Independent Evolution of Four Heme Peroxidase Superfamilies
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Peroxidase and NADPH-Cytochrome C Reductase Activity During Thyroid Hyperplasia and Involution
Peroxidase and NADPH-Cytochrome C Reductase Activity During Thyroid Hyperplasia and Involution KUNIHIRO YAMAMOTO AND LESLIE J. DEGROOT Thyroid Study Unit, Department of Medicine, University of Chicago, Chicago, Illinois 60637 ABSTRACT. The regulation of iodination was in- TSH injection, whether expressed per mg gland vestigated in male rats during physiological altera- weight, per mg protein, or per fxg DNA, suggesting tions in thyroid function. Thyroid hyperplasia was enzyme induction and cellular hypertrophy. Involu- Downloaded from https://academic.oup.com/endo/article/95/2/606/2618917 by guest on 30 September 2021 produced by giving 0.01% PTU in drinking water or tion by T4 administration caused a decrease in injection of TSH (2 USP U/day); involution was thyroid weight, DNA content, and enzyme activity per induced after PTU treatment by giving 3 fig L-T4/ml gland. The main reason for the decrease in enzyme in drinking water. Increase in activity of thyroid activity per gland was a diminution of cell numbers. peroxidase and NADPH-cytochrome c reductase per During thyroid hyperplasia and involution, perox- gland exceeded gains in thyroid weight and DNA idase and NADPH-cytochrome c reductase activity content early in hyperplasia, but increased essen- is regulated by TSH. During the onset of TSH tially in parallel manner during chronic PTU treat- action, peroxidase and NADPH-cytochrome c re- ment. Enzyme activity per /xg DNA increased to ductase increase to a greater extent than thyroid 155% of control after 4 days of PTU treatment, weight and DNA content, suggesting preferential decreased to 138% on the seventh day, and was at enzyme synthesis in addition to cell hypertrophy. -
Thyroid Peroxidase Antibody Is Associated with Plasma Homocysteine Levels in Patients with Graves’ Disease
Published online: 2018-07-02 Article Thieme Li Fang et al. Thyroid Peroxidase Antibody is … Exp Clin Endocrinol Diabetes 2018; 00: 00–00 Thyroid Peroxidase Antibody is Associated with Plasma Homocysteine Levels in Patients with Graves’ Disease Authors Fang Li1 * , Gulibositan Aji1 * , Yun Wang2, Zhiqiang Lu1, Yan Ling1 Affiliations ABSTRACT 1 Department of Endocrinology and Metabolism, Zhong- Purpose Homocysteine is associated with cardiovascular, shan Hospital, Fudan University, Shanghai, China inflammation and autoimmune diseases. Previous studies have 2 Department of Endocrinology and Metabolism, the shown that thyroid peroxidase antibody is associated with ho- Second Hospital of Shijiazhuang City, Shijiazhuang, mocysteine levels in hypothyroidism. The relationship between Hebei Province, China thyroid antibodies and homocysteine in hyperthyroidism re- mains unclear. In this study, we aimed to investigate the asso- Key words ciation of thyroid antibodies with homocysteine in patients human, cardiovascular risk, hyperthyroidism with Graves’ disease. Methods This was a cross-sectional study including 478 received 07.04.2018 Graves’ disease patients who were consecutively admitted and revised 10.05.2018 underwent radioiodine therapy. Homocysteine, thyroid hor- accepted 14.06.2018 mones, thyroid antibodies, glucose and lipids were measured. Results Patients with homocysteine levels above the median Bibliography were older and had unfavorable metabolic parameters com- DOI https://doi.org/10.1055/a-0643-4692 pared to patients with homocysteine levels below the median. Published online: 2.7.2018 Thyroglobulin antibody or thyroid peroxidase antibody was Exp Clin Endocrinol Diabetes 2020; 128: 8–14 associated with homocysteine levels (β = 0.56, 95 %CI 0.03- © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · 1.08, p = 0.04; β = 0.75, 95 %CI 0.23-1.27, p = 0.005). -
