DOCSLIB.ORG

Characterization of Cytosolic Glutathione Peroxidase And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Cytosolic Glutathione Peroxidase And Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism. Keywords: Glutathione peroxidase (GPxs) is the largest and the most studied selenoprotein family. Cytosolic glu- Selenium tathione peroxidase (cGPx, GPx1) and phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) Sodium selenite Selenocysteine are widely distributed throughout tissues, and play a pivotal role in regulating the oxidative status in the Glutathione peroxidase cell. In this study we have cloned GPx1 and GPx4 genes in rainbow trout (Oncorhynchus mykiss). The con- Salmonids stitutive mRNA expression of these GPx genes was examined in 18 trout tissues and their responsiveness RTL cell line to Se availability was analysed using a rainbow trout liver cell line (RTL). An inorganic (sodium selenite, Na2SeO3) and organic (selenocysteine, Cys-Se-Se-Cys) selenocompound have been used as Se sources. GPx1 activity was also tested to verify the impact of transcript changes on the enzymatic function of these molecules. To understand if the results obtained from the transcript expression analysis were due to Se bioavailability or generation of ROS, the cytoxicity of the two selenocompounds was tested by measuring the impact of Se on cell membrane integrity. Lastly, Se availability was quantified by mass spectropho- tometry to determine the amount of Se in the cell culture media, the Se background due to the foetal calf serum supplement and the contribution from the two selenocompounds used in the treatments. Three isoforms of genes for both GPx1 (GPx1a, 1b1 and 1b2) and GPx4 (GPx4a1, a2 and b) have been identified. The discovery of a third gene encoding for GPx1 and GPx4 hints that salmonids may have the biggest selenoproteome amongst all vertebrates. Transcripts of GPx4 genes were more highly expressed in most tissues examined in vivo (except blood, head kidney and spleen), whereas those of the GPx1 genes were more responsive to selenium exposure in vitro, especially to the organic form. Interestingly, GPx1a was the most sensitive to selenium availability in non stressful conditions, whereas GPx1b1 and GPx1b2 were highly induced by exposure to selenium levels that had some toxic effects on the cells. Although the different concentrations tested of the two selenocompounds modulate GPx1 transcript expression to various degrees, no significant change of GPx1 enzymatic activity was detectable. Our results lead us to conclude that trout GPx1 transcripts expression level may represent a sensitive biomarker for selenium intake, helping to evaluate if selenium concentration and chemical speciation impact on cell homeostasis. © 2012 Elsevier B.V. All rights reserved. 1. Introduction Selenium (Se) is an essential trace element, required as an ∗ Corresponding author at: Scottish Fish Immunology Research Centre, Institute integral part of diverse Se-containing proteins, called seleno- of Biological and Environmental Sciences (IBES), University of Aberdeen, Tillydrone proteins (Burk and Hill, 1993). Through its incorporation into Avenue, Aberdeen, AB24 2TZ, United Kingdom. Tel.: +44 1224 272857; selenoproteins as the selenocysteine (SeCys) amino acid, selenium fax: +44 1224 272872. E-mail address: [email protected] (C.J. Secombes). exerts its biological effects primarily by regulating the antioxidant 0166-445X/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aquatox.2012.12.020 98 D. Pacitti et al. / Aquatic Toxicology 130–131 (2013) 97–111 system and redox enzyme activities within the cell (McKenzie et al., non-specifically into proteins instead of methionine, leading to sig- 2002). Moreover, this trace element is involved in gene transcrip- nificant alterations in protein structure and consequently protein tion and cell signalling cascades, thyroid hormone metabolism, function (Schrauzer, 2000). immune responses and reproduction (Rayman, 2000; Hefnawy and SeCys is the most relevant selenocompound, as the naturally Tórtora-Pérez, 2010). However, Se toxicity can be reached by lev- occurring amino acid (the 21st) that provides the catalytic site for els marginally above those which are required. Among the essential the enzymatic selenoproteins (Stadtman, 1996). SeCys is character- trace elements, Se presents the narrowest range between essential- istically different from the remaining amino acids as it is encoded ity and toxicity, and for this reason it is often difficult to establish by one of the three stop codons (UGA) and is inserted into the [SeCys] which concentrations are beneficial and which become detrimen- selenoproteins by the tRNA , which has specific features that tal towards an organism’s health (NRC, 1980; Foster and Sumar, distinguish it from all other tRNAs (Bock et al., 1991). The UGA 1997). codon is made to encode SeCys