SUPPLEMENTARY DATA Supplementary Figure 1. The

Home , Eosinophil peroxidase, GPX2 (gene), GPX5, GPX6, GPX7, GPX8

SUPPLEMENTARY DATA

Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group).

Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group).

Supplementary Table 1. Primers used in qPCR

Gene Name Primer Sequences Product Size (bp)

Sirt1 F: tgccatcatgaagccagaga 241

(NM_001159589) R: aacatcgcagtctccaagga

NOX4 F: tgtgcctttattgtgcggag 172

(NM_001285833.1) R: gctgatacactggggcaatg

Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence

Antibody Company Cat. No Isotype Dilution

Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA

Supplementary Table 3. miRNA differential expression profiles from mice isolated TG samples transfected with Ad-Sirt1 versus TG samples transfected with Ad-GFP

miRNA Fold Change P value mmu-miR-5129-5p 4.58↑ 0.027 mmu-miR-1931 2.63↑ 0.030 mmu-miR-3470a 2.53↑ 0.0022 mmu-miR-182-5p 2.27↑ 0.00018 mmu-miR-3061-5p 2.15↑ 0.0097 mmu-miR-1981-5p 2.12↑ 0.010 mmu-miR-1912-5p 2.08↑ 0.0019 mmu-miR-883b-3p 2.01↑ 0.00067 mmu-miR-1a-3p 1.98↑ 0.0024 mmu-let-7i-5p 1.88↑ 0.021 mmu-miR-3068-3p 1.86↑ 0.0094 mmu-miR-28b 1.84↑ 0.0120 mmu-miR-18a-3p 1.79↑ 0.023 mmu-miR-489-5p 1.79↑ 0.024 mmu-miR-3968 1.78↑ 0.024 mmu-miR-345-5p 1.76↑ 0.010 mmu-miR-3102-5p 1.72↑ 0.020 mmu-miR-346-5p 1.68↑ 0.044 mmu-miR-145a-3p 1.64↑ 0.0081 mmu-miR-216a-5p 1.64↑ 0.018 mmu-miR-25-5p 1.63↑ 0.0047 mmu-miR-3077-5p 1.63↑ 0.00029 mmu-miR-125b-2-3p 1.59↑ 0.042 mmu-miR-3075-5p 1.56↑ 0.039 mmu-miR-5130 1.54↑ 0.0057 mmu-miR-451a 1.53↑ 0.014 mmu-miR-19a-3p 1.52↑ 0.049 mmu-miR-3090-5p 1.50↑ 0.0026 mmu-miR-467g 0.50↓ 0.017 mmu-miR-770-5p 0.46↓ 0.0083 mmu-miR-5127 0.45↓ 0.011 mmu-miR-3472 0.40↓ 0.028 mmu-miR-5615-5p 0.482↓ 0.016 mmu-let-7i-3p 0.442↓ 0.0046

Supplementary Table 4. Genes down-regulated in diabetic TG sensory neurons relative to normal as detected by PCR array

Gene description Symbol Fold regulation P Antioxidant Glutathione Peroxidases (Gpx) Glutathione peroxidase 2 Gpx2 –1.82 0.0054 Glutathione peroxidase 5 Gpx5 –6.78 0.0003 Glutathione peroxidase 6 Gpx6 –4.14 0.0014 Glutathione peroxidase 7 Gpx7 –4.29 0.0001 Glutathione peroxidase 8 Gpx8 –4.59 0.0013 Peroxiredoxins (TPx) Peroxiredoxin 1 Prdx1 –2.55 0.0020 Superoxide dismutase (SOD) Superoxide dismutase 1, soluble SOD1 –4.04 0.0001 Superoxide dismutase 2, mitochondrial SOD2 –1.64 0.0121 Superoxide dismutase 3, extracellular SOD3 –2.17 0.0126 Other Peroxidases Lactoperoxidase Lpo –5.48 0.0001 Prostaglandin-endoperoxide synthase 1 Ptgs1 –3.90 0.0008 Prostaglandin-endoperoxide synthase 2 Ptgs2 –4.79 0.0002 Recombination activating gene 2 Rag2 –3.94 0.0002 ROS Metabolism Superoxide Metabolism NADPH oxidase activator 1 Noxa1 –6.98 0.0015 NADPH oxidase organizer 1 Noxo1 –1.63 0.0349 RecQ protein-like 4 Recql4 –3.38 0.0002 Other genes involved in ROS Metabolism Interleukin 19 Il19 –4.55 0.0001 Interleukin 22 Il22 –5.39 0.0001 Oxidative stress responsive genes Dual oxidase 1 Duox1 –5.28 1.80E-05 Eosinophil peroxidase Epx –2.12 4.10E-05 Myeloperoxidase Mpo –2.07 0.0029

Membrane protein, palmitoylated 4 (MAGUK p55 Mpp4 –2.15 0.0005 subfamily member 4)

Uncoupling protein 3 (mitochondrial, proton carrier) Ucp3 –2.79 0.0008 Oxygen transporters Xin actin-binding repeat containing 1 Xirp1 –8.38 0.0001

Supplementary Table 5. Genes up-regulated in diabetic TG sensory neurons relative to normal as detected by PCR array

Gene description Symbol Fold regulation P Antioxidant Peroxidases Glutathione reductase Gsr 1.76 0.0134 Catalase Cat 3.02 0.0006 Peroxiredoxin 6, pseudogene 1 Prdx6-ps1 1.48 0.0019 ROS Metabolism Superoxide Metabolism NADPH oxidase 4 Nox4 10.11 0.0004 Protein phosphatase 1, regulatory (inhibitor) subunit Ppp1r15b 3.98 0.0001 15b