A Copper Protein and a Cytochrome Bind at the Same Site on Bacterial Cytochrome C Peroxidase† Sofia R
14566 Biochemistry 2004, 43, 14566-14576 A Copper Protein and a Cytochrome Bind at the Same Site on Bacterial Cytochrome c Peroxidase† Sofia R. Pauleta,‡,§ Alan Cooper,⊥ Margaret Nutley,⊥ Neil Errington,| Stephen Harding,| Francoise Guerlesquin,3 Celia F. Goodhew,‡ Isabel Moura,§ Jose J. G. Moura,§ and Graham W. Pettigrew‡ Veterinary Biomedical Sciences, Royal (Dick) School of Veterinary Studies, UniVersity of Edinburgh, Summerhall, Edinburgh EH9 1QH, U.K., Department of Chemistry, UniVersity of Glasgow, Glasgow G12 8QQ, U.K., Centre for Macromolecular Hydrodynamics, UniVersity of Nottingham, Sutton Bonington, Nottingham LE12 5 RD, U.K., Unite de Bioenergetique et Ingenierie des Proteines, IBSM-CNRS, 31 chemin Joseph Aiguier, 13402 Marseilles cedex 20, France, Requimte, Departamento de Quimica, CQFB, UniVersidade NoVa de Lisboa, 2829-516 Monte de Caparica, Portugal ReceiVed July 5, 2004; ReVised Manuscript ReceiVed September 9, 2004 ABSTRACT: Pseudoazurin binds at a single site on cytochrome c peroxidase from Paracoccus pantotrophus with a Kd of 16.4 µMat25°C, pH 6.0, in an endothermic reaction that is driven by a large entropy change. Sedimentation velocity experiments confirmed the presence of a single site, although results at higher pseudoazurin concentrations are complicated by the dimerization of the protein. Microcalorimetry, ultracentrifugation, and 1H NMR spectroscopy studies in which cytochrome c550, pseudoazurin, and cytochrome c peroxidase were all present could be modeled using a competitive binding algorithm. Molecular docking simulation of the binding of pseudoazurin to the peroxidase in combination with the chemical shift perturbation pattern for pseudoazurin in the presence of the peroxidase revealed a group of solutions that were situated close to the electron-transferring heme with Cu-Fe distances of about 14 Å. -
Thyroid Surgery for Patients with Hashimoto's Disease
® Clinical Thyroidology for the Public VOLUME 12 | ISSUE 7 | JULY 2019 HYPOTHYROIDISM Thyroid surgery for patients with Hashimoto’s disease BACKGROUND SUMMARY OF THE STUDY Hypothyroidism, or an underactive thyroid, is a common This study enrolled patients with hypothyroidism due to problem. In the United States, the most common cause Hashimoto’s thyroiditis who received treatment with thy- of hypothyroidism is Hashimoto’s thyroiditis. This is an roidectomy and thyroid hormone replacement or thyroid autoimmune disorder where antibodies attack the thyroid, hormone replacement alone. The outcome of the study causing inflammation and destruction of the gland. Char- was a patient-reported health score on the generic Short acteristic of Hashimoto’s thyroiditis are high antibodies Form-36 Health Survey (SF-36) after 18 months. to thyroid peroxidase (TPO Ab) on blood tests. Hypo- thyroidism is treated by thyroid hormone and returning Patients were in the age group of 18 to 79 years. They all thyroid hormone levels to the normal range usually had a TPOAb titer >1000 IU/L and reported persistent resolves symptoms in most patients. symptoms despite having normal thyroid hormone levels based on blood tests. Typical symptoms included fatigue, However, in some patients, symptoms may persist despite increased need for sleep associated with reduced sleep what appears to be adequate treatment based on blood quality, joint and muscle tenderness, dry mouth, and dry tests of thyroid function. This raises the possibility that eyes. Follow up visits were done every 3 months for 18 some symptoms may be related to the autoimmune months and the thyroid hormone therapy was adjusted as condition itself. -
How Useful Are Autoantibodies in Diagnosing Thyroid Disorders?