by the presence of a cis-acting stem- Diet and water are the two sources of Se. In the aquatic envi- loop structure, designated the SeCys insertion sequence (SECIS) ronment, Se can be absorbed through the gills, gut or epidermis; element, present in the 3 un-translated regions (3 -UTRs) in the however diet is considered the primary source of Se for animals mRNA (Walczak et al., 1996). In addition, other factors are required and the intestine the principal route of assimilation (Dallinger for the incorporation of SeCys into the mature protein, namely et al., 1987; Hamilton, 2004; Janz, 2011). The immediate bioavail- SECIS-binding protein 2 (SBP2) (Copeland et al., 2000), and SeCys- ability of Se depends on its chemical form, which determines the specific elongation factor (EFsec, also called mSelB) (Fagegaltier metabolic and toxic potential (Jonnalagadda and Prasada Rao, 1993; et al., 2000). SECIS elements are present in the 3 un-translated Jackson, 1997; Finley, 2006). Se exists in the environment and in regions (3 -UTRs) of all eukaryotic selenoprotein genes (Berry et al., biological systems as both inorganic and organic forms. The inor- 1991). The general structure of the SECIS element includes two 2− 2− ganic salts, selenite (SeO3 ) and selenate (SeO4 ), contain Se in helices separated by an internal loop, a SECIS core structure located oxidized forms (Se(IV) and Se(VI) respectively), whereas organic at the base of helix 2 and one or two apical loops; its configuration forms contain Se in the reduced state (selenide: Se(−II)) (Thomas can be selenoprotein- and species-specific. The presence of a SECIS et al., 1990; Birringer et al., 2002). Generally, selenocysteine (SeCys) dictates any in-frame UGA codon within the coding region to serve and selenomethionine (SeMet) are the most abundant selenocom- as SeCys when a minimal spacing requirement between UGA and pounds present in the diet (Suzuki, 2005; Dumont et al., 2006). The the SECIS element (51 to 111 nucleotides) is met (Low and Berry, diverse speciation of selenium suggests that the cellular uptake 1996; Fletcher et al., 2001). A set of selenoproteins in an organism of this trace element is likely to occur via multiple membrane is known as the selenoproteome. To date 25 selenoprotein genes transporters (Misra et al., 2012b). Previous studies, focused on the have been indentified in humans (Kryukov et al., 2003). Recent mechanisms of intestinal absorption of selenocompounds in mam- studies on the vertebrate selenoproteome showed that bony fish, 2− mals, suggest that SeO3 absorption occurs by simple diffusion, with 38 selenoprotein genes identified in zebrafish, have a larger 2− whilst SeO4 may be transported by a common transport mech- set of selenoproteins than humans and all terrestrial vertebrates anism with sulphate (Arduser et al., 1985; Wolffram et al., 1986). (Mariotti et al., 2012). SeMet appears to be absorbed by an active transport system shared Glutathione peroxidase (GPxs) is the largest and the most stud- with methionine (McConnell and Cho, 1965; McConnell and
Load more

Recommended publications
  • The Role of Glutathionperoxidase 4 (GPX4) in Hematopoiesis and Leukemia
    The role of glutathionperoxidase 4 (GPX4) in hematopoiesis and leukemia von Kira Célénie Stahnke Inaugral- Dissertation zur Erlangung der Doktorwürde der TierärztliChen Fakultät der Ludwig-Maximilians-Universität MünChen The role of glutathionperoxidase 4 (GPX4) in hematopoiesis and leukemia von Kira Célénie Stahnke aus Dortmund München 2016 Aus dem VeterinärwissensChaftliChen Department der TierärztliChen Fakultät der Ludwig-Maximilians-Universität München Lehrstuhl für Molekulare Tierzucht und Biotechnologie Arbeit angefertigt unter der Leitung von Univ.-Prof. Dr. Eckhard Wolf Angefertigt am Institut für Experimentelle TumorforsChung Universitätsklinikum Ulm Mentor: Prof. Dr. Christian Buske GedruCkt mit Genehmigung der TierärztliChen Fakultät der Ludwig-Maximilians-Universität München Dekan: Univ.-Prof. Dr. JoaChim Braun Berichterstatter: Univ.-Prof. Dr. Eckard Wolf Korreferent/en: Priv.-Doz. Dr. Bianka Schulz Tag der Promotion: 06.02.2016 Table of contents List of Abbreviations..............................................................................2 1 Introduction ........................................................................................6 1.1 ROS and oxidative stress in physiology and pathology..................................................... 6 1.1.1 SourCes of Reactive Oxygen SpeCies..................................................................................................6 1.1.2 PhysiologiCal role of ROS........................................................................................................................8
    [Show full text]
  • (ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
    Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process.
