DOCSLIB.ORG

SUPPLEMENTARY DATA Supplementary Figure 1. The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SUPPLEMENTARY DATA Supplementary Figure 1. The SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 3. miRNA differential expression profiles from mice isolated TG samples transfected with Ad-Sirt1 versus TG samples transfected with Ad-GFP miRNA Fold Change P value mmu-miR-5129-5p 4.58↑ 0.027 mmu-miR-1931 2.63↑ 0.030 mmu-miR-3470a 2.53↑ 0.0022 mmu-miR-182-5p 2.27↑ 0.00018 mmu-miR-3061-5p 2.15↑ 0.0097 mmu-miR-1981-5p 2.12↑ 0.010 mmu-miR-1912-5p 2.08↑ 0.0019 mmu-miR-883b-3p 2.01↑ 0.00067 mmu-miR-1a-3p 1.98↑ 0.0024 mmu-let-7i-5p 1.88↑ 0.021 mmu-miR-3068-3p 1.86↑ 0.0094 mmu-miR-28b 1.84↑ 0.0120 mmu-miR-18a-3p 1.79↑ 0.023 mmu-miR-489-5p 1.79↑ 0.024 mmu-miR-3968 1.78↑ 0.024 mmu-miR-345-5p 1.76↑ 0.010 mmu-miR-3102-5p 1.72↑ 0.020 mmu-miR-346-5p 1.68↑ 0.044 mmu-miR-145a-3p 1.64↑ 0.0081 mmu-miR-216a-5p 1.64↑ 0.018 mmu-miR-25-5p 1.63↑ 0.0047 mmu-miR-3077-5p 1.63↑ 0.00029 mmu-miR-125b-2-3p 1.59↑ 0.042 mmu-miR-3075-5p 1.56↑ 0.039 mmu-miR-5130 1.54↑ 0.0057 mmu-miR-451a 1.53↑ 0.014 mmu-miR-19a-3p 1.52↑ 0.049 mmu-miR-3090-5p 1.50↑ 0.0026 mmu-miR-467g 0.50↓ 0.017 mmu-miR-770-5p 0.46↓ 0.0083 mmu-miR-5127 0.45↓ 0.011 mmu-miR-3472 0.40↓ 0.028 mmu-miR-5615-5p 0.482↓ 0.016 mmu-let-7i-3p 0.442↓ 0.0046 ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 4. Genes down-regulated in diabetic TG sensory neurons relative to normal as detected by PCR array Gene description Symbol Fold regulation P Antioxidant Glutathione Peroxidases (Gpx) Glutathione peroxidase 2 Gpx2 –1.82 0.0054 Glutathione peroxidase 5 Gpx5 –6.78 0.0003 Glutathione peroxidase 6 Gpx6 –4.14 0.0014 Glutathione peroxidase 7 Gpx7 –4.29 0.0001 Glutathione peroxidase 8 Gpx8 –4.59 0.0013 Peroxiredoxins (TPx) Peroxiredoxin 1 Prdx1 –2.55 0.0020 Superoxide dismutase (SOD) Superoxide dismutase 1, soluble SOD1 –4.04 0.0001 Superoxide dismutase 2, mitochondrial SOD2 –1.64 0.0121 Superoxide dismutase 3, extracellular SOD3 –2.17 0.0126 Other Peroxidases Lactoperoxidase Lpo –5.48 0.0001 Prostaglandin-endoperoxide synthase 1 Ptgs1 –3.90 0.0008 Prostaglandin-endoperoxide synthase 2 Ptgs2 –4.79 0.0002 Recombination activating gene 2 Rag2 –3.94 0.0002 ROS Metabolism Superoxide Metabolism NADPH oxidase activator 1 Noxa1 –6.98 0.0015 NADPH oxidase organizer 1 Noxo1 –1.63 0.0349 RecQ protein-like 4 Recql4 –3.38 0.0002 Other genes involved in ROS Metabolism Interleukin 19 Il19 –4.55 0.0001 Interleukin 22 Il22 –5.39 0.0001 Oxidative stress responsive genes Dual oxidase 1 Duox1 –5.28 1.80E-05 Eosinophil peroxidase Epx –2.12 4.10E-05 Myeloperoxidase Mpo –2.07 0.0029 Membrane protein, palmitoylated 4 (MAGUK p55 Mpp4 –2.15 0.0005 subfamily member 4) Uncoupling protein 3 (mitochondrial, proton carrier) Ucp3 –2.79 0.0008 Oxygen transporters Xin actin-binding repeat containing 1 Xirp1 –8.38 0.0001 ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 5. Genes up-regulated in diabetic TG sensory neurons relative to normal as detected by PCR array Gene description Symbol Fold regulation P Antioxidant Peroxidases Glutathione reductase Gsr 1.76 0.0134 Catalase Cat 3.02 0.0006 Peroxiredoxin 6, pseudogene 1 Prdx6-ps1 1.48 0.0019 ROS Metabolism Superoxide Metabolism NADPH oxidase 4 Nox4 10.11 0.0004 Protein phosphatase 1, regulatory (inhibitor) subunit Ppp1r15b 3.98 0.0001 15b ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 .