Evidence Based Answers CLINIcAL INQUiRiES from the Family Physicians Inquiries Network Heather Downs, DO, How useful are autoantibodies and Albert A. Meyer, MD New Hanover Regional Medical in diagnosing thyroid disorders? Center, Wilmington, NC Donna Flake, MSLS, MSAS Coastal Area Health Education Evidence-based answer Center, Wilmington, NC They’re useful in diagnosing Graves’ increases or decreases the probability disease and, to a lesser extent, of autoimmune thyroid disease by only autoimmune thyroid disease; they can also a small to moderate degree (SOR: B, 3 help predict hypothyroidism. Thyrotropin cross-sectional studies). receptor antibodies (TRAb) may be mildly Thyroid-stimulating hormone (TSH) elevated in a variety of thyroid disorders, levels >2 mU/L, although still in the normal but a TRAb level >10 U/L increases range, can be followed up with TPOAb ® the probability of Graves’ disease by Dowdentesting to determine Health whether Mediathe patient a moderate to large degree (strength has an increased probability of developing of recommendation [SORCopyright]: B, cross- hypothyroidism (SOR: B, cohort study sectional study). A positive or negativeFor personalwith a vague hypothyroidism use only reference thyroid peroxidase antibody (TPOAb) test standard). Clinical commentary FAST TRACK In equivocal situations and pregnancy, infiltrative disorders, Reidel’s thyroiditis, antibodies may help or subacute granulomatous thyroiditis are Thyroid Under most circumstances, hypo- and suspected. TPOAb may help predict the autoantibodies hyperthyroid disorders can be diagnosed development of clinical hypothyroidism in can help diagnose by testing TSH and free T , without thyroid patients with TSH in the range of 5-10 mU/L. 4 Graves’ disease antibody testing. Radionuclide uptake and Pregnancy-related hyperthyroidism scan provide diagnostic information for requires antibody testing because and autoimmune hyperthyroid states. -
NNT Mutations: a Cause of Primary Adrenal Insufficiency, Oxidative Stress and Extra- Adrenal Defects
175:1 F Roucher-Boulez and others NNT, adrenal and extra-adrenal 175:1 73–84 Clinical Study defects NNT mutations: a cause of primary adrenal insufficiency, oxidative stress and extra- adrenal defects Florence Roucher-Boulez1,2, Delphine Mallet-Motak1, Dinane Samara-Boustani3, Houweyda Jilani1, Asmahane Ladjouze4, Pierre-François Souchon5, Dominique Simon6, Sylvie Nivot7, Claudine Heinrichs8, Maryline Ronze9, Xavier Bertagna10, Laure Groisne11, Bruno Leheup12, Catherine Naud-Saudreau13, Gilles Blondin13, Christine Lefevre14, Laetitia Lemarchand15 and Yves Morel1,2 1Molecular Endocrinology and Rare Diseases, Lyon University Hospital, Bron, France, 2Claude Bernard Lyon 1 University, Lyon, France, 3Pediatric Endocrinology, Gynecology and Diabetology, Necker University Hospital, Paris, France, 4Pediatric Department, Bab El Oued University Hospital, Alger, Algeria, 5Pediatric Endocrinology and Diabetology, American Memorial Hospital, Reims, France, 6Pediatric Endocrinology, Robert Debré Hospital, Paris, France, 7Department of Pediatrics, Rennes Teaching Hospital, Rennes, France, 8Pediatric Endocrinology, Queen Fabiola Children’s University Hospital, Brussels, Belgium, 9Endocrinology Department, L.-Hussel Hospital, Vienne, France, 10Endocrinology Department, Cochin University Hospital, Paris, France, 11Endocrinology Department, Lyon University Hospital, Bron-Lyon, France, 12Paediatric and Clinical Genetic Department, Correspondence Nancy University Hospital, Vandoeuvre les Nancy, France, 13Pediatric Endocrinology and Diabetology, should be -
