031936.00026108 CopyrightßERS Journals Ltd 2010 Glutathione peroxidase-2 protects from allergen-induced airway inflammation in mice A.M. Dittrich*,#,e, H-A. Meyer*,e, M. Krokowski*, D. Quarcoo*, B. Ahrens*, S.M. Kube", M. Witzenrath", R.S. Esworthy+, F-F. Chu+ and E. Hamelmann*,1 ABSTRACT: The aim of the present study was to identify and validate the biological significance AFFILIATIONS of new genes/proteins involved in the development of allergic airway disease in a murine asthma *Dept of Paediatric Pneumology and Immunology, Charite´ Humboldt model. University, Gene microarrays were used to identify genes with at least a two-fold increase in gene "Dept of Internal Medicine/Infectious expression in lungs of two separate mouse strains with high and low allergic susceptibility. Diseases and Respiratory Medicine, Validation of mRNA data was obtained by western blotting and immunohistochemistry, followed Charite´-Universita¨tsmedizin Berlin, Berlin, by functional analysis of one of the identified genes in mice with targeted disruption of specific #Junior Research Group SFB 587, gene expression. Hannover Medical School, Hannover, Expression of two antioxidant enzymes, glutathione peroxidase-2 (GPX2) and glutathione S- 1University Children’s Hospital, Ruhr transferase omega (GSTO) 1-1 was increased in both mouse strains after induction of allergic University, Bochum, Germany. +Dept of Radiation Biology, Beckman airway disease and localised in lung epithelial cells. Mice with targeted disruption of the Gpx-2 Research Institute of City of Hope, gene showed significantly enhanced airway inflammation compared to sensitised and challenged Duarte, CA, USA. wild-type mice.