    [Show full text]
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • A Machine Learning Tool for Predicting Protein Function Anna
    The Woolf Classifier Building Pipeline: A Machine Learning Tool for Predicting Protein Function Anna Farrell-Sherman Submitted in Partial Fulfillment of the Prerequisite for Honors in Computer Science under the advisement of Eni Mustafaraj and Vanja Klepac-Ceraj May 2019 © 2019 Anna Farrell-Sherman Abstract Proteins are the machinery that allow cells to grow, reproduce, communicate, and create multicellular organisms. For all of their importance, scientists still have a hard time understanding the function of a protein based on its sequence alone. For my honors thesis in computer science, I created a machine learning tool that can predict the function of a protein based solely on its amino acid sequence. My tool gives scientists a structure in which to build a � Nearest Neighbor or random forest classifier to distinguish between proteins that can and cannot perform a given function. Using default Min-Max scaling, and the Matthews Correlation Coefficient for accuracy assessment, the Woolf Pipeline is built with simplified choices to guide users to success. i Acknowledgments There are so many people who made this thesis possible. First, thank you to my wonderful advisors, Eni and Vanja, who never gave up on me, and always pushed me to try my hardest. Thank you also to the other members of my committee, Sohie Lee, Shikha Singh, and Rosanna Hertz for supporting me through this process. To Kevin, Sophie R, Sophie E, and my sister Phoebe, thank you for reading my drafts, and advising me when the going got tough. To all my wonderful friends, who were always there with encouraging words, warm hugs, and many congratulations, I cannot thank you enough.
    [Show full text]
  • Illness-Induced Changes in Thyroid Hormone Metabolism: Focus on the Tissue Level
    r e V i e W illness-induced changes in thyroid hormone metabolism: focus on the tissue level J. Kwakkel*, E. Fliers, A. Boelen Department of Endocrinology & Metabolism, Academic Medical Center, University of Amsterdam, the Netherlands, *corresponding author: tel.: +31 (0)20-566 67 01, fax: +31 (0)20-691 76 82, e-mail: [email protected] a b s t r a C t during illness changes in thyroid hormone metabolism ring and the outer (tyrosyl) ring of T4 can be deiodinated, occur, collectively known as the non-thyroidal illness ultimately leading to the formation of 3,3’-di-iodothyronine syndrome (NTIS). NTIS is characterised by low serum (T2) (figure 1). thyroid hormone levels without the expected rise in serum thyroid-stimulating hormone, indicating a major change in thyroid hormone feedback regulation. recent studies n o n - t H yroidal illness syndro M e have made clear that during NTIS differential changes in thyroid hormone metabolism occur in various tissues, the During illness many aspects of thyroid hormone net effect of which may be either activation or inhibition of metabolism change, collectively known as the thyroid hormone action. in this review we discuss systemic non-thyroidal illness syndrome (NTIS). The hallmark of and local changes in thyroid hormone metabolism during NTIS is decreased serum thyroid hormone levels without illness, highlighting their physiological implications in an increase in TSH and TRH expression, indicating terms of disease course. the absence of negative feedback regulation. This may represent a useful adaptation of the body to counteract excessive catabolism observed during illness and can be K e y W o r d s viewed as a part of the acute phase response.4 However, especially during prolonged critical illness in the ICU Deiodinase, inflammation, non-thyroidal illness syndrome, setting NTIS may be maladaptative.5 thyroid hormone figure 1.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • 03-232 Biochemistry Exam II – 2012 -Key Name:______Instructions: This Exam Consists of 100 Points on 6 Pages