SUPPLEMENTARY DATA Supplementary Figure 1. The
SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary -
Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components. -
Prokaryotic Origins of the Non-Animal Peroxidase Superfamily and Organelle-Mediated Transmission to Eukaryotes
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 89 (2007) 567–579 www.elsevier.com/locate/ygeno Prokaryotic origins of the non-animal peroxidase superfamily and organelle-mediated transmission to eukaryotes Filippo Passardi a, Nenad Bakalovic a, Felipe Karam Teixeira b, Marcia Margis-Pinheiro b,c, ⁎ Claude Penel a, Christophe Dunand a, a Laboratory of Plant Physiology, University of Geneva, Quai Ernest-Ansermet 30, CH-1211 Geneva 4, Switzerland b Department of Genetics, Institute of Biology, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil c Department of Genetics, Federal University of Rio Grande do Sul, Rio Grande do Sul, Brazil Received 16 June 2006; accepted 18 January 2007 Available online 13 March 2007 Abstract Members of the superfamily of plant, fungal, and bacterial peroxidases are known to be present in a wide variety of living organisms. Extensive searching within sequencing projects identified organisms containing sequences of this superfamily. Class I peroxidases, cytochrome c peroxidase (CcP), ascorbate peroxidase (APx), and catalase peroxidase (CP), are known to be present in bacteria, fungi, and plants, but have now been found in various protists. CcP sequences were detected in most mitochondria-possessing organisms except for green plants, which possess only ascorbate peroxidases. APx sequences had previously been observed only in green plants but were also found in chloroplastic protists, which acquired chloroplasts by secondary endosymbiosis. CP sequences that are known to be present in prokaryotes and in Ascomycetes were also detected in some Basidiomycetes and occasionally in some protists. -
( 12 ) United States Patent
US010208322B2 (12 ) United States Patent ( 10 ) Patent No. : US 10 ,208 , 322 B2 Coelho et al. (45 ) Date of Patent: * Feb . 19, 2019 ( 54 ) IN VIVO AND IN VITRO OLEFIN ( 56 ) References Cited CYCLOPROPANATION CATALYZED BY HEME ENZYMES U . S . PATENT DOCUMENTS 3 , 965 ,204 A 6 / 1976 Lukas et al. (71 ) Applicant: California Institute of Technology , 4 , 243 ,819 A 1 / 1981 Henrick Pasadena , CA (US ) 5 ,296 , 595 A 3 / 1994 Doyle 5 , 703 , 246 A 12 / 1997 Aggarwal et al. 7 , 226 , 768 B2 6 / 2007 Farinas et al. ( 72 ) Inventors : Pedro S . Coelho , Los Angeles, CA 7 , 267 , 949 B2 9 / 2007 Richards et al . (US ) ; Eric M . Brustad , Durham , NC 7 ,625 ,642 B2 12 / 2009 Matsutani et al. (US ) ; Frances H . Arnold , La Canada , 7 ,662 , 969 B2 2 / 2010 Doyle et al. CA (US ) ; Zhan Wang , San Jose , CA 7 ,863 ,030 B2 1 / 2011 Arnold (US ) ; Jared C . Lewis , Chicago , IL 8 ,247 ,430 B2 8 / 2012 Yuan 8 , 993 , 262 B2 * 3 / 2015 Coelho . .. .. .. • * • C12P 7 /62 (US ) 435 / 119 9 ,399 , 762 B26 / 2016 Farwell et al . (73 ) Assignee : California Institute of Technology , 9 , 493 ,799 B2 * 11 /2016 Coelho .. C12P 7162 Pasadena , CA (US ) 2006 / 0030718 AL 2 / 2006 Zhang et al. 2006 / 0111347 A1 5 / 2006 Askew , Jr . et al. 2007 /0276013 AL 11 /2007 Ebbinghaus et al . ( * ) Notice : Subject to any disclaimer , the term of this 2009 /0238790 A2 9 /2009 Sommadosi et al. patent is extended or adjusted under 35 2010 / 0056806 A1 3 / 2010 Warren U . -
New Automatically Built Profiles for a Better Understanding of the Peroxidase Superfamily Evolution