Load more

Recommended publications
  • (ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
    Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process.
    [Show full text]
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells
    Allergy Asthma Immunol Res. 2020 May;12(3):523-536 https://doi.org/10.4168/aair.2020.12.3.523 pISSN 2092-7355·eISSN 2092-7363 Original Article Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells Hyun Jae Shim ,1 So-Young Park ,2 Hyouk-Soo Kwon ,1 Woo-Jung Song ,1 Tae-Bum Kim ,1 Keun-Ai Moon ,1 Jun-Pyo Choi ,1 Sin-Jeong Kim ,1 You Sook Cho 1* 1Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea 2Division of Pulmonary, Allergy and Critical Care Medicine, Department of Internal Medicine, Konkuk University Medical Center, Seoul, Korea Received: Jul 8, 2019 ABSTRACT Revised: Nov 29, 2019 Accepted: Dec 23, 2019 Purpose: Reduction-oxidation reaction homeostasis is vital for regulating inflammatory Correspondence to conditions and its dysregulation may affect the pathogenesis of chronic airway inflammatory You Sook Cho, MD, PhD diseases such as asthma. Peroxiredoxin-6, an important intracellular anti-oxidant molecule, Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan is reported to be highly expressed in the airways and lungs. The aim of this study was to Medical Center, University of Ulsan College of analyze the expression pattern of peroxiredoxin-6 in the peripheral blood mononuclear cells Medicine, 88 Olympic-ro 43-gil, Songpa-gu, (PBMCs) of asthmatic patients and in bronchial epithelial cells (BECs). Seoul 05505, Korea. Methods: The expression levels and modifications of peroxiredoxin-6 were evaluated in Tel: +82-2-3010-3285 PBMCs from 22 asthmatic patients.
    [Show full text]
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • Role of Peroxiredoxin 6 in Human Melanoma
    Role of Peroxiredoxin 6 in human melanoma Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Alexandra Schmitt aus Würzburg Würzburg 2015 Eingereicht am:__________________________ Mitglieder der Promotionskommission: Vorsitzender:____________________________ Gutachter:______________________________ Gutachter:______________________________ Tag des Promotionskolloquiums:___________________ Doktorurkunde ausgehändigt am:___________________ Eidesstattliche Erklärung Gemäß §4, Abs. 3, Ziff. 3, 5 und 8 der Promotionsordnung der Fakultät für Biologie der Bayerischen Julius-Maximilians-Universität Würzburg Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbständig angefertigt und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet habe. Ich erkläre weiterhin, dass die vorliegende Dissertation weder in gleicher, noch in ähnlicher Form bereits in einem anderen Prüfungsverfahren vorgelegen hat. Weiterhin erkläre ich, dass ich außer den mit dem Zulassungsantrag urkundlich vorgelegten Graden keine weiteren akademischen Grade erworben oder zu erwerben versucht habe. Würzburg, Januar 2015 ______________________________________ Alexandra Schmitt Table of contents 1. Abstract ................................................................................................................. 1 2. Zusammenfassung ............................................................................................... 3 3. Introduction ..........................................................................................................