    03-232 Biochemistry Exam II – 2012 -Key Name:________________________ Instructions: This exam consists of 100 points on 6 pages. Please use the space provided to answer the question or the back of the preceding page. In questions with choices, all your answers will be graded and you will receive the best grade. Allot 1 min/2 points. A B 1. (10 pts) One protein (protein A) binds naphthalene (ligand) by sandwiching it between two tryptophan residues. Another protein Trp L Trp Tyr L Tyr (protein B) also binds naphthalene by sandwiching it between two OH tyrosine residues, however the binding is weaker. The structure of the H protein-ligand complex is shown on the right (side view), the structures N of tryptophan, naphthalene (ligand), and tyrosine are shown as well. i) What are the principal energetic factor(s) that are responsible for binding of naphthalene to these proteins? (4 pts) Tryptophan(Trp) naphthalene (L) Tyrosine (Tyr) ii) Why does the tyrosine containing protein show weaker binding? (4 pts) ii) Which kinetic rate constant, the off-rate (kOFF) or the on-rate (kON), would be most different between the two proteins? In what way would it differ? Why? (2 pts) i) van der waals (H) and the hydrophobic effect (S) (3 pts for one, 4 points for two). ii) van der waals is reduce because the contact between the tyrosine and the ligand will be smaller. There will be a smaller hydrophobic effect as well because the non-polar surface area of tyrosine is smaller than tryptophan. Therefore in protein B, a smaller number of ordered water molecules will be released.
    [Show full text]
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
    [Show full text]
  • Type 3 Lodothyronine Deiodinase: Cloning, in Vitro Expression, and Functional Analysis of the Placental Selenoenzyme
    Type 3 lodothyronine deiodinase: cloning, in vitro expression, and functional analysis of the placental selenoenzyme. D Salvatore, … , D L St Germain, P R Larsen J Clin Invest. 1995;96(5):2421-2430. https://doi.org/10.1172/JCI118299. Research Article Type 3 iodothyronine deiodinase (D3) catalyzes the conversion of T4 and T3 to inactive metabolites. It is highly expressed in placenta and thus can regulate circulating fetal thyroid hormone concentrations throughout gestation. We have cloned and expressed a 2.1-kb human placental D3 cDNA which encodes a 32-kD protein with a Km of 1.2 nM for 5 deiodination of T3 and 340 nM for 5' deiodination of reverse T3. The reaction requires DTT and is not inhibited by 6n- propylthiouracil. We quantitated transiently expressed D3 by specifically labeling the protein with bromoacetyl [125I]T3. The Kcat/Km ratio for 5 deiodination of T3 was over 1,000-fold that for 5' deiodination of reverse T3. Human D3 is a selenoenzyme as evidenced by (a) the presence of an in frame UGA codon at position 144, (b) the synthesis of a 32-kD 75Se-labeled protein in D3 cDNA transfected cells, and (c) the presence of a selenocysteine insertion sequence element in the 3' untranslated region of the mRNA which is required for its expression. The D3 selenocysteine insertion sequence element is more potent than that in the type 1 deiodinase or glutathione peroxidase gene, suggesting a high priority for selenocysteine incorporation into this enzyme. The conservation of this enzyme from Xenopus laevis tadpoles to humans implies an essential role for regulation of thyroid hormone inactivation during embryological development.