University of Geneva Practical training report submitted for the Master Degree in Proteomics and Bioinformatics New automatically built profiles for a better understanding of the peroxidase superfamily evolution presented by Dominique Koua Supervisors: Dr Christophe DUNAND Dr Nicolas HULO Laboratory of Plant Physiology, Dr Christian J.A. SIGRIST University of Geneva Swiss Institute of Bioinformatics PROSITE group. Geneva, April, 18th 2008 Abstract Motivation: Peroxidases (EC 1.11.1.x), which are encoded by small or large multigenic families, are involved in several important physiological and developmental processes. These proteins are extremely widespread and present in almost all living organisms. An important number of haem and non-haem peroxidase sequences are annotated and classified in the peroxidase database PeroxiBase (http://peroxibase.isb-sib.ch). PeroxiBase contains about 5800 peroxidase sequences classified as haem peroxidases and non-haem peroxidases and distributed between thirteen superfamilies and fifty subfamilies, (Passardi et al., 2007). However, only a few classification tools are available for the characterisation of peroxidase sequences: InterPro motifs, PRINTS and specifically designed PROSITE profiles. However, these PROSITE profiles are very global and do not allow the differenciation between very close subfamily sequences nor do they allow the prediction of specific cellular localisations. Due to the rapid growth in the number of available sequences, there is a need for continual updates and corrections of peroxidase protein sequences as well as for new tools that facilitate acquisition and classification of existing and new sequences. Currently, the PROSITE generalised profile building manner and their usage do not allow the differentiation of sequences from subfamilies showing a high degree of similarity. -
The Catalytic Role of the Distal Site Asparagine-Histidine Couple in Catalase-Peroxidases
Eur. J. Biochem. 270, 1006–1013 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03476.x The catalytic role of the distal site asparagine-histidine couple in catalase-peroxidases Christa Jakopitsch1, Markus Auer1,Gu¨ nther Regelsberger1, Walter Jantschko1, Paul G. Furtmu¨ ller1, Florian Ru¨ ker2 and Christian Obinger1 1Institute of Chemistry and 2Institute of Applied Microbiology, University of Agricultural Sciences, Vienna, Austria Catalase-peroxidases (KatGs) are unique in exhibiting an 6% and that of Asn153fiAsp is 16.5% of wild-type activity. overwhelming catalase activity and a peroxidase activity of Stopped-flow analysis of the reaction of the ferric forms with broad specificity. Similar to other peroxidases the distal H2O2 suggest that exchange of Asn did not shift significantly histidine in KatGs forms a hydrogen bond with an adjacent the ratio of rates of H2O2-mediated compound I formation conserved asparagine. To investigate the catalytic role(s) of and reduction. Both rates seem to be reduced most probably this potential hydrogen bond in the bifunctional activity of because (a) the lower basicity of His123 hampers its function KatGs, Asn153 in Synechocystis KatG was replaced with as acid-base catalyst and (b) Asn153 is part of an extended either Ala (Asn153fiAla) or Asp (Asn153fiAsp). Both KatG-typical H-bond network, the integrity of which seems variants exhibit an overall peroxidase activity similar with to be essential to provide optimal conditions for binding and wild-type KatG. Cyanide binding is monophasic, however, oxidation of the second H2O2 molecule necessary in the the second-order binding rates are reduced to 5.4% catalase reaction.