    [Show full text]
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • Lactoperoxidase Antibacterial System: Natural Occurrence, Biological Functions and Practical Applications
    724 Journal of Food Protection, Vol. 47. No. 9, Pages 724-732 (September 1984) Copyright®, International Association of Milk, Food, and Environmental Sanitarians Lactoperoxidase Antibacterial System: Natural Occurrence, Biological Functions and Practical Applications BRUNO REITER1 and GORAN HARNULV2* Downloaded from http://meridian.allenpress.com/jfp/article-pdf/47/9/724/1650811/0362-028x-47_9_724.pdf by guest on 29 September 2021 National Institute for Research in Dairying, Shinfield, Reading, RG2 9AT, England and Alfa-Laval Agri International AS, P.O. Box 39, S-I47 00 Tumba, Sweden (Received for publication January 30, 1984) ABSTRACT (37,80). The various biological functions of the LP sys­ tem, which have now been established, will be discussed In the present review dealing with the antibacterial lac­ below. toperoxidase (LP) system, it is shown that the two reactants In recent years, much work has been devoted to practi­ thiocyanate (SCN~) and hydrogen peroxide (H202) as well as cal applications of the LP system. The effect against oral the catalytic enzyme lactoperoxidase (LP) are widely distributed streptococci (5,19,33,101,105,107) has led to the de­ in nature and that evidence for the activity of the LP system velopment and marketing of a toothpaste containing nec­ in animals, including man, is accumulating. The in vitro effects on bacterial and animal cells are discussed and the unique ac­ essary ingredients to activate the LP system. Promising tion of the LP system on the bacterial cytoplasmic membrane results have also been obtained when including activating is pointed out. Some practical applications are also presented, components in the feed to calves (81,83,86) with the aim with particular emphses on the possibility of utilizing the LP of potentiating the LP system in the intestinal tract.
    [Show full text]
  • Extracellular Vesicles Derived from Induced Pluripotent Stem Cells Promote Renoprotection in Acute Kidney Injury Model
    cells Article Extracellular Vesicles Derived from Induced Pluripotent Stem Cells Promote Renoprotection in Acute Kidney Injury Model Federica Collino 1,2,3 , Jarlene A. Lopes 1,2,4, Marta Tapparo 5, Giovane G. Tortelote 1,6, Taís H. Kasai-Brunswick 1,2,4, Gustavo M.C. Lopes 1,2,4, Douglas B. Almeida 1,2,4, Renata Skovronova 7, Camila H. C. Wendt 1, Kildare R. de Miranda 1,4,8, Benedetta Bussolati 7 , Adalberto Vieyra 1,2,4,9,* and Rafael Soares Lindoso 1,2,4,* 1 Institute of Biophysics Carlos Chagas Filho, Federal University of Rio de Janeiro, 21941-902 Rio de Janeiro, Brazil; [email protected] (F.C.); [email protected] (J.A.L.); [email protected] (G.G.T.); [email protected] (T.H.K.-B.); [email protected] (G.M.C.L.); [email protected] (D.B.A.); [email protected] (C.H.C.W.); [email protected] (K.R.d.M.) 2 National Institute of Science and Technology for Regenerative Medicine-REGENERA, Federal University of Rio de Janeiro, 21941-902 Rio de Janeiro, Brazil 3 Department of Biomedical Sciences, University of Padova, 35131 Padua, Italy 4 National Center for Structural Biology and Bioimaging/CENABIO, Federal University of Rio de Janeiro, 21941-902 Rio de Janeiro, Brazil 5 Department of Medical Sciences, Molecular Biotechnology Center, University of Torino, 10126 Torino, Italy; [email protected] 6 Department of Pediatrics’ Section of Pediatric Nephrology, Tulane University School of Medicine, New Orleans, LA 70112, USA 7 Department of Molecular Biotechnology and Health Sciences, University of Torino,
    [Show full text]
  • Catalysis of Peroxide Reduction by Fast Reacting Protein Thiols Focus Review †,‡ †,‡ ‡,§ ‡,§ ∥ Ari Zeida, Madia Trujillo, Gerardo Ferrer-Sueta, Ana Denicola, Darío A
    Review Cite This: Chem. Rev. 2019, 119, 10829−10855 pubs.acs.org/CR Catalysis of Peroxide Reduction by Fast Reacting Protein Thiols Focus Review †,‡ †,‡ ‡,§ ‡,§ ∥ Ari Zeida, Madia Trujillo, Gerardo Ferrer-Sueta, Ana Denicola, Darío A. Estrin, and Rafael Radi*,†,‡ † ‡ § Departamento de Bioquímica, Centro de Investigaciones Biomedicaś (CEINBIO), Facultad de Medicina, and Laboratorio de Fisicoquímica Biologica,́ Facultad de Ciencias, Universidad de la Republica,́ 11800 Montevideo, Uruguay ∥ Departamento de Química Inorganica,́ Analítica y Química-Física and INQUIMAE-CONICET, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 2160 Buenos Aires, Argentina ABSTRACT: Life on Earth evolved in the presence of hydrogen peroxide, and other peroxides also emerged before and with the rise of aerobic metabolism. They were considered only as toxic byproducts for many years. Nowadays, peroxides are also regarded as metabolic products that play essential physiological cellular roles. Organisms have developed efficient mechanisms to metabolize peroxides, mostly based on two kinds of redox chemistry, catalases/peroxidases that depend on the heme prosthetic group to afford peroxide reduction and thiol-based peroxidases that support their redox activities on specialized fast reacting cysteine/selenocysteine (Cys/Sec) residues. Among the last group, glutathione peroxidases (GPxs) and peroxiredoxins (Prxs) are the most widespread and abundant families, and they are the leitmotif of this review. After presenting the properties and roles of different peroxides in biology, we discuss the chemical mechanisms of peroxide reduction by low molecular weight thiols, Prxs, GPxs, and other thiol-based peroxidases. Special attention is paid to the catalytic properties of Prxs and also to the importance and comparative outlook of the properties of Sec and its role in GPxs.