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • Micrornas As New Regulators of Neutrophil Extracellular Trap Formation
    International Journal of Molecular Sciences Review MicroRNAs as New Regulators of Neutrophil Extracellular Trap Formation Sonia Águila † , Ascensión M. de los Reyes-García †, María P. Fernández-Pérez, Laura Reguilón-Gallego, Laura Zapata-Martínez, Inmaculada Ruiz-Lorente, Vicente Vicente , Rocío González-Conejero *,‡ and Constantino Martínez *,‡ Department of Hematology and Medical Oncology, Morales Meseguer University Hospital, Centro Regional de Hemodonación, Universidad de Murcia, IMIB, C/Ronda de Garay S/N, 30003 Murcia, Spain; [email protected] (S.Á.); [email protected] (A.M.d.l.R.-G.); [email protected] (M.P.F.-P.); [email protected] (L.R.-G.); [email protected] (L.Z.-M.); [email protected] (I.R.-L.); [email protected] (V.V.) * Correspondence: [email protected] (R.G.-C.); [email protected] (C.M.); Tel.: +34-968341990 (R.G.-C. & C.M.); Fax: +34-968261914 (R.G.-C. & C.M.) † These authors contributed equally to this work. ‡ These authors shared senior authorship. Abstract: Neutrophil extracellular traps (NETs) are formed after neutrophils expelled their chromatin content in order to primarily capture and eliminate pathogens. However, given their characteristics due in part to DNA and different granular proteins, NETs may induce a procoagulant response linking inflammation and thrombosis. Unraveling NET formation molecular mechanisms as well Citation: Águila, S.; de los as the intracellular elements that regulate them is relevant not only for basic knowledge but also Reyes-García, A.M.; Fernández-Pérez, to design diagnostic and therapeutic tools that may prevent their deleterious effects observed in M.P.; Reguilón-Gallego, L.; several inflammatory pathologies (e.g., cardiovascular and autoimmune diseases, cancer).
    [Show full text]
  • Discovery of Oxidative Enzymes for Food Engineering. Tyrosinase and Sulfhydryl Oxi- Dase
    Dissertation VTT PUBLICATIONS 763 1,0 0,5 Activity 0,0 2 4 6 8 10 pH Greta Faccio Discovery of oxidative enzymes for food engineering Tyrosinase and sulfhydryl oxidase VTT PUBLICATIONS 763 Discovery of oxidative enzymes for food engineering Tyrosinase and sulfhydryl oxidase Greta Faccio Faculty of Biological and Environmental Sciences Department of Biosciences – Division of Genetics ACADEMIC DISSERTATION University of Helsinki Helsinki, Finland To be presented for public examination with the permission of the Faculty of Biological and Environmental Sciences of the University of Helsinki in Auditorium XII at the University of Helsinki, Main Building, Fabianinkatu 33, on the 31st of May 2011 at 12 o’clock noon. ISBN 978-951-38-7736-1 (soft back ed.) ISSN 1235-0621 (soft back ed.) ISBN 978-951-38-7737-8 (URL: http://www.vtt.fi/publications/index.jsp) ISSN 1455-0849 (URL: http://www.vtt.fi/publications/index.jsp) Copyright © VTT 2011 JULKAISIJA – UTGIVARE – PUBLISHER VTT, Vuorimiehentie 5, PL 1000, 02044 VTT puh. vaihde 020 722 111, faksi 020 722 4374 VTT, Bergsmansvägen 5, PB 1000, 02044 VTT tel. växel 020 722 111, fax 020 722 4374 VTT Technical Research Centre of Finland, Vuorimiehentie 5, P.O. Box 1000, FI-02044 VTT, Finland phone internat. +358 20 722 111, fax + 358 20 722 4374 Edita Prima Oy, Helsinki 2011 2 Greta Faccio. Discovery of oxidative enzymes for food engineering. Tyrosinase and sulfhydryl oxi- dase. Espoo 2011. VTT Publications 763. 101 p. + app. 67 p. Keywords genome mining, heterologous expression, Trichoderma reesei, Aspergillus oryzae, sulfhydryl oxidase, tyrosinase, catechol oxidase, wheat dough, ascorbic acid Abstract Enzymes offer many advantages in industrial processes, such as high specificity, mild treatment conditions and low energy requirements.
    [Show full text]