    [Show full text]
  • Significance of Peroxidase in Eosinophils Margaret A
    University of Colorado, Boulder CU Scholar Series in Biology Ecology & Evolutionary Biology Spring 4-1-1958 Significance of peroxidase in eosinophils Margaret A. Kelsall Follow this and additional works at: http://scholar.colorado.edu/sbio Recommended Citation Kelsall, Margaret A., "Significance of peroxidase in eosinophils" (1958). Series in Biology. 14. http://scholar.colorado.edu/sbio/14 This Article is brought to you for free and open access by Ecology & Evolutionary Biology at CU Scholar. It has been accepted for inclusion in Series in Biology by an authorized administrator of CU Scholar. For more information, please contact [email protected]. SIGNIFICANCE OF PEROXIDASE IN EOSINOPHILS M a rg a ret A . K e lsa ll Peroxidase-bearing granules are the primary component and product of eosino­ phils. The physiological significance of eosinophils is, therefore, considered to be related to the ability of this cell to synthesize, store, and transport peroxidase and to release the peroxidase-positive granules into body fluids by a lytic process that is controlled by hormones, by variations in the histamine-epinephrine balance, and by several other stimuli. Peroxidase occurs not only in eosinophils, but also in neutrophils and blood platelets; but it is not present in most cells of animal tissues. The purpose of this work is to consider, as a working hypothesis, that the function of eosinophils is to produce, store, and transport peroxidase to catalyze oxidations. Many of the aerobic dehydrogenases that catalyze reactions in which hydrogen peroxide is produced are involved in protein catabolism. Therefore, relations between eosinophils and several normal and pathological conditions of increased protein catabolism are emphasized, and also the significance of peroxi­ dase in eosinophils and other leukocytes to H 20 2 produced by irradiation is considered.
    [Show full text]
  • A Strong Impact of Genetic Background on Gut Microflora in Mice
    SAGE-Hindawi Access to Research International Journal of Inflammation Volume 2010, Article ID 986046, 12 pages doi:10.4061/2010/986046 Research Article A Strong Impact of Genetic Background on Gut Microflora in Mice R. Steven Esworthy,1 David D. Smith,2 and Fong-Fong Chu1 1 Department of Cancer Biology, Beckman Research Institute of the City of Hope, 1500 Duarte Road, Duarte, CA 91010-3000, USA 2 Division of Information Sciences, Beckman Research Institute of the City of Hope, 1500 Duarte Road, Duarte, CA 91010-3000, USA Correspondence should be addressed to Fong-Fong Chu, [email protected] Received 29 March 2010; Accepted 9 June 2010 Academic Editor: Gerhard Rogler Copyright © 2010 R. Steven Esworthy et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Genetic background affects susceptibility to ileocolitis in mice deficient in two intracellular glutathione peroxidases, GPx1 and GPx2. The C57BL/6 (B6) GPx1/2 double-knockout (DKO) mice have mild ileocolitis, and 129S1/Sv (129) DKO mice have severe inflammation. We used diet to modulate ileocolitis; a casein-based defined diet with AIN76A micronutrients (AIN) attenuates inflammation compared to conventional LabDiets. Because luminal microbiota induce DKO ileocolitis, we assessed bacterial composition with automated ribosomal intergenic-spacer analysis (ARISA) on cecal DNA. We found that mouse strain had the strongest impact on the composition of microbiota than diet and GPx genotypes. In comparing AIN and LabDiet, DKO mice were more resistant to change than the non-DKO or WT mice.
    [Show full text]